Structural Basis of Polycomb Bodies

Czech Academy of Sciences Publication Activity Database

Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.

2014-01-01

Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014

A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription.

Science.gov (United States)

Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier

2012-05-01

Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.

A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

Science.gov (United States)

Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

2008-01-01

DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

Science.gov (United States)

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

2016-01-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

Directory of Open Access Journals (Sweden)

Frank Spaapen

Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 Recruits the POLYCOMB-REPRESSIVE COMPLEX1 Component LIKE HETEROCHROMATIN PROTEIN1 to GAGA DNA Motifs.

Science.gov (United States)

Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk

2015-07-01

Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.

Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

Science.gov (United States)

Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

2015-10-26

The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence

Directory of Open Access Journals (Sweden)

Zhanping Lu

2018-02-01

Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.

Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.

Science.gov (United States)

Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim

2018-01-01

HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.

One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation

Directory of Open Access Journals (Sweden)

Stefania del Prete

2015-07-01

Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.

Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

Science.gov (United States)

Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

2009-07-01

The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis

Directory of Open Access Journals (Sweden)

Jian Li

2017-05-01

Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.

Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

Science.gov (United States)

Lu, You-Wei; Li, Jin; Guo, Wei-Jian

2010-11-08

The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

NARCIS (Netherlands)

Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

2005-01-01

The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

Directory of Open Access Journals (Sweden)

James eReynolds

2015-03-01

Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

International Nuclear Information System (INIS)

Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

2012-01-01

Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

KAUST Repository

Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.

2012-01-01

Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

KAUST Repository

Lengsfeld, Bettina M.

2012-09-17

Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

Science.gov (United States)

Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

2017-12-15

The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis

NARCIS (Netherlands)

Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy

2015-01-01

Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Polycomb-like proteins link the PRC2 complex to CpG islands

Energy Technology Data Exchange (ETDEWEB)

Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin

2017-09-06

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.

SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex.

Science.gov (United States)

Soulez, M; Saurin, A J; Freemont, P S; Knight, J C

1999-04-29

Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

Directory of Open Access Journals (Sweden)

Katarzyna Taran

2016-02-01

Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

Science.gov (United States)

Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

2011-01-01

A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

Polycomb complexes and silencing mechanisms

DEFF Research Database (Denmark)

Lund, Anders H; van Lohuizen, Maarten

2004-01-01

Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

Energy Technology Data Exchange (ETDEWEB)

Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

2015-01-02

Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

OpenAIRE

Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

2008-01-01

DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

Directory of Open Access Journals (Sweden)

Bart A Westerman

Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

MK3 modulation affects BMI1-dependent and independent cell cycle check-points.

Directory of Open Access Journals (Sweden)

Peggy Prickaerts

Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.

Genome-Wide Identification of Polycomb Target Genes Reveals a Functional Association of Pho with Scm in Bombyx mori

OpenAIRE

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2012-01-01

Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...

Human Polycomb group EED protein negatively affects HIV-1 assembly and release

Directory of Open Access Journals (Sweden)

Darlix Jean-Luc

2007-06-01

Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic

A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

DEFF Research Database (Denmark)

Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

2011-01-01

to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

Expression and Clinicopathological Significance of Mel-18 and Bmi-1 in Esophageal Squamous Cell Carcinoma.

Science.gov (United States)

Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin

2017-01-01

The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.

batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

Science.gov (United States)

Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

2003-02-01

Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

A repetitive elements perspective in Polycomb epigenetics.

Directory of Open Access Journals (Sweden)

Valentina eCasa

2012-10-01

Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.

Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

Science.gov (United States)

Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

2010-12-16

Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription

DEFF Research Database (Denmark)

Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien

2012-01-01

site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...

Genome-wide analysis of Polycomb targets in Drosophila

Energy Technology Data Exchange (ETDEWEB)

Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo

2006-04-01

Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

Expression of Bmi-1 is a prognostic marker in bladder cancer

International Nuclear Information System (INIS)

Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

2009-01-01

The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

Directory of Open Access Journals (Sweden)

Mohamed Abdouh

Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila

Directory of Open Access Journals (Sweden)

Bernd Schuettengruber

2014-10-01

Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.

Expression of Bmi-1 is a prognostic marker in bladder cancer

Directory of Open Access Journals (Sweden)

Xu Li-Hua

2009-02-01

Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase

DEFF Research Database (Denmark)

Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra

2005-01-01

X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...

Switch-Like Roles for Polycomb Proteins from Neurodevelopment to Neurodegeneration

Directory of Open Access Journals (Sweden)

Anke Hoffmann

2017-12-01

Full Text Available Polycomb Group (PcG proteins are best-known for maintaining repressive or active chromatin states that are passed on across multiple cell divisions, and thus sustain long-term memory of gene expression. PcG proteins engage different, partly gene- and/or stage-specific, mechanisms to mediate spatiotemporal gene expression during central nervous system development. In the course of this, PcG proteins bind to various cis-regulatory sequences (e.g., promoters, enhancers or silencers and coordinate, as well the interactions between distantly separated genomic regions to control chromatin function at different scales ranging from compaction of the linear chromatin to the formation of topological hubs. Recent findings show that PcG proteins are involved in switch-like changes in gene expression states of selected neural genes during the transition from multipotent to differentiating cells, and then to mature neurons. Beyond neurodevelopment, PcG proteins sustain mature neuronal function and viability, and prevent progressive neurodegeneration in mice. In support of this view, neuropathological findings from human neurodegenerative diseases point to altered PcG functions. Overall, improved insight into the multiplicity of PcG functions may advance our understanding of human neurodegenerative diseases and ultimately pave the way to new therapies.

Polycomb group proteins in cell cycle progression and cancer

DEFF Research Database (Denmark)

Pasini, Diego; Bracken, Adrian P; Helin, Kristian

2004-01-01

Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...

The Polycomb Group Protein L3MBTL1 Represses a SMAD5-Mediated Hematopoietic Transcriptional Program in Human Pluripotent Stem Cells

Directory of Open Access Journals (Sweden)

Fabiana Perna

2015-04-01

Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.

Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

Science.gov (United States)

Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

2016-01-01

Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

Polycomb group (PcG) proteins and Pax6 cooperate to inhibit in vivo reprogramming of the developing Drosophila eye.

Science.gov (United States)

Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P

2018-04-04

How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.

Polycomb Protein OsFIE2 Affects Plant Height and Grain Yield in Rice.

Directory of Open Access Journals (Sweden)

Xianbo Liu

Full Text Available Polycomb group (PcG proteins have been shown to affect growth and development in plants. To further elucidate their role in these processes in rice, we isolated and characterized a rice mutant which exhibits dwarfism, reduced seed setting rate, defective floral organ, and small grains. Map-based cloning revealed that abnormal phenotypes were attributed to a mutation of the Fertilization Independent Endosperm 2 (OsFIE2 protein, which belongs to the PcG protein family. So we named the mutant as osfie2-1. Histological analysis revealed that the number of longitudinal cells in the internodes decreased in osfie2-1, and that lateral cell layer of the internodes was markedly thinner than wild-type. In addition, compared to wild-type, the number of large and small vascular bundles decreased in osfie2-1, as well as cell number and cell size in spikelet hulls. OsFIE2 is expressed in most tissues and the coded protein localizes in both nucleus and cytoplasm. Yeast two-hybrid and bimolecular fluorescence complementation assays demonstrated that OsFIE2 interacts with OsiEZ1 which encodes an enhancer of zeste protein previously identified as a histone methylation enzyme. RNA sequencing-based transcriptome profiling and qRT-PCR analysis revealed that some homeotic genes and genes involved in endosperm starch synthesis, cell division/expansion and hormone synthesis and signaling are differentially expressed between osfie2-1 and wild-type. In addition, the contents of IAA, GA3, ABA, JA and SA in osfie2-1 are significantly different from those in wild-type. Taken together, these results indicate that OsFIE2 plays an important role in the regulation of plant height and grain yield in rice.

Rybp, a polycomb complex-associated protein, is required for mouse eye development

Directory of Open Access Journals (Sweden)

Schreiber-Agus Nicole

2007-04-01

Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.

Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

Directory of Open Access Journals (Sweden)

Anthony Flamier

2018-05-01

Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

The Role of BMI1 in CRPC

Science.gov (United States)

2016-10-01

we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

Science.gov (United States)

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2012-01-01

Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

Directory of Open Access Journals (Sweden)

Zhiqing Li

Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

International Nuclear Information System (INIS)

Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

2010-01-01

Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

Control of flowering and cell fate by LIF2, an RNA binding partner of the polycomb complex component LHP1.

Directory of Open Access Journals (Sweden)

David Latrasse

Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA

Alternative epigenetic chromatin states of polycomb target genes.

Directory of Open Access Journals (Sweden)

Yuri B Schwartz

2010-01-01

Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.

Polycomb proteins control proliferation and transformation independently of cell cycle checkpoints by regulating DNA replication

DEFF Research Database (Denmark)

Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora

2014-01-01

The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...

REST-mediated recruitment of polycomb repressor complexes in mammalian cells

DEFF Research Database (Denmark)

Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild

2012-01-01

Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...

A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma

Science.gov (United States)

Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.

2016-01-01

Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505

A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma.

Science.gov (United States)

Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M

2016-09-20

Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.

Clarifying the impact of polycomb complex component disruption in human cancers.

Science.gov (United States)

Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko

2014-04-01

The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.

Polycomb complexes act redundantly to repress genomic repeats and genes

DEFF Research Database (Denmark)

Leeb, Martin; Pasini, Diego; Novatchkova, Maria

2010-01-01

Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...

The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

Directory of Open Access Journals (Sweden)

Yoshikawa Reigetsu

2012-10-01

Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

Directory of Open Access Journals (Sweden)

Lowell Evan Michael

2008-12-01

Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

KDM2B recruitment of the Polycomb group complex, PRC1.1, requires cooperation between PCGF1 and BCORL1

OpenAIRE

Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.

2016-01-01

KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...

Polycomb Cbx family members mediate the balance between haematopoietic stem cell self-renewal and differentiation

DEFF Research Database (Denmark)

Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde

2013-01-01

The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...

Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing

Science.gov (United States)

Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.

