Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
DEFF Research Database (Denmark)
Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu
2010-01-01
. METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....
Polycomb group protein-mediated repression of transcription
DEFF Research Database (Denmark)
Morey, Lluís; Helin, Kristian
2010-01-01
The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....
DEFF Research Database (Denmark)
Vandamme, Julien; Völkel, Pamela; Rosnoblet, Claire
2011-01-01
Polycomb group (PcG) proteins maintain transcriptional repression of hundreds of genes involved in development, signaling or cancer using chromatin-based epigenetic mechanisms. Biochemical studies in Drosophila have revealed that PcG proteins associate in at least two classes of protein complexes...... known as Polycomb repressive complexes 1 and 2 (PRC1 and PRC2). Drosophila core PRC1 is composed of four subunits, Polycomb (Pc), Sex combs extra (Sce), Polyhomeotic (Ph), and Posterior sex combs (Psc). Each of these proteins has multiple orthologs in vertebrates classified respectively as the CBX, RING...... in order to identify interacting partners of CBX family proteins under the same experimental conditions. Our analysis identified with high confidence about 20 proteins co-eluted with CBX2 and CBX7 tagged proteins, about 40 with CBX4, and around 60 with CBX6 and CBX8. We provide evidences that the CBX...
Transcriptional regulation by Polycomb group proteins
DEFF Research Database (Denmark)
Di Croce, Luciano; Helin, Kristian
2013-01-01
Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....
EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer
Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten
2008-01-01
Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that
Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.
Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa
2015-05-01
Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.
Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.
Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald
2017-09-19
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.
Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.
Directory of Open Access Journals (Sweden)
Shunsuke Nakamura
Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.
2017-10-01
that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA
Polycomb group protein bodybuilding: working out the routines.
Sievers, Cem; Paro, Renato
2013-09-30
Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj
2007-01-01
The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...
Bmi-1: At the crossroads of physiological and pathological biology
Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar
2015-01-01
Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339
Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V
2016-01-01
Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.
Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni
2017-07-04
Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.
Drosophila DNA-Binding Proteins in Polycomb Repression
Directory of Open Access Journals (Sweden)
Maksim Erokhin
2018-01-01
Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
DEFF Research Database (Denmark)
Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden
2014-01-01
Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...
Directory of Open Access Journals (Sweden)
Hua-Bing Li
2013-04-01
Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.
BMI-1, a promising therapeutic target for human cancer
WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN
2015-01-01
BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537
Structural Basis of Polycomb Bodies
Czech Academy of Sciences Publication Activity Database
Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.
2014-01-01
Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014
Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier
2012-05-01
Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.
Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira
2008-01-01
DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154
Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.
2016-01-01
The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776
Directory of Open Access Journals (Sweden)
Frank Spaapen
Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.
Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk
2015-07-01
Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.
Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.
Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio
2015-10-26
The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in
Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence
Directory of Open Access Journals (Sweden)
Zhanping Lu
2018-02-01
Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.
Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.
Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim
2018-01-01
HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.
One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation
Directory of Open Access Journals (Sweden)
Stefania del Prete
2015-07-01
Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.
Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao
2009-07-01
The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis
Directory of Open Access Journals (Sweden)
Jian Li
2017-05-01
Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.
Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.
Lu, You-Wei; Li, Jin; Guo, Wei-Jian
2010-11-08
The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.
Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M
2005-01-01
The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We
Directory of Open Access Journals (Sweden)
James eReynolds
2015-03-01
Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.
Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance
International Nuclear Information System (INIS)
Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia
2012-01-01
Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.
2012-01-01
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.
2012-09-17
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee
2017-12-15
The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.
Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy
2015-01-01
Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Polycomb-like proteins link the PRC2 complex to CpG islands
Energy Technology Data Exchange (ETDEWEB)
Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin
2017-09-06
The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.
Soulez, M; Saurin, A J; Freemont, P S; Knight, J C
1999-04-29
Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.
Directory of Open Access Journals (Sweden)
Katarzyna Taran
2016-02-01
Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.
Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.
2011-01-01
A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Energy Technology Data Exchange (ETDEWEB)
Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)
2015-01-02
Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.
Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira
2008-01-01
DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...
GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.
Directory of Open Access Journals (Sweden)
Bart A Westerman
Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
MK3 modulation affects BMI1-dependent and independent cell cycle check-points.
Directory of Open Access Journals (Sweden)
Peggy Prickaerts
Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2012-01-01
Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...
Human Polycomb group EED protein negatively affects HIV-1 assembly and release
Directory of Open Access Journals (Sweden)
Darlix Jean-Luc
2007-06-01
Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic
DEFF Research Database (Denmark)
Comet, Itys; Schuettengruber, Bernd; Sexton, Tom
2011-01-01
to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....
Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin
2017-01-01
The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.
Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L
2003-02-01
Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.
A repetitive elements perspective in Polycomb epigenetics.
Directory of Open Access Journals (Sweden)
Valentina eCasa
2012-10-01
Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.
Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.
Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K
2010-12-16
Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared
DEFF Research Database (Denmark)
Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien
2012-01-01
site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...
Genome-wide analysis of Polycomb targets in Drosophila
Energy Technology Data Exchange (ETDEWEB)
Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo
2006-04-01
Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.
Expression of Bmi-1 is a prognostic marker in bladder cancer
International Nuclear Information System (INIS)
Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing
2009-01-01
The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer
Directory of Open Access Journals (Sweden)
Mohamed Abdouh
Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.
Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila
Directory of Open Access Journals (Sweden)
Bernd Schuettengruber
2014-10-01
Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.
Expression of Bmi-1 is a prognostic marker in bladder cancer
Directory of Open Access Journals (Sweden)
Xu Li-Hua
2009-02-01
Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.
DEFF Research Database (Denmark)
Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra
2005-01-01
X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...
Switch-Like Roles for Polycomb Proteins from Neurodevelopment to Neurodegeneration
Directory of Open Access Journals (Sweden)
Anke Hoffmann
2017-12-01
Full Text Available Polycomb Group (PcG proteins are best-known for maintaining repressive or active chromatin states that are passed on across multiple cell divisions, and thus sustain long-term memory of gene expression. PcG proteins engage different, partly gene- and/or stage-specific, mechanisms to mediate spatiotemporal gene expression during central nervous system development. In the course of this, PcG proteins bind to various cis-regulatory sequences (e.g., promoters, enhancers or silencers and coordinate, as well the interactions between distantly separated genomic regions to control chromatin function at different scales ranging from compaction of the linear chromatin to the formation of topological hubs. Recent findings show that PcG proteins are involved in switch-like changes in gene expression states of selected neural genes during the transition from multipotent to differentiating cells, and then to mature neurons. Beyond neurodevelopment, PcG proteins sustain mature neuronal function and viability, and prevent progressive neurodegeneration in mice. In support of this view, neuropathological findings from human neurodegenerative diseases point to altered PcG functions. Overall, improved insight into the multiplicity of PcG functions may advance our understanding of human neurodegenerative diseases and ultimately pave the way to new therapies.
Polycomb group proteins in cell cycle progression and cancer
DEFF Research Database (Denmark)
Pasini, Diego; Bracken, Adrian P; Helin, Kristian
2004-01-01
Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...
Directory of Open Access Journals (Sweden)
Fabiana Perna
2015-04-01
Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.
Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li
2016-01-01
Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020
Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P
2018-04-04
How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.
Polycomb Protein OsFIE2 Affects Plant Height and Grain Yield in Rice.
Directory of Open Access Journals (Sweden)
Xianbo Liu
Full Text Available Polycomb group (PcG proteins have been shown to affect growth and development in plants. To further elucidate their role in these processes in rice, we isolated and characterized a rice mutant which exhibits dwarfism, reduced seed setting rate, defective floral organ, and small grains. Map-based cloning revealed that abnormal phenotypes were attributed to a mutation of the Fertilization Independent Endosperm 2 (OsFIE2 protein, which belongs to the PcG protein family. So we named the mutant as osfie2-1. Histological analysis revealed that the number of longitudinal cells in the internodes decreased in osfie2-1, and that lateral cell layer of the internodes was markedly thinner than wild-type. In addition, compared to wild-type, the number of large and small vascular bundles decreased in osfie2-1, as well as cell number and cell size in spikelet hulls. OsFIE2 is expressed in most tissues and the coded protein localizes in both nucleus and cytoplasm. Yeast two-hybrid and bimolecular fluorescence complementation assays demonstrated that OsFIE2 interacts with OsiEZ1 which encodes an enhancer of zeste protein previously identified as a histone methylation enzyme. RNA sequencing-based transcriptome profiling and qRT-PCR analysis revealed that some homeotic genes and genes involved in endosperm starch synthesis, cell division/expansion and hormone synthesis and signaling are differentially expressed between osfie2-1 and wild-type. In addition, the contents of IAA, GA3, ABA, JA and SA in osfie2-1 are significantly different from those in wild-type. Taken together, these results indicate that OsFIE2 plays an important role in the regulation of plant height and grain yield in rice.
Rybp, a polycomb complex-associated protein, is required for mouse eye development
Directory of Open Access Journals (Sweden)
Schreiber-Agus Nicole
2007-04-01
Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.
Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency
Directory of Open Access Journals (Sweden)
Anthony Flamier
2018-05-01
Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.
2016-10-01
we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2012-01-01
Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.
Directory of Open Access Journals (Sweden)
Zhiqing Li
Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.
Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma
International Nuclear Information System (INIS)
Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua
2010-01-01
Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis
Directory of Open Access Journals (Sweden)
David Latrasse
Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA
Alternative epigenetic chromatin states of polycomb target genes.
Directory of Open Access Journals (Sweden)
Yuri B Schwartz
2010-01-01
Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.
DEFF Research Database (Denmark)
Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora
2014-01-01
The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...
REST-mediated recruitment of polycomb repressor complexes in mammalian cells
DEFF Research Database (Denmark)
Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild
2012-01-01
Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...
A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma
Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.
2016-01-01
Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505
A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma.
Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M
2016-09-20
Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.
Clarifying the impact of polycomb complex component disruption in human cancers.
Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko
2014-04-01
The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.
Polycomb complexes act redundantly to repress genomic repeats and genes
DEFF Research Database (Denmark)
Leeb, Martin; Pasini, Diego; Novatchkova, Maria
2010-01-01
Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...
Directory of Open Access Journals (Sweden)
Yoshikawa Reigetsu
2012-10-01
Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.
Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion
Directory of Open Access Journals (Sweden)
Lowell Evan Michael
2008-12-01
Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.
Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.
2016-01-01
KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...
DEFF Research Database (Denmark)
Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde
2013-01-01
The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...
Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.
2014-01-01
Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119
BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.
Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan
2006-01-01
Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.
Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha
2011-11-01
A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.
Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha
2011-01-01
A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393
Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila
DEFF Research Database (Denmark)
Bantignies, Frédéric; Roure, Virginie; Comet, Itys
2011-01-01
In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...
Directory of Open Access Journals (Sweden)
Amanda Swain
2016-09-01
Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.
Analysis list: BMI1 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie
Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway
Liu, Jiaguo; Luo, Bin; Zhao, Meng
2017-01-01
Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587
Directory of Open Access Journals (Sweden)
Catherine Creppe
2014-12-01
Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A
2010-06-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.
2010-01-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181
Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali
2016-07-21
Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.
Ruled by Ubiquitylation: A New Order for Polycomb Recruitment
Directory of Open Access Journals (Sweden)
Yuri B. Schwartz
2014-07-01
Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.
DEFF Research Database (Denmark)
Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth
2016-01-01
crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....
Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer.
Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís
2013-08-12
IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2013-01-01
Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816
Altered expression of polycomb group genes in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Gang Li
Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.
Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai
2018-02-01
B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of
Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.
Directory of Open Access Journals (Sweden)
Ian J Majewski
2008-04-01
Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.
Directory of Open Access Journals (Sweden)
Chia-I Ko
2014-01-01
Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.
Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.
2011-01-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...
Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan
2017-09-01
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.
Directory of Open Access Journals (Sweden)
Erik Södersten
2014-09-01
Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.
PRC1 Prevents Replication Stress during Chondrogenic Transit Amplification
Directory of Open Access Journals (Sweden)
Frank Spaapen
2017-12-01
Full Text Available Transit amplification (TA, a state of combined, rapid proliferative expansion and differentiation of stem cell-descendants, remains poorly defined at the molecular level. The Polycomb Repressive Complex 1 (PRC1 protein BMI1 has been localized to TA compartments, yet its exact role in TA is unclear. PRC1 proteins control gene expression, cell proliferation and DNA-damage repair. Coordination of such DNA-templated activities during TA is predicted to be crucial to support DNA replication and differentiation-associated transcriptional programming. We here examined whether chondrogenesis provides a relevant biological context for synchronized coordination of these chromatin-based tasks by BMI1. Taking advantage of a prominently featuring TA-phase during chondrogenesis in vitro and in vivo, we here report that TA is completely dependent on intact PRC1 function. BMI1-depleted chondrogenic progenitors rapidly accumulate double strand DNA breaks during DNA replication, present massive non-H3K27me3-directed transcriptional deregulation and fail to undergo chondrogenic TA. Genome-wide accumulation of Topoisomerase 2α and Geminin suggests a model in which PRC1 synchronizes replication and transcription during rapid chondrogenic progenitor expansion. Our combined data reveals for the first time a vital cell-autonomous role for PRC1 during chondrogenesis. We provide evidence that chondrocyte hyper-replication and hypertrophy represent a unique example of programmed senescence in vivo. These findings provide new perspectives on PRC1 function in development and disease.
DEFF Research Database (Denmark)
Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung
2010-01-01
Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...
2011-01-01
Background Mitogen-activated protein kinase (MAPK) cascades (p38, JNK, ERK pathways) are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Results Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK) in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Conclusions Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling. PMID:21401930
Mouchel-Vielh, Emmanuèle; Rougeot, Julien; Decoville, Martine; Peronnet, Frédérique
2011-03-14
Mitogen-activated protein kinase (MAPK) cascades (p38, JNK, ERK pathways) are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK) in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.
Directory of Open Access Journals (Sweden)
Peronnet Frédérique
2011-03-01
Full Text Available Abstract Background Mitogen-activated protein kinase (MAPK cascades (p38, JNK, ERK pathways are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Results Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Conclusions Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.
DEFF Research Database (Denmark)
Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj
2010-01-01
Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...
Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin
2014-06-01
To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
CD133 and BMI1 expressions and its prognostic role in primary ...
Indian Academy of Sciences (India)
This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.
Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J
2011-04-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.
Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.
2011-01-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366
Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.
2010-01-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
International Nuclear Information System (INIS)
Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng
2012-01-01
The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
Directory of Open Access Journals (Sweden)
Jiang Lili
2012-09-01
Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF
Transcription factors AS1 and AS2 interact with LHP1 to repress KNOX genes in Arabidopsis.
Li, Zhongfei; Li, Bin; Liu, Jian; Guo, Zhihao; Liu, Yuhao; Li, Yan; Shen, Wen-Hui; Huang, Ying; Huang, Hai; Zhang, Yijing; Dong, Aiwu
2016-12-01
Polycomb group proteins are important repressors of numerous genes in higher eukaryotes. However, the mechanism by which Polycomb group proteins are recruited to specific genes is poorly understood. In Arabidopsis, LIKE HETEROCHROMATIN PROTEIN 1 (LHP1), also known as TERMINAL FLOWER 2, was originally proposed as a subunit of polycomb repressive complex 1 (PRC1) that could bind the tri-methylated lysine 27 of histone H3 (H3K27me3) established by the PRC2. In this work, we show that LHP1 mainly functions with PRC2 to establish H3K27me3, but not with PRC1 to catalyze monoubiquitination at lysine 119 of histone H2A. Our results show that complexes of the transcription factors ASYMMETRIC LEAVES 1 (AS1) and AS2 could help to establish the H3K27me3 modification at the chromatin regions of Class-I KNOTTED1-like homeobox (KNOX) genes BREVIPEDICELLUS and KNAT2 via direct interactions with LHP1. Additionally, our transcriptome analysis indicated that there are probably more common target genes of AS1 and LHP1 besides Class-I KNOX genes during leaf development in Arabidopsis. © 2016 Institute of Botany, Chinese Academy of Sciences.
Bmi-1 expression modulates non-small cell lung cancer progression
Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua
2015-01-01
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371
Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma
International Nuclear Information System (INIS)
Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S
2014-01-01
Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC
Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A
2016-10-04
KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.
2009-01-01
The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123
Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi
2018-06-01
B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.
Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion
Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.
2008-01-01
Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in
Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong
2018-03-28
To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells. Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay. Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.
Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin
2016-01-01
Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837
BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.
Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian
2010-02-21
The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.
Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.
Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen
2010-10-01
Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.
Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis
Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin
2014-01-01
Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658
BMI and BMI SDS in childhood: annual increments and conditional change
Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt
2016-01-01
Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...
The associations of Bmi-1 with progression of glomerular chronic kidney disease .
Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren
2018-02-01
Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings. .
Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients
Directory of Open Access Journals (Sweden)
Xiaodong Li
2016-11-01
Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.
Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa
2016-03-01
Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.
BMI and BMI SDS in childhood: annual increments and conditional change.
Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt
2017-02-01
Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.
Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng
2017-03-01
Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT
Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)
2012-08-24
Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.
Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma
Directory of Open Access Journals (Sweden)
Sara Badodi
2017-12-01
Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin
How Polycomb-Mediated Cell Memory Deals With a Changing Environment
Marasca, Federica
2018-03-09
Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.
How Polycomb-Mediated Cell Memory Deals With a Changing Environment
Marasca, Federica; Bodega, Beatrice; Orlando, Valerio
2018-01-01
Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.
File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...
File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...
File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...
File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129
Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?
Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J
2017-05-01
We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.
File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...
File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...
File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...
File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...
Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle
2012-01-01
Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455
File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...
File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...
File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...
The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer
2011-09-01
new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007
BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.
Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili
2017-12-01
Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.
p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells
Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah
2015-01-01
Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797
Polycomb enables primitive endoderm lineage priming in embryonic stem cells
DEFF Research Database (Denmark)
Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V
2016-01-01
Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....
Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway
International Nuclear Information System (INIS)
Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru
2004-01-01
Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general
Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.
Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori
2017-04-01
We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Czech Academy of Sciences Publication Activity Database
Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk
2018-01-01
Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016
Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster
Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.
1994-01-01
The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...
... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...
Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.
Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E
2018-03-13
The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
Gregoretti, Francesco; Cesarini, Elisa; Lanzuolo, Chiara; Oliva, Gennaro; Antonelli, Laura
2016-01-01
The large amount of data generated in biological experiments that rely on advanced microscopy can be handled only with automated image analysis. Most analyses require a reliable cell image segmentation eventually capable of detecting subcellular structures.We present an automatic segmentation method to detect Polycomb group (PcG) proteins areas isolated from nuclei regions in high-resolution fluorescent cell image stacks. It combines two segmentation algorithms that use an active contour model and a classification technique serving as a tool to better understand the subcellular three-dimensional distribution of PcG proteins in live cell image sequences. We obtained accurate results throughout several cell image datasets, coming from different cell types and corresponding to different fluorescent labels, without requiring elaborate adjustments to each dataset.
International Nuclear Information System (INIS)
Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.
2009-01-01
Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy
Trijsburg, Laura; Geelen, Anouk; Hollman, Peter Ch; Hulshof, Paul Jm; Feskens, Edith Jm; Van't Veer, Pieter; Boshuizen, Hendriek C; de Vries, Jeanne Hm
2017-03-01
As misreporting, mostly under-reporting, of dietary intake is a generally known problem in nutritional research, we aimed to analyse the association between selected determinants and the extent of misreporting by the duplicate portion method (DP), 24 h recall (24hR) and FFQ by linear regression analysis using the biomarker values as unbiased estimates. For each individual, two DP, two 24hR, two FFQ and two 24 h urinary biomarkers were collected within 1·5 years. Also, for sixty-nine individuals one or two doubly labelled water measurements were obtained. The associations of basic determinants (BMI, gender, age and level of education) with misreporting of energy, protein and K intake of the DP, 24hR and FFQ were evaluated using linear regression analysis. Additionally, associations between other determinants, such as physical activity and smoking habits, and misreporting were investigated. The Netherlands. One hundred and ninety-seven individuals aged 20-70 years. Higher BMI was associated with under-reporting of dietary intake assessed by the different dietary assessment methods for energy, protein and K, except for K by DP. Men tended to under-report protein by the DP, FFQ and 24hR, and persons of older age under-reported K but only by the 24hR and FFQ. When adjusted for the basic determinants, the other determinants did not show a consistent association with misreporting of energy or nutrients and by the different dietary assessment methods. As BMI was the only consistent determinant of misreporting, we conclude that BMI should always be taken into account when assessing and correcting dietary intake.
Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini
2018-03-01
The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.
Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun
2014-01-01
To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841
Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua
2018-02-01
Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley
Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald
2018-04-01
The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.
Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan
2017-10-06
We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.
Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu
2017-12-01
This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Marasca, Federica; Bodega, Beatrice; Orlando, Valerio
2018-04-01
Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment. © 2018 The Authors. BioEssays Published by WILEY Periodicals, Inc.
The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT
International Nuclear Information System (INIS)
Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng
2011-01-01
Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)
2011-01-01
Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi
Polycomb domain formation depends on short and long distance regulatory cues.
Directory of Open Access Journals (Sweden)
Bernd Schuettengruber
Full Text Available BACKGROUND: Polycomb group (PcG proteins dynamically define cellular identities through the epigenetic repression of key developmental genes. In Drosophila, cis-regulatory regions termed PcG response elements (PREs act as nucleation sites for PcG proteins to create large repressive PcG domains that are marked by trimethylation of lysine 27 on histone H3 (H3K27me3. In addition to an action in cis, PREs can interact over long distances, thereby enhancing PcG dependent silencing. How PcG domains are established, which factors limit their propagation in cis, and how long range interactions of PREs in trans affect the chromatin structure is largely unknown. PRINCIPAL FINDINGS: We demonstrate that the insertion of a PRE-containing transgene in the Drosophila genome generates an artificial PcG domain and we analyze its organization by quantitative ChIP and ChIP-on-chip experiments. Intriguingly, a boundary element and known insulator proteins do not necessarily interfere with spreading of H3K27me3. Instead, domain borders correlate with the presence of promoter regions bound by RNA Polymerase II and active chromatin marks. In contrast, genes that are silent during early fly development get included within the PcG domain and this incorporation interferes with gene activation at later developmental stages. Moreover, trans-interaction of the transgenic PRE with its homologous endogenous PRE results in increased PcG binding, correlating with reinforced silencing of genes within the domain borders. CONCLUSIONS: Our results suggest that higher-order organization of PcG-bound chromatin can stabilize gene silencing within PcG domains. Further we propose that multi-protein complexes associated with active promoters are able to define the limits of PcG domains. Future work aimed to pinpoint the factors providing this barrier function will be required to understand the precise molecular mechanism by which active promoter regions can act as boundaries to stop
Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1
International Nuclear Information System (INIS)
Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon
2008-01-01
Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1
Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto
2010-05-16
Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.
Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.
2016-01-01
Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599
Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.
Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S
2018-01-01
Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.
Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun
2017-05-01
Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and
Fuel shipment experience, fuel movements from the BMI-1 transport cask
International Nuclear Information System (INIS)
Bauer, Thomas L.; Krause, Michael G.
1986-01-01
The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask
Qin, Haiyan; Zhang, Guang; Zhang, Lianbo
2018-01-01
Polycomb group genes (PcG) encode chromatin modification proteins that are involved in the epigenetic regulation of cell differentiation, proliferation and the aging processes. The key subunit of the PcG complex, enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), has a central role in a variety of mechanisms, such as the formation of chromatin structure, gene expression regulation and DNA damage. In the present study, ultraviolet A (UVA) was used to radiate human dermal fibroblasts in order to construct a photo-aged cell model. Subsequently, the cell viability assay, Hoechst staining, apoptosis detection using flow cytometry, senescence-associated β-galactosidase (SA-β-gal) staining and erythrocyte exclusion experiments were performed. GSK126, a histone methylation enzyme inhibitor of EZH2, was used as an experimental factor. Results suggested that GSK126 downregulated the mRNA expression levels of EZH2 and upregulated the mRNA expression levels of BMI-1. Notably, GSK126 affected the transcription of various photoaging-related genes and thus protected against photoaging induced by UVA radiation. PMID:29545866
Noahsen, Paneeraq; Andersen, Stig
2013-01-01
To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.
Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun
2015-01-01
To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922
International Nuclear Information System (INIS)
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-01
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.
Histone H3 Serine 28 Is Essential for Efficient Polycomb-Mediated Gene Repression in Drosophila
Directory of Open Access Journals (Sweden)
Philip Yuk Kwong Yung
2015-06-01
Full Text Available Trimethylation at histone H3K27 is central to the polycomb repression system. Juxtaposed to H3K27 is a widely conserved phosphorylatable serine residue (H3S28 whose function is unclear. To assess the importance of H3S28, we generated a Drosophila H3 histone mutant with a serine-to-alanine mutation at position 28. H3S28A mutant cells lack H3S28ph on mitotic chromosomes but support normal mitosis. Strikingly, all methylation states of H3K27 drop in H3S28A cells, leading to Hox gene derepression and to homeotic transformations in adult tissues. These defects are not caused by active H3K27 demethylation nor by the loss of H3S28ph. Biochemical assays show that H3S28A nucleosomes are a suboptimal substrate for PRC2, suggesting that the unphosphorylated state of serine 28 is important for assisting in the function of polycomb complexes. Collectively, our data indicate that the conserved H3S28 residue in metazoans has a role in supporting PRC2 catalysis.
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and
Polycomb-group genes sustaining the stem cell activity
International Nuclear Information System (INIS)
Takihara, Yoshihiro
2006-01-01
Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)
Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall
2014-03-01
Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-22
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.
Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei
2018-03-01
Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.
Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang
2015-01-01
Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.
BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.
Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G
2018-01-01
Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.
Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A
2016-09-06
Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.
Directory of Open Access Journals (Sweden)
Hourinaz Behesti
2013-01-01
BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.
