WorldWideScience

Sample records for bmi measures based

  1. Correction of self-reported BMI based on objective measurements: a Belgian experience.

    Science.gov (United States)

    Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

    2018-01-01

    Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

  2. Associations between Three School-Based Measures of Health: Is BMI Enough?

    Science.gov (United States)

    Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.

    2013-01-01

    School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…

  3. Accuracy and usefulness of BMI measures based on self-reported weight and height: findings from the NHANES & NHIS 2001-2006

    Directory of Open Access Journals (Sweden)

    Schoenborn Charlotte A

    2009-11-01

    Full Text Available Abstract Background The Body Mass Index (BMI based on self-reported height and weight ("self-reported BMI" in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Methods Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Results Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55, gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. Conclusion BMI values based on self-reported height and weight, if corrected for biases

  4. Accuracy and usefulness of BMI measures based on self-reported weight and height: findings from the NHANES & NHIS 2001-2006.

    Science.gov (United States)

    Stommel, Manfred; Schoenborn, Charlotte A

    2009-11-19

    The Body Mass Index (BMI) based on self-reported height and weight ("self-reported BMI") in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55), gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. BMI values based on self-reported height and weight, if corrected for biases associated with socio-demographic characteristics of the survey

  5. BMI calculation in older people: The effect of using direct and surrogate measures of height in a community-based setting.

    Science.gov (United States)

    Butler, Rose; McClinchy, Jane; Morreale-Parker, Claudia; Marsh, Wendy; Rennie, Kirsten L

    2017-12-01

    There is currently no consensus on which measure of height should be used in older people's body mass index (BMI) calculation. Most estimates of nutritional status include a measurement of body weight and height which should be reliable and accurate, however at present several different methods are used interchangeably. BMI, a key marker in malnutrition assessment, does not reflect age-related changes in height or changes in body composition such as loss of muscle mass or presence of oedema. The aim of this pilot study was to assess how the use of direct and surrogate measures of height impacts on BMI calculation in people aged ≥75 years. A cross-sectional study of 64 free-living older people (75-96 yrs) quantified height by two direct measurements, current height (H C ), and self-report (H R ) and surrogate equations using knee height (H K ) and ulna length (H U ). BMI calculated from current height measurement (BMI C ) was compared with BMI calculated using self-reported height (BMI R ) and height estimated from surrogate equations for knee height (BMI K ) and ulna length (BMI U ). Median difference of BMI C -BMI R was 2.31 kg/m 2 . BMI K gave the closest correlation to BMI C . The percentage of study participants identified at increased risk of under-nutrition (BMI BMI; from 5% (BMI C ), 7.8% (BMI K ), 12.5% (BMI U ), to 14% (BMI R ) respectively. The results of this pilot study in a relatively healthy sample of older people suggest that interchangeable use of current and reported height in people ≥75 years can introduce substantial significant systematic error. This discrepancy could impact nutritional assessment of older people in poor health and lead to misclassification during nutritional screening if other visual and clinical clues are not taken into account. This could result in long-term clinical and cost implications if individuals who need nutrition support are not correctly identified. A consensus is required on which method should be used to

  6. Is BMI a valid measure of obesity in postmenopausal women?

    Science.gov (United States)

    Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

    2018-03-01

    Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

  7. A Comparison of Perceived and Measured Paternal Weight and BMI, and Relationship to Weight and BMI of his Children

    LENUS (Irish Health Repository)

    Power, RF

    2018-02-01

    Nineteen percent of 9 years old Irish children are overweight; seven percent are obese. Our aims were: to examine whether differences exist between paternal self-reported and measured height, weight and BMI in a population representative sample; and to explore paternal perceptions of their own weight status.\\r\

  8. Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

    Science.gov (United States)

    Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

    2016-07-26

    The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

  9. Gender and Stress Perception Based Differences in BMI, Hormonal Response and Appetite in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Haque, Z.; Haleem, D. J.

    2014-01-01

    Objective: To evaluate and compare the gender based variations in stress perception induced changes in leptin, cortisol and serotonin (5-HT) trends, appetite and Body Mass Index (BMI). Study Design: An analytical comparative study. Place and Duration of Study: Neurochemistry Laboratory, University of Karachi, from January to August 2013. Methodology: Appetite, BMI and serum leptin, cortisol, and 5-HT were measured in 100 men and women of aged 30 - 60 years, working in teaching institutes of Karachi, to evaluate gender based, stress perception induced variations. The samples were identified by stratified random technique. The chemical variables were estimated through ELISA. Results were analysed using one-way ANOVA and multivariate general linear model using SPSS version 17. Results: Mean stress perception, BMI and serum leptin levels were significantly more in women (p < 0.05). Serum cortisol and 5-HT were found significantly reduced in women (p < 0.05). BMI, serum cortisol and leptin were found to be increased with increasing level of stress perception (p < 0.05). VAS for hunger and desire to eat as the measure of appetite was significantly higher in men (p < 0.05). Conclusion: Stress perception attenuates the positive effect of cortisol and negative effects of leptin and 5-HT on appetite through changes in their circulatory levels. Women perceive more stress and exhibit significantly attenuated changes in hormonal levels and appetite which may be the contributing factor towards obesity. Increased BMI in women despite decreased appetite merits more studies. (author)

  10. Body Mass Index (BMI) in women booking for antenatal care: comparison between selfreported and digital measurements.

    LENUS (Irish Health Repository)

    Fattah, Chro

    2012-02-01

    OBJECTIVE: We set out to compare measurement of Body Mass Index (BMI) with selfreporting in women early in pregnancy. STUDY DESIGN: We studied 100 women booking for antenatal care in the first trimester with a normal ongoing pregnancy. Selfreported maternal weight and height were recorded and the Body Mass Index was calculated. Afterwards maternal weight and height were digitally measured and actual BMI was calculated. RESULTS: If selfreporting is used for BMI classification, we found that 22% of women were classified incorrectly when BMI was measured. 12% of the women who were classified as having a normal selfreported BMI were overweight and 5% classified as overweight were obese. Similar findings have been reported outside pregnancy. CONCLUSIONS: These findings have implications for clinical practice, and for research studies exploring the relationship between maternal adiposity and pregnancy complications.

  11. Can self-reported BMI be used as a valid measure among novice runners

    DEFF Research Database (Denmark)

    Juul, Martin Serup; Nielsen, R.O.; Rasmussen, Sten

    There is an increased risk of running related injuries (RRI) among novice runners with a Body Mass Index (BMI) above 25. Information about BMI can be collected through questionnaires, when studies investigate if there is an association between BMI and RRI among novice runners. But can self...... of RRI. Healthy novice runners between the age of 18 to 65 and without lower extremity injuries were able to participate in the study. During July and August 2011 the participants were included in the study based on an online questionnaire. 1532 persons completed the questionnaire, of these, 970 were...

  12. BMI, health behaviors, and quality of life in children and adolescents: a school-based study.

    Science.gov (United States)

    Chen, Gang; Ratcliffe, Julie; Olds, Tim; Magarey, Anthea; Jones, Michelle; Leslie, Eva

    2014-04-01

    To explore the relationship between weight status (BMI) and health-related quality of life in children and adolescents through application of the Child Health Utility 9D, a new generic preference-based instrument. Data were collected from primary and high school students in rural and metropolitan regions of South Australia. Consenting participants (2588 in grades 4-6 and 765 in grades 9-10) were weighed and measured and categorized as underweight, healthy weight, overweight, or obese according to International Obesity Taskforce BMI cutoff points (primary outcome). Participants also completed a questionnaire including the Child Health Utility 9D and standardized measures of physical activity, sedentary behavior, sleep patterns, and eating behavior (secondary outcomes). Descriptive and multivariate linear regression analyses were undertaken to calculate mean utility differences. In comparison with healthy-weight primary school students, adjusted mean utilities were lower for overweight (-0.016, P = .02) or obese (-0.039, P = .001) students. For high school students, the adjusted mean utilities were also lower for overweight and obese students but were nonsignificant (-0.018, P > .10). Physical activity, sedentary behavior, sleep patterns, and eating behavior were all found to be significantly associated with utilities. Irrespective of BMI, young people engaging in more physical activities or less sedentary behavior, and having healthier sleep patterns or eating behavior exhibited higher utilities. Associations between utilities and sleep patterns or eating behavior were stronger than the associations with BMI. Future economic evaluations for obesity interventions should more formally investigate the relationship between changes over time in weight status and health-related quality of life for children and adolescents.