2014-01-01

Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119

BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

Science.gov (United States)

Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

2006-01-01

Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

Science.gov (United States)

Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

2011-11-01

A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

Science.gov (United States)

Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

2011-01-01

A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila

DEFF Research Database (Denmark)

Bantignies, Frédéric; Roure, Virginie; Comet, Itys

2011-01-01

In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...

Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

Directory of Open Access Journals (Sweden)

Amanda Swain

2016-09-01

Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

Analysis list: BMI1 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

Science.gov (United States)

Liu, Jiaguo; Luo, Bin; Zhao, Meng

2017-01-01

Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

Directory of Open Access Journals (Sweden)

Catherine Creppe

2014-12-01

Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene.

Science.gov (United States)

Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A

2010-06-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.

Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

Science.gov (United States)

Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

2010-01-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181

An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

Science.gov (United States)

Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

2016-07-21

Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

Ruled by Ubiquitylation: A New Order for Polycomb Recruitment

Directory of Open Access Journals (Sweden)

Yuri B. Schwartz

2014-07-01

Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.

Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2

DEFF Research Database (Denmark)

Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth

2016-01-01

crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....

Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer.

Science.gov (United States)

Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís

2013-08-12

IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.

Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

Science.gov (United States)

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2013-01-01

Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

Altered expression of polycomb group genes in glioblastoma multiforme.

Directory of Open Access Journals (Sweden)

Gang Li

Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.

BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

Science.gov (United States)

Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

2018-02-01

B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.

Directory of Open Access Journals (Sweden)

Ian J Majewski

2008-04-01

Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.

Pluripotency factors and Polycomb Group proteins repress aryl hydrocarbon receptor expression in murine embryonic stem cells

Directory of Open Access Journals (Sweden)

Chia-I Ko

2014-01-01

Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.

Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

OpenAIRE

Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

2011-01-01

The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...

Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

Science.gov (United States)

Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

2017-09-01

The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

Directory of Open Access Journals (Sweden)

Erik Södersten

2014-09-01

Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

PRC1 Prevents Replication Stress during Chondrogenic Transit Amplification

Directory of Open Access Journals (Sweden)

Frank Spaapen

2017-12-01

Full Text Available Transit amplification (TA, a state of combined, rapid proliferative expansion and differentiation of stem cell-descendants, remains poorly defined at the molecular level. The Polycomb Repressive Complex 1 (PRC1 protein BMI1 has been localized to TA compartments, yet its exact role in TA is unclear. PRC1 proteins control gene expression, cell proliferation and DNA-damage repair. Coordination of such DNA-templated activities during TA is predicted to be crucial to support DNA replication and differentiation-associated transcriptional programming. We here examined whether chondrogenesis provides a relevant biological context for synchronized coordination of these chromatin-based tasks by BMI1. Taking advantage of a prominently featuring TA-phase during chondrogenesis in vitro and in vivo, we here report that TA is completely dependent on intact PRC1 function. BMI1-depleted chondrogenic progenitors rapidly accumulate double strand DNA breaks during DNA replication, present massive non-H3K27me3-directed transcriptional deregulation and fail to undergo chondrogenic TA. Genome-wide accumulation of Topoisomerase 2α and Geminin suggests a model in which PRC1 synchronizes replication and transcription during rapid chondrogenic progenitor expansion. Our combined data reveals for the first time a vital cell-autonomous role for PRC1 during chondrogenesis. We provide evidence that chondrocyte hyper-replication and hypertrophy represent a unique example of programmed senescence in vivo. These findings provide new perspectives on PRC1 function in development and disease.

Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes

DEFF Research Database (Denmark)

Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung

2010-01-01

Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...

The MAP kinase ERK and its scaffold protein MP1 interact with the chromatin regulator Corto during Drosophila wing tissue development

Science.gov (United States)

2011-01-01

Background Mitogen-activated protein kinase (MAPK) cascades (p38, JNK, ERK pathways) are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Results Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK) in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Conclusions Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling. PMID:21401930

The MAP kinase ERK and its scaffold protein MP1 interact with the chromatin regulator Corto during Drosophila wing tissue development.

Science.gov (United States)

Mouchel-Vielh, Emmanuèle; Rougeot, Julien; Decoville, Martine; Peronnet, Frédérique

2011-03-14

Mitogen-activated protein kinase (MAPK) cascades (p38, JNK, ERK pathways) are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK) in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.

The MAP kinase ERK and its scaffold protein MP1 interact with the chromatin regulator Corto during Drosophila wing tissue development

Directory of Open Access Journals (Sweden)

Peronnet Frédérique

2011-03-01

Full Text Available Abstract Background Mitogen-activated protein kinase (MAPK cascades (p38, JNK, ERK pathways are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Results Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Conclusions Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.

Polycomb Group Protein Displacement and Gene Activation through MSK-Dependent H3K27me3S28 Phosphorylation

DEFF Research Database (Denmark)

Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj

2010-01-01

Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Bmi-1 Regulates Extensive Erythroid Self-Renewal

Directory of Open Access Journals (Sweden)

Ah Ram Kim

2015-06-01

Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

CD133 and BMI1 expressions and its prognostic role in primary ...

Indian Academy of Sciences (India)

This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.

Science.gov (United States)

Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J

2011-04-01

The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

Science.gov (United States)

Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

2011-01-01

The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

OpenAIRE

Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

2010-01-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...

Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

International Nuclear Information System (INIS)

Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

2012-01-01

The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

Directory of Open Access Journals (Sweden)

Jiang Lili

2012-09-01

Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

Transcription factors AS1 and AS2 interact with LHP1 to repress KNOX genes in Arabidopsis.

Science.gov (United States)

Li, Zhongfei; Li, Bin; Liu, Jian; Guo, Zhihao; Liu, Yuhao; Li, Yan; Shen, Wen-Hui; Huang, Ying; Huang, Hai; Zhang, Yijing; Dong, Aiwu

2016-12-01

Polycomb group proteins are important repressors of numerous genes in higher eukaryotes. However, the mechanism by which Polycomb group proteins are recruited to specific genes is poorly understood. In Arabidopsis, LIKE HETEROCHROMATIN PROTEIN 1 (LHP1), also known as TERMINAL FLOWER 2, was originally proposed as a subunit of polycomb repressive complex 1 (PRC1) that could bind the tri-methylated lysine 27 of histone H3 (H3K27me3) established by the PRC2. In this work, we show that LHP1 mainly functions with PRC2 to establish H3K27me3, but not with PRC1 to catalyze monoubiquitination at lysine 119 of histone H2A. Our results show that complexes of the transcription factors ASYMMETRIC LEAVES 1 (AS1) and AS2 could help to establish the H3K27me3 modification at the chromatin regions of Class-I KNOTTED1-like homeobox (KNOX) genes BREVIPEDICELLUS and KNAT2 via direct interactions with LHP1. Additionally, our transcriptome analysis indicated that there are probably more common target genes of AS1 and LHP1 besides Class-I KNOX genes during leaf development in Arabidopsis. © 2016 Institute of Botany, Chinese Academy of Sciences.

Bmi-1 expression modulates non-small cell lung cancer progression

Science.gov (United States)

Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

2015-01-01

Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

International Nuclear Information System (INIS)

Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

2014-01-01

Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

KDM2B Recruitment of the Polycomb Group Complex, PRC1.1, Requires Cooperation between PCGF1 and BCORL1.

Science.gov (United States)

Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A

2016-10-04

KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Additional sex combs-like 1 belongs to the enhancer of trithorax and Polycomb Group and genetically interacts with Cbx2 in mice

Science.gov (United States)

Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.

2009-01-01

The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123

B lymphoma Moloney murine leukemia virus insertion region 1: An oncogenic mediator in prostate cancer.

Science.gov (United States)

Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi

2018-06-01

B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.

Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

NARCIS (Netherlands)

Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

2008-01-01

Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

[In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

Science.gov (United States)

Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

2018-03-28

To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

Science.gov (United States)

Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

2016-01-01

Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

Science.gov (United States)

Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

2010-02-21

The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.

Science.gov (United States)

Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen

2010-10-01

Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

Science.gov (United States)

Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

2014-01-01

Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

BMI and BMI SDS in childhood: annual increments and conditional change

OpenAIRE

Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

2016-01-01

Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

Science.gov (United States)

Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

2018-02-01

Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

Directory of Open Access Journals (Sweden)

Xiaodong Li

2016-11-01

Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

PPARγ gene polymorphism, C-reactive protein level, BMI and periodontitis in post-menopausal Japanese women.

Science.gov (United States)

Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa

2016-03-01

Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.

BMI and BMI SDS in childhood: annual increments and conditional change.

Science.gov (United States)

Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

2017-02-01

Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

Science.gov (United States)

Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

2017-03-01

Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

2012-08-24

Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

Directory of Open Access Journals (Sweden)

Sara Badodi

2017-12-01

Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

How Polycomb-Mediated Cell Memory Deals With a Changing Environment

KAUST Repository

Marasca, Federica

2018-03-09

Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

How Polycomb-Mediated Cell Memory Deals With a Changing Environment

KAUST Repository

Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

2018-01-01

Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

Science.gov (United States)

Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

Science.gov (United States)

Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

2017-05-01

We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

Science.gov (United States)

Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

2012-01-01

Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

Science.gov (United States)

2011-09-01

new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

Science.gov (United States)

Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

2017-12-01

Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

Science.gov (United States)

Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

2015-01-01

Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

Polycomb enables primitive endoderm lineage priming in embryonic stem cells

DEFF Research Database (Denmark)

Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V

2016-01-01

Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....

Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway

International Nuclear Information System (INIS)

Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru

2004-01-01

Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general

Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

Science.gov (United States)

Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

2017-04-01

We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Polycomb repression complex 2 is required for the maintenance of retinal progenitor cells and balanced retinal differentiation

Czech Academy of Sciences Publication Activity Database

Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk

2018-01-01

Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016

Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster

OpenAIRE

Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.

1994-01-01

The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...

About BMI for Adults

Science.gov (United States)

... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.

Science.gov (United States)

Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E

2018-03-13

The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

An Automatic Segmentation Method Combining an Active Contour Model and a Classification Technique for Detecting Polycomb-group Proteinsin High-Throughput Microscopy Images.