The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer
2013-07-01
J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33
Ni, Su-Jie; Zhao, Li-Qin; Wang, Xiao-Feng; Wu, Zhen-Hua; Hua, Rui-Xi; Wan, Chun-Hua; Zhang, Jie-Yun; Zhang, Xiao-Wei; Huang, Ming-Zhu; Gan, Lu; Sun, Hua-Lin; Dimri, Goberdhan P; Guo, Wei-Jian
2018-02-08
Chromobox protein homolog 7 (CBX7), a member of the polycomb group (PcG) family of proteins, is involved in the regulation of cell proliferation and cancer progression. PcG family members, such as BMI, Mel-18, and EZH2, are integral constituents of the polycomb repressive complexes (PRCs) and have been known to regulate cancer stem cell (CSC) phenotype. However, the role of other PRCs' constituents such as CBX7 in the regulation of CSC phenotype remains largely elusive. This study was to investigate the role of CBX7 in regulating stem cell-like properties of gastric cancer and the underlying mechanisms. Firstly, the role of CBX7 in regulating stem cell-like properties of gastric cancer was investigated using sphere formation, Western blot, and xenograft tumor assays. Next, RNA interference and ectopic CBX7 expression were employed to determine the impact of CBX7 on the expression of CSC marker proteins and CSC characteristics. The expression of CBX7, its downstream targets, and stem cell markers were analyzed in gastric stem cell spheres, common cancer cells, and gastric cancer tissues. Finally, the pathways by which CBX7 regulates stem cell-like properties of gastric cancer were explored. We found that CBX7, a constituent of the polycomb repressive complex 1 (PRC1), plays an important role in maintaining stem cell-like characteristics of gastric cancer cells via the activation of AKT pathway and the downregulation of p16. Spearman rank correlation analysis showed positive correlations among the expression of CBX7 and phospho-AKT (pAKT), stem cell markers OCT-4, and CD133 in gastric cancer tissues. In addition, CBX7 was found to upregulate microRNA-21 (miR-21) via the activation of AKT-NF-κB pathway, and miR-21 contributes to CBX7-mediated CSC characteristics. CBX7 positively regulates stem cell-like characteristics of gastric cancer cells by inhibiting p16 and activating AKT-NF-κB-miR-21 pathway.
Prospective associations between sedentary lifestyle and BMI in midlife.
Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A
2006-08-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.
Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo
2015-01-01
Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744
Relationship of glycemic and triglycerides with BMI in diabetic patients
International Nuclear Information System (INIS)
Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.
2010-01-01
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Relationship of glycemic and triglycerides with BMI in diabetic patients
Energy Technology Data Exchange (ETDEWEB)
Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology
2010-04-15
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.
López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís
2015-01-01
Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.
RYBP Is a K63-Ubiquitin-Chain-Binding Protein that Inhibits Homologous Recombination Repair
Directory of Open Access Journals (Sweden)
Mohammad A.M. Ali
2018-01-01
Full Text Available Summary: Ring1-YY1-binding protein (RYBP is a member of the non-canonical polycomb repressive complex 1 (PRC1, and like other PRC1 members, it is best described as a transcriptional regulator. However, several PRC1 members were recently shown to function in DNA repair. Here, we report that RYBP preferentially binds K63-ubiquitin chains via its Npl4 zinc finger (NZF domain. Since K63-linked ubiquitin chains are assembled at DNA double-strand breaks (DSBs, we examined the contribution of RYBP to DSB repair. Surprisingly, we find that RYBP is K48 polyubiquitylated by RNF8 and rapidly removed from chromatin upon DNA damage by the VCP/p97 segregase. High expression of RYBP competitively inhibits recruitment of BRCA1 repair complex to DSBs, reducing DNA end resection and homologous recombination (HR repair. Moreover, breast cancer cell lines expressing high endogenous RYBP levels show increased sensitivity to DNA-damaging agents and poly ADP-ribose polymerase (PARP inhibition. These data suggest that RYBP negatively regulates HR repair by competing for K63-ubiquitin chain binding. : Ali et al. find that RYBP binds K63-linked ubiquitin chains and is removed from DNA damage sites. This K63-ubiquitin binding allows RYBP to hinder the recruitment of BRCA1 and Rad51 to DNA double-strand breaks, thus inhibiting homologous recombination repair. Accordingly, cancer cells expressing high RYBP are more sensitive to DNA-damaging therapies. Keywords: DNA damage response, homologous recombination, ubiquitylation, RYBP, polycomb proteins, double-strand break repair, chromatin, histone modification
Institute of Scientific and Technical Information of China (English)
Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu
2014-01-01
Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.
International Nuclear Information System (INIS)
Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc
2012-01-01
Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive
Neurodevelopmental problems and extremes in BMI
Directory of Open Access Journals (Sweden)
Nóra Kerekes
2015-07-01
Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than
Directory of Open Access Journals (Sweden)
Tony Ly
2018-05-01
Full Text Available Background: Viral oncogenes and mutated proto-oncogenes are potent drivers of cancer malignancy. Downstream of the oncogenic trigger are alterations in protein properties that give rise to cellular transformation and the acquisition of malignant cellular phenotypes. Developments in mass spectrometry enable large-scale, multidimensional characterisation of proteomes. Such techniques could provide an unprecedented, unbiased view of how oncogene activation remodels a human cell proteome. Methods: Using quantitative MS-based proteomics and cellular assays, we analysed how transformation induced by activating v-Src kinase remodels the proteome and cellular phenotypes of breast epithelial (MCF10A cells. SILAC MS was used to comprehensively characterise the MCF10A proteome and to measure v-Src-induced changes in protein abundance across seven time-points (1-72 hrs. We used pulse-SILAC MS (Boisvert et al., 2012, to compare protein synthesis and turnover in control and transformed cells. Follow-on experiments employed a combination of cellular and functional assays to characterise the roles of selected Src-responsive proteins. Results: Src-induced transformation changed the expression and/or turnover levels of ~3% of proteins, affecting ~1.5% of the total protein molecules in the cell. Transformation increased the average rate of proteome turnover and disrupted protein homeostasis. We identify distinct classes of protein kinetics in response to Src activation. We demonstrate that members of the polycomb repressive complex 1 (PRC1 are important regulators of invasion and migration in MCF10A cells. Many Src-regulated proteins are present in low abundance and some are regulated post-transcriptionally. The signature of Src-responsive proteins is highly predictive of poor patient survival across multiple cancer types. Open access to search and interactively explore all these proteomic data is provided via the EPD database (www.peptracker.com/epd. Conclusions
From Flies to Mice: The Emerging Role of Non-Canonical PRC1 Members in Mammalian Development
Directory of Open Access Journals (Sweden)
Izabella Bajusz
2018-02-01
Full Text Available Originally two types of Polycomb Repressive Complexes (PRCs were described, canonical PRC1 (cPRC1 and PRC2. Recently, a versatile set of complexes were identified and brought up several dilemmas in PRC mediated repression. These new class of complexes were named as non-canonical PRC1s (ncPRC1s. Both cPRC1s and ncPRC1s contain Ring finger protein (RING1, RNF2 and Polycomb group ring finger catalytic (PCGF core, but in ncPRCs, RING and YY1 binding protein (RYBP, or YY1 associated factor 2 (YAF2, replaces the Chromobox (CBX and Polyhomeotic (PHC subunits found in cPRC1s. Additionally, ncPRC1 subunits can associate with versatile accessory proteins, which determine their functional specificity. Homozygous null mutations of the ncPRC members in mice are often lethal or cause infertility, which underlines their essential functions in mammalian development. In this review, we summarize the mouse knockout phenotypes of subunits of the six major ncPRCs. We highlight several aspects of their discovery from fly to mice and emerging role in target recognition, embryogenesis and cell-fate decision making. We gathered data from stem cell mediated in vitro differentiation assays and genetically engineered mouse models. Accumulating evidence suggests that ncPRC1s play profound role in mammalian embryogenesis by regulating gene expression during lineage specification of pluripotent stem cells.
Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity
DEFF Research Database (Denmark)
Pasini, Diego; Bracken, Adrian P; Jensen, Michael R
2004-01-01
SUZ12 is a recently identified Polycomb group (PcG) protein, which together with EZH2 and EED forms different Polycomb repressive complexes (PRC2/3). These complexes contain histone H3 lysine (K) 27/9 and histone H1 K26 methyltransferase activity specified by the EZH2 SET domain. Here we show...
Energy Technology Data Exchange (ETDEWEB)
Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others
2012-05-25
Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture
A role for non-covalent SUMO interaction motifs in Pc2/CBX4 E3 activity.
Directory of Open Access Journals (Sweden)
Jacqueline C Merrill
2010-01-01
Full Text Available Modification of proteins by the small ubiquitin like modifier (SUMO is an essential process in mammalian cells. SUMO is covalently attached to lysines in target proteins via an enzymatic cascade which consists of E1 and E2, SUMO activating and conjugating enzymes. There is also a variable requirement for non-enzymatic E3 adapter like proteins, which can increase the efficiency and specificity of the sumoylation process. In addition to covalent attachment of SUMO to target proteins, specific non-covalent SUMO interaction motifs (SIMs that are generally short hydrophobic peptide motifs have been identified.Intriguingly, consensus SIMs are present in most SUMO E3s, including the polycomb protein, Pc2/Cbx4. However, a role for SIMs in SUMO E3 activity remains to be shown. We show that Pc2 contains two functional SIMs, both of which contribute to full E3 activity in mammalian cells, and are also required for sumoylation of Pc2 itself. Pc2 forms distinct sub-nuclear foci, termed polycomb bodies, and can recruit partner proteins, such as the corepressor CtBP. We demonstrate that mutation of the SIMs in Pc2 prevents Pc2-dependent CtBP sumoylation, and decreases enrichment of SUMO1 and SUMO2 at polycomb foci. Furthermore, mutational analysis of both SUMO1 and SUMO2 reveals that the SIM-interacting residues of both SUMO isoforms are required for Pc2-mediated sumoylation and localization to polycomb foci.This work provides the first clear evidence for a role for SIMs in SUMO E3 activity.
The nuclear receptor NR2E1/TLX controls senescence
Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M.; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús
2014-01-01
The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumours including glioblastomas. Despite NR2E1 regulating targets like p21CIP1 or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that Polycomb repressive complexes (PRC) also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the Polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16INK4a and direct repression of p21CIP1. In addition NR2E1 expression also counteracts oncogene-induced senescence (OIS). The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of Polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer. PMID:25328137
The nuclear receptor NR2E1/TLX controls senescence.
O'Loghlen, Ana; Martin, Nadine; Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús
2015-07-30
The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumors including glioblastomas. Despite NR2E1 regulating targets like p21(CIP1) or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that polycomb repressive complexes also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16(INK4a) and direct repression of p21(CIP1). In addition NR2E1 expression also counteracts oncogene-induced senescence. The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer.
BMI change during puberty and the risk of heart failure.
Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C
2018-03-12
Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.
c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.
Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B
2012-04-01
Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.
Dwarkanath, Pratibha; Hsu, Jean W; Tang, Grace J; Anand, Pauline; Thomas, Tinku; Thomas, Annamma; Sheela, C N; Kurpad, Anura V; Jahoor, Farook
2016-02-01
In India, the prevalence of low birth weight is high in women with a low body mass index (BMI), suggesting that underweight women are not capable of providing adequate energy and protein for fetal growth. Furthermore, as pregnancy progresses, there is increased need to provide methyl groups for methylation reactions associated with the synthesis of new proteins and, unlike normal-BMI American women, low-BMI Indian women are unable to increase methionine transmethylation and remethylation rates as pregnancy progresses from trimester 1 to 3. This also negatively influences birth weight. The aim was to determine the effect of dietary supplementation with energy and protein from 12 ± 1 wk of gestation to time of delivery compared with no supplement on pregnancy outcomes, protein kinetics, and the fluxes of the methyl group donors serine and glycine. Protein kinetics and serine and glycine fluxes were measured by using standard stable isotope tracer methods in the fasting and postprandial states in 24 pregnant women aged 22.9 ± 0.7 y with low BMIs [BMI (in kg/m(2)) ≤18.5] at 12 ± 1 wk (trimester 1) and 30 ± 1 wk (trimester 3) of gestation. After the first measurement, subjects were randomly assigned to either receive the supplement (300 kcal/d, 15 g protein/d) or no supplement. Supplementation had no significant effect on any variable of pregnancy outcome, and except for fasting state decreases in leucine flux (125 ± 7.14 compared with 113 ± 5.06 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.04) and nonoxidative disposal (110 ± 6.97 compared with 101 ± 3.69 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.02) from trimesters 1 to 3, it had no effect on any other leucine kinetic variable or urea, glycine, and serine fluxes. We conclude that in Indian women with a low BMI, supplementation with energy and protein from week 12 of pregnancy to time of delivery does not improve pregnancy outcome, whole-body protein kinetics, or serine and glycine fluxes. © 2016 American Society for Nutrition.
BMI at birth and overweight at age four.
Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F
Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
The Role of BMI in Hip Fracture Surgery.
Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry
2018-01-01
Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.
Omori, Yoshihiro; Kubo, Shun; Kon, Tetsuo; Furuhashi, Mayu; Narita, Hirotaka; Kominami, Taro; Ueno, Akiko; Tsutsumi, Ryotaro; Chaya, Taro; Yamamoto, Haruka; Suetake, Isao; Ueno, Shinji; Koseki, Haruhiko; Nakagawa, Atsushi; Furukawa, Takahisa
2017-09-26
Precise transcriptional regulation controlled by a transcription factor network is known to be crucial for establishing correct neuronal cell identities and functions in the CNS. In the retina, the expression of various cone and rod photoreceptor cell genes is regulated by multiple transcription factors; however, the role of epigenetic regulation in photoreceptor cell gene expression has been poorly understood. Here, we found that Samd7, a rod-enriched sterile alpha domain (SAM) domain protein, is essential for silencing nonrod gene expression through H3K27me3 regulation in rod photoreceptor cells. Samd7- null mutant mice showed ectopic expression of nonrod genes including S-opsin in rod photoreceptor cells and rod photoreceptor cell dysfunction. Samd7 physically interacts with Polyhomeotic homologs (Phc proteins), components of the Polycomb repressive complex 1 (PRC1), and colocalizes with Phc2 and Ring1B in Polycomb bodies. ChIP assays showed a significant decrease of H3K27me3 in the genes up-regulated in the Samd7 -deficient retina, showing that Samd7 deficiency causes the derepression of nonrod gene expression in rod photoreceptor cells. The current study suggests that Samd7 is a cell type-specific PRC1 component epigenetically defining rod photoreceptor cell identity.
Directory of Open Access Journals (Sweden)
You-Peng Chen
Full Text Available BACKGROUND: Environmental alternations leading to fetal programming of cardiovascular diseases in later life have been attributed to maternal factors. However, animal studies showed that paternal obesity may program cardio-metabolic diseases in the offspring. In the current study we tested the hypothesis that paternal BMI may be associated with fetal growth. METHODS AND RESULTS: We analyzed the relationship between paternal body mass index (BMI and birth weight, ultrasound parameters describing the newborn's body shape as well as parameters describing the newborns endocrine system such as cortisol, aldosterone, renin activity and fetal glycated serum protein in a birth cohort of 899 father/mother/child triplets. Since fetal programming is an offspring sex specific process, male and female offspring were analyzed separately. Multivariable regression analyses considering maternal BMI, paternal and maternal age, hypertension during pregnancy, maternal total glycated serum protein, parity and either gestational age (for birth weight or time of ultrasound investigation (for ultrasound parameters as confounding showed that paternal BMI is associated with growth of the male but not female offspring. Paternal BMI correlated with birth parameters of male offspring only: birth weight; biparietal diameter, head circumference; abdominal diameter, abdominal circumference; and pectoral diameter. Cortisol was likewise significantly correlated with paternal BMI in male newborns only. CONCLUSIONS: Paternal BMI affects growth of the male but not female offspring. Paternal BMI may thus represent a risk factor for cardiovascular diseases of male offspring in later life. It remains to be demonstrated whether this is linked to an offspring sex specific paternal programming of cortisol secretion.
Directory of Open Access Journals (Sweden)
Shrividhya Srinivasan
2008-10-01
Full Text Available Polycomb and trithorax group proteins regulate cellular pluripotency and differentiation by maintaining hereditable states of transcription. Many Polycomb and trithorax group proteins have been implicated in the covalent modification or remodeling of chromatin, but how they interact with each other and the general transcription machinery to regulate transcription is not well understood. The trithorax group protein Kismet-L (KIS-L is a member of the CHD subfamily of chromatin-remodeling factors that plays a global role in transcription by RNA polymerase II (Pol II. Mutations in CHD7, the human counterpart of kis, are associated with CHARGE syndrome, a developmental disorder affecting multiple tissues and organs. To clarify how KIS-L activates gene expression and counteracts Polycomb group silencing, we characterized defects resulting from the loss of KIS-L function in Drosophila. These studies revealed that KIS-L acts downstream of P-TEFb recruitment to stimulate elongation by Pol II. The presence of two chromodomains in KIS-L suggested that its recruitment or function might be regulated by the methylation of histone H3 lysine 4 by the trithorax group proteins ASH1 and TRX. Although we observed significant overlap between the distributions of KIS-L, ASH1, and TRX on polytene chromosomes, KIS-L did not bind methylated histone tails in vitro, and loss of TRX or ASH1 function did not alter the association of KIS-L with chromatin. By contrast, loss of kis function led to a dramatic reduction in the levels of TRX and ASH1 associated with chromatin and was accompanied by increased histone H3 lysine 27 methylation-a modification required for Polycomb group repression. A similar increase in H3 lysine 27 methylation was observed in ash1 and trx mutant larvae. Our findings suggest that KIS-L promotes early elongation and counteracts Polycomb group repression by recruiting the ASH1 and TRX histone methyltransferases to chromatin.
Proresolving protein Annexin A1: The role in type 2 diabetes mellitus and obesity.
Pietrani, Nathalia T; Ferreira, Cláudia N; Rodrigues, Kathryna F; Perucci, Luiza O; Carneiro, Fernanda S; Bosco, Adriana A; Oliveira, Marina C; Pereira, Solange S; Teixeira, Antônio L; Alvarez-Leite, Jacqueline I; Ferreira, Adaliene V; Sousa, Lirlândia P; Gomes, Karina B
2018-04-17
Annexin A1 (AnxA1) is a protein involved in inflammation resolution that might be altered in obesity-associated type 2 diabetes mellitus (DM), which is a chronic inflammatory disease. The aim of this study was to evaluate AnxA1 serum levels in individuals with and without DM stratified according to the body mass index (BMI), and the dynamic of AnxA1 expression in adipose tissue from humans with obesity and non-obesity. Serum samples were obtained from 41 patients with DM (lean, overweight and obese) and 40 controls, and adipose tissue samples were obtained from 16 individuals with obesity (with or without DM), and 15 controls. DM patients showed similar AnxA1 serum levels when compared to controls. However, when the individuals were stratified according to BMI, AnxA1 levels were higher in individuals with obesity than lean or overweight, and in overweight compared to lean individuals. Moreover, AnxA1 was correlated positively with IL-6 levels. AnxA1 levels were also positively correlated with BMI, waist circumference and waist-to-hip ratio. Furthermore, higher levels of cleaved AnxA1 were observed in adipose tissue from individuals with obesity, independently of DM status. Enhanced levels of AnxA1 in serum of individuals with obesity suggest an attempt to counter-regulate the systemic inflammation process in this disease. However, the higher levels of cleaved AnxA1 in the adipose tissue of individuals with obesity could compromise its anti-inflammatory and proresolving actions, locally. Considering our data, AnxA1 cleavage in the adipose tissue, despite increased serum levels of this protein, and consequently the failure in inflammation resolution, suggests an important pathophysiological mechanism involved in inflammatory status observed in obesity. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Prediction of BMI by impulsivity, eating behavior and activity level
Directory of Open Access Journals (Sweden)
Jiang Xiaxia
2016-01-01
Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.
Directory of Open Access Journals (Sweden)
Lluis Morey
2013-01-01
Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.
Low birth weight, adult BMI and inflammation in middle age
DEFF Research Database (Denmark)
Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten
2013-01-01
This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...
Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.
Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena
2016-04-01
While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.
Are BMI and Sedentariness Correlated? A Multilevel Study in Children
Directory of Open Access Journals (Sweden)
Thayse Natacha Gomes
2015-07-01
Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.
Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G
2011-10-01
Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.
Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J
2010-07-01
High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.
Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.
Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y
2018-04-01
Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.
Eating tasty food to cope. Longitudinal association with BMI.
Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D
2015-04-01
The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.
Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.
Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A
2017-07-01
We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI
Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T
2018-01-01
Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.
Keskin Kurt, Raziye; Okyay, Ayşe Güler; Hakverdi, Ali Ulvi; Gungoren, Arif; Dolapcioglu, Kenan Serdar; Karateke, Atilla; Dogan, Mustafa Ozcil
2014-08-01
Previous studies have shown increased inflammatory activity in patients with polycystic ovary syndrome (PCOS); however, it remains uncertain whether this increased inflammatory activity is a consequence of the disorder itself or of the accompanying obesity. We therefore aimed to test the inflammatory marker levels in obese and lean patients with PCOS by using two separate control groups with matching body mass index (BMI). A total of 120 women in reproductive age with (n = 62) and without (n = 60) PCOS were recruited for the study. Patients with PCOS were divided into two groups as obese (n = 32) and lean (n = 30) PCOS groups according to BMI. Two BMI-matched control groups were created. Furthermore, high sensitive CRP protein (hsCRP), neutrophils, lymphocytes, white blood cell count (WBC) and neutrophil to lymphocyte ratio (NLR) were evaluated with complete blood count. The hsCRP (5.5 ± 0.8 vs. 3.1 ± 0.7, p PCOS compared to the control group while lymphocyte count was lower (1.71 ± 0.65 vs. 1.98 ± 0.39, p = 0.008). Similarly, both obese and lean patients with PCOS had higher levels of hsCRP, neutrophils, leukocytes and NLR ratios compared to BMI-matched controls. The correlation analysis revealed a moderate correlation between NLR and hsCRP (r 0.459, p lean and obese patients with PCOS have increased inflammatory markers compared to BMI-matched control groups indicating that the inflammation seen in PCOS might be related with the presence of the disorder rather than with obesity.
Beals, Joseph W; Sukiennik, Richard A; Nallabelli, Julian; Emmons, Russell S; van Vliet, Stephan; Young, Justin R; Ulanov, Alexander V; Li, Zhong; Paluska, Scott A; De Lisio, Michael; Burd, Nicholas A
2016-10-01
Excess body fat diminishes muscle protein synthesis rates in response to hyperinsulinemic-hyperaminoacidemic clamps. However, muscle protein synthetic responses after the ingestion of a protein-dense food source across a range of body mass indexes (BMIs) have not been compared. We compared the myofibrillar protein synthetic response and underlying nutrient-sensing mechanisms after the ingestion of lean pork between obese, overweight, and healthy-weight adults. Ten healthy-weight [HW; BMI (in kg/m 2 ): 22.7 ± 0.4], 10 overweight (OW; BMI: 27.1 ± 0.5), and 10 obese (OB; BMI: 35.9 ± 1.3) adults received primed continuous l-[ring- 13 C 6 ]phenylalanine infusions. Blood and muscle biopsy samples were collected before and after the ingestion of 170 g pork (36 g protein and 3 g fat) to assess skeletal muscle anabolic signaling, amino acid transporters [large neutral and small neutral amino acid transporters (LAT1, SNAT2) and CD98], and myofibrillar protein synthesis. At baseline, OW and OB groups showed greater relative amounts of mammalian target of rapamycin complex 1 (mTORC1) protein than the HW group. Pork ingestion increased mTORC1 phosphorylation only in the HW group (P = 0.001). LAT1 and SNAT2 protein content increased during the postprandial period in all groups (time effect, P anabolic signals, that reduces muscle sensitivity to food ingestion. This trial was registered at clinicaltrials.gov as NCT02613767. © 2016 American Society for Nutrition.
Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki
2015-11-01
The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel
2018-01-15
Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.
Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.
Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M
2013-12-01
Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.
Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.
Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo
2017-05-01
Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.
Is BMI a valid measure of obesity in postmenopausal women?
Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew
2018-03-01
Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.
Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella
2016-06-01
The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.
Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid
2017-01-01
Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069
Chen, Boyu; Li, Zhiqiang; Chen, Jianhua; Ji, Jue; Shen, Jingyi; Xu, Yufeng; Zhao, Yingying; Liu, Danping; Shen, Yinhuan; Zhang, Weijie; Shen, Jiawei; Wang, Yonggang; Shi, Yongyong
2018-04-14
Body mass index (BMI) is the most commonly used quantitative measure of adiposity. It is a kind of complex genetic diseases which are caused by multiple susceptibility genes. The first intron of fat mass and obesity-associated (FTO) has been widely discovered to be associated with BMI. Retinitis pigmentosa GTPase regulator-interacting protein-1 like (RPGRIP1L) is located in the upstream region of FTO and has been proved to be linked with obesity through functional tests. We carried out a genetic association analysis to figure out the role of the FTO gene and the RPGRIP1L gene in BMI. A quantitative traits study with 6,102 Chinese female samples, adjusted for age, was performed during our project. Among the twelve SNPs, rs1421085, rs1558902, rs17817449, rs8050136, rs9939609, rs7202296, rs56137030, rs9930506 and rs12149832 in the FTO gene were significantly associated with BMI after Bonferroni correction. Meanwhile, rs9934800 in the RPGRIP1L gene showed significance with BMI before Bonferroni correction, but this association was eliminated after Bonferroni correction. Our results suggested that genetic variants in the FTO gene were strongly associated with BMI in Chinese women, which may serve as targets of pharmaceutical research and development concerning BMI. Meanwhile, we didn't found the significant association between RPGRIP1L and BMI in Chinese women.
BMI trajectory groups in veterans of the Iraq and Afghanistan wars.
Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally
2011-09-01
The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.
Community-Specific BMI Cutoff Points for South Indian Females
Directory of Open Access Journals (Sweden)
K. B. Kishore Mohan
2011-01-01
Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.
Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.
Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran
2018-03-01
High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A
2016-07-26
The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).
Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L
2017-03-21
More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P
2014-05-01
Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.
Rondanelli, Mariangela; Klersy, Chaterine; Perna, Simone; Faliva, Milena Anna; Montorfano, Gigliola; Roderi, Paola; Colombo, Irma; Corsetto, Paola Antonia; Fioravanti, Marisa; Solerte, Sebastiano Bruno; Rizzo, Angela Maria
2015-10-29
Nowadays no researches has been performed on fatty acid profile (FA) and desaturase activity in metabolically healthy obesity (MHO). The aim of this study was to assessed gender and BMI-related difference in FA, estimated desaturase activities and the efficacy on metabolic changes produced by 2-months well-balance diet in MHO subjects. In 103 MHO subjects (30/73 M/F; age:42.2 ± 9.5) FA, estimated desaturase activity, body composition (by DXA), Body Mass Index (BMI), lipid profile, adipokines (leptin, adiponectin, grelin, glucagon-like peptide-1), insulin resistence (by Homestasis metabolic assessment), C-reactive proteine, Atherogenic index of plasma (AIP) and Body Shape Index (ABSI) have been assessed. Gender and BMI related difference have been evaluated and the efficacy produced by 2-months well-balance diet has been considered. At baseline, obese subjects, compared to overweight, show a significantly higher oleic (p insulin resistance (p = 0.006), leptin (p = 0.006), adiponectin (p <0.001), grelin (p = 0.030), CRP (p = 0.004), BMI (p <0.001) and android fat mass (p <0.001). The balanced diet intervention was effective in improving metabolic indices.