  13. Behavioural measures of child's eating temperament and their link with BMI.

    Science.gov (United States)

    Godefroy, Valérie; Trinchera, Laura; Darcel, Nicolas; Rigal, Natalie

    2017-03-01

    Rothbart's model of temperament, defined as individual differences in reactivity and self-regulation, has a strong heuristic value with applications in a wide variety of children's outcomes. Our objective was to test Rothbart's model applied to children's food behaviours and BMI outcome through behavioural measures. Our hypotheses, according to Rothbart's model, were as follows: (i) self-regulation in eating modulates appetite reactivity; (ii) appetite reactivity increases the risk of excess BMI, whereas self-regulation in eating limits this risk. One hundred and four children aged between 7 and 12 years completed four behavioural tasks to assess scores for two components of appetite reactivity (i.e. appetite arousal and appetite persistence) and two components of self-regulation in eating (i.e. self-regulation in eating without hunger and self-regulation in eating speed). Their heights and weights were measured in order to calculate their BMI-for-age. T-tests and regression analysis were used to verify our hypotheses. None of the scores of self-regulation in eating was directly associated with BMI but we observed a significant impact of self-regulation in eating without hunger on appetite arousal (p-value = 0.04), together with a modest but significant association between appetite persistence and BMI (p-value = 0.02). We can thus conclude that our behavioural measures could be used for the determination of the child's eating temperament. Further studies are needed to investigate how to use these measures to improve the treatment of overweight in children. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. BMI and BMI SDS in childhood: annual increments and conditional change.

    Science.gov (United States)

    Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

    2017-02-01

    Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

  15. Associations between parity and maternal BMI in a population-based cohort study.

    Science.gov (United States)

    Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

    2018-02-07

    We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

  16. Know Your Body Mass Index (BMI)

    Science.gov (United States)

    ... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

  17. ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

    Science.gov (United States)

    Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

    2011-10-01

    Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

  18. Image noise-based dose adaptation in dynamic volume CT of the heart: dose and image quality optimisation in comparison with BMI-based dose adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Odedra, Devang [Queen' s University, School of Medicine, Kingston, ON (Canada); Blobel, Joerg [Toshiba Medical Systems Europe BV, Zoetermeer (Netherlands); University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada); AlHumayyd, Saad; Durand, Miranda; Jimenez-Juan, Laura; Paul, Narinder [University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada)

    2014-01-15

    To compare the image quality and radiation dose using image-noise (IN)-based determination of X-ray tube settings compared with a body mass index (BMI)-based protocol during CT coronary angiography (CTCA). Two hundred consecutive patients referred for CTCA to our institution were divided into two groups: BMI-based, 100 patients had CTCA with the X-ray tube current adjusted to the patient's BMI while maintaining a fixed tube potential of 120 kV; IN-based, 100 patients underwent imaging with the X-ray tube current and voltage adjusted to the IN measured within the mid-left ventricle on a pre-acquisition trans-axial image. Two independent cardiac radiologists performed blinded image quality assessment with quantification of the IN and signal-to-noise ratio (SNR) from the mid-LV and qualitative assessment using a three-point score. Radiation dose (CTDI and DLP) was recorded from the console. Results showed: IN (HU): BMI-based, 30.1 ± 9.9; IN-based, 33.1 ± 6.7; 32 % variation reduction (P = 0.001); SNR: BMI-based, 18.6 ± 7.1; IN-based, 15.4 ± 3.7; 48 % variation reduction (P < 0.0001). Visual scores: BMI-based, 2.3 ± 0.6; IN-based, 2.2 ± 0.5 (P = 0.54). Radiation dose: CTDI (mGy), BMI-based, 22.68 ± 8.9; IN-based, 17.16 ± 7.6; 24.3 % reduction (P < 0.001); DLP (mGy.cm), BMI-based, 309.3 ± 127.5; IN-based, 230.6 ± 105.5; 25.4 % reduction (P < 0.001). Image-noise-based stratification of X-ray tube parameters for CTCA results in 32 % improvement in image quality and 25 % reduction in radiation dose compared with a BMI-based protocol. (orig.)

  19. EFFECTS OF A SCHOOL-BASED INTERVENTION ON BMI AND MOTOR ABILITIES IN CHILDHOOD

    Directory of Open Access Journals (Sweden)

    Christine Graf

    2005-09-01

    Full Text Available Obesity in childhood is increasing worldwide. To combat overweight and obesity in childhood, the school-based Children's Health InterventionaL Trial (CHILT project combines health education and physical activity. This paper examines the effect of intervention on the body mass index (BMI and motor abilities after 20.8 ± 1.0 months in 12 randomly selected primary schools compared with 5 randomly selected control schools. The anthropometric data were assessed, BMI was calculated. Coordination was determined by lateral jumping and endurance performance by a 6-minute run. No difference in the prevalence of overweight and obesity was found between the intervention (IS and control schools (CS either at baseline or following intervention (each p > 0.05. The increase in the number of lateral jumps was significantly higher in the IS than in the CS (p < 0.001. For the 6-minute run the increase in distance run was significantly improved in IS (p = 0.020. All variables were controlled for gender and age. Overweight and obese children in both IS and CS produced significantly lower scores in coordination and endurance tasks than normal and underweight children during both examinations (each p < 0.001, adjusted for gender and age. Preventive intervention in primary schools offers an effective means to improve motor skills in childhood and to break through the vicious circle of physical inactivity - motor deficits - frustration - increasing inactivity possibly combined with an excess energy intake and weight gain. To prevent overweight and obesity these measures have to be intensified

  20. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  1. Correlation between physical activity measured by accelerometry and BMI in adolescents

    Directory of Open Access Journals (Sweden)

    Antonio Stabelini Neto

    2013-03-01

    The aim of this study was to investigate the correlation between physical activity measured by accelerometry and excess weight in schoolchildren. Three hundred and ninety one school-age adolescents (10 to 18 years old participated in the study. The cut-off points used to estimate time spent in physical activity were: moderate ≥3.0 METs and vigorous ≥6.0 METs. Student’s t-test and Pearson product-moment correlation coefficient were used to verify statistical differences and correlations between physical activity and body mass index (BMI. Statistical significance was set at p<0.05. Male schoolchildren spent more time in moderate (96.1 ± 39.6 min.day-1 and vigorous (9.7 ± 8.8 min.day-1 physical activity than their female peers (moderate: 73.7 ± 37.7 min.day-1; vigorous: 6.1 ± 6.8 min.day-1. For both sexes, younger schoolchildren (10 to 14 years old were more physically active than older ones (14 to 18 years old. Time spent in moderate-vigorous physical activity was inversely related to BMI. These findings suggest that regular physical activity (RPA is related to body weight reduction in schoolchildren. Therefore, RPA can be used as an obesity prevention strategy in elementary school.

  2. The role of culture in the context of school-based BMI screening.

    Science.gov (United States)

    Fitzgibbon, Marian L; Beech, Bettina M

    2009-09-01

    The high prevalence of overweight and obesity is a significant public health concern in the United States. Minority populations are disproportionately affected, and the impact of obesity on minority children is especially alarming. In this article we discuss school-based BMI reporting, which is intended to increase parental awareness of their children's weight status. This information could potentially lead parents of overweight and obese children to carefully examine and possibly change their children's diet and activity patterns. However, any program related to child weight status must consider culturally defined aspects of body size and shape. In other words, the cultural context in which information on child BMI is presented to and received by parents must be considered. In this article we review parental perceptions of child weight. Multiple studies have shown that parents of overweight or obese children often fail to correctly perceive their children as overweight. Possible reasons for, and implications of, this misperception of child weight status among minority parents are then explored within a cultural framework. The PEN-3 model is used to examine influences on health behaviors and could help inform the development of a culturally sensitive BMI-notification program for minority parents. Reporting materials congruent with the social and cultural values and practices of the target audience are likely to maximize program effectiveness. A culturally based BMI-notification program should be conceptualized as a small step in a comprehensive plan to reduce childhood obesity and improve the current and future health of minority children.