Science.gov (United States)

Gregoretti, Francesco; Cesarini, Elisa; Lanzuolo, Chiara; Oliva, Gennaro; Antonelli, Laura

2016-01-01

The large amount of data generated in biological experiments that rely on advanced microscopy can be handled only with automated image analysis. Most analyses require a reliable cell image segmentation eventually capable of detecting subcellular structures.We present an automatic segmentation method to detect Polycomb group (PcG) proteins areas isolated from nuclei regions in high-resolution fluorescent cell image stacks. It combines two segmentation algorithms that use an active contour model and a classification technique serving as a tool to better understand the subcellular three-dimensional distribution of PcG proteins in live cell image sequences. We obtained accurate results throughout several cell image datasets, coming from different cell types and corresponding to different fluorescent labels, without requiring elaborate adjustments to each dataset.

Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

International Nuclear Information System (INIS)

Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

2009-01-01

Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

BMI was found to be a consistent determinant related to misreporting of energy, protein and potassium intake using self-report and duplicate portion methods.

Science.gov (United States)

Trijsburg, Laura; Geelen, Anouk; Hollman, Peter Ch; Hulshof, Paul Jm; Feskens, Edith Jm; Van't Veer, Pieter; Boshuizen, Hendriek C; de Vries, Jeanne Hm

2017-03-01

As misreporting, mostly under-reporting, of dietary intake is a generally known problem in nutritional research, we aimed to analyse the association between selected determinants and the extent of misreporting by the duplicate portion method (DP), 24 h recall (24hR) and FFQ by linear regression analysis using the biomarker values as unbiased estimates. For each individual, two DP, two 24hR, two FFQ and two 24 h urinary biomarkers were collected within 1·5 years. Also, for sixty-nine individuals one or two doubly labelled water measurements were obtained. The associations of basic determinants (BMI, gender, age and level of education) with misreporting of energy, protein and K intake of the DP, 24hR and FFQ were evaluated using linear regression analysis. Additionally, associations between other determinants, such as physical activity and smoking habits, and misreporting were investigated. The Netherlands. One hundred and ninety-seven individuals aged 20-70 years. Higher BMI was associated with under-reporting of dietary intake assessed by the different dietary assessment methods for energy, protein and K, except for K by DP. Men tended to under-report protein by the DP, FFQ and 24hR, and persons of older age under-reported K but only by the 24hR and FFQ. When adjusted for the basic determinants, the other determinants did not show a consistent association with misreporting of energy or nutrients and by the different dietary assessment methods. As BMI was the only consistent determinant of misreporting, we conclude that BMI should always be taken into account when assessing and correcting dietary intake.

Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

Science.gov (United States)

Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

2018-03-01

The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

Science.gov (United States)

Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

2014-01-01

To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

Science.gov (United States)

Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

2018-02-01

Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

MUC1-C activates polycomb repressive complexes and downregulates tumor suppressor genes in human cancer cells.

Science.gov (United States)

Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald

2018-04-01

The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.

Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

Science.gov (United States)

Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

2017-10-06

We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

Science.gov (United States)

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

Science.gov (United States)

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

2016-01-07

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

How Polycomb-Mediated Cell Memory Deals With a Changing Environment: Variations in PcG complexes and proteins assortment convey plasticity to epigenetic regulation as a response to environment.

Science.gov (United States)

Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

2018-04-01

Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment. © 2018 The Authors. BioEssays Published by WILEY Periodicals, Inc.

The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT

International Nuclear Information System (INIS)

Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng

2011-01-01

Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)

Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

Science.gov (United States)

2011-01-01

Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

Polycomb domain formation depends on short and long distance regulatory cues.

Directory of Open Access Journals (Sweden)

Bernd Schuettengruber

Full Text Available BACKGROUND: Polycomb group (PcG proteins dynamically define cellular identities through the epigenetic repression of key developmental genes. In Drosophila, cis-regulatory regions termed PcG response elements (PREs act as nucleation sites for PcG proteins to create large repressive PcG domains that are marked by trimethylation of lysine 27 on histone H3 (H3K27me3. In addition to an action in cis, PREs can interact over long distances, thereby enhancing PcG dependent silencing. How PcG domains are established, which factors limit their propagation in cis, and how long range interactions of PREs in trans affect the chromatin structure is largely unknown. PRINCIPAL FINDINGS: We demonstrate that the insertion of a PRE-containing transgene in the Drosophila genome generates an artificial PcG domain and we analyze its organization by quantitative ChIP and ChIP-on-chip experiments. Intriguingly, a boundary element and known insulator proteins do not necessarily interfere with spreading of H3K27me3. Instead, domain borders correlate with the presence of promoter regions bound by RNA Polymerase II and active chromatin marks. In contrast, genes that are silent during early fly development get included within the PcG domain and this incorporation interferes with gene activation at later developmental stages. Moreover, trans-interaction of the transgenic PRE with its homologous endogenous PRE results in increased PcG binding, correlating with reinforced silencing of genes within the domain borders. CONCLUSIONS: Our results suggest that higher-order organization of PcG-bound chromatin can stabilize gene silencing within PcG domains. Further we propose that multi-protein complexes associated with active promoters are able to define the limits of PcG domains. Future work aimed to pinpoint the factors providing this barrier function will be required to understand the precise molecular mechanism by which active promoter regions can act as boundaries to stop

Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

International Nuclear Information System (INIS)

Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

2008-01-01

Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

Origin of the polycomb repressive complex 2 and gene silencing by an E(z) homolog in the unicellular alga Chlamydomonas.

Science.gov (United States)

Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto

2010-05-16

Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.

BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

Science.gov (United States)

Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

2016-01-01

Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

Science.gov (United States)

Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

2018-01-01

Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

Science.gov (United States)

Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

2017-05-01

Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

Fuel shipment experience, fuel movements from the BMI-1 transport cask

International Nuclear Information System (INIS)

Bauer, Thomas L.; Krause, Michael G.

1986-01-01

The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

GSK126 (EZH2 inhibitor) interferes with ultraviolet A radiation-induced photoaging of human skin fibroblast cells

Science.gov (United States)

Qin, Haiyan; Zhang, Guang; Zhang, Lianbo

2018-01-01

Polycomb group genes (PcG) encode chromatin modification proteins that are involved in the epigenetic regulation of cell differentiation, proliferation and the aging processes. The key subunit of the PcG complex, enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), has a central role in a variety of mechanisms, such as the formation of chromatin structure, gene expression regulation and DNA damage. In the present study, ultraviolet A (UVA) was used to radiate human dermal fibroblasts in order to construct a photo-aged cell model. Subsequently, the cell viability assay, Hoechst staining, apoptosis detection using flow cytometry, senescence-associated β-galactosidase (SA-β-gal) staining and erythrocyte exclusion experiments were performed. GSK126, a histone methylation enzyme inhibitor of EZH2, was used as an experimental factor. Results suggested that GSK126 downregulated the mRNA expression levels of EZH2 and upregulated the mRNA expression levels of BMI-1. Notably, GSK126 affected the transcription of various photoaging-related genes and thus protected against photoaging induced by UVA radiation. PMID:29545866

Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

Science.gov (United States)

Noahsen, Paneeraq; Andersen, Stig

2013-01-01

To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

Science.gov (United States)

Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

2015-01-01

To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

International Nuclear Information System (INIS)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-01

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

Histone H3 Serine 28 Is Essential for Efficient Polycomb-Mediated Gene Repression in Drosophila

Directory of Open Access Journals (Sweden)

Philip Yuk Kwong Yung

2015-06-01

Full Text Available Trimethylation at histone H3K27 is central to the polycomb repression system. Juxtaposed to H3K27 is a widely conserved phosphorylatable serine residue (H3S28 whose function is unclear. To assess the importance of H3S28, we generated a Drosophila H3 histone mutant with a serine-to-alanine mutation at position 28. H3S28A mutant cells lack H3S28ph on mitotic chromosomes but support normal mitosis. Strikingly, all methylation states of H3K27 drop in H3S28A cells, leading to Hox gene derepression and to homeotic transformations in adult tissues. These defects are not caused by active H3K27 demethylation nor by the loss of H3S28ph. Biochemical assays show that H3S28A nucleosomes are a suboptimal substrate for PRC2, suggesting that the unphosphorylated state of serine 28 is important for assisting in the function of polycomb complexes. Collectively, our data indicate that the conserved H3S28 residue in metazoans has a role in supporting PRC2 catalysis.

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

NARCIS (Netherlands)

Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

Polycomb-group genes sustaining the stem cell activity

International Nuclear Information System (INIS)

Takihara, Yoshihiro

2006-01-01

Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

An H3K9/S10 methyl-phospho switch modulates Polycomb and Pol II binding at repressed genes during differentiation.

Science.gov (United States)

Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall

2014-03-01

Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

Science.gov (United States)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-22

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

Science.gov (United States)

Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

2018-03-01

Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

Science.gov (United States)

Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

2015-01-01

Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

Science.gov (United States)

Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

2018-01-01

Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

Science.gov (United States)

Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

2016-09-06

Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

Directory of Open Access Journals (Sweden)

Hourinaz Behesti

2013-01-01

BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer

Science.gov (United States)

2013-07-01

J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

CBX7 regulates stem cell-like properties of gastric cancer cells via p16 and AKT-NF-κB-miR-21 pathways.