Usmanova, N M; Kazakov, V I; Tomilin, N V
2008-01-01
Using computer-based methods we determined the global distribution of short interspersed nuclear elements (SINEs) in the human and mouse X chromosomes. It has been shown that this distributions is similar to the distributions of CpG islands and genes but is different from the distribution of LINE1 elements. Since SINEs (human Alu and mouse B2) may have binding sites for Polycomb protein YY1, we suggest that these repeats can serve as additional signals ("boosters") in Polycomb-dependent silencing of gene rich segments during X inactivation.
Mel-18 interacts with RanGAP1 and inhibits its sumoylation.
Zhang, Jie; Sarge, Kevin D
2008-10-17
Our previous results showed that the polycomb protein mel-18 binds to a protein called HSF2 and inhibits HSF2 sumoylation, thereby functioning as an anti-SUMO E3 factor. This study also suggested that mel-18 regulates the sumoylation of other cellular proteins, but the identities of these other proteins were unknown. Here we show that mel-18 interacts with the RanGAP1 protein and inhibits its sumoylation, and that these activities do not require the RING domain of mel-18. The results also show that RanGAP1 sumoylation is decreased during mitosis, and that this is associated with increased interaction between RanGAP1 and mel-18 during this stage of the cell cycle. Intriguingly, this regulatory relationship is the opposite of that found for mel-18 and HSF2, in which the interaction between these two proteins decreases during mitosis, resulting in elevated HSF2 sumoylation. The results of this study strengthen the conclusion that mel-18 functions as an anti-SUMO E3 factor, and extend its targets to include regulation of the sumoylation of the important cellular protein RanGAP1.
LA VÍA RB/E2F Y LA FAMILIA DE PROTEÍNAS REPRESORAS POLYCOMB EN EL DESARROLLO DE CÁNCER
Directory of Open Access Journals (Sweden)
MERCEDES IMELDA DÁVALOS-SALAS
2011-01-01
Full Text Available El control adecuado del ciclo celular mediante la acción coordinada de la familia de factores de transcripción E2F resulta ser clave para la homeostasis celular. El entender su modo de acción desde una perspectiva epigenética resulta ser un tema de gran actualidad y cambia la visión de cómo es regulado el ciclo celular. Uno de los principales reguladores epigenéticos está conformado por el grupo de proteínas Polycomb (PcG, relacionadas con procesos patológicos como el cáncer, a través de la desregulación a nivel epigenético de genes supresores de tumores como BRCA1, p16 y p53, entre otros. Con relación a lo anterior, la regulación del gen supresor Retinoblastoma (Rb ha sido ampliamente estudiado dada su importante participación como regulador negativo del ciclo celular, pero más reciente se ha demostrado que su modo de acción está relacionado con el grupo de proteínas PcG. Cada uno de los procesos que involucran a componentes de la familia de factores E2F, los miembros de Polycomb y la familia de proteína Rb, parecen ser en cierta medida independientes y, por ende, poco relacionados. Sin embargo, existen evidencias de una convergencia a nivel epigenético en la acción de estos conjuntos de moléculas reguladoras de la progresión del ciclo celular y su desregulación nos puede llevar a entender mejor su contribución al desarrollo de procesos patológicos como el cáncer.
Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.
Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L
2018-02-01
Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.
Difficulty buying food, BMI, and eating habits in young children.
Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S
2018-01-22
To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.
Socioeconomic differences in childhood BMI trajectories in Belarus.
Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M
2018-02-28
To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location, children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic
Directory of Open Access Journals (Sweden)
Justin W Leung
2014-03-01
Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.
Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer
Directory of Open Access Journals (Sweden)
Carolina Nör
2014-02-01
Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
The effect of standardized food intake on the association between BMI and 1H-NMR metabolites
Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.
2016-01-01
Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the
The Report Card on BMI Report Cards.
Thompson, Hannah R; Madsen, Kristine A
2017-06-01
Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.
BMI Trajectories from Birth to Young Adulthood.
McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K
2018-04-19
This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.
Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R
2015-12-01
to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Know Your Body Mass Index (BMI)
... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...
Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study
Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.
2014-01-01
Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943
Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F
2017-11-01
Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2 = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2 = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.
Energy Technology Data Exchange (ETDEWEB)
Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery
2018-02-15
To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.
International Nuclear Information System (INIS)
Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.
2018-01-01
To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.
Dinner rituals that correlate with child and adult BMI.
Wansink, Brian; van Kleef, Ellen
2014-05-01
What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.
The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.
Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale
2018-02-01
Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.
The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.
LENUS (Irish Health Repository)
Elshorbagy, Amany K
2009-07-01
We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.
Modeling initiation of Ewing sarcoma in human neural crest cells.
Directory of Open Access Journals (Sweden)
Cornelia von Levetzow
2011-04-01
Full Text Available Ewing sarcoma family tumors (ESFT are aggressive bone and soft tissue tumors that express EWS-ETS fusion genes as driver mutations. Although the histogenesis of ESFT is controversial, mesenchymal (MSC and/or neural crest (NCSC stem cells have been implicated as cells of origin. For the current study we evaluated the consequences of EWS-FLI1 expression in human embryonic stem cell-derived NCSC (hNCSC. Ectopic expression of EWS-FLI1 in undifferentiated hNCSC and their neuro-mesenchymal stem cell (hNC-MSC progeny was readily tolerated and led to altered expression of both well established as well as novel EWS-FLI1 target genes. Importantly, whole genome expression profiling studies revealed that the molecular signature of established ESFT is more similar to hNCSC than any other normal tissue, including MSC, indicating that maintenance or reactivation of the NCSC program is a feature of ESFT pathogenesis. Consistent with this hypothesis, EWS-FLI1 induced hNCSC genes as well as the polycomb proteins BMI-1 and EZH2 in hNC-MSC. In addition, up-regulation of BMI-1 was associated with avoidance of cellular senescence and reversible silencing of p16. Together these studies confirm that, unlike terminally differentiated cells but consistent with bone marrow-derived MSC, NCSC tolerate expression of EWS-FLI1 and ectopic expression of the oncogene initiates transition to an ESFT-like state. In addition, to our knowledge this is the first demonstration that EWS-FLI1-mediated induction of BMI-1 and epigenetic silencing of p16 might be critical early initiating events in ESFT tumorigenesis.
Body size estimation of self and others in females varying in BMI.
Directory of Open Access Journals (Sweden)
Anne Thaler
Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
Body size estimation of self and others in females varying in BMI.
Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J
2018-01-01
Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin
2015-01-01
Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not
Gene-diet interaction effects on BMI levels in the Singapore Chinese population.
Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat
2018-02-24
Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.
Smoking and Socio-demographic correlates of BMI
Directory of Open Access Journals (Sweden)
Peizhi Wang
2016-06-01
Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.
Meta-analysis of genome-wide linkage studies in BMI and obesity.
Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A
2007-09-01
The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.
Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F
2017-09-01
The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.
Ijarotimi, Oluwole Steve
2010-06-01
Breastfeeding is an unequalled way of providing ideal food for the infants. The benefits of breastfeeding practices to infants and mothers are well documented. However, information on breastfeeding practices and its effect on body mass index (BMI) of mothers are scarce, particularly in Ekiti State of Nigeria. Therefore, the present study is designed to assess breastfeeding practices and its association with BMI of mothers. A descriptive and cross-sectional study was conducted among breastfeeding mothers that attended postnatal clinic of the state specialist hospitals and maternity centers in the study location. The specialist hospital and two-third of the nine maternity centers were purposively selected because of their health facilities and personnel. The mother-child pairs (200 respondents) were randomly selected from the study locations. Information on demographic characteristic, socio-economic parameters, nutritional knowledge of breastfeeding and dietary intakes of mothers were collected using questionnaires. BMI of mothers was determined as described by World Health Organization. Age distribution of mothers was between 25-34 years; and almost half of respondents had good educational background and were engaged in different occupations. The respondent monthly income ranged between = N = 3500 - 26000 ($26.92 - $200); and their dietary intakes varied between starchy and protein-based food. The result also showed that the respondent consumed enough nutrients to meet up the recommended daily allowance for protein, carbohydrate, fat, zinc, magnesium, sodium and phosphorous requirements. The BMI classifications showed that over three-fifth of respondents were normal, while the remaining were underweight (6%) and overweight/obese (26.5%). Also, large proportion of respondents engaged in exclusive breastfeeding and with good knowledge of breastfeeding practices. Statistically, exclusive breastfeeding practices had no correlation between the BMI and frequency of
Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.
Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M
Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for
Optimum BMI cut points to screen asian americans for type 2 diabetes.
Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y
2015-05-01
Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Associations between parity and maternal BMI in a population-based cohort study.
Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G
2018-02-07
We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino
2015-01-01
Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.
Directory of Open Access Journals (Sweden)
Alessandro Grasso
2015-01-01
Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.
Eating frequency in relation to BMI in very young children: a longitudinal analysis.
Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara
2017-06-01
Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.
Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W
2014-08-01
Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Dissociated incretin hormone response to protein versus fat ingestion in obese subjects
DEFF Research Database (Denmark)
Lindgren, O; Carr, RD; Holst, Jens Juul
2011-01-01
kcal/kg) fat (olive oil) or protein (whey protein) was ingested by non-diabetic obese male volunteers [body mass index (BMI) >30 kg/m(2) ; n = 12] and plasma GIP and GLP-1 were determined. We found no difference in the early GIP or GLP-1 responses to fat versus protein. However, the total 300-min GIP...
Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian
2018-01-01
The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.
Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.
Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T
2016-11-01
The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
2008-12-01
Balasis,1Purva Bali,1Veronica Estrella ,1Sandhya Kumaraswamy,1 Rekha Rao,1Kathy Rocha,1Bryan Herger,1Francis Lee,2 Victoria Richon,3 and Kapil Bhalla1...Balasis M, Bali P, Estrella V, Kumaraswamy S, et al. Histone deacetylase inhibitors deplete EZH2 and associated Polycomb Repressive Complex 2 proteins
Eating behaviour patterns and BMI in Portuguese higher education students.
Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora
2013-12-01
Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria
2018-01-01
Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...
Directory of Open Access Journals (Sweden)
Ling Li
Full Text Available Polycomb repressive complex 2 (PRC2, a histone H3 lysine 27 methyltransferase, plays a key role in gene regulation and is a known epigenetics drug target for cancer therapy. The WD40 domain-containing protein EED is the regulatory subunit of PRC2. It binds to the tri-methylated lysine 27 of the histone H3 (H3K27me3, and through which stimulates the activity of PRC2 allosterically. Recently, we disclosed a novel PRC2 inhibitor EED226 which binds to the K27me3-pocket on EED and showed strong antitumor activity in xenograft mice model. Here, we further report the identification and validation of four other EED binders along with EED162, the parental compound of EED226. The crystal structures for all these five compounds in complex with EED revealed a common deep pocket induced by the binding of this diverse set of compounds. This pocket was created after significant conformational rearrangement of the aromatic cage residues (Y365, Y148 and F97 in the H3K27me3 binding pocket of EED, the width of which was delineated by the side chains of these rearranged residues. In addition, all five compounds interact with the Arg367 at the bottom of the pocket. Each compound also displays unique features in its interaction with EED, suggesting the dynamics of the H3K27me3 pocket in accommodating the binding of different compounds. Our results provide structural insights for rational design of novel EED binder for the inhibition of PRC2 complex activity.
Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes
Directory of Open Access Journals (Sweden)
Andrew Fedor
2013-04-01
Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.
Higher BMI is associated with reduced cognitive performance in division I athletes.
Fedor, Andrew; Gunstad, John
2013-01-01
Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.
Mechanism by which BMI influences leisure-time physical activity behavior.
Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand
2008-06-01
The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.
Directory of Open Access Journals (Sweden)
Zhenxin Zheng
2018-03-01
Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.
VE-Cadherin-Mediated Epigenetic Regulation of Endothelial Gene Expression.
Morini, Marco F; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I; Conze, Lei L; O'Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P; Dejana, Elisabetta; Taddei, Andrea
2018-01-19
The mechanistic foundation of vascular maturation is still largely unknown. Several human pathologies are characterized by deregulated angiogenesis and unstable blood vessels. Solid tumors, for instance, get their nourishment from newly formed structurally abnormal vessels which present wide and irregular interendothelial junctions. Expression and clustering of the main endothelial-specific adherens junction protein, VEC (vascular endothelial cadherin), upregulate genes with key roles in endothelial differentiation and stability. We aim at understanding the molecular mechanisms through which VEC triggers the expression of a set of genes involved in endothelial differentiation and vascular stabilization. We compared a VEC-null cell line with the same line reconstituted with VEC wild-type cDNA. VEC expression and clustering upregulated endothelial-specific genes with key roles in vascular stabilization including claudin-5 , vascular endothelial-protein tyrosine phosphatase ( VE-PTP ), and von Willebrand factor ( vWf ). Mechanistically, VEC exerts this effect by inhibiting polycomb protein activity on the specific gene promoters. This is achieved by preventing nuclear translocation of FoxO1 (Forkhead box protein O1) and β-catenin, which contribute to PRC2 (polycomb repressive complex-2) binding to promoter regions of claudin-5 , VE-PTP , and vWf . VEC/β-catenin complex also sequesters a core subunit of PRC2 (Ezh2 [enhancer of zeste homolog 2]) at the cell membrane, preventing its nuclear translocation. Inhibition of Ezh2/VEC association increases Ezh2 recruitment to claudin-5 , VE-PTP , and vWf promoters, causing gene downregulation. RNA sequencing comparison of VEC-null and VEC-positive cells suggested a more general role of VEC in activating endothelial genes and triggering a vascular stability-related gene expression program. In pathological angiogenesis of human ovarian carcinomas, reduced VEC expression paralleled decreased levels of claudin-5 and VE-PTP. These
de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R
2015-07-01
The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.
The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.
Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H
2018-02-21
The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.
Prospective associations between sedentary lifestyle and BMI in midlife
DEFF Research Database (Denmark)
Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C
2006-01-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....
Long-term BMI and growth profiles in offspring of women with gestational diabetes.
Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W
2018-05-01
Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM
Directory of Open Access Journals (Sweden)
Tenna Ruest Haarmark Nielsen
Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
Genetic Influences on Growth Traits of BMI
DEFF Research Database (Denmark)
Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri
2008-01-01
Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...
Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam
2013-01-01
Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Mammalian SFMBTs have been considered to be polycomb group repressors. However, molecular mechanisms underlying mammalian SFMBTs-mediated gene regulation and their biological function have not been characterized. In the present study, we identified YY1 and methylated histones as interacting proteins of ...
The Long Non-coding RNA HOTTIP Enhances Pancreatic Cancer Cell Proliferation, Survival and Migration
ABSTRACTHOTTIP is a long non-coding RNA (lncRNA) transcribed from the 5' tip of the HOXA locus and is associated with the polycomb repressor complex 2 (PRC2) and WD repeat containing protein 5 (WDR5)/mixed lineage leukemia 1 (MLL1) chromatin modifying complexes. HOTTIP is expres...
Peck, Travis; Scharf, Rebecca J; Conaway, Mark R; DeBoer, Mark D
2015-08-01
Evaluate associations between TV viewing and weight status in children from kindergarten to first grade. Linear and logistic regression was used to evaluate associations of TV-viewing time on BMI-z-score cross-sectionally at kindergarten and first grade and longitudinally in between, among a nationally representative sample of 14,645 children from the Early Childhood Longitudinal Study-Kindergarten Cohort 2011. All analyses were adjusted for sex, race/ethnicity, parental education, and household income. Weekday TV-viewing time was correlated with BMI-z-score (P TV daily, children watching ≥1 h in kindergarten and first grade had a greater odds of overweight (1.50-1.60) and obesity (1.58-1.73). Children watching 1-TV had a greater odds of becoming overweight (1.39) and obese (1.86) between evaluations. Children watching as little as 1-TV daily were more likely to become overweight and obese over time. Physicians should encourage families to restrict TV-viewing time to reduce weight gain. © 2015 The Obesity Society.
Desirable factors for maintaining normal BMI of urban affluent women of Delhi.
Gupta, Anu Taneja; Siddhu, Anupa
2015-01-01
The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.
Body mass index (BMI) in the Saudi population of Gassim.
Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H
1998-01-01
In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.
Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun
2017-01-01
Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164
Are genes associated with energy metabolism important in asthma and BMI?
Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna
2009-02-01
Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage
Lee, Myoungsook; Kwon, Dae Young; Kim, Myung-Sunny; Choi, Chong Ran; Park, Mi-Young; Kim, Ae-Jung
2016-02-01
This is the first study to identify common genetic factors associated with the basal metabolic rate (BMR) and body mass index (BMI) in obese Korean women including overweight. This will be a basic study for future research of obese gene-BMR interaction. The experimental design was 2 by 2 with variables of BMR and BMI. A genome-wide association study (GWAS) of single nucleotide polymorphisms (SNPs) was conducted in the overweight and obesity (BMI > 23 kg/m(2)) compared to the normality, and in women with low BMR (BMR. A total of 140 SNPs reached formal genome-wide statistical significance in this study (P BMR (rs10786764; P = 8.0 × 10(-7), rs1040675; 2.3 × 10(-6)) and BMI (rs10786764; P = 2.5 × 10(-5), rs10786764; 6.57 × 10(-5)). The other genes related to BMI (HSD52, TMA16, MARCH1, NRG1, NRXN3, and STK4) yielded P BMR and BMI, including NRG3, OR8U8, BCL2L2-PABPN1, PABPN1, and SLC22A17 were identified in obese Korean women (P BMR- and BMI-related genes using GWAS. Although most of these newly established loci were not previously associated with obesity, they may provide new insights into body weight regulation. Our findings of five common genes associated with BMR and BMI in Koreans will serve as a reference for replication and validation of future studies on the metabolic rate.
Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer
2017-10-03
To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation
DEFF Research Database (Denmark)
Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire
2017-01-01
-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...
Gender expression associated with BMI in a prospective cohort study of US adolescents.
Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A
2016-02-01
To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.
International Nuclear Information System (INIS)
Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan
2016-01-01
Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.
Energy Technology Data Exchange (ETDEWEB)
Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com
2016-08-01
Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.
Trends in BMI of urban Australian adults, 1980-2000
DEFF Research Database (Denmark)
Walls, Helen L; Wolfe, Rory; Haby, Michelle M
2010-01-01
of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...
Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.
2015-01-01
Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051
International Nuclear Information System (INIS)
Abdel-Messeih, PH.L.; El-safie, A.I.; Said, A.I.
2011-01-01
Recent evidence favours the primary role of cellular auto immunity and its humoral mediators in the pathogenesis and follow up of children with type 1 diabetes mellitus (type 1 DM). The present study is carried out to investigate serum levels of pregnancy associated plasma protein-A (PAPP-A), tumor necrosis factor-alpha (TNF-alpha ) and highly sensitive C-reactive protein (hs-CRP) in children with type 1 DM. Potential role of body mass index (BMI) was evaluated. Circulating levels of TNF-alpha, PAPP-A and hs-CRP are significantly increased in children with type 1 DM as compared with healthy subjects suggesting activation of inflammatory immune response system. A significant negative correlation was obtained between TNF-alpha and BMI in diabetic patients. This is highly suggestive of the availability of these non invasive indices to help further examining type 1 DM pathophysiology and monitoring pharmacological interventions to interfere with disease development and progression.
The decline in BMI among Japanese women after World War II.
Maruyama, Shiko; Nakamura, Sayaka
2015-07-01
The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sujatha Venkataraman
Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.
DEFF Research Database (Denmark)
Ankarfeldt, Mikkel Z; Angquist, Lars; Jakobsen, Marianne Uhre
2014-01-01
and at follow-up about 5 years later were analyzed with multiple linear regression and dietary macronutrient substitution models. Interactions between dietary protein and baseline body mass index (BMI) and baseline WC adjusted for BMI (WCBMI ) (divided in tertiles; nine groups total), were analyzed in relation...... protein, whether replacing carbohydrate or fat, and weight change. However, individuals in the highest tertile of baseline BMI (irrespective of baseline WCBMI ) had significantly inverse change in waist circumference when protein replaced carbohydrate, but not when protein replaced fat. CONCLUSION......: Replacing carbohydrate with protein in the diet may prevent a relative increase in WC in individuals with a greater BMI....
Directory of Open Access Journals (Sweden)
Mehmet Zeynel Keskin
2017-10-01
Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
Assessing the genetic overlap between BMI and cognitive function
Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J
2016-01-01
Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597
Education modifies genetic and environmental influences on BMI
DEFF Research Database (Denmark)
Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel
2011-01-01
environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...
Maternal BMI and migration status as predictors of childhood obesity in Mexico.
Jiménez-Cruz, A; Wojcicki, J M; Bacardí-Gascón, M; Castellón-Zaragoza, A; García-Gallardo, J L; Schwartz, N; Heyman, M B
2011-01-01
To assess the association of maternal migration to Baja California, body mass index (BMI) status, children's perceived food insecurity, and childhood lifestyle behaviors with overweight (BMI > 85% ile), obesity (BMI > 95% ile) and abdominal obesity (Waist Circumference > 90% ile). Convenience sampling methods were used to recruit a cross-sectional sample of 4th, 5th and 6th grade children and their parents at Tijuana and Tecate Public Schools. Children's and parents' weights and heights were measured. Children were considered to have migrant parents if parents were not born in Baja California. One hundred and twenty-two children and their parents were recruited. The mean age of the children was 10.1 ± 1.0 years. Forty nine per cent of children were overweight or obese. Children with obese parents (BMI > 30) had greater odds of being obese, Odds Ratio (OR) 4.9 (95% Confidence Interval (CI), 1.2-19, p = 0.03). Children with migrant parents had greater odds of being obese, OR= 3.7 (95% CI, 1.6-8.3), p = 0.01) and of having abdominal obesity, OR = 3.2 (95% CI, 1.4-7.1, p = 0.01). Children from migrant parents have greater risk of higher consumption of potato chips, OR = 8.0 (95% CI, 2.1-29.1, p = 0.01). Children from non-migrant parents had greater odds of being at risk of hunger. Parental obesity and migration are associated with increased risk of obesity among Mexican children. Children whose parents were born in Baja California have greater odds of being at risk of hunger. Further studies should evaluate the role of migration on risk for childhood obesity.
Stracciolini, Andrea; Stein, Cynthia J; Kinney, Susan; McCrystal, Tara; Pepin, Michael J; Meehan Iii, William P
2017-09-15
The purpose of this study was to investigate associations between sedentary behaviors, sleep hours, and body mass index (BMI) in 12- to 17-year-old dancers. This was a cross sectional survey in which bivariate correlation and simple linear regression were used to determine associations between self-reported components. One hundred fifteen dancers were queried, 91.3% of whom were female. The mean BMI was 19.6 ± 2.3 kg/m2. Two-thirds of dancers fell below the 50th percentile for age-adjusted BMI, and 30.4% fell below the 25th percentile. Better than 12% of dancers reported a history of anxiety, and 2.6% reported depression. Mean hours of sleep per night was 7.8 ± 0.9, with 58% of the dancers getting less than 8 hours of sleep per night. The mean total screen time for dancers was 3.4 ± 2.1 hours/day, which consisted of tablet and computer usage: 1.6 ± 1.1 hours/day; texting: 0.5 ± 1.1 hours/day; watching television: 1.2 ± 1.1 hours/day; and playing video games 1.2 ± 1.1 hours/ day. Total screen time was independently associated positively with BMI, explaining nearly 10% of the variability in BMI. Age, hours dancing per day, and hours of sleep per night were not independently associated with BMI. To summarize: screen time was associated with increased BMI in this young dancer cohort; the majority of dancers slept less than 8 hours per night; anticipatory guidance addressing media use and sleep hygiene in the adolescent dancer population is needed.
Prescott, Hallie C; Chang, Virginia W
2018-02-06
Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.
Directory of Open Access Journals (Sweden)
Gouet Patrice
2008-02-01
Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group proteins, is involved in multiple cellular protein complexes. Its C-terminal domain, which is common to the four EED isoforms, contains seven repeats of a canonical WD-40 motif. EED is an interactor of three HIV-1 proteins, matrix (MA, integrase (IN and Nef. An antiviral activity has been found to be associated with isoforms EED3 and EED4 at the late stage of HIV-1 replication, due to a negative effect on virus assembly and genomic RNA packaging. The aim of the present study was to determine the regions of the EED C-terminal core domain which were accessible and available to protein interactions, using three-dimensional (3D protein homology modelling with a WD-40 protein of known structure, and epitope mapping of anti-EED antibodies. Results Our data suggested that the C-terminal domain of EED was folded as a seven-bladed β-propeller protein. During the completion of our work, crystallographic data of EED became available from co-crystals of the EED C-terminal core with the N-terminal domain of its cellular partner EZH2. Our 3D-model was in good congruence with the refined structural model determined from crystallographic data, except for a unique α-helix in the fourth β-blade. More importantly, the position of flexible loops and accessible β-strands on the β-propeller was consistent with our mapping of immunogenic epitopes and sites of interaction with HIV-1 MA and IN. Certain immunoreactive regions were found to overlap with the EZH2, MA and IN binding sites, confirming their accessibility and reactivity at the surface of EED. Crystal structure of EED showed that the two discrete regions of interaction with MA and IN did not overlap with each other, nor with the EZH2 binding pocket, but were contiguous, and formed a continuous binding groove running along the lateral face of the β-propeller. Conclusion Identification of antibody-, MA-, IN- and EZH2
Childhood BMI growth trajectories and endometrial cancer risk
DEFF Research Database (Denmark)
Aarestrup, Julie; Gamborg, Michael; Tilling, Kate
2017-01-01
Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...
Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth
2017-05-24
Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.
Maternal BMI during Pregnancy: Effect on trace elements Status and ...
African Journals Online (AJOL)
Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...
Percutaneous Nephrolithotomy in Patients With BMI >50: Single Surgeon Outcomes and Feasibility.