  3. Renal cortical volume measured using automatic contouring software for computed tomography and its relationship with BMI, age and renal function

    International Nuclear Information System (INIS)

    Muto, Natalia Sayuri; Kamishima, Tamotsu; Harris, Ardene A.; Kato, Fumi; Onodera, Yuya; Terae, Satoshi; Shirato, Hiroki

    2011-01-01

    Purpose: To evaluate the relationship between renal cortical volume, measured by an automatic contouring software, with body mass index (BMI), age and renal function. Materials and methods: The study was performed in accordance to the institutional guidelines at our hospital. Sixty-four patients (34 men, 30 women), aged 19 to 79 years had their CT scans for diagnosis or follow-up of hepatocellular carcinoma retrospectively examined by a computer workstation using a software that automatically contours the renal cortex and the renal parenchyma. Body mass index and estimated glomerular filtration rate (eGFR) were calculated based on data collected. Statistical analysis was done using the Student t-test, multiple regression analysis, and intraclass correlation coefficient (ICC). Results: The ICC for total renal and renal cortical volumes were 0.98 and 0.99, respectively. Renal volume measurements yielded a mean cortical volume of 105.8 cm 3 ± 28.4 SD, mean total volume of 153 cm 3 ± 39 SD and mean medullary volume of 47.8 cm 3 ± 19.5 SD. The correlation between body weight/height/BMI and both total renal and cortical volumes presented r = 0.6, 0.6 and 0.4, respectively, p < 0.05, while the correlation between renal cortex and age was r = -0.3, p < 0.05. eGFR showed correlation with renal cortical volume r = 0.6, p < 0.05. Conclusion: This study demonstrated that renal cortical volume had a moderate positive relationship with BMI, moderate negative relationship with age, and a strong positive relationship with the renal function, and provided a new method to routinely produce volumetric assessment of the kidney.

  4. Measures for reduction of severe accident consequences: Comprehensive evaluation of the results sponsored by the BMI

    International Nuclear Information System (INIS)

    Bracht, K.; Friedrichs, H.G.

    1989-01-01

    A number of analytical studies were initial in the past by the Federal Ministry of Interior (BMI) of FRG, to investigate the potential of additional constructive measures for risk reduction. Those measures were proposed especially against uncontrolled overpressurization of the containment due to continuous gas/steam generation, penetration of the foundation of the reactor building by melt-concrete interaction, and failure of the containment due to violent hydrogen combustion. This report gives an overview about those studies and summarizes their results. Concerning uncontrolled overpressurization, only filtered venting may be a reasonable measure, while it seems to make not much sense, to look at measures against penetration of the foundation like 'core-catcher' in further detail. To prevent hydrogen combustion with severe consequences, several potential possibilities exist, but none of them can be considered as a safe measure. Additional analysis concerning hydrogen distribution and combustion in a multi-compartment containment are necessary. All studies mentioned in this report, deal with additional constructive measures to mitigate the consequences of severe accidents. Up to day in FRG, the potential of accident prevention and mitigation of its consequences by still or again operable and already existing systems of a plant have not been investigated in detail. As indicated by first results, the use of those systems in the frame of an appropriate accident management may have a large potential for risk reduction. (orig.) [de

  5. A BMI-based occupational therapy assist suit: asynchronous control by SSVEP

    Directory of Open Access Journals (Sweden)

    Takeshi eSakurada

    2013-09-01

    Full Text Available A brain-machine interface (BMI is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS. We prepared a pre-recorded series of useful actionsa grasping-a-ball movement and a carrying-the-ball movementand added asynchronous control using steady-state visual evoked potential (SSVEP signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz in real time. Untrained, able-bodied participants (n = 12 operated the system successfully. Classification accuracy and time required for SSVEP detection were approximately 88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries; they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.

  6. A BMI-based occupational therapy assist suit: asynchronous control by SSVEP.

    Science.gov (United States)

    Sakurada, Takeshi; Kawase, Toshihiro; Takano, Kouji; Komatsu, Tomoaki; Kansaku, Kenji

    2013-01-01

    A brain-machine interface (BMI) is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS). We prepared a pre-recorded series of useful actions-a grasping-a-ball movement and a carrying-the-ball movement-and added asynchronous control using steady-state visual evoked potential (SSVEP) signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz) in real time. Untrained, able-bodied participants (n = 12) operated the system successfully. Classification accuracy and time required for SSVEP detection were ~88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries (SCIs); they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.

  7. A hybrid BMI-based exoskeleton for paresis: EMG control for assisting arm movements.

    Science.gov (United States)

    Kawase, Toshihiro; Sakurada, Takeshi; Koike, Yasuharu; Kansaku, Kenji

    2017-02-01

    Brain-machine interface (BMI) technologies have succeeded in controlling robotic exoskeletons, enabling some paralyzed people to control their own arms and hands. We have developed an exoskeleton asynchronously controlled by EEG signals. In this study, to enable real-time control of the exoskeleton for paresis, we developed a hybrid system with EEG and EMG signals, and the EMG signals were used to estimate its joint angles. Eleven able-bodied subjects and two patients with upper cervical spinal cord injuries (SCIs) performed hand and arm movements, and the angles of the metacarpophalangeal (MP) joint of the index finger, wrist, and elbow were estimated from EMG signals using a formula that we derived to calculate joint angles from EMG signals, based on a musculoskeletal model. The formula was exploited to control the elbow of the exoskeleton after automatic adjustments. Four able-bodied subjects and a patient with upper cervical SCI wore an exoskeleton controlled using EMG signals and were required to perform hand and arm movements to carry and release a ball. Estimated angles of the MP joints of index fingers, wrists, and elbows were correlated well with the measured angles in 11 able-bodied subjects (correlation coefficients were 0.81  ±  0.09, 0.85  ±  0.09, and 0.76  ±  0.13, respectively) and the patients (e.g. 0.91  ±  0.01 in the elbow of a patient). Four able-bodied subjects successfully positioned their arms to adequate angles by extending their elbows and a joint of the exoskeleton, with root-mean-square errors  exoskeleton, successfully carried a ball to a goal in all 10 trials. A BMI-based exoskeleton for paralyzed arms and hands using real-time control was realized by designing a new method to estimate joint angles based on EMG signals, and these may be useful for practical rehabilitation and the support of daily actions.

  8. A hybrid BMI-based exoskeleton for paresis: EMG control for assisting arm movements

    Science.gov (United States)

    Kawase, Toshihiro; Sakurada, Takeshi; Koike, Yasuharu; Kansaku, Kenji

    2017-02-01

    Objective. Brain-machine interface (BMI) technologies have succeeded in controlling robotic exoskeletons, enabling some paralyzed people to control their own arms and hands. We have developed an exoskeleton asynchronously controlled by EEG signals. In this study, to enable real-time control of the exoskeleton for paresis, we developed a hybrid system with EEG and EMG signals, and the EMG signals were used to estimate its joint angles. Approach. Eleven able-bodied subjects and two patients with upper cervical spinal cord injuries (SCIs) performed hand and arm movements, and the angles of the metacarpophalangeal (MP) joint of the index finger, wrist, and elbow were estimated from EMG signals using a formula that we derived to calculate joint angles from EMG signals, based on a musculoskeletal model. The formula was exploited to control the elbow of the exoskeleton after automatic adjustments. Four able-bodied subjects and a patient with upper cervical SCI wore an exoskeleton controlled using EMG signals and were required to perform hand and arm movements to carry and release a ball. Main results. Estimated angles of the MP joints of index fingers, wrists, and elbows were correlated well with the measured angles in 11 able-bodied subjects (correlation coefficients were 0.81  ±  0.09, 0.85  ±  0.09, and 0.76  ±  0.13, respectively) and the patients (e.g. 0.91  ±  0.01 in the elbow of a patient). Four able-bodied subjects successfully positioned their arms to adequate angles by extending their elbows and a joint of the exoskeleton, with root-mean-square errors  exoskeleton, successfully carried a ball to a goal in all 10 trials. Significance. A BMI-based exoskeleton for paralyzed arms and hands using real-time control was realized by designing a new method to estimate joint angles based on EMG signals, and these may be useful for practical rehabilitation and the support of daily actions.