Science.gov (United States)

Ni, Su-Jie; Zhao, Li-Qin; Wang, Xiao-Feng; Wu, Zhen-Hua; Hua, Rui-Xi; Wan, Chun-Hua; Zhang, Jie-Yun; Zhang, Xiao-Wei; Huang, Ming-Zhu; Gan, Lu; Sun, Hua-Lin; Dimri, Goberdhan P; Guo, Wei-Jian

2018-02-08

Chromobox protein homolog 7 (CBX7), a member of the polycomb group (PcG) family of proteins, is involved in the regulation of cell proliferation and cancer progression. PcG family members, such as BMI, Mel-18, and EZH2, are integral constituents of the polycomb repressive complexes (PRCs) and have been known to regulate cancer stem cell (CSC) phenotype. However, the role of other PRCs' constituents such as CBX7 in the regulation of CSC phenotype remains largely elusive. This study was to investigate the role of CBX7 in regulating stem cell-like properties of gastric cancer and the underlying mechanisms. Firstly, the role of CBX7 in regulating stem cell-like properties of gastric cancer was investigated using sphere formation, Western blot, and xenograft tumor assays. Next, RNA interference and ectopic CBX7 expression were employed to determine the impact of CBX7 on the expression of CSC marker proteins and CSC characteristics. The expression of CBX7, its downstream targets, and stem cell markers were analyzed in gastric stem cell spheres, common cancer cells, and gastric cancer tissues. Finally, the pathways by which CBX7 regulates stem cell-like properties of gastric cancer were explored. We found that CBX7, a constituent of the polycomb repressive complex 1 (PRC1), plays an important role in maintaining stem cell-like characteristics of gastric cancer cells via the activation of AKT pathway and the downregulation of p16. Spearman rank correlation analysis showed positive correlations among the expression of CBX7 and phospho-AKT (pAKT), stem cell markers OCT-4, and CD133 in gastric cancer tissues. In addition, CBX7 was found to upregulate microRNA-21 (miR-21) via the activation of AKT-NF-κB pathway, and miR-21 contributes to CBX7-mediated CSC characteristics. CBX7 positively regulates stem cell-like characteristics of gastric cancer cells by inhibiting p16 and activating AKT-NF-κB-miR-21 pathway.

Prospective associations between sedentary lifestyle and BMI in midlife.

Science.gov (United States)

Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

2006-08-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

Science.gov (United States)

Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

2015-01-01

Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

Relationship of glycemic and triglycerides with BMI in diabetic patients

International Nuclear Information System (INIS)

Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.

2010-01-01

Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

Relationship of glycemic and triglycerides with BMI in diabetic patients

Energy Technology Data Exchange (ETDEWEB)

Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology

2010-04-15

Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

Science.gov (United States)

López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

2015-01-01

Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

RYBP Is a K63-Ubiquitin-Chain-Binding Protein that Inhibits Homologous Recombination Repair

Directory of Open Access Journals (Sweden)

Mohammad A.M. Ali

2018-01-01

Full Text Available Summary: Ring1-YY1-binding protein (RYBP is a member of the non-canonical polycomb repressive complex 1 (PRC1, and like other PRC1 members, it is best described as a transcriptional regulator. However, several PRC1 members were recently shown to function in DNA repair. Here, we report that RYBP preferentially binds K63-ubiquitin chains via its Npl4 zinc finger (NZF domain. Since K63-linked ubiquitin chains are assembled at DNA double-strand breaks (DSBs, we examined the contribution of RYBP to DSB repair. Surprisingly, we find that RYBP is K48 polyubiquitylated by RNF8 and rapidly removed from chromatin upon DNA damage by the VCP/p97 segregase. High expression of RYBP competitively inhibits recruitment of BRCA1 repair complex to DSBs, reducing DNA end resection and homologous recombination (HR repair. Moreover, breast cancer cell lines expressing high endogenous RYBP levels show increased sensitivity to DNA-damaging agents and poly ADP-ribose polymerase (PARP inhibition. These data suggest that RYBP negatively regulates HR repair by competing for K63-ubiquitin chain binding. : Ali et al. find that RYBP binds K63-linked ubiquitin chains and is removed from DNA damage sites. This K63-ubiquitin binding allows RYBP to hinder the recruitment of BRCA1 and Rad51 to DNA double-strand breaks, thus inhibiting homologous recombination repair. Accordingly, cancer cells expressing high RYBP are more sensitive to DNA-damaging therapies. Keywords: DNA damage response, homologous recombination, ubiquitylation, RYBP, polycomb proteins, double-strand break repair, chromatin, histone modification

Polycomb-group histone methyltransferase CLF is required for proper somatic recombination in Arabidopsis

Institute of Scientific and Technical Information of China (English)

Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu

2014-01-01

Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

International Nuclear Information System (INIS)

Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

2012-01-01

Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

Neurodevelopmental problems and extremes in BMI

Directory of Open Access Journals (Sweden)

Nóra Kerekes

2015-07-01

Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

Proteome-wide analysis of protein abundance and turnover remodelling during oncogenic transformation of human breast epithelial cells [version 1; referees: 2 approved, 1 approved with reservations

Directory of Open Access Journals (Sweden)

Tony Ly

2018-05-01

Full Text Available Background: Viral oncogenes and mutated proto-oncogenes are potent drivers of cancer malignancy. Downstream of the oncogenic trigger are alterations in protein properties that give rise to cellular transformation and the acquisition of malignant cellular phenotypes. Developments in mass spectrometry enable large-scale, multidimensional characterisation of proteomes. Such techniques could provide an unprecedented, unbiased view of how oncogene activation remodels a human cell proteome. Methods: Using quantitative MS-based proteomics and cellular assays, we analysed how transformation induced by activating v-Src kinase remodels the proteome and cellular phenotypes of breast epithelial (MCF10A cells. SILAC MS was used to comprehensively characterise the MCF10A proteome and to measure v-Src-induced changes in protein abundance across seven time-points (1-72 hrs. We used pulse-SILAC MS (Boisvert et al., 2012, to compare protein synthesis and turnover in control and transformed cells. Follow-on experiments employed a combination of cellular and functional assays to characterise the roles of selected Src-responsive proteins. Results: Src-induced transformation changed the expression and/or turnover levels of ~3% of proteins, affecting ~1.5% of the total protein molecules in the cell. Transformation increased the average rate of proteome turnover and disrupted protein homeostasis. We identify distinct classes of protein kinetics in response to Src activation. We demonstrate that members of the polycomb repressive complex 1 (PRC1 are important regulators of invasion and migration in MCF10A cells. Many Src-regulated proteins are present in low abundance and some are regulated post-transcriptionally. The signature of Src-responsive proteins is highly predictive of poor patient survival across multiple cancer types. Open access to search and interactively explore all these proteomic data is provided via the EPD database (www.peptracker.com/epd. Conclusions

From Flies to Mice: The Emerging Role of Non-Canonical PRC1 Members in Mammalian Development

Directory of Open Access Journals (Sweden)

Izabella Bajusz

2018-02-01

Full Text Available Originally two types of Polycomb Repressive Complexes (PRCs were described, canonical PRC1 (cPRC1 and PRC2. Recently, a versatile set of complexes were identified and brought up several dilemmas in PRC mediated repression. These new class of complexes were named as non-canonical PRC1s (ncPRC1s. Both cPRC1s and ncPRC1s contain Ring finger protein (RING1, RNF2 and Polycomb group ring finger catalytic (PCGF core, but in ncPRCs, RING and YY1 binding protein (RYBP, or YY1 associated factor 2 (YAF2, replaces the Chromobox (CBX and Polyhomeotic (PHC subunits found in cPRC1s. Additionally, ncPRC1 subunits can associate with versatile accessory proteins, which determine their functional specificity. Homozygous null mutations of the ncPRC members in mice are often lethal or cause infertility, which underlines their essential functions in mammalian development. In this review, we summarize the mouse knockout phenotypes of subunits of the six major ncPRCs. We highlight several aspects of their discovery from fly to mice and emerging role in target recognition, embryogenesis and cell-fate decision making. We gathered data from stem cell mediated in vitro differentiation assays and genetically engineered mouse models. Accumulating evidence suggests that ncPRC1s play profound role in mammalian embryogenesis by regulating gene expression during lineage specification of pluripotent stem cells.

Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity

DEFF Research Database (Denmark)

Pasini, Diego; Bracken, Adrian P; Jensen, Michael R

2004-01-01

SUZ12 is a recently identified Polycomb group (PcG) protein, which together with EZH2 and EED forms different Polycomb repressive complexes (PRC2/3). These complexes contain histone H3 lysine (K) 27/9 and histone H1 K26 methyltransferase activity specified by the EZH2 SET domain. Here we show...

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

Energy Technology Data Exchange (ETDEWEB)

Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

2012-05-25

Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

A role for non-covalent SUMO interaction motifs in Pc2/CBX4 E3 activity.

Directory of Open Access Journals (Sweden)

Jacqueline C Merrill

2010-01-01

Full Text Available Modification of proteins by the small ubiquitin like modifier (SUMO is an essential process in mammalian cells. SUMO is covalently attached to lysines in target proteins via an enzymatic cascade which consists of E1 and E2, SUMO activating and conjugating enzymes. There is also a variable requirement for non-enzymatic E3 adapter like proteins, which can increase the efficiency and specificity of the sumoylation process. In addition to covalent attachment of SUMO to target proteins, specific non-covalent SUMO interaction motifs (SIMs that are generally short hydrophobic peptide motifs have been identified.Intriguingly, consensus SIMs are present in most SUMO E3s, including the polycomb protein, Pc2/Cbx4. However, a role for SIMs in SUMO E3 activity remains to be shown. We show that Pc2 contains two functional SIMs, both of which contribute to full E3 activity in mammalian cells, and are also required for sumoylation of Pc2 itself. Pc2 forms distinct sub-nuclear foci, termed polycomb bodies, and can recruit partner proteins, such as the corepressor CtBP. We demonstrate that mutation of the SIMs in Pc2 prevents Pc2-dependent CtBP sumoylation, and decreases enrichment of SUMO1 and SUMO2 at polycomb foci. Furthermore, mutational analysis of both SUMO1 and SUMO2 reveals that the SIM-interacting residues of both SUMO isoforms are required for Pc2-mediated sumoylation and localization to polycomb foci.This work provides the first clear evidence for a role for SIMs in SUMO E3 activity.

The nuclear receptor NR2E1/TLX controls senescence

Science.gov (United States)

Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M.; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús

2014-01-01

The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumours including glioblastomas. Despite NR2E1 regulating targets like p21CIP1 or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that Polycomb repressive complexes (PRC) also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the Polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16INK4a and direct repression of p21CIP1. In addition NR2E1 expression also counteracts oncogene-induced senescence (OIS). The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of Polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer. PMID:25328137

The nuclear receptor NR2E1/TLX controls senescence.