Streeper, Necole M; Radtke, Andrew C; Penniston, Kristina L; McDermott, John C; Nakada, Stephen Y
2016-01-01
To evaluate the use of percutaneous nephrolithotomy (PNL) and technical approach in the super obese population (body mass index [BMI] ≥ 50). We performed a retrospective review of 31 consecutive PNL cases with a BMI > 50 from a single surgeon (SYN) from 1995 to 2013. Procedures were performed in the prone position, and upper pole access was used. Operative time, length of hospital stay, stone burden, complication rates, and stone-free rates were measured. Of the 31 patients who underwent PNL (age 51.2 ± 12; 71% female), the mean BMI was 59.1 ± 6 kg/m(2) (range 50.4-71.7 kg/m(2)). Mean stone burden was 3.8 cm ± 2. The majority of patients (90.3%) had an upper pole puncture site for access with an operative time of 122.1 ± 75 minutes. The technique was similar to non-obese patients; however, there was a need for extra-long instrumentation. The overall stone-free rate was 71%, with utilization of a second-look PNL in 11 cases. The complication rate, Clavien grade 3 or higher, was 9.7% (3 of 31). PNL is technically feasible, safe, and effective in patients with a BMI ≥ 50. The complication rate, length of hospital stay, and stone-free rate with use of second-look PNL in super obese patients are comparable to severely obese patients. Intervention should not be automatically ruled out or delayed based on the patient's BMI alone. Copyright © 2015 Elsevier Inc. All rights reserved.
Parental nonstandard work schedules during infancy and children's BMI trajectories
Directory of Open Access Journals (Sweden)
Afshin Zilanawala
2017-09-01
Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.
Zuo, Li; He, Feng; Tinsley, Grant M; Pannell, Benjamin K; Ward, Emery; Arciero, Paul J
2016-01-01
It has been debated whether different diets are more or less effective in long-term weight loss success and cardiovascular disease prevention among men and women. To further explore these questions, the present study evaluated the combined effects of a high-protein, intermittent fasting, low-calorie diet plan compared with a heart healthy diet plan during weight loss, and weight loss maintenance on blood lipids and vascular compliance of obese individuals. The experiment involved 40 obese adults (men, n = 21; women, n = 19) and was divided into two phases: (a) 12-week high-protein, intermittent fasting, low-calorie weight loss diet comparing men and women (Phase 1) and (b) a 1-year weight maintenance phase comparing high-protein, intermittent fasting with a heart healthy diet (Phase 2). Body weight, body mass index (BMI), blood lipids, and arterial compliance outcomes were assessed at weeks 1 (baseline control), 12 (weight loss), and 64 (12 + 52 week; weight loss maintenance). At the end of weight loss intervention, concomitant reductions in body weight, BMI and blood lipids were observed, as well as enhanced arterial compliance. No sex-specific differences in responses were observed. During phase 2, the high-protein, intermittent fasting group demonstrated a trend for less regain in BMI, low-density lipoprotein (LDL), and aortic pulse wave velocity than the heart healthy group. Our results suggest that a high-protein, intermittent fasting and low-calorie diet is associated with similar reductions in BMI and blood lipids in obese men and women. This diet also demonstrated an advantage in minimizing weight regain as well as enhancing arterial compliance as compared to a heart healthy diet after 1 year.
Physical activity modifies the FTO effect on BMI change in Japanese adolescents.
Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro
2018-04-14
Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
VE-Cadherin–Mediated Epigenetic Regulation of Endothelial Gene Expression
Morini, Marco F.; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I.; Conze, Lei L.; O’Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P.
2018-01-01
Rationale: The mechanistic foundation of vascular maturation is still largely unknown. Several human pathologies are characterized by deregulated angiogenesis and unstable blood vessels. Solid tumors, for instance, get their nourishment from newly formed structurally abnormal vessels which present wide and irregular interendothelial junctions. Expression and clustering of the main endothelial-specific adherens junction protein, VEC (vascular endothelial cadherin), upregulate genes with key roles in endothelial differentiation and stability. Objective: We aim at understanding the molecular mechanisms through which VEC triggers the expression of a set of genes involved in endothelial differentiation and vascular stabilization. Methods and Results: We compared a VEC-null cell line with the same line reconstituted with VEC wild-type cDNA. VEC expression and clustering upregulated endothelial-specific genes with key roles in vascular stabilization including claudin-5, vascular endothelial-protein tyrosine phosphatase (VE-PTP), and von Willebrand factor (vWf). Mechanistically, VEC exerts this effect by inhibiting polycomb protein activity on the specific gene promoters. This is achieved by preventing nuclear translocation of FoxO1 (Forkhead box protein O1) and β-catenin, which contribute to PRC2 (polycomb repressive complex-2) binding to promoter regions of claudin-5, VE-PTP, and vWf. VEC/β-catenin complex also sequesters a core subunit of PRC2 (Ezh2 [enhancer of zeste homolog 2]) at the cell membrane, preventing its nuclear translocation. Inhibition of Ezh2/VEC association increases Ezh2 recruitment to claudin-5, VE-PTP, and vWf promoters, causing gene downregulation. RNA sequencing comparison of VEC-null and VEC-positive cells suggested a more general role of VEC in activating endothelial genes and triggering a vascular stability-related gene expression program. In pathological angiogenesis of human ovarian carcinomas, reduced VEC expression paralleled decreased
Characteristics of screen media use associated with higher BMI in young adolescents.
Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael
2013-05-01
This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.
Predictors of Success in Bariatric Surgery: the Role of BMI and Pre-operative Comorbidities.
da Cruz, Magda Rosa Ramos; Branco-Filho, Alcides José; Zaparolli, Marília Rizzon; Wagner, Nathalia Farinha; de Paula Pinto, José Simão; Campos, Antônio Carlos Ligocki; Taconeli, Cesar Augusto
2017-11-10
This is a retrospective review of 204 patients who underwent bariatric surgery. The impact of weight regain (WR), pre-operative comorbidities and BMI values on the recurrence of comorbidities was evaluated, and an equation was elaborated to estimate BMI at 5 years of bariatric surgery. Pre-operative data, after 1 year and after 5 years, was collected from the medical records. Descriptive analyses and bivariate hypothesis tests were performed first, and then, a generalised linear regression model with Tweedie distribution was adjusted. The hit rate and the Kendall coefficient of concordance (Kendall's W) of the equation were calculated. At the end, the Mann-Whitney test was performed between the BMI, WR and the presence of comorbidities, after a post-operative period of 5 years. The adjustment of the model resulted in an equation that estimates the mean value of BMI 5 years after surgery. The hit rate was 82.35% and the value of Kendall's W was 0.85 for the equation. It was found that patients with comorbidities presented a higher median WR (10.13%) and a higher mean BMI (30.09 kg/m 2 ) 5 years after the surgery. It is concluded that the equation is useful for estimating the mean BMI at 5 years of surgery and that patients with low pre-operative HDL and folic acid levels, with depression and/or anxiety and a higher BMI, have a higher BMI at 5 years of surgery and higher incidence of comorbid return and dissatisfaction with post-operative results.
Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu
2018-03-27
Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.
YAP1 regulates prostate cancer stem cell-like characteristics to promote castration resistant growth
DEFF Research Database (Denmark)
Jiang, Ning; Ke, Binghu; Hjort-Jensen, Kim
2017-01-01
Castration resistant prostate cancer (CRPC) is a stage of relapse that arises after various forms of androgen ablation therapy (ADT) and causes significant morbidity and mortality. However, the mechanism underlying progression to CRPC remains poorly understood. Here, we report that YAP1, which...... is negatively regulated by AR, influences prostate cancer (PCa) cell self-renewal and CRPC development. Specifically, we found that AR directly regulates the methylation of YAP1 gene promoter via the formation of a complex with Polycomb group protein EZH2 and DNMT3a. In normal conditions, AR recruits EZH2......-differentiation of PCa cells to stem/progenitor-like cells (PCSC), which potentially contribute to disease recurrence. Finally, the knock down of YAP1 expression or the inhibition of YAP1 function by Verteporfin in TRAMP prostate cancer mice significantly suppresses tumor recurrence following castration. In conclusion...
Correction of self-reported BMI based on objective measurements: a Belgian experience.
Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J
2018-01-01
Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.
Duration of the action of rocuronium in patients with BMI of less than 25: An observational study.
Takahata, Osamu; Takahoko, Ken-Ichi; Sasakawa, Tomoki; Inagaki, Yasuyoshi; Takahoko, Hiroyuki; Kunisawa, Takayuki
2018-05-02
The duration of rocuronium in patients with BMI more than 30 kg m is prolonged. Whether the reverse is true when BMI is less than 18.5 kg m is unclear. The objective of this study was to investigate whether a BMI less than 25 kg m affects the duration of rocuronium in doses adjusted for actual body weight. A prospective, observational, single-centre study. The operating room of a teaching hospital from 1 June 2008 to 30 June 2015. Thirty patients with American Society of Anesthesiologists physical status I or II who were scheduled to undergo elective surgery (BMI rocuronium (D1) was defined as the time from injection of rocuronium 0.6 mg kg to return of first twitch height to 25% of the control. Duration of additional doses (D2) was the time from a supplement of 0.15 mg kg rocuronium to return of first twitch height to 25% of the control. The relationship between D1 or D2 and BMI was examined using linear regression analysis. Linear regression analysis revealed a significant correlation between duration of initial dose and BMI (R = 0.246; P = 0.00531). A significant correlation between the duration of the additional dose and BMI was also found (R = 0.316; P = 0.00122). The lower the BMI, the shorter the duration of rocuronium at initial and additional doses determined by the actual body weight in adult patients with a BMI less than 25 kg m. www.umin.ac.jp/ctr/index/htm with registry number UMIN 00009337 and UMIN 000015407.
Raised BMI cut-off for overweight in Greenland Inuit--a review.
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.
Geng, Tingting; Smith, Caren E; Li, Changwei; Huang, Tao
2018-05-01
To test the causal effect of childhood BMI on adult cardiometabolic diseases using a Mendelian randomization analysis. We used 15 single nucleotide polymorphisms as instrumental variables for childhood BMI to test the causal effect of childhood BMI on cardiometabolic diseases using summary-level data from consortia. We found that a 1-SD increase in childhood BMI (kg/m 2 ) was associated with an 83% increase in risk of type 2 diabetes (odds ratio [OR] 1.83 [95% CI 1.46, 2.30]; P = 2.5 × 10 -7 ) and a 28% increase in risk of coronary artery disease (CAD) (OR 1.28 [95% CI 1.17, 1.39]; P = 2.1 × 10 -8 ) at the Bonferroni-adjusted level of significance ( P BMI was associated with a 0.587-SD increase in adulthood BMI (kg/m 2 ), a 0.062-SD increase in hip circumference (cm), a 0.602-SD increase in waist circumference (cm), a 0.111 pmol/L increase in log fasting insulin, a 0.068 increase in log-transformed HOMA of ß-cell function (%), a 0.126 increase in log-transformed HOMA of insulin resistance (%), and a 0.109-SD increase in triglyceride (mg/dL) but a 0.138-SD decrease in HDL (mg/dL) in adults at the Bonferroni-adjusted level of significance ( P BMI was associated with increased risk of type 2 diabetes and CAD in adult life. These results provide evidence supportive of a causal association between childhood BMI and these outcomes. © 2018 by the American Diabetes Association.
Rossi, Isabelle A; Rousson, Valentin; Viswanathan, Bharathi; Bovet, Pascal
2011-12-09
The relationship between body mass index (BMI) and socioeconomic status (SES) tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region). We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403). We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p < 0.001). The difference in BMI between men or women of high vs. low SES did not change significantly across successive cohorts (the interaction between SES and year of birth of cohort was statistically not significant). Smoking was associated with lower BMI in men and women (respectively -1.55 kg/m2 and 2.46 kg/m2, p < 0.001). Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.
Directory of Open Access Journals (Sweden)
Risa M Wolf
Full Text Available C1q/TNF-related protein-3 (CTRP3 is a novel adipokine that lowers blood glucose levels, reduces liver triglyceride synthesis, and is protective against hepatic steatosis in diet-induced obese mouse models. We hypothesized that higher circulating serum levels of CTRP3 would be associated with a lean body mass index (BMI and a more favorable metabolic profile in humans. The aim of this study was to investigate CTRP3 levels in lean individuals compared to obese individuals.This was a cross-sectional study of obese (n=44 and lean control patients (n=60. Fasting metabolic parameters were measured in all patients and serum CTRP3 levels were measured by ELISA.BMI of the lean group was 21.9 ± 0.2 kg/m2 and obese group was 45.2 ± 1.1 kg/m2. We found significantly lower circulating levels of CTRP3 in obese individuals (405 ± 8.3 vs. 436 ± 6.7 ng/mL, p=0.004 compared to the lean group. Serum CTRP3 levels were inversely correlated with BMI (p=0.001, and triglycerides (p<0.001, and significantly associated with gender (p<0.01, ethnicity (p=0.05, HDL-cholesterol (p<0.01, and adiponectin (p<0.01. We found BMI (p<0.01, gender (p<0.01, and ethnicity (p<0.05 to be significant predictors of CTRP3 levels when controlling for age in multiple regression analysis.CTRP3 is a beneficial adipokine whose circulating levels are significantly lower in obese individuals. Obesity causes dysregulation in adipokine production, including the down-regulation of CTRP3. Lower CTRP3 levels may contribute to the pathophysiology of metabolic disorders associated with obesity. Optimizing CTRP3 levels through novel therapies may improve obesity and its comorbidities.
Directory of Open Access Journals (Sweden)
Vincent van den Boom
2016-01-01
Full Text Available Polycomb proteins are classical regulators of stem cell self-renewal and cell lineage commitment and are frequently deregulated in cancer. Here, we find that the non-canonical PRC1.1 complex, as identified by mass-spectrometry-based proteomics, is critically important for human leukemic stem cells. Downmodulation of PRC1.1 complex members, like the DNA-binding subunit KDM2B, strongly reduces cell proliferation in vitro and delays or even abrogates leukemogenesis in vivo in humanized xenograft models. PRC1.1 components are significantly overexpressed in primary AML CD34+ cells. Besides a set of genes that is targeted by PRC1 and PRC2, ChIP-seq studies show that PRC1.1 also binds a distinct set of genes that are devoid of H3K27me3, suggesting a gene-regulatory role independent of PRC2. This set encompasses genes involved in metabolism, which have transcriptionally active chromatin profiles. These data indicate that PRC1.1 controls specific genes involved in unique cell biological processes required for leukemic cell viability.
Aye, Irving L.M.H.; Lager, Susanne; Ramirez, Vanessa I.; Gaccioli, Francesca; Dudley, Donald J.; Jansson, Thomas; Powell, Theresa L.
2014-01-01
ABSTRACT Obese pregnant women have increased levels of proinflammatory cytokines in maternal circulation and placental tissues. However, the pathways contributing to placental inflammation in obesity are largely unknown. We tested the hypothesis that maternal body mass index (BMI) was associated with elevated proinflammatory cytokines in maternal and fetal circulations and increased activation of placental inflammatory pathways. A total of 60 women of varying pre-/early pregnancy BMI, undergoing delivery by Cesarean section at term, were studied. Maternal and fetal (cord) plasma were collected for analysis of insulin, leptin, IL-1beta, IL-6, IL-8, monocyte chemoattractant protein (MCP) 1, and TNFalpha by multiplex ELISA. Activation of the inflammatory pathways in the placenta was investigated by measuring the phosphorylated and total protein expression of p38-mitogen-activated protein kinase (MAPK), c-Jun-N-terminal kinase (JNK)-MAPK, signal transducer-activated transcription factor (STAT) 3, caspase-1, IL-1beta, IkappaB-alpha protein, and p65 DNA-binding activity. To determine the link between activated placental inflammatory pathways and elevated maternal cytokines, cultured primary human trophoblast (PHT) cells were treated with physiological concentrations of insulin, MCP-1, and TNFalpha, and inflammatory signaling analyzed by Western blot. Maternal BMI was positively correlated with maternal insulin, leptin, MCP-1, and TNFalpha, whereas only fetal leptin was increased with BMI. Placental phosphorylation of p38-MAPK and STAT3, and the expression of IL-1beta protein, were increased with maternal BMI; phosphorylation of p38-MAPK was also correlated with birth weight. In contrast, placental NFkappaB, JNK and caspase-1 signaling, and fetal cytokine levels were unaffected by maternal BMI. In PHT cells, p38-MAPK was activated by MCP-1 and TNFalpha, whereas STAT3 phosphorylation was increased following TNFalpha treatment. Maternal BMI is associated with elevated
DEFF Research Database (Denmark)
Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes
2009-01-01
circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range....
DEFF Research Database (Denmark)
Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes
2009-01-01
circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range...
Liu, Chao; Wang, Qian; Sun, Bing; Meng, Xiangying; Li, Lan; Yang, Liuchun; Cong, Yang; Liu, Jiannan; Xuan, Liang; Huang, Yan; Wu, Shikai
2018-03-01
Transforming growth factor-β (TGF-β), interleukin-10 (IL-10), and forkhead box P3 (Foxp3) have important roles in breast cancer development. Previous studies confirmed a correlation between these immune molecules and tumor characteristics, but their association with nutritional status in breast cancer is largely unknown. We aimed to investigate the association between body mass index (BMI), hemoglobin, total protein, albumin, globulin (GLB), albumin/GLB ratio (AGR), pre-albumin, prognostic nutritional index, and TGF-β, IL-10, and Foxp3 mRNA expression in patients with breast cancer. Quantitative real-time PCR was used to detect the mRNA expression of TGF-β, IL-10, and Foxp3 in the peripheral blood of 107 patients with breast cancer and 21 healthy controls. We found that TGF-β mRNA levels were 2.6-fold, 3.2-fold, and 2.3-fold higher in patients with low BMI (BMI (BMI BMI ≥ 25), respectively (P BMI, may strongly affect systematic immune function in patients with breast cancer. © 2018 IUBMB Life, 70(3):237-245, 2018. © 2018 International Union of Biochemistry and Molecular Biology.
Reduced cortical thickness associated with visceral fat and BMI
Directory of Open Access Journals (Sweden)
Ralf Veit
2014-01-01
Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.
Directory of Open Access Journals (Sweden)
Pilato Valentina
2011-07-01
Full Text Available Abstract Background Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES of families in Tuscany. Methods The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health and consisted of 1,751 (922 males and 855 females 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. Results The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p Conclusion Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.
Relationship between BMI and blood pressure in girls and boys.
Gundogdu, Zuhal
2008-10-01
To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.
Underreporting of energy, protein and potassium intake in relation to body mass index
Heerstrass, D W; Ocké, M C; Bueno De Mesquita, H Bas; Peeters, P.H.; Seidell, J C
BACKGROUND: Differential underreporting of dietary intake by subgroups of body mass index (BMI) will confound associations between dietary intake and BMI-related diseases. We estimated the magnitude of BMI-related underreporting for energy, protein, and potassium intake for the Dutch cohorts of the
Self-control mediates the relationship between time perspective and BMI.
Price, Menna; Higgs, Suzanne; Lee, Michelle
2017-01-01
Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.
The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.
Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea
2018-02-01
Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.
Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.
Directory of Open Access Journals (Sweden)
Yuki Someya
Full Text Available Hypertension is developed easily in Asian adults with normal body mass index (BMI (~23 kg/m2, compared with other ethnicities with similar BMI. This study tested the hypothesis that slightly increased BMI at young age is a risk factor for future hypertension in Japanese men by historical cohort study.The study participants were 636 male alumni of the physical education school. They had available data on their physical examination at college age and follow-up investigation between 2007 and 2011. The participants were categorized into six categories: BMI at college age of <20.0 kg/m2, 20.0-21.0kg/m2, 21.0-22.0kg/m2, 22.0-23.0kg/m2, 23.0-24.0kg/m2, and ≥24.0kg/m2, and the incidence of hypertension was compared.This study covered 27-year follow-up period (interquartile range: IQR: 23-31 which included 17,059 person-years of observation. Subjects were 22 (22-22 years old at graduated college, and 49 (45-53 years old at first follow-up investigation. During the period, 120 men developed hypertension. The prevalence rates of hypertension for lowest to highest BMI categories were 9.4%, 14.6%, 16.1%, 17.5%, 30.3%, and 29.3%, respectively (p<0.001 for trend, and their hazard ratios were 1.00 (reference, 1.80 (95%CI: 0.65-4.94, 2.17 (0.83-5.64, 2.29 (0.89-5.92, 3.60 (1.37-9.47 and 4.72 (1.78-12.48, respectively (p<0.001 for trend. This trend was similar after adjustment for age, year of graduation, smoking, current exercise status and current dietary intake.Slightly increased BMI at young age is a risk factor for future hypertension in Japanese men.
Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E
2017-11-06
Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.
Defining a BMI Cut-Off Point for the Iranian Population: The Shiraz Heart Study.
Directory of Open Access Journals (Sweden)
Mohammad Ali Babai
Full Text Available In this study we evaluated and redefined the optimum body mass index (BMI cut-off point for the Iranian population based on metabolic syndrome (MeS risk factors. We further evaluated BMI cut-off points with and without waist circumference (WC as a cofactor of risk and compared the differences. This study is part of the largest surveillance programs conducted in Shiraz, Iran, termed the Shiraz Heart study. Our study sample included subjects between the ages of 20 to 65 years old. After excluding pregnant women, those with missing data and those with comorbid disease, a total of 12283 made up the study population. The participants underwent a series of tests and evaluations by trained professionals in accordance with WHO recommendations. Hypertension, abnormal fasting blood sugar (FBS, triglyceride (TG and high density lipoprotein cholesterol (HDL (in the context of the definition of metabolic syndrome were prevalent among 32.4%, 27.6%, 42.1 and 44.2% of our participants, respectively. Women displayed higher rates of overall obesity compared to men (based on the definition by the WHO as higher than 30 kg/m2. Regarding MeS, 38.9% of our population had the all symptoms of MeS which was more prevalent among women (41.5% vs. 36%. When excluding WC in the definition of MeS, results showed that males tend to show a higher rate of metabolic risk factors (19.2% vs. 15.6%. Results of multivariate analysis showed that parallel to an increase in BMI, the odds ratio (OR for acquiring each component of the metabolic syndrome increased (OR = 1.178; CI: 1.166-1.190. By excluding WC, the previous OR decreased (OR = 1.105; CI: 1.093-1.118. Receiver Operating Characteristic (ROC curve analysis showed that the optimum BMI cut-off point for predicting metabolic syndrome was 26.1 kg/m2 and 26.2 kg/m2 [Accuracy (Acc = 69% and 61%, respectively] for males and females, respectively. The overall BMI cut-off for both sexes was 26.2 kg/m2 (Acc = 65% with sensitivity and
Alternative regression models to assess increase in childhood BMI.
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-09-08
Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
Oxandrolone Improves Height Velocity and BMI in Patients with Cystic Fibrosis
Directory of Open Access Journals (Sweden)
Todd Varness
2009-01-01
Full Text Available Objective. To evaluate the effectiveness of oxandrolone in improving the nutritional status and linear growth of pediatric patients with cystic fibrosis (CF. Methods. Medical records of patients with CF treated with oxandrolone were reviewed for height z score, height velocity (HV, BMI z score, weight velocity (WV, Tanner stage, pulmonary function, liver enzyme levels, and any reported adverse events. Data were compared before (pre-Ox and after (Ox oxandrolone using a paired t-test. Results. 5 subjects (ages 8.5–14.5 years were treated with oxandrolone 2.5 mg daily for 8–38 months. After 8–12 months of treatment, there was a statistically significant improvement in HV (pre-Ox=5.3±1.4 cm/yr, Ox=8.3±1.2 cm/yr, P<.01 and BMI z score (pre-Ox=−0.61±1.04, Ox=−0.30±0.86, P=.02. Both height z score (pre-Ox=−1.64±0.63, Ox=−1.30±0.49, P=.057 and WV (pre-Ox=4.2±3.7 kg/yr, Ox =6.8±1.0 kg/yr, P=.072 showed beneficial trends that did not reach statistical significance. No adverse events were reported. Conclusions. In this brief clinical report, oxandrolone improved the HV and BMI z score in patients with CF. Larger studies are needed to determine if oxandrolone is an effective, safe, and affordable option to stimulate appetite, improve weight gain, and promote linear growth in patients with CF.
A comparison of chewing rate between overweight and normal BMI individuals.
White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro
2015-06-01
Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.
Identification of a third protein 4.1 tumor suppressor, protein 4.1R, in meningioma pathogenesis
Energy Technology Data Exchange (ETDEWEB)
Robb, Victoria A.; Li, Wen; Gascard, Philippe; Perry, Arie; Mohandas, Narla; Gutmann, David H.
2003-06-11
Meningiomas are common tumors of the central nervous system, however, the mechanisms under lying their pathogenesis are largely undefined. Two members of the Protein 4.1 super family, the neuro fibromatosis 2 (NF2) gene product (merlin/schwannomin) and Protein 4.1B have been implicated as meningioma tumor suppressors. In this report, we demonstrate that another Protein 4.1 family member, Protein 4.1R, also functions as a meningioma tumor suppressor. Based on the assignment of the Protein 4.1R gene to chromosome 1p32-36, a common region of deletion observed in meningiomas, we analyzed Protein 4.1R expression in meningioma cell lines and surgical tumor specimens. We observed loss of Protein 4.1R protein expression in two meningioma cell lines (IOMM-Lee, CH157-MN) by Western blotting as well as in 6 of 15 sporadic meningioma as by immuno histo chemistry (IHC). Analysis of a subset of these sporadic meningiomas by fluorescent in situ hybridization (FISH) with a Protein 4.1R specific probe demonstrated 100 percent concordance with the IHC results. In support of a meningioma tumor suppressor function, over expression of Protein 4.1R resulted in suppression of IOMM-Lee and CH157MN cell proliferation. Similar to the Protein 4.1B and merlin meningioma tumor suppressors, Protein 4.1R localization in the membrane fraction increased significantly under conditions of growth arrest in vitro. Lastly, Protein 4.1R interacted with some known merlin/Protein 4.1B interactors such as CD44 and bII-spectrin, but did not associate with the Protein 4.1B interactors 14-3-3 and PRMT3 or the merlin binding proteins SCHIP-1 and HRS. Collectively, these results suggest that Protein 4.1R functions as an important tumor suppressor important in the molecular pathogenesis of meningioma.