  9. Infant BMI peak as a predictor of overweight and obesity at age 2 years in a Chinese community-based cohort

    Science.gov (United States)

    Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun

    2017-01-01

    Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164

  10. Muscle mass, BMI, and mortality among adults in the United States: A population-based cohort study.

    Science.gov (United States)

    Abramowitz, Matthew K; Hall, Charles B; Amodu, Afolarin; Sharma, Deep; Androga, Lagu; Hawkins, Meredith

    2018-01-01

    The level of body-mass index (BMI) associated with the lowest risk of death remains unclear. Although differences in muscle mass limit the utility of BMI as a measure of adiposity, no study has directly examined the effect of muscle mass on the BMI-mortality relationship. Body composition was measured by dual-energy x-ray absorptiometry in 11,687 participants of the National Health and Nutrition Examination Survey 1999-2004. Low muscle mass was defined using sex-specific thresholds of the appendicular skeletal muscle mass index (ASMI). Proportional hazards models were created to model associations with all-cause mortality. At any level of BMI ≥22, participants with low muscle mass had higher body fat percentage (%TBF), an increased likelihood of diabetes, and higher adjusted mortality than other participants. Increases in %TBF manifested as 30-40% smaller changes in BMI than were observed in participants with preserved muscle mass. Excluding participants with low muscle mass or adjustment for ASMI attenuated the risk associated with low BMI, magnified the risk associated with high BMI, and shifted downward the level of BMI associated with the lowest risk of death. Higher ASMI was independently associated with lower mortality. Effects were similar in never-smokers and ever-smokers. Additional adjustment for waist circumference eliminated the risk associated with higher BMI. Results were unchanged after excluding unintentional weight loss, chronic illness, early mortality, and participants performing muscle-strengthening exercises or recommended levels of physical activity. Muscle mass mediates associations of BMI with adiposity and mortality and is inversely associated with the risk of death. After accounting for muscle mass, the BMI associated with the greatest survival shifts downward toward the normal range. These results provide a concrete explanation for the obesity paradox.

  11. Design and optimization of an EEG-based brain machine interface (BMI to an upper-limb exoskeleton for stroke survivors

    Directory of Open Access Journals (Sweden)

    Nikunj Arunkumar Bhagat

    2016-03-01

    Full Text Available This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG-based brain machine interface (BMI. Intent was inferred from movement related cortical potentials (MRCPs measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II, to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: 1 an adaptive time window was used for extracting features during BMI calibration; 2 training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and 3 BMI predictions were gated by residual electromyography (EMG activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR = 62.7 +/- 21.4 % on day 4 and 67.1 +/- 14.6 % on day 5. The overall false positive rate (FPR across subjects was 27.74 +/- 37.46 % on day 4 and 27.5 +/- 35.64 % on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10 %. On average, motor intent was detected -367 +/- 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration.

  12. Design and Optimization of an EEG-Based Brain Machine Interface (BMI) to an Upper-Limb Exoskeleton for Stroke Survivors

    Science.gov (United States)

    Bhagat, Nikunj A.; Venkatakrishnan, Anusha; Abibullaev, Berdakh; Artz, Edward J.; Yozbatiran, Nuray; Blank, Amy A.; French, James; Karmonik, Christof; Grossman, Robert G.; O'Malley, Marcia K.; Francisco, Gerard E.; Contreras-Vidal, Jose L.

    2016-01-01

    This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG)-based brain machine interface (BMI). Intent was inferred from movement related cortical potentials (MRCPs) measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II), to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: (1) an adaptive time window was used for extracting features during BMI calibration; (2) training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and (3) BMI predictions were gated by residual electromyography (EMG) activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR) = 62.7 ± 21.4% on day 4 and 67.1 ± 14.6% on day 5. The overall false positive rate (FPR) across subjects was 27.74 ± 37.46% on day 4 and 27.5 ± 35.64% on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10%). On average, motor intent was detected −367 ± 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration. PMID:27065787

  13. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    NARCIS (Netherlands)

    Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

  14. Cycling to School Is Associated With Lower BMI and Lower Odds of Being Overweight or Obese in a Large Population-Based Study of Danish Adolescents

    DEFF Research Database (Denmark)

    Østergaard, Lars; Grøntved, Anders; Bjørkelund Børrestad, Line Anita

    2012-01-01

    Previous studies have been inconclusive concerning the effect of active transport on BMI. Our objective was to investigate the association between travel mode and BMI in a large community-based sample of Danish adolescents.......Previous studies have been inconclusive concerning the effect of active transport on BMI. Our objective was to investigate the association between travel mode and BMI in a large community-based sample of Danish adolescents....

  15. The impact of serum adropin and ischemia modified albumin levels based on BMI in PCOS.

    Science.gov (United States)

    Inal, Zeynep Ozturk; Erdem, Sami; Gederet, Yavuz; Duran, Cevdet; Kucukaydin, Zehra; Kurku, Huseyin; Sakarya, Derya Kilic

    2018-02-21

    The aim of this study was to evaluate the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on serum adropin and ischemia modified albumin (IMA) levels. This prospective cross-sectional study was performed with a total of 120 women [group1; non-PCOS = 60 (BMI PCOS = 60 (BMI PCOS and non-PCOS patients in the lean and overweight groups (pPCOS group were lower than in the lean non-PCOS group (pPCOS group than in the overweight non-PCOS group (pPCOS group than in the non-PCOS group in both the lean and overweight groups (pPCOS group, IMA levels increased. Further studies are needed to determine the effects of adropin and IMA in women with PCOS and to use a new marker to monitorize treatment outcomes.

  16. Asthma, Smoking and BMI in Adults with Intellectual Disabilities: A Community-Based Survey

    Science.gov (United States)

    Gale, L.; Naqvi, H.; Russ, L.

    2009-01-01

    Background: Recent research evidence from the general population has shown that tobacco smoking and raised body mass index (BMI) are associated with worse asthma outcomes. There are indications that asthma morbidity and mortality may be higher among people with intellectual disabilities (ID) than the general population, but the reason for this is…

  17. Gender and socioeconomic disparities in BMI trajectories in the Seychelles: a cohort analysis based on serial population-based surveys.

    Science.gov (United States)

    Rossi, Isabelle A; Rousson, Valentin; Viswanathan, Bharathi; Bovet, Pascal

    2011-12-09

    The relationship between body mass index (BMI) and socioeconomic status (SES) tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region). We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403). We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p < 0.001). The difference in BMI between men or women of high vs. low SES did not change significantly across successive cohorts (the interaction between SES and year of birth of cohort was statistically not significant). Smoking was associated with lower BMI in men and women (respectively -1.55 kg/m2 and 2.46 kg/m2, p < 0.001). Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.

  18. Gender and socioeconomic disparities in BMI trajectories in the Seychelles: a cohort analysis based on serial population-based surveys

    Directory of Open Access Journals (Sweden)

    Rossi Isabelle A

    2011-12-01

    Full Text Available Abstract Background The relationship between body mass index (BMI and socioeconomic status (SES tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region. Methods We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403. We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. Results BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p 2 and 2.46 kg/m2, p Conclusions Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.

  19. An Investigation of Factors Affecting Elementary School Students’ BMI Values Based on the System Dynamics Modeling

    Directory of Open Access Journals (Sweden)

    Tian-Syung Lan

    2014-01-01

    Full Text Available This study used system dynamics method to investigate the factors affecting elementary school students’ BMI values. The construction of the dynamic model is divided into the qualitative causal loop and the quantitative system dynamics modeling. According to the system dynamics modeling, this study consisted of research on the four dimensions: student’s personal life style, diet-relevant parenting behaviors, advocacy and implementation of school nutrition education, and students’ peer interaction. The results of this study showed that students with more adequate health concepts usually have better eating behaviors and consequently have less chance of becoming obese. In addition, this study also verified that educational attainment and socioeconomic status of parents have a positive correlation with students’ amounts of physical activity, and nutrition education has a prominent influence on changing students’ high-calorie diets.