Science.gov (United States)

O'Loghlen, Ana; Martin, Nadine; Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús

2015-07-30

The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumors including glioblastomas. Despite NR2E1 regulating targets like p21(CIP1) or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that polycomb repressive complexes also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16(INK4a) and direct repression of p21(CIP1). In addition NR2E1 expression also counteracts oncogene-induced senescence. The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer.

BMI change during puberty and the risk of heart failure.

Science.gov (United States)

Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

2018-03-12

Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

Science.gov (United States)

Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

2012-04-01

Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

Energy and Protein Supplementation Does Not Affect Protein and Amino Acid Kinetics or Pregnancy Outcomes in Underweight Indian Women.

Science.gov (United States)

Dwarkanath, Pratibha; Hsu, Jean W; Tang, Grace J; Anand, Pauline; Thomas, Tinku; Thomas, Annamma; Sheela, C N; Kurpad, Anura V; Jahoor, Farook

2016-02-01

In India, the prevalence of low birth weight is high in women with a low body mass index (BMI), suggesting that underweight women are not capable of providing adequate energy and protein for fetal growth. Furthermore, as pregnancy progresses, there is increased need to provide methyl groups for methylation reactions associated with the synthesis of new proteins and, unlike normal-BMI American women, low-BMI Indian women are unable to increase methionine transmethylation and remethylation rates as pregnancy progresses from trimester 1 to 3. This also negatively influences birth weight. The aim was to determine the effect of dietary supplementation with energy and protein from 12 ± 1 wk of gestation to time of delivery compared with no supplement on pregnancy outcomes, protein kinetics, and the fluxes of the methyl group donors serine and glycine. Protein kinetics and serine and glycine fluxes were measured by using standard stable isotope tracer methods in the fasting and postprandial states in 24 pregnant women aged 22.9 ± 0.7 y with low BMIs [BMI (in kg/m(2)) ≤18.5] at 12 ± 1 wk (trimester 1) and 30 ± 1 wk (trimester 3) of gestation. After the first measurement, subjects were randomly assigned to either receive the supplement (300 kcal/d, 15 g protein/d) or no supplement. Supplementation had no significant effect on any variable of pregnancy outcome, and except for fasting state decreases in leucine flux (125 ± 7.14 compared with 113 ± 5.06 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.04) and nonoxidative disposal (110 ± 6.97 compared with 101 ± 3.69 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.02) from trimesters 1 to 3, it had no effect on any other leucine kinetic variable or urea, glycine, and serine fluxes. We conclude that in Indian women with a low BMI, supplementation with energy and protein from week 12 of pregnancy to time of delivery does not improve pregnancy outcome, whole-body protein kinetics, or serine and glycine fluxes. © 2016 American Society for Nutrition.

BMI at birth and overweight at age four.

Science.gov (United States)

Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

The Role of BMI in Hip Fracture Surgery.

Science.gov (United States)

Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

2018-01-01

Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

Samd7 is a cell type-specific PRC1 component essential for establishing retinal rod photoreceptor identity.

Science.gov (United States)

Omori, Yoshihiro; Kubo, Shun; Kon, Tetsuo; Furuhashi, Mayu; Narita, Hirotaka; Kominami, Taro; Ueno, Akiko; Tsutsumi, Ryotaro; Chaya, Taro; Yamamoto, Haruka; Suetake, Isao; Ueno, Shinji; Koseki, Haruhiko; Nakagawa, Atsushi; Furukawa, Takahisa

2017-09-26

Precise transcriptional regulation controlled by a transcription factor network is known to be crucial for establishing correct neuronal cell identities and functions in the CNS. In the retina, the expression of various cone and rod photoreceptor cell genes is regulated by multiple transcription factors; however, the role of epigenetic regulation in photoreceptor cell gene expression has been poorly understood. Here, we found that Samd7, a rod-enriched sterile alpha domain (SAM) domain protein, is essential for silencing nonrod gene expression through H3K27me3 regulation in rod photoreceptor cells. Samd7- null mutant mice showed ectopic expression of nonrod genes including S-opsin in rod photoreceptor cells and rod photoreceptor cell dysfunction. Samd7 physically interacts with Polyhomeotic homologs (Phc proteins), components of the Polycomb repressive complex 1 (PRC1), and colocalizes with Phc2 and Ring1B in Polycomb bodies. ChIP assays showed a significant decrease of H3K27me3 in the genes up-regulated in the Samd7 -deficient retina, showing that Samd7 deficiency causes the derepression of nonrod gene expression in rod photoreceptor cells. The current study suggests that Samd7 is a cell type-specific PRC1 component epigenetically defining rod photoreceptor cell identity.

Paternal body mass index (BMI is associated with offspring intrauterine growth in a gender dependent manner.

Directory of Open Access Journals (Sweden)

You-Peng Chen

Full Text Available BACKGROUND: Environmental alternations leading to fetal programming of cardiovascular diseases in later life have been attributed to maternal factors. However, animal studies showed that paternal obesity may program cardio-metabolic diseases in the offspring. In the current study we tested the hypothesis that paternal BMI may be associated with fetal growth. METHODS AND RESULTS: We analyzed the relationship between paternal body mass index (BMI and birth weight, ultrasound parameters describing the newborn's body shape as well as parameters describing the newborns endocrine system such as cortisol, aldosterone, renin activity and fetal glycated serum protein in a birth cohort of 899 father/mother/child triplets. Since fetal programming is an offspring sex specific process, male and female offspring were analyzed separately. Multivariable regression analyses considering maternal BMI, paternal and maternal age, hypertension during pregnancy, maternal total glycated serum protein, parity and either gestational age (for birth weight or time of ultrasound investigation (for ultrasound parameters as confounding showed that paternal BMI is associated with growth of the male but not female offspring. Paternal BMI correlated with birth parameters of male offspring only: birth weight; biparietal diameter, head circumference; abdominal diameter, abdominal circumference; and pectoral diameter. Cortisol was likewise significantly correlated with paternal BMI in male newborns only. CONCLUSIONS: Paternal BMI affects growth of the male but not female offspring. Paternal BMI may thus represent a risk factor for cardiovascular diseases of male offspring in later life. It remains to be demonstrated whether this is linked to an offspring sex specific paternal programming of cortisol secretion.

Drosophila Kismet regulates histone H3 lysine 27 methylation and early elongation by RNA polymerase II.

Directory of Open Access Journals (Sweden)

Shrividhya Srinivasan

2008-10-01

Full Text Available Polycomb and trithorax group proteins regulate cellular pluripotency and differentiation by maintaining hereditable states of transcription. Many Polycomb and trithorax group proteins have been implicated in the covalent modification or remodeling of chromatin, but how they interact with each other and the general transcription machinery to regulate transcription is not well understood. The trithorax group protein Kismet-L (KIS-L is a member of the CHD subfamily of chromatin-remodeling factors that plays a global role in transcription by RNA polymerase II (Pol II. Mutations in CHD7, the human counterpart of kis, are associated with CHARGE syndrome, a developmental disorder affecting multiple tissues and organs. To clarify how KIS-L activates gene expression and counteracts Polycomb group silencing, we characterized defects resulting from the loss of KIS-L function in Drosophila. These studies revealed that KIS-L acts downstream of P-TEFb recruitment to stimulate elongation by Pol II. The presence of two chromodomains in KIS-L suggested that its recruitment or function might be regulated by the methylation of histone H3 lysine 4 by the trithorax group proteins ASH1 and TRX. Although we observed significant overlap between the distributions of KIS-L, ASH1, and TRX on polytene chromosomes, KIS-L did not bind methylated histone tails in vitro, and loss of TRX or ASH1 function did not alter the association of KIS-L with chromatin. By contrast, loss of kis function led to a dramatic reduction in the levels of TRX and ASH1 associated with chromatin and was accompanied by increased histone H3 lysine 27 methylation-a modification required for Polycomb group repression. A similar increase in H3 lysine 27 methylation was observed in ash1 and trx mutant larvae. Our findings suggest that KIS-L promotes early elongation and counteracts Polycomb group repression by recruiting the ASH1 and TRX histone methyltransferases to chromatin.

Proresolving protein Annexin A1: The role in type 2 diabetes mellitus and obesity.

Science.gov (United States)

Pietrani, Nathalia T; Ferreira, Cláudia N; Rodrigues, Kathryna F; Perucci, Luiza O; Carneiro, Fernanda S; Bosco, Adriana A; Oliveira, Marina C; Pereira, Solange S; Teixeira, Antônio L; Alvarez-Leite, Jacqueline I; Ferreira, Adaliene V; Sousa, Lirlândia P; Gomes, Karina B

2018-04-17

Annexin A1 (AnxA1) is a protein involved in inflammation resolution that might be altered in obesity-associated type 2 diabetes mellitus (DM), which is a chronic inflammatory disease. The aim of this study was to evaluate AnxA1 serum levels in individuals with and without DM stratified according to the body mass index (BMI), and the dynamic of AnxA1 expression in adipose tissue from humans with obesity and non-obesity. Serum samples were obtained from 41 patients with DM (lean, overweight and obese) and 40 controls, and adipose tissue samples were obtained from 16 individuals with obesity (with or without DM), and 15 controls. DM patients showed similar AnxA1 serum levels when compared to controls. However, when the individuals were stratified according to BMI, AnxA1 levels were higher in individuals with obesity than lean or overweight, and in overweight compared to lean individuals. Moreover, AnxA1 was correlated positively with IL-6 levels. AnxA1 levels were also positively correlated with BMI, waist circumference and waist-to-hip ratio. Furthermore, higher levels of cleaved AnxA1 were observed in adipose tissue from individuals with obesity, independently of DM status. Enhanced levels of AnxA1 in serum of individuals with obesity suggest an attempt to counter-regulate the systemic inflammation process in this disease. However, the higher levels of cleaved AnxA1 in the adipose tissue of individuals with obesity could compromise its anti-inflammatory and proresolving actions, locally. Considering our data, AnxA1 cleavage in the adipose tissue, despite increased serum levels of this protein, and consequently the failure in inflammation resolution, suggests an important pathophysiological mechanism involved in inflammatory status observed in obesity. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Prediction of BMI by impulsivity, eating behavior and activity level

Directory of Open Access Journals (Sweden)

Jiang Xiaxia

2016-01-01

Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

RYBP and Cbx7 Define Specific Biological Functions of Polycomb Complexes in Mouse Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Lluis Morey

2013-01-01

Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.