Directory of Open Access Journals (Sweden)
Chris Power
Full Text Available Childhood maltreatment including abuse and neglect has been associated with adult obesity, but evidence on life-course development of obesity or BMI gain is unclear. We aim to establish whether childhood maltreatments are related to obesity or BMI at different life-stages 7 y-50 y and to identify possible explanations for associations.Childhood physical, psychological and sexual abuse, neglect and BMI at seven ages were recorded in the 1958 birth cohort (n~15,000. Associations of child maltreatments with BMI at separate ages were tested using linear regression or logistic regression for obesity, and with rate of child-to-adult BMI gain using multilevel models. We adjusted for potential covariates.Abuse was reported in ~12% of the population. Abuse was not associated with elevated childhood BMI, but adult associations were observed: i.e. the abused had faster child-adult BMI gain than the non-abused; associations were independent of adult covariates. For physical abuse in both genders there was a positive linear association of ~0.006/y zBMI gain with age after adjustment for all covariates. Similarly, there was a linear association of physical abuse with obesity risk: e.g. among females from a low OR(adjusted of 0.34 (0.16,0.71 at 7 y to 1.67 (1.25,2.24 at 50 y. In females faster zBMI gains with age of ~0.0034/y were observed for sexual abuse and increases in obesity risk were faster: from a low OR(adjusted of 0.23 (0.06,0.84 at 7 y to 1.34 (0.86,2.10 at 50 y. Psychological abuse and neglect associations were less consistent.Childhood maltreatment associations with BMI or obesity varied across life: physical and, in females, sexual abuse were associated with faster lifetime BMI gains, which may have detrimental long-term health consequences.
Washington, Shannan D; Musarrat, Farhana; Ertel, Monica K; Backes, Gregory L; Neumann, Donna M
2018-04-15
There are seven conserved CTCF binding domains in the herpes simplex virus 1 (HSV-1) genome. These binding sites individually flank the latency-associated transcript (LAT) and the immediate early (IE) gene regions, suggesting that CTCF insulators differentially control transcriptional domains in HSV-1 latency. In this work, we show that two CTCF binding motifs in HSV-1 display enhancer blocking in a cell-type-specific manner. We found that CTCF binding to the latent HSV-1 genome was LAT dependent and that the quantity of bound CTCF was site specific. Following reactivation, CTCF eviction was dynamic, suggesting that each CTCF site was independently regulated. We explored whether CTCF sites recruit the polycomb-repressive complex 2 (PRC2) to establish repressive domains through a CTCF-Suz12 interaction and found that Suz12 colocalized to the CTCF insulators flanking the ICP0 and ICP4 regions and, conversely, was removed at early times postreactivation. Collectively, these data support the idea that CTCF sites in HSV-1 are independently regulated and may contribute to lytic-latent HSV-1 control in a site-specific manner. IMPORTANCE The role of chromatin insulators in DNA viruses is an area of interest. It has been shown in several beta- and gammaherpesviruses that insulators likely control the lytic transcriptional profile through protein recruitment and through the formation of three-dimensional (3D) chromatin loops. The ability of insulators to regulate alphaherpesviruses has been understudied to date. The alphaherpesvirus HSV-1 has seven conserved insulator binding motifs that flank regions of the genome known to contribute to the establishment of latency. Our work presented here contributes to the understanding of how insulators control transcription of HSV-1. Copyright © 2018 American Society for Microbiology.
The relation between anxiety and BMI - is it all in our curves?
Haghighi, Mohammad; Jahangard, Leila; Ahmadpanah, Mohammad; Bajoghli, Hafez; Holsboer-Trachsler, Edith; Brand, Serge
2016-01-30
The relation between anxiety and excessive weight is unclear. The aims of the present study were three-fold: First, we examined the association between anxiety and Body Mass Index (BMI). Second, we examined this association separately for female and male participants. Next, we examined both linear and non-linear associations between anxiety and BMI. The BMI was assessed of 92 patients (mean age: M=27.52; 57% females) suffering from anxiety disorders. Patients completed the Beck Anxiety Inventory. Both linear and non-linear correlations were computed for the sample as a whole and separately by gender. No gender differences were observed in anxiety scores or BMI. No linear correlation between anxiety scores and BMI was observed. In contrast, a non-linear correlation showed an inverted U-shaped association, with lower anxiety scores both for lower and very high BMI indices, and higher anxiety scores for medium to high BMI indices. Separate computations revealed no differences between males and females. The pattern of results suggests that the association between BMI and anxiety is complex and more accurately captured with non-linear correlations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Associations between Three School-Based Measures of Health: Is BMI Enough?
Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.
2013-01-01
School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…
Buchvold, Hogne Vikanes; Pallesen, Ståle; Øyane, Nicolas M F; Bjorvatn, Bjørn
2015-11-12
Shift work is associated with negative health effects. Increased prevalence of several cardiovascular risk factors among shift workers/night workers compared with day workers have been shown resulting in increased risk of cardiovascular events among shift workers and night workers. Previous studies have taken a dichotomous approach to the comparison between day and night workers. The present study uses a continuous approach and provides such a new perspective to the negative effects of night work load as a possible risk factor for undesirable health effects. This cross sectional study (The SUrvey of Shift work, Sleep and Health (SUSSH)) uses data collected from December 2008 to March 2009. The study population consists of Norwegian nurses. The study collected information about demographic and lifestyle factors: Body Mass Index (BMI), smoking habits, alcohol consumption, caffeine consumption and exercise habits. The lifestyle parameters were evaluated using multiple hierarchical regression and binary logistic regression. Number of night shifts worked last year (NNL) was used as operationalization of night work load. Adjustment for possible confounders were made. Obesity was defined as BMI > 30. Alcohol Consumption was evaluated using the short form of the Alcohol Use Disorders Identification Test Consumption (AUDIT-C). Data were analyzed using SPSS version 22. We had data from 2059 nurses. NNL was significantly and positively associated with BMI, both when evaluated against BMI as a continuous parameter (Beta = .055, p < .05), and against obesity (OR = 1.01, 95 % CI = 1.00-1.01). The AUDIT-C score was significantly and positively associated with hours worked per week (OR = 1.03, 95 % CI = 1.01-1.05). We found a positive significant association between night work load and BMI. This suggests that workers with a heavy night work load might need special attention and frequent health checks due to higher risk of undesirable health effects.
BMI is not a good indicator for metabolic risk in adolescent girls
BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...
Targeting protein-protein interaction between MLL1 and reciprocal proteins for leukemia therapy.
Wang, Zhi-Hui; Li, Dong-Dong; Chen, Wei-Lin; You, Qi-Dong; Guo, Xiao-Ke
2018-01-15
The mixed lineage leukemia protein-1 (MLL1), as a lysine methyltransferase, predominantly regulates the methylation of histone H3 lysine 4 (H3K4) and functions in hematopoietic stem cell (HSC) self-renewal. MLL1 gene fuses with partner genes that results in the generation of MLL1 fusion proteins (MLL1-FPs), which are frequently detected in acute leukemia. In the progress of leukemogenesis, a great deal of proteins cooperate with MLL1 to form multiprotein complexes serving for the dysregulation of H3K4 methylation, the overexpression of homeobox (HOX) cluster genes, and the consequent generation of leukemia. Hence, disrupting the interactions between MLL1 and the reciprocal proteins has been considered to be a new treatment strategy for leukemia. Here, we reviewed potential protein-protein interactions (PPIs) between MLL1 and its reciprocal proteins, and summarized the inhibitors to target MLL1 PPIs. The druggability of MLL1 PPIs for leukemia were also discussed. Copyright © 2017. Published by Elsevier Ltd.
Heney, Jessica H; Dimock, Camia C; Friedman, Jennifer F; Lewis, Carol
2014-01-05
To evaluate BMI change among pediatric refugees resettling in Providence, RI. Retrospective chart review of pediatric refugees from the initial evaluation to year 3 post-resettlement at Hasbro Children's Hospital. Primary outcome of interest was within person change in BMI percentile at each time point. From 2007-2012, 181 children visited the clinic. Initial prevalence of overweight and obesity was 14.1% and 3.2% versus 22.8% and 12.6% at year 3. From visit 1 and years 1-3, there was a positive mean within person change in BMI percentile of 12.9% (95% CI 6.3-19.6%s), 16.6% (95% CI 11.2-21.9%), and 14.4% (95% CI 9.1-19.7%). The prevalence of overweight and obesity increased from 17.3% at initial intake to 35.4% at 3 years post-resettlement to surpass that of American children (31.7-31.8% for 2007-2012). Refugee children have additional risk factors for obesity; multidisciplinary interventions must be designed to address nutrition at each visit.
BMI may underestimate the socioeconomic gradient in true obesity
van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.
2013-01-01
Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity
Directory of Open Access Journals (Sweden)
Cristina Bartocci
2014-05-01
Full Text Available When telomeres become critically short, DNA damage response factors are recruited at chromosome ends, initiating a cellular response to DNA damage. We performed proteomic isolation of chromatin fragments (PICh in order to define changes in chromatin composition that occur upon onset of acute telomere dysfunction triggered by depletion of the telomere-associated factor TRF2. This unbiased purification of telomere-associated proteins in functional or dysfunctional conditions revealed the dynamic changes in chromatin composition that take place at telomeres upon DNA damage induction. On the basis of our results, we describe a critical role for the polycomb group protein Ring1b in nonhomologous end-joining (NHEJ-mediated end-to-end chromosome fusions. We show that cells with reduced levels of Ring1b have a reduced ability to repair uncapped telomeric chromatin. Our data represent an unbiased isolation of chromatin undergoing DNA damage and are a valuable resource to map the changes in chromatin composition in response to DNA damage activation.
Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin
2018-02-27
To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95 > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95 > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95 > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.
Alternative regression models to assess increase in childhood BMI
Directory of Open Access Journals (Sweden)
Mansmann Ulrich
2008-09-01
Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
Body Mass Index (BMI) and All-Cause Mortality Pooling Project
The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.
Directory of Open Access Journals (Sweden)
Marga B M Bekkers
Full Text Available OBJECTIVE: Childhood and adolescent overweight, defined by body mass index (BMI are associated with an increased risk of cardiovascular disease in later life. Abdominal adiposity may be more important in associations with cardiovascular diseases but waist circumference (WC has been rarely studied in children. We studied associations between BMI and WC and blood pressure (BP and cholesterol in 12-year-old children and prospectively changes in BMI or WC status between age 8 and 12 years and BP and cholesterol at age 12. STUDY DESIGN: Weight, height, WC, BP and cholesterol concentrations were measured in 1432 children at age 12 years. Linear regression was used to study the associations between high BMI and large WC (>90(th percentile and BP and cholesterol. RESULTS: Systolic BP was 4.9 mmHg higher (95% (CI 2.5, 7.2 in girls and 4.2 mmHg (95%CI 1.9, 6.5 in boys with a high BMI. Large WC was also associated with higher systolic BP in girls (3.7 mmHg (95%CI 1.3, 6.1 and boys (3.5 mmHg (95%CI 1.2, 5.8. Diastolic BP and cholesterol concentrations were significantly positively (HDL cholesterol negatively associated with high BMI and large WC, too. Normal weight children with a history of overweight did not have higher blood pressure levels or adverse cholesterol concentrations than children that were normal weight at both ages. CONCLUSION: A high BMI and large WC were associated with higher BP levels and adverse cholesterol concentrations. WC should be taken into account when examining cardiovascular risk factors in children.
Maternal depression and child BMI: longitudinal findings from a US sample.
Duarte, C S; Shen, S; Wu, P; Must, A
2012-04-01
To examine the association between maternal depression and child body mass index (BMI) from Kindergarten (K) to fifth grade. Analysis of four waves of data from the Early Childhood Longitudinal Study - Kindergarten spanning K to fifth grade. Maternal depressive symptoms (MDSs) were measured by a brief version of the Center for Epidemiological Studies Depression scale. Data were analyzed using multiple regression analyses, adjusting for key covariates and potential confounders. The analytic sample was restricted to children of normal birth weight. The relationship between MDS and child BMI varies by child gender and age. Among girls, severe MDS at K was related to lower BMI at third grade (but not later at fifth grade) and to an increase in BMI from K to third and K to fifth grades. Among boys, severe MDS at K was related to higher boys' BMI at fifth grade. When severe MDS occurred at third grade, it was related to higher BMI at fifth grade among girls whereas no statistically significant relationship was found for boys. Low levels of physical activity in comparison to peers at fifth grade and more screen time on weekends at third grade are likely mediators of the relationship between MDS and child BMI among girls, while among boys the relationship appears to be mediated by unhealthy eating habits. Our findings, indicating developmental and gender differences in the relationship between maternal depression and child BMI, if confirmed, suggest that interventions addressing maternal depression may have concomitant impact on childhood obesity. © 2012 The Authors. Pediatric Obesity © 2012 International Association for the Study of Obesity.
In a safety net population HPV4 vaccine adherence worsens as BMI increases.
Directory of Open Access Journals (Sweden)
Diane M Harper
Full Text Available Obesity adversely inhibits antibody response to vaccination. Three doses of HPV4 may or may not provide adequate long term protection against HPV 16/18 in obese females. The aim of this study was to determine whether adherence to HPV4 vaccination in a safety net population was reduced with increasing body mass index (BMI.We designed a historical prospective study evaluating the number and dates of HPV4 dosing that occurred from July 1, 2006 through October 1, 2009 by the demographic characteristics of the 10-26 year old recipient females. The defined dosing intervals were adapted from the literature and obesity categories were defined by the WHO.1240 females with BMI measurements received at least one dose of HPV4; 38% were obese (class I, II and III and 25% were overweight. Females with normal BMI received on-time triplet dosing significantly more often than did the obese class II and III females (30% vs. 18%, p<0.001. Obese class II/III females have a significant 45% less chance of completing the on-time triplet HPV4 series than normal women (OR = 0.55, 95% CI: 0.37, 0.83. Pregnancy history has a significant influence on BMI and HPV4 dosing compliance in this safety net population where 71% had been gravid. Hispanic females were less likely to complete HPV4 dosing regardless of BMI (aOR = 0.39, 95% CI: 0.16, 0.95.Obesity, as well as gravidity and Hispanic race, are risk factors for lack of HPV4 vaccine adherence among young females in a safety net population.
Ibe, Yoko; Miyakawa, Happei; Fuse-Nagase, Yasuko; Hirose, Ayumi Sugawara; Hirasawa, Reiko; Yachi, Yoko; Fujihara, Kazuya; Kobayashi, Kazuto; Shimano, Hitoshi; Sone, Hirohito
2016-09-01
Epidemiological longitudinal investigations of the association between not eating three meals regularly and changes in BMI and weight are scarce. The aim of this study was to investigate whether or not regularly eating three meals was associated with changes in BMI and weight in young Japanese men and women. Study participants were 1241 men and 897 women aged 19.0±1.2 and 18.8±0.8years, respectively, who underwent health checkups at a university in Japan in 2001 as the baseline and subsequently in 2003. Weight and height were measured at baseline and 2years later. Whether an individual ate three meals regularly was determined by a self-report questionnaire in 2001. During the 2-year follow-up, the BMI gain was 0.347 for men and 0.067 for women. In the logistic regression analysis, for men, eating three meals irregularly was significantly associated with a 4% BMI gain (OR 1.60, CI 1.11-2.30), 6% BMI gain (OR 1.72, CI 1.12-2.63), 4kg weight gain (OR 2.01, CI 1.29-3.13), 6kg weight gain (OR 1.86, CI 1.02-3.37), and incidence of obesity (BMI ≧ 25)(OR 2.96, CI 1.22-7.17). For women, eating three meals irregularly was significantly associated with a 4% BMI loss (OR 1.99, CI 1.01-3.94), 6% BMI loss (OR 2.79, CI 1.29-6.03), 4kg weight loss (OR 3.85, CI 1.62-9.12), 6kg weight loss (OR 7.65, CI 2.06-28.46), and the incidence of underweight (OR 3.95, CI 1.32-11.89). The current results suggested that eating three meals irregularly was associated with subsequent BMI and weight gains for men and subsequent BMI and weight losses for women; both groups were around 20years of age. Self-reported eating behavior in this study might be used to screen and evaluate young Japanese men and women at high risk for changes in BMI and weight in a practical clinical setting. Copyright © 2016 Elsevier Inc. All rights reserved.
Chen, Yi-Lun; Liu, Yao-Chung; Wu, Chia-Hung; Yeh, Chiu-Mei; Chiu, Hsun-I; Lee, Gin-Yi; Lee, Yu-Ting; Hsu, Pei; Lin, Ting-Wei; Gau, Jyh-Pyng; Hsiao, Liang-Tsai; Chiou, Tzeon-Jye; Liu, Jin-Hwang; Liu, Chia-Jen
2018-04-01
Vertebral fractures affect approximately 30% of myeloma patients and lead to a poor impact on survival and life quality. In general, age and body mass index (BMI) are reported to have an important role in vertebral fractures. However, the triangle relationship among age, BMI, and vertebral fractures is still unclear in newly diagnosed multiple myeloma (NDMM) patients. This study recruited consecutive 394 patients with NDMM at Taipei Veterans General Hospital between January 1, 2005 and December 31, 2015. Risk factors for vertebral fractures in NDMM patients were collected and analyzed. The survival curves were demonstrated using Kaplan-Meier estimate. In total, 301 (76.4%) NDMM patients were enrolled in the cohort. In the median follow-up period of 18.0 months, the median survival duration in those with vertebral fractures ≥ 2 was shorter than those with vertebral fracture BMI BMI ≥ 24.0 kg/m 2 (adjusted RR, 2.79; 95% CI, 1.44-5.43). In multivariable logistic regression, BMI BMI ≥ 24.0 kg/m 2 (adjusted OR, 6.05; 95% CI, 2.43-15.08). Among age stratifications, patients with both old age and low BMI were at a greater risk suffering from increased vertebral fractures, especially in patients > 75 years and BMI BMI. Elder patients with low BMI should consider to routinely receive spinal radiographic examinations and regular follow-up. Copyright © 2017 John Wiley & Sons, Ltd.
Infant BMI peak, breastfeeding, and body composition at age 3 y
DEFF Research Database (Denmark)
Jensen, Signe Marie; Ritz, Christian; Ejlerskov, Katrine Tschentscher
2015-01-01
BACKGROUND: With the increasing focus on obesity, growth patterns in infancy and early childhood have gained much attention. Although the adiposity rebound has been in focus because of a shown association with adult obesity, not much has been published about the infant peak in body mass index (BMI......) cohort were used to estimate BMI growth curves for the age span from 14 d to 19 mo by using a nonlinear mixed-effects model. BMI growth velocity before peak and age and BMI at peak were derived from the subject-specific models. Information about pregnancy and breastfeeding was assessed from background...
DEFF Research Database (Denmark)
Bliddal, Mette; Pottegård, Anton; Kirkegaard, Helene
2015-01-01
BACKGROUND: Previous studies have shown an association between prepregnancy BMI and postpartum depression, but little is known about this association beyond one year postpartum and the influence of postpartum weight retention (PPWR). METHODS: We used data from 70355 mothers from the Danish National......-weight, though the associations were attenuated after adjustments (HR 1.24 [95% CI 1.06-1.45], 1.05 [95% CI 0.96-1.15] and 1.07 [95% CI 0.95-1.21] for underweight, overweight and obese, respectively). Compared to mothers who had returned to their prepregnancy BMI, risk of depression/anxiety disorders...... Birth Cohort to estimate the associations between maternal prepregnancy BMI and PPWR, respectively, and incident depression/anxiety disorders until six years postpartum. Outcome was depression or anxiety diagnosed clinically or filling a prescription for an antidepressant. Cox regression was used...
Differential models of twin correlations in skew for body-mass index (BMI).
Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric
2018-01-01
Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.
de Wilde, J A; Dekker, M; Middelkoop, B J C
2018-03-01
South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. To compare the BMI distribution of contemporary South Asian 0-20 year olds in the Netherlands with: (1) The South Asian norm reference (secular trends); and (2) The WHO child growth standard and reference. The BMI-for-age distribution of 6677 routine measurements of 3322 South Asian children, aged 0-20 years, was described with the LMS method and BMI z-scores. The BMI distribution in South Asian 0-4 year olds was almost similar to the norm reference (mean BMI z-score = 0.11, skewness = 0.31, SD = 1.0), whereas in 5-19 year olds the distribution had shifted upwards (mean = 0.53) and widened (skewness = -0.12, SD = 1.08). Overweight (incl. obesity) and obesity peaked at 8-10 years, at 45-48% and 35-37%, respectively. Relative to the WHO references, the BMI distribution was left-shifted at ages 0-4 years (mean BMI z-score = -0.46, skewness = 0.23, SD = 0.98) and widened at ages 5-20 years (mean = 0.05; skewness = -0.02, SD = 1.40). At most ages, thinness rates were significantly higher and obesity rates lower than based on South Asian norms. A secular change of BMI-for-age in South Asian children mostly affected children >4 years. WHO references likely under-estimate overweight and obesity rates in South Asian children.
Fontana, Luigi; Meyer, Timothy E; Klein, Samuel; Holloszy, John O
2007-06-01
Western diets, which typically contain large amounts of energy-dense processed foods, together with a sedentary lifestyle are associated with increased cardiometabolic risk. We evaluated the long-term effects of consuming a low-calorie low-protein vegan diet or performing regular endurance exercise on cardiometabolic risk factors. In this cross-sectional study, cardiometabolic risk factors were evaluated in 21 sedentary subjects, who had been on a low-calorie low-protein raw vegan diet for 4.4 +/- 2.8 years, (mean age, 53.1 +/- 11 yrs), 21 body mass index (BMI)-matched endurance runners consuming Western diets, and 21 age- and gender-matched sedentary subjects, consuming Western diets. BMI was lower in the low-calorie low-protein vegan diet (21.3 +/- 3.1 kg/m(2)) and endurance runner (21.1 +/- 1.6 kg/m(2)) groups than in the sedentary Western diet group (26.5 +/- 2.7 kg/m(2)) (p vegan diet and runner groups than in the Western diet group (all p vegan diet group (104 +/- 15 and 62 +/- 11 mm Hg) than in BMI-matched endurance runners (122 +/- 13 and 72 +/- 9 mmHg) and Western diet group (132 +/- 14 and 79 +/- 8 mm Hg) (p vegan diet or regular endurance exercise training is associated with low cardiometabolic risk. Moreover, our data suggest that specific components of a low-calorie low-protein vegan diet provide additional beneficial effects on blood pressure.
The effects of breastfeeding on childhood BMI: a propensity score matching approach.
Gibson, Laura A; Hernández Alava, Mónica; Kelly, Michael P; Campbell, Michael J
2017-12-01
Many studies have found a statistical association between breastfeeding and childhood adiposity. This paper investigates whether breastfeeding has an effect on subsequent childhood body mass index (BMI) using propensity scores to account for confounding. We use data from the Millennium Cohort Study, a nationally representative UK cohort survey, which contains detailed information on infant feeding and childhood BMI. Propensity score matching is used to investigate the mean BMI in children breastfed exclusively and partially for different durations of time. We find statistically significant influences of breastfeeding on childhood BMI, particularly in older children, when breastfeeding is prolonged and exclusive. At 7 years, children who were exclusively breastfed for 16 weeks had a BMI 0.28 kg/m2 (95% confidence interval 0.07 to 0.49) lower than those who were never breastfed, a 2% reduction from the mean BMI of 16.6 kg/m2. For this young cohort, even small effects of breastfeeding on BMI could be important. In order to reduce BMI, breastfeeding should be encouraged as part of wider lifestyle intervention. This evidence could help to inform public health bodies when creating public health guidelines and recommendations. © The Author 2016. Published by Oxford University Press on behalf of Faculty of Public Health.
Correlation between BMI and motor coordination in children.
Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P
2012-01-01
To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Bliddal, Mette; Olsen, Jørn; Støvring, Henrik; Eriksen, Hanne-Lise F; Kesmodel, Ulrik S; Sørensen, Thorkild I A; Nøhr, Ellen A
2014-01-01
An association between maternal pre-pregnancy BMI and childhood intelligence quotient (IQ) has repeatedly been found but it is unknown if this association is causal or due to confounding caused by genetic or social factors. We used a cohort of 1,783 mothers and their 5-year-old children sampled from the Danish National Birth Cohort. The children participated between 2003 and 2008 in a neuropsychological assessment of cognitive ability including IQ tests taken by both the mother and the child. Linear regression analyses were used to estimate the associations between parental BMI and child IQ adjusted for a comprehensive set of potential confounders. Child IQ was assessed with the Wechsler Primary and Preschool Scales of Intelligence--Revised (WPPSI-R). The crude association between maternal BMI and child IQ showed that BMI was adversely associated with child IQ with a reduction in IQ of -0.40 point for each one unit increase in BMI. This association was attenuated after adjustment for social factors and maternal IQ to a value of -0.27 (-0.50 to -0.03). After mutual adjustment for the father's BMI and all other factors except maternal IQ, the association between paternal BMI and child IQ yielded a regression coefficient of -0.26 (-0.59 to 0.07), which was comparable to that seen for maternal BMI (-0.20 (-0.44 to 0.04)). Although maternal pre-pregnancy BMI was inversely associated with the IQ of her child, the similar association with paternal BMI suggests that it is not a specific pregnancy related adiposity effect.
DEFF Research Database (Denmark)
Mikkelsen, Ulla Ramer; Dideriksen, Kasper; Andersen, Mads Bisgaard
2015-01-01
and anabolic signaling response in patients with RA compared to healthy controls. METHODS: Thirteen RA patients (age range 34-84 years; diagnosed for 1-32 years, median 8 years) were individually matched with 13 healthy controls for gender, age, BMI and activity level (CON). Plasma levels of C-reactive protein...... and in combination with physical exercise in patients with well-treated RA to a similar extent as in healthy individuals. This indicates that moderately inflamed RA patients have maintained their muscle anabolic responsiveness to physical activity and protein intake....
Kawachi, Asuka; Shimazu, Taichi; Budhathoki, Sanjeev; Sawada, Norie; Yamaji, Taiki; Iwasaki, Motoki; Inoue, Manami; Tsugane, Shoichiro
2018-04-18
Evidence on the association between BMI, height, and endometrial cancer risk, including by subtypes, among Asian populations remains limited. We evaluated the impact of BMI and height on the risk of endometrial cancer, overall and by histological subtype. We prospectively investigated 53 651 Japanese women aged 40-69 years. With an average follow-up duration of 18.6 years, 180 newly diagnosed endometrial cancers were reported, including 119 type 1 and 21 type 2. The association between BMI, height, and endometrial cancer risk was assessed using a Cox proportional hazards regression model with adjustment for potential confounders. Overweight and obesity were associated positively with the risk of endometrial cancer. Compared with BMI of 23.0-24.9 kg/m, hazard ratios (HRs) (95% confidence intervals) were 1.93 (1.17-3.16) for BMI of 27.0-29.9 kg/m and 2.37 (1.20-4.66) for BMI of at least 30.0 kg/m. On analysis by histological subtype, with each increase in BMI of 5 U, the estimated HR of type 1 endometrial cancer increased (HR=1.54, 95% confidence interval: 1.21-1.98), but HR of type 2 endometrial cancer was unaffected. There was no statistically significant association between height and endometrial cancer risk. In conclusion, the risk of endometrial cancer was elevated in women with a BMI of at least 27.0 kg/m. By histological subtype, BMI was associated with type 1, but not type 2 endometrial cancer risk among a population with a relatively low BMI compared with western populations.