  20. An investigation of factors affecting elementary school students' BMI values based on the system dynamics modeling.

    Science.gov (United States)

    Lan, Tian-Syung; Chen, Kai-Ling; Chen, Pin-Chang; Ku, Chao-Tai; Chiu, Pei-Hsuan; Wang, Meng-Hsiang

    2014-01-01

    This study used system dynamics method to investigate the factors affecting elementary school students' BMI values. The construction of the dynamic model is divided into the qualitative causal loop and the quantitative system dynamics modeling. According to the system dynamics modeling, this study consisted of research on the four dimensions: student's personal life style, diet-relevant parenting behaviors, advocacy and implementation of school nutrition education, and students' peer interaction. The results of this study showed that students with more adequate health concepts usually have better eating behaviors and consequently have less chance of becoming obese. In addition, this study also verified that educational attainment and socioeconomic status of parents have a positive correlation with students' amounts of physical activity, and nutrition education has a prominent influence on changing students' high-calorie diets.

  1. Discordance Between Body Mass Index (BMI) and a Novel Body Composition Change Index (BCCI) as Outcome Measures in Weight Change Interventions.

    Science.gov (United States)

    Nugent, Stephen D; Kaats, Gilbert R; Preuss, Harry G

    2018-01-01

    A general assumption is that the body mass index (BMI) reflects changes in fat mass (FM). However, it fails to distinguish the type of weight that is lost or gained-fat mass (FM) or fat-free mass (FFM). The BMI treats both changes the same although they have opposite health consequences. The objective of this study was to propose a more precise measure, a body composition change index (BCCI), which distinguishes between changes in FM and FFM, and this study compares it with using the BMI as an outcome measure. Data were obtained from 3,870 subjects who had completed dual-energy x-ray absorptiometry (DEXA) total body scans at baseline and end-of-study when participating in a variety of weight-loss interventions. Since height remained constant in this adult cohort, changes in the BMI corresponded with scale weight changes (r = 0.994), allowing BMI changes to be converted to "lbs." to match the statistic used for calculation of the BCCI. The BCCI is calculated by scoring increases in FFM (lbs.) and decreases in FM (lbs.) as positive outcomes and scoring decreases in FFM and increases in FM as negative outcomes. The BCCI is the net sum of these calculations. Differences between scale weight changes and BCCI values were subsequently compared to obtain "discordance scores." Discordance scores ranged from 0.0 lbs. to >30.0 lbs. with a mean absolute value of between the two measures of 7.79 lbs. (99% confidence interval: 7.49-8.10, p BCCI and the BMI to evaluate the efficacy of weight loss interventions. If assessing changes in body composition is a treatment goal, use of the BMI could result in significantly erroneous conclusions.

  2. Group-based developmental BMI trajectories, polycystic ovary syndrome, and gestational diabetes: a community-based longitudinal study.

    Science.gov (United States)

    Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E

    2017-11-06

    Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.

  3. Differences in genetic and environmental variation in adult BMI by sex, age, time period, and region: an individual-based pooled analysis of 40 twin cohorts.

    Science.gov (United States)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo; Yokoyama, Yoshie; Hur, Yoon-Mi; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Honda, Chika; Inui, Fujio; Iwatani, Yoshinori; Watanabe, Mikio; Tomizawa, Rie; Pietiläinen, Kirsi H; Rissanen, Aila; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Tan, Qihua; Zhang, Dongfeng; Pang, Zengchang; Piirtola, Maarit; Aaltonen, Sari; Öncel, Sevgi Y; Aliev, Fazil; Rebato, Esther; Hjelmborg, Jacob B; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Silberg, Judy L; Eaves, Lindon J; Cutler, Tessa L; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Song, Yun-Mi; Yang, Sarah; Lee, Kayoung; Franz, Carol E; Kremen, William S; Lyons, Michael J; Busjahn, Andreas; Nelson, Tracy L; Whitfield, Keith E; Kandler, Christian; Jang, Kerry L; Gatz, Margaret; Butler, David A; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Duncan, Glen E; Buchwald, Dedra; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Jeong, Hoe-Uk; Swan, Gary E; Krasnow, Ruth; Magnusson, Patrik Ke; Pedersen, Nancy L; Dahl Aslan, Anna K; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; Tynelius, Per; Baker, Laura A; Tuvblad, Catherine; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Spector, Timothy D; Mangino, Massimo; Lachance, Genevieve; Burt, S Alexandra; Klump, Kelly L; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas S; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Corley, Robin P; Huibregtse, Brooke M; Bartels, Meike; van Beijsterveldt, Catharina Em; Willemsen, Gonneke; Goldberg, Jack H; Rasmussen, Finn; Tarnoki, Adam D; Tarnoki, David L; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth Jf; Hopper, John L; Sung, Joohon; Maes, Hermine H; Turkheimer, Eric; Boomsma, Dorret I; Sørensen, Thorkild Ia; Kaprio, Jaakko

    2017-08-01

    Background: Genes and the environment contribute to variation in adult body mass index [BMI (in kg/m 2 )], but factors modifying these variance components are poorly understood. Objective: We analyzed genetic and environmental variation in BMI between men and women from young adulthood to old age from the 1940s to the 2000s and between cultural-geographic regions representing high (North America and Australia), moderate (Europe), and low (East Asia) prevalence of obesity. Design: We used genetic structural equation modeling to analyze BMI in twins ≥20 y of age from 40 cohorts representing 20 countries (140,379 complete twin pairs). Results: The heritability of BMI decreased from 0.77 (95% CI: 0.77, 0.78) and 0.75 (95% CI: 0.74, 0.75) in men and women 20-29 y of age to 0.57 (95% CI: 0.54, 0.60) and 0.59 (95% CI: 0.53, 0.65) in men 70-79 y of age and women 80 y of age, respectively. The relative influence of unique environmental factors correspondingly increased. Differences in the sets of genes affecting BMI in men and women increased from 20-29 to 60-69 y of age. Mean BMI and variances in BMI increased from the 1940s to the 2000s and were greatest in North America and Australia, followed by Europe and East Asia. However, heritability estimates were largely similar over measurement years and between regions. There was no evidence of environmental factors shared by co-twins affecting BMI. Conclusions: The heritability of BMI decreased and differences in the sets of genes affecting BMI in men and women increased from young adulthood to old age. The heritability of BMI was largely similar between cultural-geographic regions and measurement years, despite large differences in mean BMI and variances in BMI. Our results show a strong influence of genetic factors on BMI, especially in early adulthood, regardless of the obesity level in the population. © 2017 American Society for Nutrition.

  4. Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

    Science.gov (United States)

    Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

    2018-01-01

    Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

  5. Increased Coagulation and Decreased Fibrinolysis as Measured with Overall Hemostatic Potential Are Dependent on BMI and Not Associated with PCOS.

    Science.gov (United States)

    Rakusa, Matej; Jensterle, Mojca; Božič-Mijovski, Mojca; Janez, Andrej

    2017-05-01

    Overall hemostatic potential (OHP) captures all factors that affect coagulation and fibrinolysis cascade. It has not yet been assessed in polycystic ovary syndrome (PCOS). The aim of the study was to identify the relationship of OHP with a syndrome per se and body mass index (BMI). In 90 women with PCOS aged 30.9 ± 8.1 years (50 obese, 13 overweight, and 27 lean) and 21 healthy age-matched controls (11 obese and 10 lean), OHP with overall coagulation potential (OCP) and overall fibrinolytic potential (OFP) was determined spectrophotometrically. OFP was calculated. OHP increased with BMI in PCOS (9.6 ± 2.3 in lean, 12.5 ± 5.1 in overweight, and 15.5 ± 3.8 Abs-sum in obese) and in controls (9.1 ± 1.0 in lean and 17.3 ± 4.6 Abs-sum in obese). There was significant difference between lean and obese PCOS (P PCOS (P PCOS (P PCOS did not differ significantly, while OHP for healthy obese was increased in comparison to overweight and lean PCOS (P PCOS was not associated with increased OHP compared with BMI and age-matched controls. However, increase in OHP was positively associated with BMI in PCOS and healthy women.

  6. A population study of 5 to 15 year olds: full time maternal employment not associated with high BMI. The importance of screen-based activity, reading for pleasure and sleep duration in children's BMI.