Low birth weight, adult BMI and inflammation in middle age

DEFF Research Database (Denmark)

Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten

2013-01-01

This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...

Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

Science.gov (United States)

Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

2016-04-01

While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

Are BMI and Sedentariness Correlated? A Multilevel Study in Children

Directory of Open Access Journals (Sweden)

Thayse Natacha Gomes

2015-07-01

Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

Science.gov (United States)

Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

2011-10-01

Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation.

Science.gov (United States)

Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J

2010-07-01

High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.

Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.

Science.gov (United States)

Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y

2018-04-01

Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.

Eating tasty food to cope. Longitudinal association with BMI.

Science.gov (United States)

Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

2015-04-01

The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.

Science.gov (United States)

Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A

2017-07-01

We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI

Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

Science.gov (United States)

Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

2018-01-01

Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

The effect of obesity on inflammatory markers in patients with PCOS: a BMI-matched case-control study.

Science.gov (United States)

Keskin Kurt, Raziye; Okyay, Ayşe Güler; Hakverdi, Ali Ulvi; Gungoren, Arif; Dolapcioglu, Kenan Serdar; Karateke, Atilla; Dogan, Mustafa Ozcil

2014-08-01

Previous studies have shown increased inflammatory activity in patients with polycystic ovary syndrome (PCOS); however, it remains uncertain whether this increased inflammatory activity is a consequence of the disorder itself or of the accompanying obesity. We therefore aimed to test the inflammatory marker levels in obese and lean patients with PCOS by using two separate control groups with matching body mass index (BMI). A total of 120 women in reproductive age with (n = 62) and without (n = 60) PCOS were recruited for the study. Patients with PCOS were divided into two groups as obese (n = 32) and lean (n = 30) PCOS groups according to BMI. Two BMI-matched control groups were created. Furthermore, high sensitive CRP protein (hsCRP), neutrophils, lymphocytes, white blood cell count (WBC) and neutrophil to lymphocyte ratio (NLR) were evaluated with complete blood count. The hsCRP (5.5 ± 0.8 vs. 3.1 ± 0.7, p PCOS compared to the control group while lymphocyte count was lower (1.71 ± 0.65 vs. 1.98 ± 0.39, p = 0.008). Similarly, both obese and lean patients with PCOS had higher levels of hsCRP, neutrophils, leukocytes and NLR ratios compared to BMI-matched controls. The correlation analysis revealed a moderate correlation between NLR and hsCRP (r 0.459, p lean and obese patients with PCOS have increased inflammatory markers compared to BMI-matched control groups indicating that the inflammation seen in PCOS might be related with the presence of the disorder rather than with obesity.

Anabolic sensitivity of postprandial muscle protein synthesis to the ingestion of a protein-dense food is reduced in overweight and obese young adults.

Science.gov (United States)

Beals, Joseph W; Sukiennik, Richard A; Nallabelli, Julian; Emmons, Russell S; van Vliet, Stephan; Young, Justin R; Ulanov, Alexander V; Li, Zhong; Paluska, Scott A; De Lisio, Michael; Burd, Nicholas A

2016-10-01

Excess body fat diminishes muscle protein synthesis rates in response to hyperinsulinemic-hyperaminoacidemic clamps. However, muscle protein synthetic responses after the ingestion of a protein-dense food source across a range of body mass indexes (BMIs) have not been compared. We compared the myofibrillar protein synthetic response and underlying nutrient-sensing mechanisms after the ingestion of lean pork between obese, overweight, and healthy-weight adults. Ten healthy-weight [HW; BMI (in kg/m 2 ): 22.7 ± 0.4], 10 overweight (OW; BMI: 27.1 ± 0.5), and 10 obese (OB; BMI: 35.9 ± 1.3) adults received primed continuous l-[ring- 13 C 6 ]phenylalanine infusions. Blood and muscle biopsy samples were collected before and after the ingestion of 170 g pork (36 g protein and 3 g fat) to assess skeletal muscle anabolic signaling, amino acid transporters [large neutral and small neutral amino acid transporters (LAT1, SNAT2) and CD98], and myofibrillar protein synthesis. At baseline, OW and OB groups showed greater relative amounts of mammalian target of rapamycin complex 1 (mTORC1) protein than the HW group. Pork ingestion increased mTORC1 phosphorylation only in the HW group (P = 0.001). LAT1 and SNAT2 protein content increased during the postprandial period in all groups (time effect, P anabolic signals, that reduces muscle sensitivity to food ingestion. This trial was registered at clinicaltrials.gov as NCT02613767. © 2016 American Society for Nutrition.

Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

Science.gov (United States)

Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

2015-11-01

The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

The Predictive Factors for Diabetic Remission in Chinese Patients with BMI > 30 kg/m2 and BMI < 30 kg/m2 Are Different.

Science.gov (United States)

Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel

2018-01-15

Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.

Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

Science.gov (United States)

Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

2013-12-01

Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

Science.gov (United States)

Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

2017-05-01

Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

Is BMI a valid measure of obesity in postmenopausal women?

Science.gov (United States)

Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

2018-03-01

Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

The relationship between BMI and insulin resistance and progression from single to multiple autoantibody positivity and type 1 diabetes among TrialNet Pathway to Prevention participants.

Science.gov (United States)

Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella

2016-06-01

The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.

Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

Science.gov (United States)

Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

2017-01-01

Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

Association of fat mass and obesity-associated and retinitis pigmentosa guanosine triphosphatase (GTPase) regulator-interacting protein-1 like polymorphisms with body mass index in Chinese women.

Science.gov (United States)

Chen, Boyu; Li, Zhiqiang; Chen, Jianhua; Ji, Jue; Shen, Jingyi; Xu, Yufeng; Zhao, Yingying; Liu, Danping; Shen, Yinhuan; Zhang, Weijie; Shen, Jiawei; Wang, Yonggang; Shi, Yongyong

2018-04-14

Body mass index (BMI) is the most commonly used quantitative measure of adiposity. It is a kind of complex genetic diseases which are caused by multiple susceptibility genes. The first intron of fat mass and obesity-associated (FTO) has been widely discovered to be associated with BMI. Retinitis pigmentosa GTPase regulator-interacting protein-1 like (RPGRIP1L) is located in the upstream region of FTO and has been proved to be linked with obesity through functional tests. We carried out a genetic association analysis to figure out the role of the FTO gene and the RPGRIP1L gene in BMI. A quantitative traits study with 6,102 Chinese female samples, adjusted for age, was performed during our project. Among the twelve SNPs, rs1421085, rs1558902, rs17817449, rs8050136, rs9939609, rs7202296, rs56137030, rs9930506 and rs12149832 in the FTO gene were significantly associated with BMI after Bonferroni correction. Meanwhile, rs9934800 in the RPGRIP1L gene showed significance with BMI before Bonferroni correction, but this association was eliminated after Bonferroni correction. Our results suggested that genetic variants in the FTO gene were strongly associated with BMI in Chinese women, which may serve as targets of pharmaceutical research and development concerning BMI. Meanwhile, we didn't found the significant association between RPGRIP1L and BMI in Chinese women.

BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

Science.gov (United States)

Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

2011-09-01

The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

Community-Specific BMI Cutoff Points for South Indian Females

Directory of Open Access Journals (Sweden)

K. B. Kishore Mohan

2011-01-01

Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

Science.gov (United States)

Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

2018-03-01

High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

Science.gov (United States)

Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

2016-07-26

The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

Science.gov (United States)

Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

2017-03-21

More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

Causal relationship between the AHSG gene and BMD through fetuin-A and BMI: multiple mediation analysis.

Science.gov (United States)

Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P

2014-05-01

Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.

Effects of two-months balanced diet in metabolically healthy obesity: lipid correlations with gender and BMI-related differences.

Science.gov (United States)

Rondanelli, Mariangela; Klersy, Chaterine; Perna, Simone; Faliva, Milena Anna; Montorfano, Gigliola; Roderi, Paola; Colombo, Irma; Corsetto, Paola Antonia; Fioravanti, Marisa; Solerte, Sebastiano Bruno; Rizzo, Angela Maria

2015-10-29

Nowadays no researches has been performed on fatty acid profile (FA) and desaturase activity in metabolically healthy obesity (MHO). The aim of this study was to assessed gender and BMI-related difference in FA, estimated desaturase activities and the efficacy on metabolic changes produced by 2-months well-balance diet in MHO subjects. In 103 MHO subjects (30/73 M/F; age:42.2 ± 9.5) FA, estimated desaturase activity, body composition (by DXA), Body Mass Index (BMI), lipid profile, adipokines (leptin, adiponectin, grelin, glucagon-like peptide-1), insulin resistence (by Homestasis metabolic assessment), C-reactive proteine, Atherogenic index of plasma (AIP) and Body Shape Index (ABSI) have been assessed. Gender and BMI related difference have been evaluated and the efficacy produced by 2-months well-balance diet has been considered. At baseline, obese subjects, compared to overweight, show a significantly higher oleic (p insulin resistance (p = 0.006), leptin (p = 0.006), adiponectin (p <0.001), grelin (p = 0.030), CRP (p = 0.004), BMI (p <0.001) and android fat mass (p <0.001). The balanced diet intervention was effective in improving metabolic indices.

[SINEs in mammalian genomes can serve as additional signals in formation of facultative heterochromatin].

Science.gov (United States)

Usmanova, N M; Kazakov, V I; Tomilin, N V

2008-01-01

Using computer-based methods we determined the global distribution of short interspersed nuclear elements (SINEs) in the human and mouse X chromosomes. It has been shown that this distributions is similar to the distributions of CpG islands and genes but is different from the distribution of LINE1 elements. Since SINEs (human Alu and mouse B2) may have binding sites for Polycomb protein YY1, we suggest that these repeats can serve as additional signals ("boosters") in Polycomb-dependent silencing of gene rich segments during X inactivation.