Festin, Mario Philip R; Peregoudov, Alexandre; Seuc, Armando; Kiarie, James; Temmerman, Marleen
2017-01-01
To estimate the effect of increased body weight and body mass index (BMI) on pregnancy rates with levonorgestrel (LNG) 1.5mg used as emergency contraception (EC). The study reviewed data from 6873 women in four WHO-HRP randomized trials on EC conducted between 1993 and 2010. Participants took either 1.5mg of LNG as a single dose or in two doses 12h apart, up to 120h of unprotected intercourse. Contraceptive efficacy (pregnancy rates) at different weight and BMI categories was evaluated. Overall pregnancy rate was low at 1.2%. Pregnancy rates were also low in women weighing over 80kg (0.7%) and who were obese (BMI over 30kg/m 2 ) (2.0%). The pooled analyses for pregnancy demonstrated that BMI over 30kg/m 2 decreased efficacy significantly (odds ratio 8.27, 95% confidence interval = 2.70-25.37) when compared to women in lower BMI categories, mainly influenced by pregnancies in obese women from one study site. Sensitivity analyses excluding that site showed that obesity was no longer a risk factor; however, the other studies included too few obese women in the sample to exclude a substantial decrease in efficacy. Pregnancy rates with use of LNG 1.5mg for EC were low at less than 3% across different weight and BMI categories. Pooled analyses showed an increase in pregnancy rates among obese women (BMI more than 30kg/m 2 ) compared to women with normal BMI levels, influenced by pregnancies all coming from one study site. Access to LNG as EC should still be promoted to women who need them, and not be restricted in any weight or BMI category, with additional attention for counselling and advice for obese women. Copyright © 2016. Published by Elsevier Inc.
BMI in relation to sperm count: an updated systematic review and collaborative meta-analysis.
Sermondade, N; Faure, C; Fezeu, L; Shayeb, A G; Bonde, J P; Jensen, T K; Van Wely, M; Cao, J; Martini, A C; Eskandar, M; Chavarro, J E; Koloszar, S; Twigt, J M; Ramlau-Hansen, C H; Borges, E; Lotti, F; Steegers-Theunissen, R P M; Zorn, B; Polotsky, A J; La Vignera, S; Eskenazi, B; Tremellen, K; Magnusdottir, E V; Fejes, I; Hercberg, S; Lévy, R; Czernichow, S
2013-01-01
BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men) obtained from the Infertility Center of Bondy, France. Abstracts of relevant articles were examined and studies that could be included in this review were retrieved. Authors of relevant studies for the meta-analysis were contacted by email and asked to provide standardized data. RESULTS A total of 21 studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm concentration did not differ significantly across BMI categories. There was a J-shaped relationship between BMI categories and risk of oligozoospermia or azoospermia. Compared with men of normal weight, the odds ratio (95% confidence interval) for oligozoospermia or azoospermia was 1.15 (0.93-1.43) for underweight, 1.11 (1.01-1.21) for overweight, 1.28 (1.06-1.55) for obese and 2.04 (1.59-2.62) for morbidly obese men. CONCLUSIONS Overweight and obesity were associated with an increased prevalence of azoospermia or oligozoospermia. The main limitation of this report is that studied populations varied, with men recruited from both the general population and infertile couples. Whether weight normalization could improve sperm parameters should be evaluated further.
Association between C-reactive protein and features of the metabolic syndrome
DEFF Research Database (Denmark)
Fröhlich, M; Imhof, A; Berg, Gabriele
2000-01-01
OBJECTIVE: To assess the association of circulating levels of C-reactive protein, a sensitive systemic marker of inflammation, with different components of the metabolic syndrome. RESEARCH DESIGN AND METHODS: Total cholesterol (TC), HDL cholesterol, triglycerides, uric acid, BMI , and prevalence...... C-reactive protein and TC (R = 0.19), TG (R = 0.29), BMI (R = 0.32), glucose (R = 0.11), and uric acid (R = 0.14) (all P
Ketterl, Tyler G; Dundas, Nicolas J; Roncaioli, Steven A; Littman, Alyson J; Phipps, Amanda I
2018-03-06
Background Maternal overweight and obesity is one of the most common high-risk obstetric conditions associated with adverse birth outcomes. Smaller studies have suggested that pre-pregnancy body mass index (BMI) is associated with postpartum weight retention. Objective The primary objective of this study was to examine the association between pre-pregnancy BMI status and maternal weight retention. Study design We conducted a population-based retrospective cohort study using Washington State birth certificate data from 2003-2013. We included women who had two sequential births during this time period, with the second birth occurring within 18-36 months of the first singleton delivery date. BMI before a women's first pregnancy ("pre-pregnancy BMI") was categorized as normal (18.5-24.9 kg/m 2 ) and overweight/obese (25-40 kg/m 2 ). Women were classified as having returned to first pre-pregnancy BMI if their BMI before their second pregnancy was no more than 1 kg/m 2 more compared to their BMI before their first pregnancy. Analyses were stratified by gestational weight gain during the first pregnancy (below, met, exceeded recommended gestational weight gain). Results A total of 49,132 mothers were included in the study. Among women who met their recommended gestational weight gain, compared to mothers with a normal BMI, obese/overweight mothers were less likely to return to their pre-pregnancy BMI (76.5 vs 72.3%; RR Obese/Overweight = 0.88; 95% CI: 0.85-0.92). A similar pattern was observed among women who exceeded their recommended gestational weight gain (62.6 vs 53.2%; RR Obese/Overweight = 0.79, 95% CI: 0.78-0.80). Conclusion Pre-pregnancy BMI in the overweight/obese range is associated with a decreased likelihood of returning to pre-pregnancy BMI. Further research to support women during and after their pregnancy to promote behavior changes that prevent excessive weight gain during pregnancy and weight retention after birth is needed.
Wu, Yan Yan; Lye, Stephen; Briollais, Laurent
2017-10-01
Recent studies have implicated the FTO gene in child and adult obesity. A longer duration of exclusive breastfeeding (EXBF) has been shown to reduce body mass index (BMI) and the risk of being overweight in the general population and among FTO gene carriers. However, it remains unclear whether the preventive effect of EXBF could be explained by its impact on early life growth development, e.g. ages at adiposity peak (AP) and adiposity rebound (AR) and BMI velocities in the first years of life, which are major determinants of overweight and obesity later in life. We studied 5590 children from the British Avon Longitudinal Study of Parents and Children (ALSPAC) cohort and modelled their longitudinal BMI profiles with mixed effects models from birth to 16 years of age, as well as their ages at AP, AR and BMI velocities in relation to the FTO gene variant and EXBF. A longer duration of EXBF (i.e. at least 5 months) has substantial impact on BMI growth trajectories among children carrying the FTO adverse variant by modulating the age at AP, age at AR and BMI velocities. EXBF acts antagonistically to the FTO rs9939609 risk allele and by the age of 15, the predicted reduction in BMI after 5 months of EXBF is 0.56 kg/m2 [95% confidence interval (CI) 0.11-1.01; P = 0.003] and 1.14 kg/m2 (95% CI 0.67-1.62; P < 0.0001) in boys and girls, respectively. EXBF influences early life growth development and thus plays a critical role in preventing the risks of overweight and obesity even when those are exacerbated by genetic factors. © The Author 2017; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association
Directory of Open Access Journals (Sweden)
Rossi Isabelle A
2011-12-01
Full Text Available Abstract Background The relationship between body mass index (BMI and socioeconomic status (SES tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region. Methods We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403. We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. Results BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p 2 and 2.46 kg/m2, p Conclusions Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.
Raised BMI cut-off for overweight in Greenland Inuit – a review
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Background Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI. PMID:23986904
Raised BMI cut-off for overweight in Greenland Inuit – a review
Directory of Open Access Journals (Sweden)
Stig Andersen
2013-08-01
Full Text Available Background. Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI, a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI.
Change in BMI accurately predicted by social exposure to acquaintances.
Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas
2013-01-01
Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.
BMI and risk of dementia in two million people over two decades: a retrospective cohort study.
Qizilbash, Nawab; Gregson, John; Johnson, Michelle E; Pearce, Neil; Douglas, Ian; Wing, Kevin; Evans, Stephen J W; Pocock, Stuart J
2015-06-01
Dementia and obesity are increasingly important public health issues. Obesity in middle age has been proposed to lead to dementia in old age. We investigated the association between BMI and risk of dementia. For this retrospective cohort study, we used a cohort of 1,958,191 individuals derived from the United Kingdom Clinical Practice Research Datalink (CPRD) which included people aged 40 years or older in whom BMI was recorded between 1992 and 2007. Follow-up was until the practice's final data collection date, patient death or transfer out of practice, or first record of dementia (whichever occurred first). People with a previous record of dementia were excluded. We used Poisson regression to calculate incidence rates of dementia for each BMI category. Our cohort of 1,958,191 people from UK general practices had a median age at baseline of 55 years (IQR 45-66) and a median follow-up of 9·1 years (IQR 6·3-12·6). Dementia occurred in 45,507 people, at a rate of 2·4 cases per 1000 person-years. Compared with people of a healthy weight, underweight people (BMI risk of dementia. Furthermore, the incidence of dementia continued to fall for every increasing BMI category, with very obese people (BMI >40 kg/m(2)) having a 29% lower (95% CI 22-36) dementia risk than people of a healthy weight. These patterns persisted throughout two decades of follow-up, after adjustment for potential confounders and allowance for the J-shape association of BMI with mortality. Being underweight in middle age and old age carries an increased risk of dementia over two decades. Our results contradict the hypothesis that obesity in middle age could increase the risk of dementia in old age. The reasons for and public health consequences of these findings need further investigation. None. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nicholas M Johnson
Full Text Available Malignant brain tumour (MBT domain proteins are transcriptional repressors that function within Polycomb complexes. Some MBT genes are tumour suppressors, but how they prevent tumourigenesis is unknown. The Caenorhabditis elegans MBT protein LIN-61 is a member of the synMuvB chromatin-remodelling proteins that control vulval development. Here we report a new role for LIN-61: it protects the genome by promoting homologous recombination (HR for the repair of DNA double-strand breaks (DSBs. lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. They are hypersensitive to ionizing radiation and interstrand crosslinks but not UV light. Using a novel reporter system that monitors repair of a defined DSB in C. elegans somatic cells, we show that LIN-61 contributes to HR. The involvement of this MBT protein in HR raises the possibility that MBT-deficient tumours may also have defective DSB repair.
Laxy, Michael; Stark, Renée; Peters, Annette; Hauner, Hans; Holle, Rolf; Teuner, Christina M
2017-08-30
This study aims to analyse the non-linear relationship between Body Mass Index (BMI) and direct health care costs, and to quantify the resulting cost fraction attributable to obesity in Germany. Five cross-sectional surveys of cohort studies in southern Germany were pooled, resulting in data of 6757 individuals (31-96 years old). Self-reported information on health care utilisation was used to estimate direct health care costs for the year 2011. The relationship between measured BMI and annual costs was analysed using generalised additive models, and the cost fraction attributable to obesity was calculated. We found a non-linear association of BMI and health care costs with a continuously increasing slope for increasing BMI without any clear threshold. Under the consideration of the non-linear BMI-cost relationship, a shift in the BMI distribution so that the BMI of each individual is lowered by one point is associated with a 2.1% reduction of mean direct costs in the population. If obesity was eliminated, and the BMI of all obese individuals were lowered to 29.9 kg/m², this would reduce the mean direct costs by 4.0% in the population. Results show a non-linear relationship between BMI and health care costs, with very high costs for a few individuals with high BMI. This indicates that population-based interventions in combination with selective measures for very obese individuals might be the preferred strategy.
Directory of Open Access Journals (Sweden)
Aleksander F Sikorski
2007-01-01
Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.
Linares, Jeannette; Corvalán, Camila; Galleguillos, Bárbara; Kain, Juliana; González, Laura; Uauy, Ricardo; Garmendia, María Luisa; Mericq, Verónica
2016-06-01
To assess the effect of pre-pregnancy body mass index (BMI), gestational weight gain (GWG), and other maternal factors on the timing of adiposity rebound (AR). In this study, 594 mothers (mothers who do not have diabetes and not underweight) from the longitudinal Growth and Obesity Chilean Cohort Study self-reported their weights at the beginning and end of their pregnancies, and their heights were measured. Pre-pregnancy BMI was categorized as normal weight, overweight, or obesity, and GWG was assessed according to Institute of Medicine guidelines. For children, weight and height measurements from 0 to 3 years were retrieved from records, and they were measured from age 4 to 7 years. BMI curves from 0 to 7 years were used to estimate the age at AR, which was categorized as early (7 years). The associations between pre-pregnancy BMI and GWG and early AR were tested using logistic regression models. In total, 33% of the mothers had excess pre-pregnancy weight, 31.2% exceeded Institute of Medicine recommendations, and 45% of children had early AR. The pre-pregnancy BMI and parity were associated with earlier AR (OR = 1.07, 95% CI = 1.02-1.11; OR = 0.86; 95% CI = 0.74-0.99, respectively), but GWG was unrelated. These results suggest that preventive strategies for promoting normal pre-pregnancy BMI, especially in women's first pregnancies, could delay the timing of AR, with protective metabolic effects on offspring. © 2016 The Obesity Society.
Liu, Jianyu; Stevens, Payton D; Eshleman, Nichole E; Gao, Tianyan
2013-08-09
Protein translation initiation is a tightly controlled process responding to nutrient availability and mitogen stimulation. Serving as one of the most important negative regulators of protein translation, 4E binding protein 1 (4E-BP1) binds to translation initiation factor 4E and inhibits cap-dependent translation in a phosphorylation-dependent manner. Although it has been demonstrated previously that the phosphorylation of 4E-BP1 is controlled by mammalian target of rapamycin in the mammalian target of rapamycin complex 1, the mechanism underlying the dephosphorylation of 4E-BP1 remains elusive. Here, we report the identification of PPM1G as the phosphatase of 4E-BP1. A coimmunoprecipitation experiment reveals that PPM1G binds to 4E-BP1 in cells and that purified PPM1G dephosphorylates 4E-BP1 in vitro. Knockdown of PPM1G in 293E and colon cancer HCT116 cells results in an increase in the phosphorylation of 4E-BP1 at both the Thr-37/46 and Ser-65 sites. Furthermore, the time course of 4E-BP1 dephosphorylation induced by amino acid starvation or mammalian target of rapamycin inhibition is slowed down significantly in PPM1G knockdown cells. Functionally, the amount of 4E-BP1 bound to the cap-dependent translation initiation complex is decreased when the expression of PPM1G is depleted. As a result, the rate of cap-dependent translation, cell size, and protein content are increased in PPM1G knockdown cells. Taken together, our study has identified protein phosphatase PPM1G as a novel regulator of cap-dependent protein translation by negatively controlling the phosphorylation of 4E-BP1.
Cardiorespiratory fitness, BMI, and risk of hypertension: the HYPGENE study.
Rankinen, Tuomo; Church, Timothy S; Rice, Treva; Bouchard, Claude; Blair, Steven N
2007-10-01
Cardiorespiratory fitness and regular physical activity are inversely associated with the risk of hypertension, and exercise training has been shown to lower elevated blood pressure (BP). Genetic factors contribute significantly to the interindividual differences in endurance training-induced changes in BP. However, similar data on the genotype-by-fitness interactions on the risk of hypertension are scarce. In 2000, we started a systematic collection of blood samples from all consenting subjects of the Aerobics Center Longitudinal Study (ACLS) with a goal to generate a resource for studies addressing genotype-by-fitness interaction effects on various health-related end points. Here, we introduce the rationale and design of the first study based on the ACLS genetics resource focusing on hypertension as the health outcome (HYPGENE study), and we report the associations of cardiorespiratory fitness and body mass index (BMI) with the risk of hypertension. All HYPGENE subjects (N = 1234) were healthy and normotensive at their first clinic visit. Cases (N = 629) developed hypertension during the follow-up period (mean 8.7 yr), whereas controls (N = 605) remained normotensive (mean follow-up 10.1 yr). Cardiorespiratory fitness was the strongest predictor of the hypertension risk, with each maximal metabolic equivalent unit being associated with a 19% lower risk (95% confidence interval [95% CI], 12-24%). Each baseline BMI unit was associated with a 9% higher hypertension risk (95% CI, 4-13%). However, the association of BMI was greatly attenuated (odds ratio 1.04 [95% CI, 0.99-1.09]) when fitness also was included in the model. The HYPGENE study will provide an excellent resource to address hypotheses regarding the genetic basis of hypertension while taking cardiorespiratory fitness level into account.
Directory of Open Access Journals (Sweden)
Michael Anthony Ruiz
Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.
BMI in relation to sperm count
DEFF Research Database (Denmark)
Sermondade, N; Faure, C; Fezeu, L
2013-01-01
BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...
Association of ATM and BMI-1 genetic variation with breast cancer risk in Han Chinese.
Yue, Li-Ling; Wang, Fu-Chao; Zhang, Ming-Long; Liu, Dan; Chen, Ping; Mei, Qing-Bu; Li, Peng-Hui; Pan, Hong-Ming; Zheng, Li-Hong
2018-04-24
We tested the hypothesis that genetic variation in ATM and BMI-1 genes can alter the risk of breast cancer through genotyping 6 variants among 524 breast cancer cases and 518 cancer-free controls of Han nationality. This was an observational, hospital-based, case-control association study. Analyses of single variant, linkage, haplotype, interaction and nomogram were performed. Risk was expressed as odds ratio (OR) and 95% confidence interval (CI). All studied variants were in the Hardy-Weinberg equilibrium and were not linked. The mutant allele frequencies of rs1890637, rs3092856 and rs1801516 in ATM gene were significantly higher in cases than in controls (P = .005, ATM gene were significantly associated with 1.98-fold and 6.04-fold increased risk of breast cancer (95% CI: 1.36-2.90 and 1.65-22.08, respectively). Nomogram analysis estimated that the cumulative proportion of 3 significant variants in ATM gene was about 12.5%. Our findings collectively indicated that ATM gene was a candidate gene in susceptibility to breast cancer in Han Chinese. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney
2018-04-19
Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.
Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.
Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S
2014-11-01
A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much
Bezerra Duarte, Sebastião Mauro; Faintuch, Joel; Stefano, José Tadeu; Sobral de Oliveira, Maria Beatriz; de Campos Mazo, Daniel Ferraz; Rabelo, Fabiola; Vanni, Denise; Nogueira, Monize Aydar; Carrilho, Flair José; Marques Souza de Oliveira, Claudia Pinto
2014-01-01
To investigate the role of hypocaloric highprotein diet, a prospective clinical study was conducted in NAFLD patients. Pre-versus post-interventional data were analyzed in 48 stable NAFLD patients (submitted to a hypocaloric high-protein diet during 75 days. Variables included anthropometrics (body mass index/ BMI and waist circumference/WC), whole-body and segmental bioimpedance analysis and biochemical tests. Diet compliance was assessed by interviews every two weeks. BMI, WC and body fat mass remained relatively stable (-1.3%, -1.8% and -2.5% respectively, no significance). HDL- cholesterol increased (P hypocaloric diet were associated with improvement of lipid profile, glucose homeostasis and liver enzymes in NAFLD independent on BMI decrease or body fat mass reduction.
Przybyl, Joanna; Kidzinski, Lukasz; Hastie, Trevor; Debiec-Rychter, Maria; Nusse, Roel; van de Rijn, Matt
2018-05-01
Low-grade endometrial stromal sarcomas (LGESS) harbor chromosomal translocations that affect proteins associated with chromatin remodeling Polycomb Repressive Complex 2 (PRC2), including SUZ12, PHF1 and EPC1. Roughly half of LGESS also demonstrate nuclear accumulation of β-catenin, which is a hallmark of Wnt signaling activation. However, the targets affected by the fusion proteins and the role of Wnt signaling in the pathogenesis of these tumors remain largely unknown. Here we report the results of a meta-analysis of three independent gene expression profiling studies on LGESS and immunohistochemical evaluation of nuclear expression of β-catenin and Lef1 in 112 uterine sarcoma specimens obtained from 20 LGESS and 89 LMS patients. Our results demonstrate that 143 out of 310 genes overexpressed in LGESS are known to be directly regulated by SUZ12. In addition, our gene expression meta-analysis shows activation of multiple genes implicated in Wnt signaling. We further emphasize the role of the Wnt signaling pathway by demonstrating concordant nuclear expression of β-catenin and Lef1 in 7/16 LGESS. Based on our findings, we suggest that LGESS-specific fusion proteins disrupt the repressive function of the PRC2 complex similar to the mechanism seen in synovial sarcoma, where the SS18-SSX fusion proteins disrupt the mSWI/SNF (BAF) chromatin remodeling complex. We propose that these fusion proteins in LGESS contribute to overexpression of Wnt ligands with subsequent activation of Wnt signaling pathway and formation of an active β-catenin/Lef1 transcriptional complex. These observations could lead to novel therapeutic approaches that focus on the Wnt pathway in LGESS. Copyright © 2018 Elsevier Inc. All rights reserved.
Food brand recognition and BMI in preschoolers.
Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally
2017-07-01
Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.
Brown, Mark A; Goodwin, James L; Silva, Graciela E; Behari, Ajay; Newman, Anne B; Punjabi, Naresh M; Resnick, Helaine E; Robbins, John A; Quan, Stuart F
2011-12-08
INTRODUCTION: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB). However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS) were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors. METHODS: A full-montage unattended home polysomnogram (PSG) and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI) was categorized using clinical thresholds: sleep apnea), and ≥ 15 (moderate to severe sleep apnea). Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates. RESULTS: Mean (SD) age was 62.2 years (10.14), 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD) change of 0.53 (2.62) kg/m(2) (p=0.071). A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m(2) (p=0.055) and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m(2) (plosing weight.
Does the cortisol awakening response link childhood adversity to adult BMI?
Miller, Kelly F; Arbel, Reout; Shapiro, Lauren S; Han, Sohyun C; Margolin, Gayla
2018-04-26
Childhood adversity is a risk factor for the development of obesity in adulthood. Dysregulated hypothalamic-pituitary-adrenal (HPA) activity, which has been associated separately with both adverse childhood experiences and obesity, has been posited as a mechanism by which stressful experiences influence body mass index (BMI); however, this mechanism has not yet been tested longitudinally. The present study uses multireporter, longitudinal data across three time points to test whether the adolescent cortisol awakening response (CAR), an index of diurnal HPA activity, mediates the association between adversity in childhood and BMI in adulthood. Eighty-two youth, mothers, and fathers reported on adverse childhood experiences from middle childhood to late adolescence. During adolescence, youth provided saliva samples three times each morning across three days, which were assayed for cortisol to calculate CAR. During early adulthood, youth reported height and weight to calculate BMI. Greater adversity predicted flatter CAR and higher young adult BMI. Flatter CAR partially mediated the association between childhood adversity and young adult BMI. Stress-related alterations to HPA activity account in part for the childhood adversity-adult obesity link. Findings are consistent with theoretical models implicating HPA alterations as linking childhood adversity to metabolic and behavioral determinants of BMI in adulthood. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.
Stommel, Manfred; Schoenborn, Charlotte A
2010-09-01
When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.
The dose-response analysis between BMI and common chronic diseases in northeast China.
Yu, Jianxing; Tao, Yuchun; Dou, Jing; Ye, Junsen; Yu, Yaqin; Jin, Lina
2018-03-09
High body mass index (BMI) predisposes to several chronic diseases, but a large-scale systematic and detailed study of dose-response relationship between BMI and chronic diseases has not been reported previously. In this study, we aimed to investigate the relationship between BMI and 3 chronic diseases (hypertension, dyslipidemia and MetS) in northeast China. A sample of 16412 participants aged 18~79 years old were included in Jilin province in 2012. The lambda-mu-sigma (LMS) method was applied to examine the trend of BMI by age, and the restricted cubic splines were used to investigate the non-linear associations (dose-response curve) between BMI and chronic diseases. It was pointed out that BMI increased rapidly when young, then kept steady in middle age, and finally declined slowly in old age, and accordingly age was divided into 3 segments, which were different by gender. The odds ratios (ORs) of BMI for the chronic diseases increased relatively slowly when young, then increased dramatically in middle-age and old population, especially for men. Further, the ORs of BMI among non-smokers were lower than those among smokers, and the same trend was shown to be more apparent among drinkers and non-drinkers. The risk of BMI for common chronic diseases increased dramatically in middle-aged, especially for men with drinking and smoking habits.
Maternal and offspring intelligence in relation to BMI across childhood and adolescence.
Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R
2018-01-30
The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous
Bhagat, Nikunj A.; Venkatakrishnan, Anusha; Abibullaev, Berdakh; Artz, Edward J.; Yozbatiran, Nuray; Blank, Amy A.; French, James; Karmonik, Christof; Grossman, Robert G.; O'Malley, Marcia K.; Francisco, Gerard E.; Contreras-Vidal, Jose L.
2016-01-01
This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG)-based brain machine interface (BMI). Intent was inferred from movement related cortical potentials (MRCPs) measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II), to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: (1) an adaptive time window was used for extracting features during BMI calibration; (2) training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and (3) BMI predictions were gated by residual electromyography (EMG) activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR) = 62.7 ± 21.4% on day 4 and 67.1 ± 14.6% on day 5. The overall false positive rate (FPR) across subjects was 27.74 ± 37.46% on day 4 and 27.5 ± 35.64% on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10%). On average, motor intent was detected −367 ± 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration. PMID:27065787
Directory of Open Access Journals (Sweden)
Nikunj Arunkumar Bhagat
2016-03-01
Full Text Available This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG-based brain machine interface (BMI. Intent was inferred from movement related cortical potentials (MRCPs measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II, to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: 1 an adaptive time window was used for extracting features during BMI calibration; 2 training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and 3 BMI predictions were gated by residual electromyography (EMG activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR = 62.7 +/- 21.4 % on day 4 and 67.1 +/- 14.6 % on day 5. The overall false positive rate (FPR across subjects was 27.74 +/- 37.46 % on day 4 and 27.5 +/- 35.64 % on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10 %. On average, motor intent was detected -367 +/- 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration.
Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2.