    Science.gov (United States)

    Taylor, Anne W; Winefield, Helen; Kettler, Lisa; Roberts, Rachel; Gill, Tiffany K

    2012-04-01

    To describe the relationship between maternal full time employment and health-related and demographic variables associated with children aged 5-15 years, and the factors associated with child overweight/obesity. Data from a chronic disease and risk factor surveillance system were limited to children aged 5-15 years whose mothers responded on their behalf (n = 641). Univariate/multivariate analyses described the differences between mothers who did and did not work full time. The same data were analysed comparing children who are overweight/obese against those with a normal BMI. The children of mothers who worked full time are more likely to be older, live in a household with a higher household income, be an only child or have one sibling or other child in the household, have a sole mother family structure and not spend any time reading for pleasure. No relationship was found between maternal employment and BMI. Compared with children of normal weight, those who were overweight/obese were more likely to spend no time studying, spend more than 2 h per day in screen-based activity and sleep less than 10 h per night. Child BMI status was not related to maternal employment. Although this analysis included eight diet related variables none proved to be significant in the final models.This study has shown that mothers' working status is not related to children's BMI. The relationship between overweight/obesity of children and high levels of screen-based activity, low levels of studying, and short sleep duration suggests a need for better knowledge and understanding of sedentary behaviours of children.

  7. Objectively measured active travel and uses of activity-friendly neighborhood resources: Does change in use relate to change in physical activity and BMI?

    Directory of Open Access Journals (Sweden)

    Barbara B. Brown

    2017-12-01

    Full Text Available Few studies examine how objectively measured use of local physical activity resources contributes to objectively-measured healthy physical activity and weight changes over time. We utilized objective measures to test whether changes in active travel and uses of three physical activity (PA resources–parks, recreation centers, and transit– related to changes in PA and BMI. Adults (n=536 in Salt Lake City, UT, wore accelerometer and GPS units in 2012 and 2013, before and after neighborhood rail completion. Regression outcomes included accelerometer counts per minute (cpm, MVPA (moderate-to-vigorous activity minutes/10h accelerometer wear and measured BMI; key predictors were changes in active travel and PA resource uses (former and new uses. Significant results (all p<0.05 showed that increased active travel related to increased total PA (59.86cpm and 8.50 MVPA; decreased active travel related to decreased MVPA (−3.01 MVPA. Poorer outcomes were seen after discontinuing use of parks (−36.29cpm, −5.73 MVPA, and +0.44 BMI points, recreation centers (−6.18 MVPA, and transit (−48.14cpm, −5.43 MVPA, and +0.66 BMI. Healthier outcomes were seen after commencing use of parks (29.83cpm, 5.25 MVPA, recreation centers (44.63cpm and transit (38.44cpm, 4.17 MVPA, and −0.56 BMI. Transit and park/recreational center uses were unrelated, although park users were more likely to be recreation center users. Active travel and use of three neighborhood PA resources relate to healthy activity and could be fostered by policy and design. Keywords: Recreation center, Accelerometry, Active transport, Built environment, Parks, Global positioning system

  8. About BMI for Adults

    Science.gov (United States)

    ... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

  9. Maternal pre-pregnancy BMI and intelligence quotient (IQ) in 5-year-old children: a cohort based study.

    Science.gov (United States)

    Bliddal, Mette; Olsen, Jørn; Støvring, Henrik; Eriksen, Hanne-Lise F; Kesmodel, Ulrik S; Sørensen, Thorkild I A; Nøhr, Ellen A

    2014-01-01

    An association between maternal pre-pregnancy BMI and childhood intelligence quotient (IQ) has repeatedly been found but it is unknown if this association is causal or due to confounding caused by genetic or social factors. We used a cohort of 1,783 mothers and their 5-year-old children sampled from the Danish National Birth Cohort. The children participated between 2003 and 2008 in a neuropsychological assessment of cognitive ability including IQ tests taken by both the mother and the child. Linear regression analyses were used to estimate the associations between parental BMI and child IQ adjusted for a comprehensive set of potential confounders. Child IQ was assessed with the Wechsler Primary and Preschool Scales of Intelligence--Revised (WPPSI-R). The crude association between maternal BMI and child IQ showed that BMI was adversely associated with child IQ with a reduction in IQ of -0.40 point for each one unit increase in BMI. This association was attenuated after adjustment for social factors and maternal IQ to a value of -0.27 (-0.50 to -0.03). After mutual adjustment for the father's BMI and all other factors except maternal IQ, the association between paternal BMI and child IQ yielded a regression coefficient of -0.26 (-0.59 to 0.07), which was comparable to that seen for maternal BMI (-0.20 (-0.44 to 0.04)). Although maternal pre-pregnancy BMI was inversely associated with the IQ of her child, the similar association with paternal BMI suggests that it is not a specific pregnancy related adiposity effect.

  10. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    Science.gov (United States)

    Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

  11. Soft drink intake at age six and nine and the association with BMI three and seven years later - A follow-up study based on the Copenhagen School Child Intervention Study (CoSCIS)

    DEFF Research Database (Denmark)

    Jensen, Britt Wang; Nielsen, Birgit Marie; Husby, Ida

    Introduction: The consumption of sugar-sweetened beverages is one of the few dietary components that have been associated with the development of obesity. However, most previous studies have been based on children or adolescents aged 8 years or more. Method: The study was based on the Copenhagen......-days pre-printed food record. Analyses were conducted using the mixed model approach for repeated measurements and were adjusted for gender, puberty, parental BMI, municipality, school, baseline BMI, SES and physical activity. Results: 154 children, 68 boys and 86 girls were included in the analyses....... Mean intake of soft drinks was 0.14 l/d at age 6 and 0.12 l/d at age 9 (difference p=0.08). No associations were found between intake of soft drink at age 6 and BMI at age 13 (b:-0.8; p=0.91), or intake at age 9 and BMI at age 13 (b:-0.3; p= 0.80). Neither was the change in intake of soft drinks from...

  12. The impact of follicular fluid adiponectin and ghrelin levels based on BMI on IVF outcomes in PCOS.

    Science.gov (United States)

    Inal, H A; Yilmaz, N; Gorkem, U; Oruc, A S; Timur, H

    2016-04-01

    This study aimed at evaluating the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on follicular fluid (FF) adiponectin and ghrelin levels, and on in vitro fertilization outcomes in patients who underwent controlled ovarian hyperstimulation. This prospective cross-sectional study was performed with a total of 120 primary infertile women [group 1; non-PCOS = 60 (BMI PCOS = 60 (BMI lean PCOS group than the lean non-PCOS group (p = 0.001), and these levels were lower in the overweight non-PCOS group compared to lean non-PCOS group (0.001). However, there was no difference in the FF ghrelin levels between the groups. Additionally, we could not find a relationship between clinical pregnancy and adiponectin and ghrelin levels. The FF adiponectin and ghrelin levels have no effects on clinical pregnancy in PCOS. Therefore, further studies are needed to elucidate this issue.

  13. Associations of genetic risk scores based on adult adiposity pathways with childhood growth and adiposity measures

    OpenAIRE

    Monnereau, Claire; Vogelezang, Suzanne; Kruithof, Claudia J.; Jaddoe, Vincent W. V.; Felix, Janine F.

    2016-01-01

    Background Results from genome-wide association studies (GWAS) identified many loci and biological pathways that influence adult body mass index (BMI). We aimed to identify if biological pathways related to adult BMI also affect infant growth and childhood adiposity measures. Methods We used data from a population-based prospective cohort study among 3,975 children with a mean age of 6?years. Genetic risk scores were constructed based on the 97 SNPs associated with adult BMI previously identi...

  14. The Report Card on BMI Report Cards.

    Science.gov (United States)

    Thompson, Hannah R; Madsen, Kristine A

    2017-06-01

    Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

  15. BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

    Science.gov (United States)

    Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

    2018-01-01

    Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

  16. Maternal nutritional status (as measured by height, weight and BMI) in Bangladesh: trends and socio-economic association over the period 1996 to 2007.