Mel-18 interacts with RanGAP1 and inhibits its sumoylation.

Science.gov (United States)

Zhang, Jie; Sarge, Kevin D

2008-10-17

Our previous results showed that the polycomb protein mel-18 binds to a protein called HSF2 and inhibits HSF2 sumoylation, thereby functioning as an anti-SUMO E3 factor. This study also suggested that mel-18 regulates the sumoylation of other cellular proteins, but the identities of these other proteins were unknown. Here we show that mel-18 interacts with the RanGAP1 protein and inhibits its sumoylation, and that these activities do not require the RING domain of mel-18. The results also show that RanGAP1 sumoylation is decreased during mitosis, and that this is associated with increased interaction between RanGAP1 and mel-18 during this stage of the cell cycle. Intriguingly, this regulatory relationship is the opposite of that found for mel-18 and HSF2, in which the interaction between these two proteins decreases during mitosis, resulting in elevated HSF2 sumoylation. The results of this study strengthen the conclusion that mel-18 functions as an anti-SUMO E3 factor, and extend its targets to include regulation of the sumoylation of the important cellular protein RanGAP1.

LA VÍA RB/E2F Y LA FAMILIA DE PROTEÍNAS REPRESORAS POLYCOMB EN EL DESARROLLO DE CÁNCER

Directory of Open Access Journals (Sweden)

MERCEDES IMELDA DÁVALOS-SALAS

2011-01-01

Full Text Available El control adecuado del ciclo celular mediante la acción coordinada de la familia de factores de transcripción E2F resulta ser clave para la homeostasis celular. El entender su modo de acción desde una perspectiva epigenética resulta ser un tema de gran actualidad y cambia la visión de cómo es regulado el ciclo celular. Uno de los principales reguladores epigenéticos está conformado por el grupo de proteínas Polycomb (PcG, relacionadas con procesos patológicos como el cáncer, a través de la desregulación a nivel epigenético de genes supresores de tumores como BRCA1, p16 y p53, entre otros. Con relación a lo anterior, la regulación del gen supresor Retinoblastoma (Rb ha sido ampliamente estudiado dada su importante participación como regulador negativo del ciclo celular, pero más reciente se ha demostrado que su modo de acción está relacionado con el grupo de proteínas PcG. Cada uno de los procesos que involucran a componentes de la familia de factores E2F, los miembros de Polycomb y la familia de proteína Rb, parecen ser en cierta medida independientes y, por ende, poco relacionados. Sin embargo, existen evidencias de una convergencia a nivel epigenético en la acción de estos conjuntos de moléculas reguladoras de la progresión del ciclo celular y su desregulación nos puede llevar a entender mejor su contribución al desarrollo de procesos patológicos como el cáncer.

Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

Science.gov (United States)

Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

2018-02-01

Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

Difficulty buying food, BMI, and eating habits in young children.

Science.gov (United States)

Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

2018-01-22

To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

Socioeconomic differences in childhood BMI trajectories in Belarus.

Science.gov (United States)

Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

2018-02-28

To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

Directory of Open Access Journals (Sweden)

Justin W Leung

2014-03-01

Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

Directory of Open Access Journals (Sweden)

Carolina Nör

2014-02-01

Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

DEFF Research Database (Denmark)

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

2016-01-01

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

The effect of standardized food intake on the association between BMI and 1H-NMR metabolites

NARCIS (Netherlands)

Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.

2016-01-01

Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the

The Report Card on BMI Report Cards.

Science.gov (United States)

Thompson, Hannah R; Madsen, Kristine A

2017-06-01

Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

BMI Trajectories from Birth to Young Adulthood.

Science.gov (United States)

McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

2018-04-19

This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

ENERGY CONSUMPTION, THE DISTRIBUTION OF MACRONUTRIENTS AND BMI IN MOTHERS AND THEIR MEXICAN SCHOOLCHILDREN.

Science.gov (United States)

Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R

2015-12-01

to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Know Your Body Mass Index (BMI)

Science.gov (United States)

... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

Science.gov (United States)

Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

2014-01-01

Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

Science.gov (United States)

Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

2017-11-01

Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

Energy Technology Data Exchange (ETDEWEB)

Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery

2018-02-15

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

International Nuclear Information System (INIS)

Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.

2018-01-01

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

Dinner rituals that correlate with child and adult BMI.

Science.gov (United States)

Wansink, Brian; van Kleef, Ellen

2014-05-01

What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

Science.gov (United States)

Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

2018-02-01

Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.

LENUS (Irish Health Repository)

Elshorbagy, Amany K

2009-07-01

We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.

Modeling initiation of Ewing sarcoma in human neural crest cells.

Directory of Open Access Journals (Sweden)

Cornelia von Levetzow

2011-04-01

Full Text Available Ewing sarcoma family tumors (ESFT are aggressive bone and soft tissue tumors that express EWS-ETS fusion genes as driver mutations. Although the histogenesis of ESFT is controversial, mesenchymal (MSC and/or neural crest (NCSC stem cells have been implicated as cells of origin. For the current study we evaluated the consequences of EWS-FLI1 expression in human embryonic stem cell-derived NCSC (hNCSC. Ectopic expression of EWS-FLI1 in undifferentiated hNCSC and their neuro-mesenchymal stem cell (hNC-MSC progeny was readily tolerated and led to altered expression of both well established as well as novel EWS-FLI1 target genes. Importantly, whole genome expression profiling studies revealed that the molecular signature of established ESFT is more similar to hNCSC than any other normal tissue, including MSC, indicating that maintenance or reactivation of the NCSC program is a feature of ESFT pathogenesis. Consistent with this hypothesis, EWS-FLI1 induced hNCSC genes as well as the polycomb proteins BMI-1 and EZH2 in hNC-MSC. In addition, up-regulation of BMI-1 was associated with avoidance of cellular senescence and reversible silencing of p16. Together these studies confirm that, unlike terminally differentiated cells but consistent with bone marrow-derived MSC, NCSC tolerate expression of EWS-FLI1 and ectopic expression of the oncogene initiates transition to an ESFT-like state. In addition, to our knowledge this is the first demonstration that EWS-FLI1-mediated induction of BMI-1 and epigenetic silencing of p16 might be critical early initiating events in ESFT tumorigenesis.

Body size estimation of self and others in females varying in BMI.

Directory of Open Access Journals (Sweden)

Anne Thaler

Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Body size estimation of self and others in females varying in BMI.

Science.gov (United States)

Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

2018-01-01

Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Impact of HSD11B1 polymorphisms on BMI and components of the metabolic syndrome in patients receiving psychotropic treatments

KAUST Repository

Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin

2015-01-01

Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not

Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

Science.gov (United States)

Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

2018-02-24

Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

Smoking and Socio-demographic correlates of BMI

Directory of Open Access Journals (Sweden)

Peizhi Wang

2016-06-01

Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

Meta-analysis of genome-wide linkage studies in BMI and obesity.

Science.gov (United States)

Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A

2007-09-01

The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.

Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

Science.gov (United States)

Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

2017-09-01

The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

Assessing exclusive breastfeeding practices, dietary intakes and body mass index (BMI) of nursing mothers in Ekiti State of Nigeria.

Science.gov (United States)

Ijarotimi, Oluwole Steve

2010-06-01

Breastfeeding is an unequalled way of providing ideal food for the infants. The benefits of breastfeeding practices to infants and mothers are well documented. However, information on breastfeeding practices and its effect on body mass index (BMI) of mothers are scarce, particularly in Ekiti State of Nigeria. Therefore, the present study is designed to assess breastfeeding practices and its association with BMI of mothers. A descriptive and cross-sectional study was conducted among breastfeeding mothers that attended postnatal clinic of the state specialist hospitals and maternity centers in the study location. The specialist hospital and two-third of the nine maternity centers were purposively selected because of their health facilities and personnel. The mother-child pairs (200 respondents) were randomly selected from the study locations. Information on demographic characteristic, socio-economic parameters, nutritional knowledge of breastfeeding and dietary intakes of mothers were collected using questionnaires. BMI of mothers was determined as described by World Health Organization. Age distribution of mothers was between 25-34 years; and almost half of respondents had good educational background and were engaged in different occupations. The respondent monthly income ranged between = N = 3500 - 26000 ($26.92 - $200); and their dietary intakes varied between starchy and protein-based food. The result also showed that the respondent consumed enough nutrients to meet up the recommended daily allowance for protein, carbohydrate, fat, zinc, magnesium, sodium and phosphorous requirements. The BMI classifications showed that over three-fifth of respondents were normal, while the remaining were underweight (6%) and overweight/obese (26.5%). Also, large proportion of respondents engaged in exclusive breastfeeding and with good knowledge of breastfeeding practices. Statistically, exclusive breastfeeding practices had no correlation between the BMI and frequency of

Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

Science.gov (United States)

Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

Optimum BMI cut points to screen asian americans for type 2 diabetes.

Science.gov (United States)

Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

2015-05-01

Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Associations between parity and maternal BMI in a population-based cohort study.

Science.gov (United States)

Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

2018-02-07

We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients.

Science.gov (United States)

Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino

2015-01-01

Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients

Directory of Open Access Journals (Sweden)

Alessandro Grasso

2015-01-01

Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

Eating frequency in relation to BMI in very young children: a longitudinal analysis.

Science.gov (United States)

Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara

2017-06-01

Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.

Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

Science.gov (United States)

Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

2014-08-01

Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Dissociated incretin hormone response to protein versus fat ingestion in obese subjects

DEFF Research Database (Denmark)

Lindgren, O; Carr, RD; Holst, Jens Juul

2011-01-01

kcal/kg) fat (olive oil) or protein (whey protein) was ingested by non-diabetic obese male volunteers [body mass index (BMI) >30 kg/m(2) ; n = 12] and plasma GIP and GLP-1 were determined. We found no difference in the early GIP or GLP-1 responses to fat versus protein. However, the total 300-min GIP...

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Science.gov (United States)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.