Christofides, Anthos; Karantanos, Theodoros; Bardhan, Kankana; Boussiotis, Vassiliki A
2016-12-20
Polycomb group proteins regulate chromatin structure and have an important regulatory role on gene expression in various cell types. Two polycomb group complexes (Polycomb repressive complex 1 (PRC1) and 2 (PRC2)) have been identified in mammalian cells. Both PRC1 and PRC2 compact chromatin, and also catalyze histone modifications. PRC1 mediates monoubiquitination of histone H2A, whereas PRC2 catalyzes methylation of histone H3 on lysine 27. These alterations of histones can lead to altered gene expression patterns by regulating chromatin structure. Numerous studies have highlighted the role of the PRC2 catalytic component enhancer of zeste homolog 2 (EZH2) in neoplastic development and progression, and EZH2 mutations have been identified in various malignancies. Through modulating the expression of critical genes, EZH2 is actively involved in fundamental cellular processes such as cell cycle progression, cell proliferation, differentiation and apoptosis. In addition to cancer cells, EZH2 also has a decisive role in the differentiation and function of T effector and T regulatory cells. In this review we summarize the recent progress regarding the role of EZH2 in human malignancies, highlight the molecular mechanisms by which EZH2 aberrations promote the pathogenesis of cancer, and discuss the anti-tumor effects of EZH2 targeting via activating direct anti-cancer mechanisms and anti-tumor immunity.
Maternal Pre-pregnancy BMI and Reproductive Health of Daughters in Young Adulthood
DEFF Research Database (Denmark)
Mariansdatter, Saga Elise; Ernst, Andreas; Toft, Gunnar
2016-01-01
Objective To investigate the possible associations between maternal pre-pregnancy body mass index (BMI) and daughters' age of menarche and subsequent markers of reproductive health. Methods Nine hundred eighty-five pregnant women (80 %) were enrolled at their routine 30th week examinations in 1988...... dehydroepiandrosterone-sulphate (DHEAS), estradiol, and free estrogen index (FEI), compared to the middle BMI tertile. This was supported by a sub-analysis using the WHO classification (underweight, BMI obese, BMI ≥ 25.00 kg/m2) as exposure groups, in which daughters...... of overweight mothers had lower levels of DHEAS and estradiol, and lower FEI compared to daughters of normal weight mothers. No associations were found for ovarian follicle count in any of the groups. Conclusions for Practice We found that higher maternal BMI is associated with earlier age of menarche...
Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase
Kim, Dongjin; Ntui, Valentine Otang; Zhang, Nianshu; Xiong, Liming
2015-01-01
Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.
Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase
Kim, Dongjin
2015-10-09
Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.
Directory of Open Access Journals (Sweden)
Yeon Jeong Kim
Full Text Available Protein disulfide isomerase (PDI is a chaperone protein involved in oxidative protein folding by acting as a catalyst and assisting folding in the endoplasmic reticulum (ER. A genome database search showed that rice contains 19 PDI-like genes. However, their functions are not clearly identified. This paper shows possible functions of rice PDI-like protein 1-1 (PDIL1-1 during seed development. Seeds of the T-DNA insertion PDIL1-1 mutant, PDIL1-1Δ, identified by genomic DNA PCR and western blot analysis, display a chalky phenotype and a thick aleurone layer. Protein content per seed was significantly lower and free sugar content higher in PDIL1-1Δ mutant seeds than in the wild type. Proteomic analysis of PDIL1-1Δ mutant seeds showed that PDIL1-1 is post-translationally regulated, and its loss causes accumulation of many types of seed proteins including glucose/starch metabolism- and ROS (reactive oxygen species scavenging-related proteins. In addition, PDIL1-1 strongly interacts with the cysteine protease OsCP1. Our data indicate that the opaque phenotype of PDIL1-1Δ mutant seeds results from production of irregular starch granules and protein body through loss of regulatory activity for various proteins involved in the synthesis of seed components.
Energy Technology Data Exchange (ETDEWEB)
Sakamoto, Hikaru [Department of Bioproduction, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-shi, Hokkaido 093-2422 (Japan); Sakata, Keiko; Kusumi, Kensuke [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Kojima, Mikiko; Sakakibara, Hitoshi [RIKEN Plant Science Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045 (Japan); Iba, Koh, E-mail: koibascb@kyushu-u.org [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)
2012-06-29
Highlights: Black-Right-Pointing-Pointer ITN1, a plasma membrane ankyrin protein, interacts with a nuclear DNA-binding protein RTV1. Black-Right-Pointing-Pointer The nuclear transport of RTV1 is partially inhibited by interaction with ITN1. Black-Right-Pointing-Pointer RTV1 can promote the nuclear localization of ITN1. Black-Right-Pointing-Pointer Both overexpression of RTV1 and the lack of ITN1 increase salicylic acids sensitivity in plants. -- Abstract: The increased tolerance to NaCl 1 (ITN1) protein is a plasma membrane (PM)-localized protein involved in responses to NaCl stress in Arabidopsis. The predicted structure of ITN1 is composed of multiple transmembrane regions and an ankyrin-repeat domain that is known to mediate protein-protein interactions. To elucidate the molecular functions of ITN1, we searched for interacting partners using a yeast two-hybrid assay, and a nuclear-localized DNA-binding protein, RTV1, was identified as a candidate. Bimolecular fluorescence complementation analysis revealed that RTV1 interacted with ITN1 at the PM and nuclei in vivo. RTV1 tagged with red fluorescent protein localized to nuclei and ITN1 tagged with green fluorescent protein localized to PM; however, both proteins localized to both nuclei and the PM when co-expressed. These findings suggest that RTV1 and ITN1 regulate the subcellular localization of each other.
Sex differences in heritability of BMI
DEFF Research Database (Denmark)
Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O
2003-01-01
pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....
Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.
Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M
2017-01-01
This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Change in BMI accurately predicted by social exposure to acquaintances.
Directory of Open Access Journals (Sweden)
Rahman O Oloritun
Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as
DEFF Research Database (Denmark)
Zhang, Dong Feng; Pang, Zengchang; Li, Shuxia
2012-01-01
The genetic loci affecting the commonly used BMI have been intensively investigated using linkage approaches in multiple populations. This study aims at performing the first genome-wide linkage scan on BMI in the Chinese population in mainland China with hypothesis that heterogeneity in genetic...... linkage could exist in different ethnic populations. BMI was measured from 126 dizygotic twins in Qingdao municipality who were genotyped using high-resolution Affymetrix Genome-Wide Human SNP arrays containing about 1 million single-nucleotide polymorphisms (SNPs). Nonparametric linkage analysis...... in western countries. Multiple loci showing suggestive linkage were found on chromosome 1 (lod score 2.38 at 242 cM), chromosome 8 (2.48 at 95 cM), and chromosome 14 (2.2 at 89.4 cM). The strong linkage identified in the Chinese subjects that is consistent with that found in populations of European origin...
Directory of Open Access Journals (Sweden)
Claudia Börnhorst
Full Text Available Starting from birth, this explorative study aimed to investigate between-country differences in body mass index (BMI trajectories and whether early life factors explain these differences.The sample included 7,644 children from seven European countries (Belgium, Cyprus, Germany, Hungary, Italy, Spain, Sweden participating in the multi-centre IDEFICS study. Information on early life factors and in total 53,409 repeated measurements of height and weight from 0 to <12 years of age were collected during the baseline (2007/2008 and follow-up examination (2009/2010 supplemented by records of routine child health visits. Country-specific BMI growth curves were estimated using fractional polynomial mixed effects models. Several covariates focussing on early life factors were added to the models to investigate their role in the between-countries differences.Large between-country differences were observed with Italian children showing significantly higher mean BMI values at all ages ≥ 3 years compared to the other countries. For instance, at age 11 years mean BMI values in Italian boys and girls were 22.3 [21.9;22.8; 99% confidence interval] and 22.0 [21.5;22.4], respectively, compared to a range of 18.4 [18.1;18.8] to 20.3 [19.8;20.7] in boys and 18.2 [17.8;18.6] to 20.3 [19.8;20.7] in girls in the other countries. After adjustment for early life factors, differences between country-specific BMI curves became smaller. Maternal BMI was the factor being most strongly associated with BMI growth (p<0.01 in all countries with associations increasing during childhood. Gestational weight gain (GWG was weakly associated with BMI at birth in all countries. In some countries, positive associations between BMI growth and children not being breastfed, mothers' smoking during pregnancy and low educational level of parents were found.Early life factors seem to explain only some of the inter-country variation in growth. Maternal BMI showed the strongest association
Trajectories of BMI from early childhood through early adolescence: SES and psychosocial predictors.
Lane, Sean P; Bluestone, Cheryl; Burke, Christopher T
2013-02-01
This study examined the ways in which body mass index (BMI) percentile - an identified risk factor for overweight and cardiovascular disease in adulthood - develops from birth through early adolescence. In addition, we examined whether psychosocial factors, such as parenting style and maternal depression, mediated the link between socio-economic status (SES) and BMI growth. Design. Data were obtained from phases 1-3 of the National Institute of Child Health and Human Development (NICHD) Study of Early Child Care and Youth Development (SECCYD) - a longitudinal study that followed children from 10 communities in the United States from birth to age 11. We applied growth mixture models to identify distinct subtypes of BMI development. Within these models, we performed between- and within-class mediation analyses to examine whether SES predicted class membership or differences in development within each class via maternal depression and parenting styles. Results identified three prototypic trajectories of BMI percentile growth, elevated, steady increase, and stable. We found evidence for both between- and within-class mediation, suggesting multiple pathways by which SES can affect BMI development. These findings add to the research that suggests that being in a family with a low SES is associated with falling into patterns of development characterized by early and lasting increases in BMI relative to one's peers, and that this association is partly accounted for by maternal depression and parenting styles. What is already known? Past research has found evidence that patterns of childhood overweight are impacted by socioeconomic status through psychosocial factors like parenting and depression. This evidence is often limited to individual points in time where neglectful, permissive, and authoritarian parenting and higher levels of maternal depression are associated with higher levels of overweight status among children from infancy to adolescence. However, little
Lifescience Database Archive (English)
Full Text Available MPA1 TLR signaling molecules MAVS IPS1, KIAA1271, VISA VISA_(gene) Mitochondrial antiviral-signaling pr...otein CARD adapter inducing interferon beta, Interferon beta promoter stimulator protein... 1, Putative NF-kappa-B-activating protein 031N, Virus-induced-signaling adapter 9606 Homo sapiens Q7Z434 57506 2VGQ 57506 ...
Mackenzie, Kimberly D; Lim, Yoon; Duffield, Michael D; Chataway, Timothy; Zhou, Xin-Fu; Keating, Damien J
2017-07-01
Huntingtin-associated protein 1 (HAP1) was initially identified as a binding partner of huntingtin, mutations in which underlie Huntington's disease. Subcellular localization and protein interaction data indicate that HAP1 may be important in vesicle trafficking, cell signalling and receptor internalization. In this study, a proteomics approach was used for the identification of novel HAP1-interacting partners to attempt to shed light on the physiological function of HAP1. Using affinity chromatography with HAP1-GST protein fragments bound to Sepharose columns, this study identified a number of trafficking-related proteins that bind to HAP1. Interestingly, many of the proteins that were identified by mass spectrometry have trafficking-related functions and include the clathrin light chain B and Sec23A, an ER to Golgi trafficking vesicle coat component. Using co-immunoprecipitation and GST-binding assays the association between HAP1 and clathrin light chain B has been validated in vitro. This study also finds that HAP1 co-localizes with clathrin light chain B. In line with a physiological function of the HAP1-clathrin interaction this study detected a dramatic reduction in vesicle retrieval and endocytosis in adrenal chromaffin cells. Furthermore, through examination of transferrin endocytosis in HAP1 -/- cortical neurons, this study has determined that HAP1 regulates neuronal endocytosis. In this study, the interaction between HAP1 and Sec23A was also validated through endogenous co-immunoprecipitation in rat brain homogenate. Through the identification of novel HAP1 binding partners, many of which have putative trafficking roles, this study provides us with new insights into the mechanisms underlying the important physiological function of HAP1 as an intracellular trafficking protein through its protein-protein interactions. Copyright © 2017 Elsevier Inc. All rights reserved.
Social disparities in body mass index (BMI) trajectories among Chinese adults in 1991-2011.
Fang, Changchun; Liang, Ying
2017-08-16
Obesity is a serious public health problem in China. The relationship between obesity and socio-economic status (SES) is changing and affected by uncertainty, particularly, in developing countries. The sex-related differences in body mass index (BMI) trajectories are controversial and require substantial empirical data for updating and enriching. This study examined the relationship between SES and BMI in Chinese adults from a dynamic perspective using longitudinal data (1991-2011) from the China Health and Nutrition Survey (CHNS). Then, sex-related differences were determined. A hierarchical linear model was used. SES positively affected the male BMI changes, with faster BMI growth rates in the high-SES males over the past 20 years. By contrast, female BMI was only affected by BMI baseline and residential area. Specifically, greater BMI baseline led to greater BMI growth rate and earlier BMI decline. In the past 20 years, the BMI growth rate has been greater in the urban females than in the rural females. The relationship between SES and obesity is complex in China, and a substantial sex-related difference exists. We argue that this large sex-related difference is due to the rapid economic and social changes that have affected national health and increased the gender inequality and social role restrictions in females. We provide insights for further research and policy recommendations.
Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu
2018-02-01
Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.
Monitoring cure properties of out-of-autoclave BMI composites using IFPI sensor
Kaur, Amardeep; Anandan, Sudharshan; Yuan, Lei; Watkins, Steve E.; Chandrashekhara, K.; Xiao, Hai; Phan, Nam
2016-04-01
A non-destructive technique for inspection of a Bismaleimide (BMI) composite is presented using an optical fiber sensor. High performance BMI composites are used for Aerospace application for their mechanical strength. They are also used as an alternative to toughened epoxy resins. A femtosecond-laser-inscribed Intrinsic Fabry-Perot Interferometer (IFPI) sensor is used to perform real time cure monitoring of a BMI composite. The composite is cured using the out-of-autoclave (OOA) process. The IFPI sensor was used for in-situ monitoring; different curing stages are analyzed throughout the curing process. Temperature-induced-strain was measured to analyze the cure properties. The IFPI structure comprises of two reflecting mirrors inscribed on the core of the fiber using a femtosecond-laser manufacturing process. The manufacturing process makes the sensor thermally stable and robust for embedded applications. The sensor can withstand very high temperatures of up to 850 °C. The temperature and strain sensitivities of embedded IFPI sensor were measured to be 1.4 pm/μepsilon and 0.6 pm/μepsilon respectively.
Bacchini, Dario; Licenziati, Maria Rosaria; Affuso, Gaetana; Garrasi, Alessandra; Corciulo, Nicola; Driul, Daniela; Tanas, Rita; Fiumani, Perla Maria; Di Pietro, Elena; Pesce, Sabino; Crinò, Antonino; Maltoni, Giulio; Iughetti, Lorenzo; Sartorio, Alessandro; Deiana, Manuela; Lombardi, Francesca; Valerio, Giuliana
2017-06-01
Research has provided evidence that obesity is associated with peer victimization and low levels of self-concept. No study has examined the relationship between BMI z-score, self-concept in multiple domains, and peer victimization. The aim of the research was to investigate the interplay between BMI z-score, self-concept in multiple domains (physical, athletic, social), and peer victimization, testing direct, mediated, and moderated associations. Eighty hundred fifteen outpatient children and adolescents were consecutively recruited in 14 hospitals distributed over the Italian country. The sample consisted of 419 males and 396 females; mean age 10.91 ± 1.97 years (range 6-14 years) and mean BMI z-score 1.85 ± 0.74 (range -0.97 ± 3.27). Peer victimization and self-concept were assessed with a revised Olweus Bully/Victim Questionnaire and with the Self-Perception Profile for Children. A structural equation model approach was used to determine the associations among variables, testing two competing models. In both models, path analysis revealed that BMI z-score was directly associated with peer victimization and self-concept in multiple domains. In the first model, peer victimization mediated the relationship between BMI-score and self-concept, whereas in the alternative model, self-concept mediated the relationship between BMI z-score and peer victimization. Interaction analyses revealed that social competence moderated the relationship between BMI z-score and peer victimization and that peer victimization moderated the relationship between BMI z-score and physical appearance. Higher levels of BMI z-score are a risk factor for peer victimization and poor self-concept. When high levels of BMI z-score are associated with a negative self-concept, the risk of victimization increases. Preventive and supportive interventions are needed to avoid negative consequences on quality of life in children and adolescents with obesity.
Alternative regression models to assess increase in childhood BMI
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-01-01
Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...
The Role of BMI Change on Smoking Abstinence in a Sample of HIV-Infected Smokers
Gritz, Ellen R.; Kypriotakis, George; Arduino, Roberto C.; Vidrine, Damon J.
2016-01-01
The prevalence of cigarette smoking among persons living with HIV/AIDS (PLWHA) is approximately 40%, significantly higher than that of the general population. Identifying predictors of successful smoking cessation for PLWHA is necessary to alleviate the morbidity and mortality associated with smoking in this population. Weight gain has been associated with smoking relapse in the general population, but has not been studied among PLWHA. Data from 474 PLWHA enrolled in a smoking cessation randomized clinical trial were analyzed to examine the effect of BMI change, from baseline to 3-month follow-up, on smoking outcomes using multiple logistic regression. The odds of 7-day smoking abstinence at 3-month follow-up were 4.22 (95% CI=1.65, 10.82) times higher for participants classified as BMI decrease and 4.22 (95% CI=1.62, 11.01) times higher for participants classified as BMI increase as compared to participants with a minimal increase or decrease in BMI. In this sample, both weight gain and loss following smoking cessation were significantly associated with abstinence at 3-month follow-up among HIV-infected smokers. Further research and a better understanding of predictors of abstinence will encourage more tailored interventions, with the potential to reduce morbidity and mortality. PMID:26666313
Directory of Open Access Journals (Sweden)
Linong Ji
Full Text Available Differences exist between treatment recommendations regarding the choice of metformin as first-line therapy for type 2 diabetes patients according to body mass index (BMI. This study compared the efficacy of metformin monotherapy among normal-weight, overweight, and obese patients with newly diagnosed type 2 diabetes.In this prospective, multicenter, open-label study in China, patients aged 23-77 years were enrolled 1∶1:1 according to baseline BMI: normal-weight (BMI 18.5-23.9 kg/m(2; n = 125; overweight (BMI 24.0-27.9 kg/m(2; n = 122 or obese (BMI ≥28 kg/m(2; n = 124. Extended-release metformin was administered for 16 weeks (500 mg/day, up-titrated weekly to a maximum 2,000 mg/day. The primary efficacy endpoint was the effect of baseline BMI on glycemic control with metformin monotherapy, measured as the change from baseline in glycosylated hemoglobin (HbA1c at week 16 compared among BMI groups using ANCOVA. Other endpoints included comparisons of metformin's effects on fasting plasma glucose (FPG, lipid levels and body weight.Mean HbA1c decreases at week 16, adjusted for baseline values, were -1.84%, -1.78% and -1.78% in normal-weight, overweight and obese patients, (P = 0.664; body weight decreased by 2.4%, 3.9% and 3.5%, respectively. FPG levels decreased similarly over time in all BMI groups (P = 0.461 and changes from baseline in high-density lipoprotein cholesterol (HDL-C and low-density lipoprotein cholesterol (LDL-C did not differ significantly among BMI groups at week 16 (P = 0.143 and 0.451, respectively.Baseline BMI had no impact on glycemic control, weight change or other efficacy measures with metformin monotherapy. These data suggest that normal-weight type 2 diabetes patients would derive the same benefits from first-line treatment with metformin as overweight and obese patients, and are not at increased risk of excess weight loss.ClinicalTrials.gov NCT00778622.
Venous and autonomic function in formerly pre-eclamptic women and BMI-matched controls.
Heidema, Wieteke M; van Drongelen, Joris; Spaanderman, Marc E A; Scholten, Ralph R
2018-03-25
Pre-pregnancy reduced plasma volume increases the risk on subsequent pre-eclamptic pregnancy. Reduced plasma volume is thought to reflect venous reserve capacity, especially when venous vasculature is constricted and sympathetic tone is elevated. As obesity might affect these variables and also relates to pre-eclampsia, increased body weight may underlie these observations. We hypothesized that the relationship between reduced venous reserve and preeclampsia is independent of body mass index (BMI). We compared the non-pregnant venous reserve capacity in 30 formerly pre-eclamptic women, equally divided in 3 BMI-classes (BMI 19.5-24.9, BMI 25-29.9, BMI ≥30) to 30 controls. Cases and controls were matched for BMI, age and parity. The venous reserve capacity was quantified by assessing plasma volume and venous compliance. The autonomic nervous system regulating the venous capacitance was evaluated with heart rate variability analysis in resting supine position and during positive head-up tilt (HUT). Formerly pre-eclamptic women had in supine position lower plasma volume than controls (1339 ± 79 vs 1547 ± 139 ml/m 2 (pBMI-matched controls, reduced venous reserve capacity. This is reflected by lower plasma volume and venous compliance, the autonomic balance is shifted towards sympathetic dominance and lower baroreceptor sensitivity. This suggests that not BMI, but underlying reduced venous reserve relates to pre-eclampsia. This article is protected by copyright. All rights reserved.
Zhang, Hui-Jie; Han, Peng; Sun, Su-Yun; Wang, Li-Ying; Yan, Bing; Zhang, Jin-Hua; Zhang, Wei; Yang, Shu-Yu; Li, Xue-Jun
2013-01-01
Obesity is related to hyperlipidemia and risk of cardiovascular disease. Health benefits of vegetarian diets have well-documented in the Western countries where both obesity and hyperlipidemia were prevalent. We studied the association between BMI and various lipid/lipoprotein measures, as well as between BMI and predicted coronary heart disease probability in lean, low risk populations in Southern China. The study included 170 Buddhist monks (vegetarians) and 126 omnivore men. Interaction between BMI and vegetarian status was tested in the multivariable regression analysis adjusting for age, education, smoking, alcohol drinking, and physical activity. Compared with omnivores, vegetarians had significantly lower mean BMI, blood pressures, total cholesterol, low density lipoprotein cholesterol, high density lipoprotein cholesterol, total cholesterol to high density lipoprotein ratio, triglycerides, apolipoprotein B and A-I, as well as lower predicted probability of coronary heart disease. Higher BMI was associated with unfavorable lipid/lipoprotein profile and predicted probability of coronary heart disease in both vegetarians and omnivores. However, the associations were significantly diminished in Buddhist vegetarians. Vegetarian diets not only lower BMI, but also attenuate the BMI-related increases of atherogenic lipid/ lipoprotein and the probability of coronary heart disease.
Lazzeri, Giacomo; Pammolli, Andrea; Pilato, Valentina; Giacchi, Mariano V
2011-07-19
Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES) of families in Tuscany. The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health) and consisted of 1,751 (922 males and 855 females) 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI) categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p parents' educational level and child obesity, the lowest educational level corresponding to the highest prevalence of obese children: 9.3% for mothers with a low educational level compared to 5.8% for mothers with a high educational level (p = 0.15); similarly, the corresponding prevalence for fathers was 9.5% compared to 4.5% (p = 0.03). Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.
PcG and trxG in plants - friends or foes.
Pu, Li; Sung, Zinmay Renee
2015-05-01
The highly-conserved Polycomb group (PcG) and trithorax group (trxG) proteins play major roles in regulating gene expression and maintaining developmental states in many organisms. However, neither the recruitment of Polycomb repressive complexes (PRC) nor the mechanisms of PcG and trxG-mediated gene silencing and activation are well understood. Recent progress in Arabidopsis research challenges the dominant model of PRC2-dependent recruitment of PRC1 to target genes. Moreover, evidence indicates that diverse forms of PRC1, with shared components, are a common theme in plants and mammals. Although trxG is known to antagonize PcG, emerging data reveal that trxG can also repress gene expression, acting cooperatively with PcG. We discuss these recent findings and highlight the employment of diverse epigenetic mechanisms during development in plants and animals. Copyright © 2015 Elsevier Ltd. All rights reserved.
Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity.
Lindinger, Peter W; Christe, Martine; Eberle, Alex N; Kern, Beatrice; Peterli, Ralph; Peters, Thomas; Jayawardene, Kamburapola J I; Fearnley, Ian M; Walker, John E
2015-09-01
Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender.
Grijalva‐Eternod, Carlos; Cortina‐Borja, Mario; Williams, Jane; Fewtrell, Mary; Wells, Jonathan
2016-01-01
ABSTRACT Objectives This study sets out to investigate the intergenerational associations between the body mass index (BMI) of parents and the body composition of their offspring. Methods The cross‐sectional data were analyzed for 511 parent–offspring trios from London and south‐east England. The offspring were aged 5–21 years. Parental BMI was obtained by recall and offspring fat mass and lean mass were obtained using the four‐component model. Multivariable regression analysis, with multiple imputation for missing paternal values was used. Sensitivity analyses for levels of non‐paternity were conducted. Results A positive association was seen between parental BMI and offspring BMI, fat mass index (FMI), and lean mass index (LMI). The mother's BMI was positively associated with the BMI, FMI, and LMI z‐scores of both daughters and sons and of a similar magnitude for both sexes. The father's BMI showed similar associations to the mother's BMI, with his son's BMI, FMI, and LMI z‐scores, but no association with his daughter. Sensitivity tests for non‐paternity showed that maternal coefficients remained greater than paternal coefficients throughout but there was no statistical difference at greater levels of non‐paternity. Conclusions We found variable associations between parental BMI and offspring body composition. Associations were generally stronger for maternal than paternal BMI, and paternal associations appeared to differ between sons and daughters. In this cohort, the mother's BMI was statistically significantly associated with her child's body composition but the father's BMI was only associated with the body composition of his sons. Am. J. Hum. Biol. 28:524–533, 2016. © 2016 The Authors American Journal of Human Biology Published by Wiley Periodicals, Inc. PMID:26848813
Protein Profiling Reveals Novel Proteins in Pollen and Pistil of W22 (ga1; Ga1 in Maize
Directory of Open Access Journals (Sweden)
Jin Yu
2014-05-01
Full Text Available Gametophytic factors mediate pollen-pistil interactions in maize (Zea mays L. and play active roles in limiting gene flow among maize populations and between maize and teosinte. This study was carried out to identify proteins and investigate the mechanism of gametophytic factors using protein analysis. W22 (ga1; which did not carry a gametophytic factor and W22 (Ga1, a near iso-genic line, were used for the proteome investigation. SDS-PAGE was executed to investigate proteins in the pollen and pistil of W22 (ga1 and W22 (Ga1. A total of 44 differentially expressed proteins were identified in the pollen and pistil on SDS-PAGE using LTQ-FTICR MS. Among the 44 proteins, a total of 24 proteins were identified in the pollen of W22 (ga1 and W22 (Ga1 whereas 20 differentially expressed proteins were identified from the pistil of W22 (ga1 and W22 (Ga1. However, in pollen, 2 proteins were identified only in the W22 (ga1 and 12 proteins only in the W22 (Ga1 whereas 10 proteins were confirmed from the both of W22 (ga1 and W22 (Ga1. In contrary, 10 proteins were appeared only in the pistil of W22 (ga1 and 7 proteins from W22 (Ga1 while 3 proteins confirmed in the both of W22 (ga1 and W22 (Ga1. Moreover, the identified proteins were generally involved in hydrolase activity, nucleic acid binding and nucleotide binding. These results help to reveal the mechanism of gametophytic factors and provide a valuable clue for the pollen and pistil research in maize.