    Science.gov (United States)

    Mohsena, Masuda; Goto, Rie; Mascie-Taylor, Cg Nicholas

    2016-06-01

    To analyse trends in maternal nutritional status in Bangladesh over a 12-year period and to examine the associations between nutritional status and socio-economic variables. Maternal nutritional status indicators were height, weight and BMI. Socio-economic variables used were region, residency, education and occupation of the mothers and their husbands, house type, and possession score in the household. Bangladesh Demographic and Health Surveys (1996, 2000, 2004 and 2007) were the source of data. A total of 16 278 mothers were included. All of the socio-economic variables showed significant associations with maternal nutritional status indicators. Regional variation was found to be present; all three indicators were found to be lowest in the Sylhet division. Upward trends in maternal height, weight and BMI were evident from no possessions to four possessions in households, and for no education to higher education of women and their husbands. Bangladeshi mothers measured in 2007 were found to be on average 0·34 cm taller and 3·36 kg heavier than mothers measured in 1996. Between 1996 and 2007 maternal underweight fell from nearly 50 % to just over 30 % while overweight and obesity increased from about 3 % to over 9 % (WHO cut-offs) or from 7 % to nearly 18 % (Asian cut-offs). The study reveals that over the 12-year period in Bangladesh there has been a substantial reduction in maternal underweight accompanied by a considerable increase in obesity. It is also evident that malnutrition in Bangladesh is a multidimensional problem that warrants a proper policy mix and programme intervention.

  17. The role of a FADS1 polymorphism in the association of fatty acid blood levels, BMI and blood pressure in young children-Analyses based on path models.

    Directory of Open Access Journals (Sweden)

    Maike Wolters

    Full Text Available The recent obesity epidemic in children also showed an increase in the prevalence of hypertension. As blood pressure (BP is associated with (long-chain polyunsaturated fatty acids (LC PUFA, genetic variation in desaturase enzymes being involved in the synthesis of LC PUFA may be associated with BP. This study aimed to investigate the direct effects (independent of mediating variables and indirect effects (mediated through intermediate variables of a common variant in the FADS1 gene, rs174546, known to affect delta-5 desaturase (D5D activity on PUFA level, body mass index (BMI and BP.A subsample of the IDEFICS (Identification and prevention of dietary- and lifestyle-induced health effects in children and infants baseline survey including 520 children aged 2 to <10 years from six European countries was included. The association between rs174546 (TBMI z-score were investigated through path model analyses, adjusting for sex, age, educational level of parents, family history of hypertension, lifestyle factors and blood levels of saturated and monounsaturated fatty acids, triglycerides and low density lipoprotein cholesterol. Whole blood fatty acids were measured by a validated gas chromatographic method and recorded as percentage of weight of all fatty acids detected.Minor allele carriers of the SNP rs174546 had significantly higher DGLA and lower ARA and EPA levels as well as a lower D5D index. Via ARA and BMI z-score, the polymorphism had an indirect lowering effect on systolic BP z-score for each additional T allele (standardized effect estimate -0.057, p = 0.007. For DGLA, EPA and D5D index, the indirect effects of rs174546 on systolic BP were also negative but did not reach significance. DGLA and EPA had an increasing indirect effect on

  18. Representativeness and optimal use of body mass index (BMI) in the UK Clinical Practice Research Datalink (CPRD)

    Science.gov (United States)

    Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam

    2013-01-01

    Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008

  19. Relationship between body fat and BMI in a U.S. Hispanic population-based cohort study: Results from HCHS/SOL

    Science.gov (United States)

    To evaluate the percentage of body fat (%BF)-BMI relationship, identify %BF levels corresponding to adult BMI cut points, and examine %BF-BMI agreement in a diverse Hispanic/Latino population. %BF by bioelectrical impedance analysis was corrected against %BF by 18O dilution in 434 participants of th...

  20. Low birth weight, adult BMI and inflammation in middle age

    DEFF Research Database (Denmark)

    Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten

    2013-01-01

    This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...

  1. Refractive index based measurements

    DEFF Research Database (Denmark)

    2014-01-01

    In a method for performing a refractive index based measurement of a property of a fluid such as chemical composition or temperature by observing an apparent angular shift in an interference fringe pattern produced by back or forward scattering interferometry, ambiguities in the measurement caused...... by the apparent shift being consistent with one of a number of numerical possibilities for the real shift which differ by 2n are resolved by combining measurements performed on the same sample using light paths therethrough of differing lengths....

  2. Refractive index based measurements

    DEFF Research Database (Denmark)

    2014-01-01

    In a method for performing a refractive index based measurement of a property of a fluid such as chemical composition or temperature, a chirp in the local spatial frequency of interference fringes of an interference pattern is reduced by mathematical manipulation of the recorded light intensity...

  3. Prospectively measured lifestyle factors and BMI explain differences in health-related quality of life between colorectal cancer patients with and without comorbid diabetes

    NARCIS (Netherlands)

    Vissers, P.A.J.; Thong, M.S.Y.; Pouwer, F.; Creemers, G.-J.; Slooter, G.D.; van de Poll-Franse, L.V.

    2016-01-01

    Purpose This study aimed to assess the longitudinal association between lifestyle factors, body mass index (BMI), and health-related quality of life (HRQoL) among colorectal cancer patients with (CRCDM+) and without diabetes (CRCDM−). Methods Data from a longitudinal study among CRC patients

  4. Prospectively measured lifestyle factors and BMI explain differences in health-related quality of life between colorectal cancer patients with and without comorbid diabetes.

    Science.gov (United States)

    Vissers, Pauline A J; Thong, Melissa S Y; Pouwer, Frans; Creemers, Geert-Jan; Slooter, Gerrit D; van de Poll-Franse, Lonneke V

    2016-06-01

    This study aimed to assess the longitudinal association between lifestyle factors, body mass index (BMI), and health-related quality of life (HRQoL) among colorectal cancer patients with (CRCDM+) and without diabetes (CRCDM-). Data from a longitudinal study among CRC patients diagnosed between 2000 and 2009 were used. Clinical characteristics were retrieved from the Netherlands Cancer Registry and questionnaires were sent in 2010, 2011, and 2012 using the Patient Reported Outcomes Following Initial Treatment and Long term Evaluation of Survivorship (PROFILES) registry. Lifestyle (including moderate-to-vigorous physical activity (MVPA), smoking and alcohol use), BMI, diabetes status, and HRQoL were assessed in the questionnaire. One thousand seven hundred thirty-nine (49 %) patients responded to ≥2 questionnaires, of whom 126 CRCDM+ and 789 CRCDM- patients were included. CRCDM+ patients had a higher BMI (29.1 ± 4.2 vs. 26.4 ± 3.7 kg/m(2)), whereas the number of alcohol users was lower (50 vs. 70 %, p value lifestyle factors and BMI which were all significant predictors of HRQoL. Additional adjustment for comorbidity further attenuated the main effect of DM on HRQoL. Diabetes was not independently associated with HRQoL but deteriorated HRQoL among CRCDM+ patients seem to be explained by an unhealthier lifestyle and other comorbid conditions. Moreover, residual confounding cannot be ruled out.

  5. Modification of Bisphenol-A Based Bismaleimide Resin (BPA-BMI) with an Allyl-Terminated Hyperbranched Polyimide (AT-PAEKI)

    National Research Council Canada - National Science Library

    Qin, Haihu; Mather, Patrick T; Baek, Jong-Beom; Tan, Loon-Seng

    2006-01-01

    ... bismaleimide resin (BPA-BMI). This was pursued in anticipation of improvements in processability as well as physical properties including glass transition temperature, elastic modulus, and fracture toughness...

  6. Refractive index based measurements

    DEFF Research Database (Denmark)

    2014-01-01

    A refractive index based measurement of a property of a fluid is measured in an apparatus comprising a variable wavelength coherent light source (16), a sample chamber (12), a wavelength controller (24), a light sensor (20), a data recorder (26) and a computation apparatus (28), by - directing...... coherent light having a wavelength along an input light path, - producing scattering of said light from each of a plurality of interfaces within said apparatus including interfaces between said fluid and a surface bounding said fluid, said scattering producing an interference pattern formed by said...... scattered light, - cyclically varying the wavelength of said light in said input light path over a 1 nm to 20nm wide range of wavelengths a rate of from 10Hz to 50 KHz, - recording variation of intensity of the interfering light with change in wavelength of the light at an angle of observation...