Science.gov (United States)

Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T

2016-11-01

The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Combinations of Novel Histone Deacetylase and Bcr-Abl Inhibitors in the Therapy of Imatinib Mesylate-Sensitive and -Refractory Bcr-Abl Expressing Leukemia

Science.gov (United States)

2008-12-01

Balasis,1Purva Bali,1Veronica Estrella ,1Sandhya Kumaraswamy,1 Rekha Rao,1Kathy Rocha,1Bryan Herger,1Francis Lee,2 Victoria Richon,3 and Kapil Bhalla1...Balasis M, Bali P, Estrella V, Kumaraswamy S, et al. Histone deacetylase inhibitors deplete EZH2 and associated Polycomb Repressive Complex 2 proteins

Eating behaviour patterns and BMI in Portuguese higher education students.

Science.gov (United States)

Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

2013-12-01

Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations

DEFF Research Database (Denmark)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria

2018-01-01

Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...

Discovery and Molecular Basis of a Diverse Set of Polycomb Repressive Complex 2 Inhibitors Recognition by EED.

Directory of Open Access Journals (Sweden)

Ling Li

Full Text Available Polycomb repressive complex 2 (PRC2, a histone H3 lysine 27 methyltransferase, plays a key role in gene regulation and is a known epigenetics drug target for cancer therapy. The WD40 domain-containing protein EED is the regulatory subunit of PRC2. It binds to the tri-methylated lysine 27 of the histone H3 (H3K27me3, and through which stimulates the activity of PRC2 allosterically. Recently, we disclosed a novel PRC2 inhibitor EED226 which binds to the K27me3-pocket on EED and showed strong antitumor activity in xenograft mice model. Here, we further report the identification and validation of four other EED binders along with EED162, the parental compound of EED226. The crystal structures for all these five compounds in complex with EED revealed a common deep pocket induced by the binding of this diverse set of compounds. This pocket was created after significant conformational rearrangement of the aromatic cage residues (Y365, Y148 and F97 in the H3K27me3 binding pocket of EED, the width of which was delineated by the side chains of these rearranged residues. In addition, all five compounds interact with the Arg367 at the bottom of the pocket. Each compound also displays unique features in its interaction with EED, suggesting the dynamics of the H3K27me3 pocket in accommodating the binding of different compounds. Our results provide structural insights for rational design of novel EED binder for the inhibition of PRC2 complex activity.

Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes

Directory of Open Access Journals (Sweden)

Andrew Fedor

2013-04-01

Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.

Higher BMI is associated with reduced cognitive performance in division I athletes.

Science.gov (United States)

Fedor, Andrew; Gunstad, John

2013-01-01

Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.

Mechanism by which BMI influences leisure-time physical activity behavior.

Science.gov (United States)

Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand

2008-06-01

The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.

MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

Directory of Open Access Journals (Sweden)

Zhenxin Zheng

2018-03-01

Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

VE-Cadherin-Mediated Epigenetic Regulation of Endothelial Gene Expression.

Science.gov (United States)

Morini, Marco F; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I; Conze, Lei L; O'Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P; Dejana, Elisabetta; Taddei, Andrea

2018-01-19

The mechanistic foundation of vascular maturation is still largely unknown. Several human pathologies are characterized by deregulated angiogenesis and unstable blood vessels. Solid tumors, for instance, get their nourishment from newly formed structurally abnormal vessels which present wide and irregular interendothelial junctions. Expression and clustering of the main endothelial-specific adherens junction protein, VEC (vascular endothelial cadherin), upregulate genes with key roles in endothelial differentiation and stability. We aim at understanding the molecular mechanisms through which VEC triggers the expression of a set of genes involved in endothelial differentiation and vascular stabilization. We compared a VEC-null cell line with the same line reconstituted with VEC wild-type cDNA. VEC expression and clustering upregulated endothelial-specific genes with key roles in vascular stabilization including claudin-5 , vascular endothelial-protein tyrosine phosphatase ( VE-PTP ), and von Willebrand factor ( vWf ). Mechanistically, VEC exerts this effect by inhibiting polycomb protein activity on the specific gene promoters. This is achieved by preventing nuclear translocation of FoxO1 (Forkhead box protein O1) and β-catenin, which contribute to PRC2 (polycomb repressive complex-2) binding to promoter regions of claudin-5 , VE-PTP , and vWf . VEC/β-catenin complex also sequesters a core subunit of PRC2 (Ezh2 [enhancer of zeste homolog 2]) at the cell membrane, preventing its nuclear translocation. Inhibition of Ezh2/VEC association increases Ezh2 recruitment to claudin-5 , VE-PTP , and vWf promoters, causing gene downregulation. RNA sequencing comparison of VEC-null and VEC-positive cells suggested a more general role of VEC in activating endothelial genes and triggering a vascular stability-related gene expression program. In pathological angiogenesis of human ovarian carcinomas, reduced VEC expression paralleled decreased levels of claudin-5 and VE-PTP. These

Modeling the dynamics of BMI changes during adolescence. The Oporto Growth, Health and Performance Study.

Science.gov (United States)

de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R

2015-07-01

The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.

The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.

Science.gov (United States)

Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H

2018-02-21

The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.

Prospective associations between sedentary lifestyle and BMI in midlife

DEFF Research Database (Denmark)

Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

2006-01-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

Long-term BMI and growth profiles in offspring of women with gestational diabetes.

Science.gov (United States)

Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

2018-05-01

Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Directory of Open Access Journals (Sweden)

Tenna Ruest Haarmark Nielsen

Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

Science.gov (United States)

Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2010-06-01

Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

Genetic Influences on Growth Traits of BMI

DEFF Research Database (Denmark)

Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

2008-01-01

Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

Representativeness and optimal use of body mass index (BMI) in the UK Clinical Practice Research Datalink (CPRD)

Science.gov (United States)

Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam

2013-01-01

Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Mammalian SFMBTs have been considered to be polycomb group repressors. However, molecular mechanisms underlying mammalian SFMBTs-mediated gene regulation and their biological function have not been characterized. In the present study, we identified YY1 and methylated histones as interacting proteins of ...

The Long Non-coding RNA HOTTIP Enhances Pancreatic Cancer Cell Proliferation, Survival and Migration

Science.gov (United States)

ABSTRACTHOTTIP is a long non-coding RNA (lncRNA) transcribed from the 5' tip of the HOXA locus and is associated with the polycomb repressor complex 2 (PRC2) and WD repeat containing protein 5 (WDR5)/mixed lineage leukemia 1 (MLL1) chromatin modifying complexes. HOTTIP is expres...

Viewing as little as 1 hour of TV daily is associated with higher change in BMI between kindergarten and first grade.

Science.gov (United States)

Peck, Travis; Scharf, Rebecca J; Conaway, Mark R; DeBoer, Mark D

2015-08-01

Evaluate associations between TV viewing and weight status in children from kindergarten to first grade. Linear and logistic regression was used to evaluate associations of TV-viewing time on BMI-z-score cross-sectionally at kindergarten and first grade and longitudinally in between, among a nationally representative sample of 14,645 children from the Early Childhood Longitudinal Study-Kindergarten Cohort 2011. All analyses were adjusted for sex, race/ethnicity, parental education, and household income. Weekday TV-viewing time was correlated with BMI-z-score (P TV daily, children watching ≥1 h in kindergarten and first grade had a greater odds of overweight (1.50-1.60) and obesity (1.58-1.73). Children watching 1-TV had a greater odds of becoming overweight (1.39) and obese (1.86) between evaluations. Children watching as little as 1-TV daily were more likely to become overweight and obese over time. Physicians should encourage families to restrict TV-viewing time to reduce weight gain. © 2015 The Obesity Society.

Desirable factors for maintaining normal BMI of urban affluent women of Delhi.

Science.gov (United States)

Gupta, Anu Taneja; Siddhu, Anupa

2015-01-01

The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.

Body mass index (BMI) in the Saudi population of Gassim.

Science.gov (United States)

Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

1998-01-01

In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

Infant BMI peak as a predictor of overweight and obesity at age 2 years in a Chinese community-based cohort

Science.gov (United States)

Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun

2017-01-01

Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164

Are genes associated with energy metabolism important in asthma and BMI?

Science.gov (United States)

Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna

2009-02-01

Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage

Genome-wide association study for the interaction between BMR and BMI in obese Korean women including overweight.

Science.gov (United States)

Lee, Myoungsook; Kwon, Dae Young; Kim, Myung-Sunny; Choi, Chong Ran; Park, Mi-Young; Kim, Ae-Jung

2016-02-01

This is the first study to identify common genetic factors associated with the basal metabolic rate (BMR) and body mass index (BMI) in obese Korean women including overweight. This will be a basic study for future research of obese gene-BMR interaction. The experimental design was 2 by 2 with variables of BMR and BMI. A genome-wide association study (GWAS) of single nucleotide polymorphisms (SNPs) was conducted in the overweight and obesity (BMI > 23 kg/m(2)) compared to the normality, and in women with low BMR (BMR. A total of 140 SNPs reached formal genome-wide statistical significance in this study (P BMR (rs10786764; P = 8.0 × 10(-7), rs1040675; 2.3 × 10(-6)) and BMI (rs10786764; P = 2.5 × 10(-5), rs10786764; 6.57 × 10(-5)). The other genes related to BMI (HSD52, TMA16, MARCH1, NRG1, NRXN3, and STK4) yielded P BMR and BMI, including NRG3, OR8U8, BCL2L2-PABPN1, PABPN1, and SLC22A17 were identified in obese Korean women (P BMR- and BMI-related genes using GWAS. Although most of these newly established loci were not previously associated with obesity, they may provide new insights into body weight regulation. Our findings of five common genes associated with BMR and BMI in Koreans will serve as a reference for replication and validation of future studies on the metabolic rate.

Investigation of the effect of body mass index (BMI) on semen parameters and male reproductive system hormones.

Science.gov (United States)

Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer

2017-10-03

To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation

DEFF Research Database (Denmark)

Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire

2017-01-01

-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...

Gender expression associated with BMI in a prospective cohort study of US adolescents.

Science.gov (United States)

Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

2016-02-01

To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

International Nuclear Information System (INIS)

Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

2016-01-01

Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

Energy Technology Data Exchange (ETDEWEB)

Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

2016-08-01