Directory of Open Access Journals (Sweden)
Maike Wolters
Full Text Available The recent obesity epidemic in children also showed an increase in the prevalence of hypertension. As blood pressure (BP is associated with (long-chain polyunsaturated fatty acids (LC PUFA, genetic variation in desaturase enzymes being involved in the synthesis of LC PUFA may be associated with BP. This study aimed to investigate the direct effects (independent of mediating variables and indirect effects (mediated through intermediate variables of a common variant in the FADS1 gene, rs174546, known to affect delta-5 desaturase (D5D activity on PUFA level, body mass index (BMI and BP.A subsample of the IDEFICS (Identification and prevention of dietary- and lifestyle-induced health effects in children and infants baseline survey including 520 children aged 2 to <10 years from six European countries was included. The association between rs174546 (T
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan
Directory of Open Access Journals (Sweden)
Naho Morisaki
2017-09-01
Full Text Available Background: The Institute of Medicine (IOM guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM recommendations. Methods: We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005–2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0–18.4, 18.5–19.9, 20–22.9, 23–24.9, and 25–27.4 kg/m2, we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications using multivariate regression. Results: Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m2, and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m2. Conclusion: Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines.
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan.
Morisaki, Naho; Nagata, Chie; Jwa, Seung Chik; Sago, Haruhiko; Saito, Shigeru; Oken, Emily; Fujiwara, Takeo
2017-10-01
The Institute of Medicine (IOM) guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI) and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM) recommendations. We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005-2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0-18.4, 18.5-19.9, 20-22.9, 23-24.9, and 25-27.4 kg/m 2 ), we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications) using multivariate regression. Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks) for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m 2 , and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m 2 . Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m 2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Gurka, Matthew J; Filipp, Stephanie L; Musani, Solomon K; Sims, Mario; DeBoer, Mark D
2018-02-01
Estimates of adiposity in evaluating the metabolic syndrome (MetS) have traditionally utilized measures of waist circumference (WC), whereas body mass index (BMI) is more commonly used clinically. Our objective was to determine if a MetS severity Z-score employing BMI as its measure of adiposity (MetS-Z-BMI) would perform similarly to a WC-based score (MetS-Z-WC) in predicting future disease. To formulate the MetS-Z-BMI, we performed confirmatory factor analysis on a sex- and race/ethnicity-specific basis on MetS-related data for 6870 adult participants of the National Health and Nutrition Survey 1999-2010. We then validated this score and compared it to MetS-Z-WC in assessing correlations with future coronary heart disease (CHD) and Type 2 diabetes mellitus (T2DM) using Cox proportional hazard analysis of 13,094 participants of the Atherosclerosis Risk in Communities study and Jackson Heart Study. Loading factors, which represent the relative contribution of each component to the latent MetS factor, were lower for BMI than for WC in formulating the two respective scores (MetS-Z-BMI and MetS-Z-WC). Nevertheless, MetS-Z-BMI and MetS-Z-WC exhibited similar hazard ratios (HR) toward future disease. For each one standard-deviation-unit increase in MetS-Z-BMI, HR for CHD was 1.76 (95% confidence interval [CI]: 1.65, 1.88) and HR for T2DM was 3.39 (CI 3.16, 3.63) (both p BMI scores in their associations with future CHD and T2DM. A MetS severity Z-score utilizing BMI as its measure of adiposity operated similarly to a WC-based score in predicting future CHD and T2DM, suggesting overall similarity in MetS-based risk as estimated by both measures of adiposity. This indicates potential clinical usefulness of MetS-Z-BMI in assessing and following MetS-related risk over time. Copyright © 2018. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Mohd Masood
Full Text Available This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis.Data from the World Health Survey conducted in 2002-2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants' sex, age, marital-status, education, occupation, household-wealth and location(rural/urban at the individual-level. The country-level factors used were average national income (GNI-PPP and income inequality (Gini-index. A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome.The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84. All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased.Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects.
Reidpath, Daniel D.
2017-01-01
Background This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis. Methods Data from the World Health Survey conducted in 2002–2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants’ sex, age, marital-status, education, occupation, household-wealth and location(rural/urban) at the individual-level. The country-level factors used were average national income (GNI-PPP) and income inequality (Gini-index). A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome. Results The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84). All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased. Conclusion Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects. PMID:28662041
Correlation between physical activity measured by accelerometry and BMI in adolescents
Directory of Open Access Journals (Sweden)
Antonio Stabelini Neto
2013-03-01
The aim of this study was to investigate the correlation between physical activity measured by accelerometry and excess weight in schoolchildren. Three hundred and ninety one school-age adolescents (10 to 18 years old participated in the study. The cut-off points used to estimate time spent in physical activity were: moderate ≥3.0 METs and vigorous ≥6.0 METs. Student’s t-test and Pearson product-moment correlation coefficient were used to verify statistical differences and correlations between physical activity and body mass index (BMI. Statistical significance was set at p<0.05. Male schoolchildren spent more time in moderate (96.1 ± 39.6 min.day-1 and vigorous (9.7 ± 8.8 min.day-1 physical activity than their female peers (moderate: 73.7 ± 37.7 min.day-1; vigorous: 6.1 ± 6.8 min.day-1. For both sexes, younger schoolchildren (10 to 14 years old were more physically active than older ones (14 to 18 years old. Time spent in moderate-vigorous physical activity was inversely related to BMI. These findings suggest that regular physical activity (RPA is related to body weight reduction in schoolchildren. Therefore, RPA can be used as an obesity prevention strategy in elementary school.
The EED protein–protein interaction inhibitor A-395 inactivates the PRC2 complex
Energy Technology Data Exchange (ETDEWEB)
He, Yupeng; Selvaraju, Sujatha; Curtin, Michael L.; Jakob, Clarissa G.; Zhu, Haizhong; Comess, Kenneth M.; Shaw, Bailin; The, Juliana; Lima-Fernandes, Evelyne; Szewczyk, Magdalena M.; Cheng, Dong; Klinge, Kelly L.; Li, Huan-Qiu; Pliushchev, Marina; Algire, Mikkel A.; Maag, David; Guo, Jun; Dietrich, Justin; Panchal, Sanjay C.; Petros, Andrew M.; Sweis, Ramzi F.; Torrent, Maricel; Bigelow, Lance J.; Senisterra, Guillermo; Li, Fengling; Kennedy, Steven; Wu, Qin; Osterling, Donald J.; Lindley, David J.; Gao, Wenqing; Galasinski, Scott; Barsyte-Lovejoy, Dalia; Vedadi, Masoud; Buchanan, Fritz G.; Arrowsmith, Cheryl H.; Chiang, Gary G.; Sun, Chaohong; Pappano , William N. (AbbVie); (Toronto)
2017-01-30
Polycomb repressive complex 2 (PRC2) is a regulator of epigenetic states required for development and homeostasis. PRC2 trimethylates histone H3 at lysine 27 (H3K27me3), which leads to gene silencing, and is dysregulated in many cancers. The embryonic ectoderm development (EED) protein is an essential subunit of PRC2 that has both a scaffolding function and an H3K27me3-binding function. Here we report the identification of A-395, a potent antagonist of the H3K27me3 binding functions of EED. Structural studies demonstrate that A-395 binds to EED in the H3K27me3-binding pocket, thereby preventing allosteric activation of the catalytic activity of PRC2. Phenotypic effects observed in vitro and in vivo are similar to those of known PRC2 enzymatic inhibitors; however, A-395 retains potent activity against cell lines resistant to the catalytic inhibitors. A-395 represents a first-in-class antagonist of PRC2 protein–protein interactions (PPI) for use as a chemical probe to investigate the roles of EED-containing protein complexes.
Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.
Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A
2018-03-15
The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.
The impact of sleep-disordered breathing on body mass index (BMI: the sleep heart health study (SHHS
Directory of Open Access Journals (Sweden)
Robbins JA
2011-12-01
Full Text Available Introduction: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB. However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors.Methods: A full-montage unattended home polysomnogram (PSG and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI was categorized using clinical thresholds: < 5 (normal, ≥ 5 to <15 (mild sleep apnea, and ³ 15 (moderate to severe sleep apnea. Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates.Results: Mean (SD age was 62.2 years (10.14, 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD change of 0.53 (2.62 kg/m2 (p=0.071. A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m2 (p=0.055 and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m2 (p<0.001 compared to those with baseline AHI of <5.Conclusion: Our findings suggest that there is a positive association between severity of SDB and subsequent increased BMI over approximately 5 years. This observation may help explain why persons with SDB have difficulty losing weight.
van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.
2015-01-01
Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of
Is BMI a relevant marker of fat mass in 4 year old children? Results from the MINISTOP trial.
Delisle Nyström, Christine; Henriksson, Pontus; Ek, Anna; Henriksson, Hanna; Ortega, Francisco B; Ruiz, Jonatan R; Löf, Marie
2018-03-20
Due to the increase in childhood obesity, identifying children with excess body fat as early as possible is essential. Body mass index (BMI) is commonly used as a marker of body fat in children, adolescents, and adults, yet whether BMI is a valid marker of body fat in pre-school aged children remains to be confirmed. Therefore, we analyzed the associations of BMI with fat and fat-free mass in healthy 4-year-old Swedish children. The study comprised of 303 children (135 girls) participating in the MINISTOP obesity prevention trial. Fat and fat-free mass were measured using air displacement plethysmography and we computed fat mass index (FMI) and fat free mass index (FFMI) as fat and fat free mass (kg)/height 2 (m). BMI was positively yet weakly associated with percent fat mass (boys: r 2 = 0.120, P Children classified as normal weight had a wide range of percent fat mass (12.3 to 35.3%) and FMI (1.75 to 5.78 kg/m 2 ). BMI was strongly associated to both FMI and FFMI. Therefore, caution is needed when interpreting body fat status based on BMI values in pre-school children.
The impact of serum adropin and ischemia modified albumin levels based on BMI in PCOS.
Inal, Zeynep Ozturk; Erdem, Sami; Gederet, Yavuz; Duran, Cevdet; Kucukaydin, Zehra; Kurku, Huseyin; Sakarya, Derya Kilic
2018-02-21
The aim of this study was to evaluate the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on serum adropin and ischemia modified albumin (IMA) levels. This prospective cross-sectional study was performed with a total of 120 women [group1; non-PCOS = 60 (BMI PCOS = 60 (BMI PCOS and non-PCOS patients in the lean and overweight groups (pPCOS group were lower than in the lean non-PCOS group (pPCOS group than in the overweight non-PCOS group (pPCOS group than in the non-PCOS group in both the lean and overweight groups (pPCOS group, IMA levels increased. Further studies are needed to determine the effects of adropin and IMA in women with PCOS and to use a new marker to monitorize treatment outcomes.
Directory of Open Access Journals (Sweden)
Rutgers Bea
2010-05-01
Full Text Available Abstract Background Multidrug resistance-associated protein-1 (MRP1 protects against oxidative stress and toxic compounds generated by cigarette smoking, which is the main risk factor for chronic obstructive pulmonary disease (COPD. We have previously shown that single nucleotide polymorphisms (SNPs in MRP1 significantly associate with level of FEV1 in two independent population based cohorts. The aim of our study was to assess the associations of MRP1 SNPs with FEV1 level, MRP1 protein levels and inflammatory markers in bronchial biopsies and sputum of COPD patients. Methods Five SNPs (rs212093, rs4148382, rs504348, rs4781699, rs35621 in MRP1 were genotyped in 110 COPD patients. The effects of MRP1 SNPs were analyzed using linear regression models. Results One SNP, rs212093 was significantly associated with a higher FEV1 level and less airway wall inflammation. Another SNP, rs4148382 was significantly associated with a lower FEV1 level, higher number of inflammatory cells in induced sputum and with a higher MRP1 protein level in bronchial biopsies. Conclusions This is the first study linking MRP1 SNPs with lung function and inflammatory markers in COPD patients, suggesting a role of MRP1 SNPs in the severity of COPD in addition to their association with MRP1 protein level in bronchial biopsies.
Universal equation for estimating ideal body weight and body weight at any BMI.
Peterson, Courtney M; Thomas, Diana M; Blackburn, George L; Heymsfield, Steven B
2016-05-01
Ideal body weight (IBW) equations and body mass index (BMI) ranges have both been used to delineate healthy or normal weight ranges, although these 2 different approaches are at odds with each other. In particular, past IBW equations are misaligned with BMI values, and unlike BMI, the equations have failed to recognize that there is a range of ideal or target body weights. For the first time, to our knowledge, we merged the concepts of a linear IBW equation and of defining target body weights in terms of BMI. With the use of calculus and approximations, we derived an easy-to-use linear equation that clinicians can use to calculate both IBW and body weight at any target BMI value. We measured the empirical accuracy of the equation with the use of NHANES data and performed a comparative analysis with past IBW equations. Our linear equation allowed us to calculate body weights for any BMI and height with a mean empirical accuracy of 0.5-0.7% on the basis of NHANES data. Moreover, we showed that our body weight equation directly aligns with BMI values for both men and women, which avoids the overestimation and underestimation problems at the upper and lower ends of the height spectrum that have plagued past IBW equations. Our linear equation increases the sophistication of IBW equations by replacing them with a single universal equation that calculates both IBW and body weight at any target BMI and height. Therefore, our equation is compatible with BMI and can be applied with the use of mental math or a calculator without the need for an app, which makes it a useful tool for both health practitioners and the general public. © 2016 American Society for Nutrition.
Martínez-Calleja, América; Quiróz-Vargas, Irma; Parra-Rojas, Isela; Muñoz-Valle, José Francisco; Leyva-Vázquez, Marco A; Fernández-Tilapa, Gloria; Vences-Velázquez, Amalia; Cruz, Miguel; Salazar-Martínez, Eduardo; Flores-Alfaro, Eugenia
2012-01-01
We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP), type 2 diabetes (T2D), obesity, and risk score of coronary heart disease. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG) was associated with increased levels of CRP (β = 0.3; 95%CI: 0.1, 0.5; P = 0.005) and haplotype 7 (TGGG) with higher body mass index (BMI) (β = 0.2; 95%CI: 0.1, 0.3; P obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR.
Kearns, Karen; Dee, Anne; Fitzgerald, Anthony P; Doherty, Edel; Perry, Ivan J
2014-02-10
Overweight and obesity prevalence has risen dramatically in recent decades. While it is known that overweight and obesity is associated with a wide range of chronic diseases, the cumulative burden of chronic disease in the population associated with overweight and obesity is not well quantified. The aims of this paper were to examine the associations between BMI and chronic disease prevalence; to calculate Population Attributable Fractions (PAFs) associated with overweight and obesity; and to estimate the impact of a one unit reduction in BMI on the population prevalence of chronic disease. A cross-sectional analysis of 10,364 adults aged ≥18 years from the Republic of Ireland National Survey of Lifestyle, Attitudes and Nutrition (SLÁN 2007) was performed. Using binary regression, we examined the relationship between BMI and the selected chronic diseases. In further analyses, we calculated PAFs of selected chronic diseases attributable to overweight and obesity and we assessed the impact of a one unit reduction in BMI on the overall burden of chronic disease. Overweight and obesity prevalence was higher in men (43.0% and 16.1%) compared to women (29.2% and 13.4%), respectively. The most prevalent chronic conditions were lower back pain, hypertension, and raised cholesterol. Prevalence of chronic disease generally increased with increasing BMI. Compared to normal weight persons, the strongest associations were found in obese women for diabetes (RR 3.9, 95% CI 2.5-6.3), followed by hypertension (RR 2.9, 95% CI 2.3-3.6); and in obese men for hypertension (RR 2.1, 95% CI 1.6-2.7), followed by osteoarthritis (RR 2.0, 95% CI 1.2-3.2). Calculated PAFs indicated that a large proportion of chronic disease is attributable to increased BMI, most noticeably for diabetes in women (42%) and for hypertension in men (30%). Overall, a one unit decrease in BMI results in 26 and 28 fewer cases of chronic disease per 1,000 men and women, respectively. Overweight and obesity are
Msp1 Is a Membrane Protein Dislocase for Tail-Anchored Proteins.
Wohlever, Matthew L; Mateja, Agnieszka; McGilvray, Philip T; Day, Kasey J; Keenan, Robert J
2017-07-20
Mislocalized tail-anchored (TA) proteins of the outer mitochondrial membrane are cleared by a newly identified quality control pathway involving the conserved eukaryotic protein Msp1 (ATAD1 in humans). Msp1 is a transmembrane AAA-ATPase, but its role in TA protein clearance is not known. Here, using purified components reconstituted into proteoliposomes, we show that Msp1 is both necessary and sufficient to drive the ATP-dependent extraction of TA proteins from the membrane. A crystal structure of the Msp1 cytosolic region modeled into a ring hexamer suggests that active Msp1 contains a conserved membrane-facing surface adjacent to a central pore. Structure-guided mutagenesis of the pore residues shows that they are critical for TA protein extraction in vitro and for functional complementation of an msp1 deletion in yeast. Together, these data provide a molecular framework for Msp1-dependent extraction of mislocalized TA proteins from the outer mitochondrial membrane. Copyright © 2017 Elsevier Inc. All rights reserved.
Cost of fertility treatment and live birth outcome in women of different ages and BMI.
Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya
2014-10-10
What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent
2-Year BMI Changes of Children Referred for Multidisciplinary Weight Management
Directory of Open Access Journals (Sweden)
Jennifer K. Cheng
2014-01-01
Full Text Available Objective. To examine body mass index (BMI changes among pediatric multidisciplinary weight management participants and nonparticipants. Design. In this retrospective database analysis, we used multivariable mixed effect models to compare 2-year BMI z-score trajectories among 583 eligible overweight or obese children referred to the One Step Ahead program at the Boston Children’s Primary Care Center between 2003 and 2009. Results. Of the referred children, 338 (58% attended the program; 245 (42% did not participate and were instead followed by their primary care providers within the group practice. The mean BMI z-score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. The group-level difference in the rate of change in BMI z-score between participants and nonparticipants was statistically significant for 0–6 months (P=0.001 and 19–24 months (P=0.008; it was marginally significant for 13–18 months (P=0.051 after referral. Younger participants (<5 years had better outcomes across all time periods examined. Conclusion. Children attending a multidisciplinary program experienced greater BMI z-score reductions compared with usual primary care in a real world practice; younger participants had significantly better outcomes. Future research should consider early intervention and cost-effectiveness analyses.
Fitness differences according to BMI categories: a new point of view.
Lovecchio, Nicola; Zago, Matteo
2018-03-06
Many studies have reported negative association between fitness level and BMI categories but the lack of body weight correction and and the systematic use of physical endurance test made these differences controversial. Thus, the aim of this study was the assessment of physical fitness level associated to BMI using alternative tests. BMI was calculated as body mass/stature2 while fitness level was assessed using field test. In particular, Sit and Reach (SAR), Standing Broad Jump (SBJ), Shuttle Run Test 5mx 10 (SHR), Sit ups (SUP), Bent arm hang (BAH) were assessed in 2545 students. Subsequently, normal weight/overweight/obesity/underweight/thinness students were classified according to the cut-off points defined in literature and then the relative fitness results. The performances in SBJ showed very low differences between BMI categories such as for SUP test. The effects size in SHR were low or close to moderate while in BAH thin students revealed high performance than normal/overweight peers. In SAR test no clear trends in the BMI categories were observed. All test (exluding BAH) were similar for normal, overweight and thin students. This finding can be useful to teachers to encourage over/under-weighted students to adopt active life style because they are close to normal weight counterparts.
BMI and obesity incidence in relation to food patterns of Polish older people
DEFF Research Database (Denmark)
Wadolowska, L.; Danowska-Oziewicz, M.; Niedzwiedzka, E.
2006-01-01
BMI differentiation and obesity incidence in relation to food patterns of Polish older people were analysed. The research included 422 people aged 65+ years. 21 food patterns were separated by the factor analysis. On the basis of the self-reported body mass and height, the BMI and percentages...... of overweight or obese people were calculated. The increase of the BMI and overweight and obesity incidence for both sexes was unequivocally connected with eating rye. The increase of the BMI and overweight and obesity incidence depended among women on consuming pork meat and alcoholic beverages. For men...
Meta-analysis of genome-wide linkage studies in BMI and obesity
Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.
Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000
Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years
Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.
2013-01-01
Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605
Risk of a venous thromboembolic episode due to caesarean section and BMI
DEFF Research Database (Denmark)
Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S
2014-01-01
BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....
The Association between BMI and Different Frailty Domains: A U-Shaped Curve?
Rietman, M L; van der A, D L; van Oostrom, S H; Picavet, H S J; Dollé, M E T; van Steeg, H; Verschuren, W M M; Spijkerman, A M W
2018-01-01
Previous studies showed a U-shaped association between BMI and (physical) frailty. We studied the association between BMI and physical, cognitive, psychological, and social frailty. Furthermore, the overlap between and prevalence of these frailty domains was examined. Cross-sectional study. The Doetinchem Cohort Study is a longitudinal population-based study starting in 1987-1991 examining men and women aged 20-59 with follow-up examinations every 5 yrs. For the current analyses, we used data from round 5 (2008-2012) with 4019 participants aged 41-81 yrs. Physical frailty was defined as having ≥ 2 of 4 frailty criteria from the Frailty Phenotype (unintentional weight loss, exhaustion, physical activity, handgrip strength). Cognitive frailty was defined as the BMI was divided into four classes. Analyses were adjusted for sex, age, level of education, and smoking. A U-shaped association was observed between BMI and physical frailty, a small linear association for BMI and cognitive frailty and no association between BMI and psychological and social frailty. The four frailty domains showed only a small proportion of overlap. The prevalence of physical, cognitive and social frailty increased with age, whereas psychological frailty did not. We confirm that not only underweight but also obesity is associated with physical frailty. Obesity also seems to be associated with cognitive frailty. Further, frailty prevention should focus on multiple domains and target individuals at a younger age (<65yrs).
Tittl, L; Endig, S; Marten, S; Reitter, A; Beyer-Westendorf, I; Beyer-Westendorf, J
2018-03-14
Direct acting non-Vitamin K antagonist oral anticoagulants (NOAC) are characterized by a fixed dosing regimen. Despite the potential for relative underdosing due to large distribution volumes, dose adjustments for patients with high body mass index (BMI) are not recommended. Since efficacy and safety data in obese patients are scarce, we evaluated the impact of BMI on clinical outcomes in daily care patients treated with NOAC for stroke prevention in atrial fibrillation or venous thromboembolism. Using prospectively collected data from a non-interventional registry, cardiovascular (CV), major bleeding events (MB) and all-cause mortality were evaluated according to BMI classes. All outcome events were centrally adjudicated using standard scientific definitions. Between November 1st 2011 and December 31st 2016, 3432 patients were enrolled into the registry (61.3% rivaroxaban; 20% apixaban; 10.1% dabigatran, 8.6% edoxaban; mean follow-up 998.1 ± 542.9 days; median 1004 days). With increasing BMI (range 13.7-57.2 kg/m 2 ), the proportion of patients receiving standard (vs. reduced) NOAC dose increased from 64.7% (underweight) to 78.9% (obesity). Although obese patients had more cardiovascular risk factors compared to normal weight patients, on-treatment rates of clinical outcomes (CV, MB, all-cause-mortality) were lowest in overweight and obese patients. In a large set of real-life NOAC recipients we found no indication that high BMI is associated with inferior NOAC effectiveness or safety, which is in line with recent epidemiological data of a "BMI paradox" that indicates a somewhat protective effect of higher BMI regarding unfavourable outcomes also in patients receiving fixed dose NOAC anticoagulation without dose adjustment for higher BMI. Copyright © 2017. Published by Elsevier B.V.
Wilde, J.A. de; Dekker, M.; Middelkoop, B.J.
2018-01-01
Background: South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. Aim: To compare the BMI distribution of contemporary South Asian 0–20 year olds in the Netherlands with: (1) The
Increased genetic variance of BMI with a higher prevalence of obesity
DEFF Research Database (Denmark)
Rokholm, Benjamin; Silventoinen, Karri; Ängquist, Lars
2011-01-01
populations. Several recent studies suggest that the genetic effects on adiposity may be stronger when combined with presumed risk factors for obesity. We tested the hypothesis that a higher prevalence of obesity and overweight and a higher BMI mean is associated with a larger genetic variation in BMI....
Susanto, Hendri; Nesse, Willem; Dijkstra, Pieter U; Hoedemaker, Evelien; van Reenen, Yvonne Huijser; Agustina, Dewi; Vissink, Arjan; Abbas, Frank
2012-08-01
Periodontitis may exert an infectious and inflammatory burden, evidenced by increased C-reactive protein (CRP). This burden may impair blood glucose control (HbA1c). The aim of our study was to analyze whether periodontitis severity as measured with the periodontal inflamed surface area (PISA) and CRP predict HbA1c levels in a group of healthy Indonesians and a group of Indonesians treated for type 2 diabetes mellitus (DM2). A full-mouth periodontal examination, including probing pocket depth, gingival recession, clinical attachment loss, plaque index and bleeding on probing, was performed in 132 healthy Indonesians and 101 Indonesians treated for DM2. Using these data, PISA was calculated. In addition, HbA1c and CRP were analyzed. A validated questionnaire was used to assess smoking, body mass index (BMI), education and medical conditions. In regression analyses, it was assessed whether periodontitis severity and CRP predict HbA1c, controlling for confounding and effect modification (i.e., age, sex, BMI, pack years, and education). In healthy Indonesians, PISA and CRP predicted HbA1c as did age, sex, and smoking. In Indonesians treated for DM2, PISA did not predict HbA1c. Periodontitis may impair blood glucose regulation in healthy Indonesians in conjunction with elevated CRP levels. The potential effect of periodontitis on glucose control in DM2 patients may be masked by DM2 treatment. periodontitis may impair blood glucose control through exerting an inflammatory and infectious burden evidenced by increased levels of CRP.
Nilsen, Bente B; Yngve, Agneta; Werner, Bo
2018-02-06
This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.