  7. The Non-Linear Relationship between BMI and Health Care Costs and the Resulting Cost Fraction Attributable to Obesity.

    Science.gov (United States)

    Laxy, Michael; Stark, Renée; Peters, Annette; Hauner, Hans; Holle, Rolf; Teuner, Christina M

    2017-08-30

    This study aims to analyse the non-linear relationship between Body Mass Index (BMI) and direct health care costs, and to quantify the resulting cost fraction attributable to obesity in Germany. Five cross-sectional surveys of cohort studies in southern Germany were pooled, resulting in data of 6757 individuals (31-96 years old). Self-reported information on health care utilisation was used to estimate direct health care costs for the year 2011. The relationship between measured BMI and annual costs was analysed using generalised additive models, and the cost fraction attributable to obesity was calculated. We found a non-linear association of BMI and health care costs with a continuously increasing slope for increasing BMI without any clear threshold. Under the consideration of the non-linear BMI-cost relationship, a shift in the BMI distribution so that the BMI of each individual is lowered by one point is associated with a 2.1% reduction of mean direct costs in the population. If obesity was eliminated, and the BMI of all obese individuals were lowered to 29.9 kg/m², this would reduce the mean direct costs by 4.0% in the population. Results show a non-linear relationship between BMI and health care costs, with very high costs for a few individuals with high BMI. This indicates that population-based interventions in combination with selective measures for very obese individuals might be the preferred strategy.

  8. Comparison of Body Mass Index (BMI) Categories Based on Asian and Universal Standards and Language Spoken at Home among Asian American University Students

    Science.gov (United States)

    Ng, Tiffany; McMahan, Shari; Mouttapa, Michele; Tanjasiri, Sora Park; Beam, William

    2009-01-01

    Background: The World Health Organization released lower Body Mass Index (BMI) cutoff points for Asian individuals to account for increased body fat percentage (BF%) and risk of obesity-related conditions at a lower body mass index. Purpose: This preliminary study: (1) explores the impact of utilizing Asian BMI standards (compared to universal…

  9. Socioeconomic differences in childhood BMI trajectories in Belarus.

    Science.gov (United States)

    Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

    2018-02-28

    To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

  10. Association of BMI and height with the risk of endometrial cancer, overall and by histological subtype: a population-based prospective cohort study in Japan.

    Science.gov (United States)

    Kawachi, Asuka; Shimazu, Taichi; Budhathoki, Sanjeev; Sawada, Norie; Yamaji, Taiki; Iwasaki, Motoki; Inoue, Manami; Tsugane, Shoichiro

    2018-04-18

    Evidence on the association between BMI, height, and endometrial cancer risk, including by subtypes, among Asian populations remains limited. We evaluated the impact of BMI and height on the risk of endometrial cancer, overall and by histological subtype. We prospectively investigated 53 651 Japanese women aged 40-69 years. With an average follow-up duration of 18.6 years, 180 newly diagnosed endometrial cancers were reported, including 119 type 1 and 21 type 2. The association between BMI, height, and endometrial cancer risk was assessed using a Cox proportional hazards regression model with adjustment for potential confounders. Overweight and obesity were associated positively with the risk of endometrial cancer. Compared with BMI of 23.0-24.9 kg/m, hazard ratios (HRs) (95% confidence intervals) were 1.93 (1.17-3.16) for BMI of 27.0-29.9 kg/m and 2.37 (1.20-4.66) for BMI of at least 30.0 kg/m. On analysis by histological subtype, with each increase in BMI of 5 U, the estimated HR of type 1 endometrial cancer increased (HR=1.54, 95% confidence interval: 1.21-1.98), but HR of type 2 endometrial cancer was unaffected. There was no statistically significant association between height and endometrial cancer risk. In conclusion, the risk of endometrial cancer was elevated in women with a BMI of at least 27.0 kg/m. By histological subtype, BMI was associated with type 1, but not type 2 endometrial cancer risk among a population with a relatively low BMI compared with western populations.

  11. Child fitness and father's BMI are important factors in childhood obesity: a school based cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Sinead Brophy

    Full Text Available BACKGROUND: This study examines obesity and factors associated with obesity in children aged 11-13 years in the UK. METHODS: 1147 children from ten secondary schools participated in a health survey that included blood samples, fitness test and anthropometric measures. Factors associated with obesity were examined using multilevel logistic regression. FINDINGS: Of the children examined (490 male; 657 female a third were overweight, 1 in 6 had elevated blood pressure, more than 1 in 10 had high cholesterol, 58% consumed more fat than recommended, whilst 37% were classified as unfit. Children in deprived areas had a higher proportion of risk factors; for example, they had higher blood pressure (20% (deprived compared to 11% (non-deprived, difference: 9.0% (95%CI: 4.7%-13.4%. Obesity is associated with risk factors for heart disease and diabetes. Maintaining fitness is associated with a reduction in the risk factors for heart disease (high blood pressure and cholesterol but not on risk factors for diabetes (insulin levels. In order of importance, the main risk factors for childhood obesity are being unfit, having an obese father, and being large at birth. CONCLUSION: The high proportion of children with risk factors suggests future interventions need to focus on community and policy change to shift the population norm rather than targeting the behaviour of high risk individuals. Interventions need to focus on mothers' lifestyle in pregnancy, fathers' health, as well as promoting fitness among children. Obesity was not associated with deprivation. Therefore, strategies should be adopted in both deprived and non deprived areas.

  12. BMI Trajectories from Birth to Young Adulthood.

    Science.gov (United States)

    McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

    2018-04-19

    This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

  13. Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

    Science.gov (United States)

    Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

    2018-01-01

    Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

  14. Definition of new cut-offs of BMI and waist circumference based on body composition and insulin resistance: differences between children, adolescents and adults.

    Science.gov (United States)

    Hübers, M; Pourhassan, M; Braun, W; Geisler, C; Müller, M J

    2017-09-01

    This study aims to determine associations between anthropometric traits, regional fat depots and insulin resistance in children, adolescents and adults to define new cut-offs of body mass index (BMI) or waist circumference (WC). Cross-sectional data were assessed in 433 children, adolescents and adults (aged: 6-60 years, BMI: 23.6 [21.0-27.7] kg m -2 ). Total adipose tissue (TAT), regional subcutaneous adipose tissue (SAT total , SAT trunk ) and visceral adipose tissue (VAT) were determined by whole-body magnetic resonance imaging, fat mass by air-displacement plethysmography. Insulin resistance was evaluated by homeostasis model assessment of insulin resistance (HOMA-IR). Bivariate as well as partial correlations and regression analyses were used. Cut-off values of BMI and WC related to regional fat depots and HOMA-IR were analysed by receiver operating characteristics curve. In adults, TAT, SAT total and SAT trunk increased linearly with increasing BMI and WC, whereas they followed a cubic function in children and adolescents with a steep increase at BMI and WC ≥1 standard deviation score and VAT at WC ≥2 standard deviation score. Sex differences were apparent in adults with women having higher masses of TAT and SAT and men having higher VAT. Using established BMI or WC cut-offs, correspondent masses of TAT, SAT total , SAT trunk and VAT increased from childhood to adulthood. In all age groups, there were positive associations between BMI, WC, SAT trunk , VAT and HOMA-IR. When compared with normative cut-offs of BMI or WC, HOMA-IR-derived cut-offs of regional fat depots were lower in all age groups. Associations between BMI, WC and regional fat depots varied between children, adolescents, young and older adults. When compared with BMI-derived and WC-derived values, an insulin resistance-derived cut-off corresponded to lower masses of regional fat depots. Thus, established BMI and WC cut-offs are not appropriate to assess metabolic disturbances associated

  15. Evaluation of the Effectiveness of Nutritional Education based on Health Belief Model on Self-Esteem and BMI of Overweight and at Risk of Overweight Adolescent Girls

    Directory of Open Access Journals (Sweden)

    Leili Rabiei

    2017-08-01

    Full Text Available Background Due to significant increases in the prevalence of overweight and obesity in adolescents in developed countries, much attention has been focused on this issue. This study aimed to determine the effectiveness of nutritional education based on Health Belief Model (HBM on self-esteem and body mass index (BMI of overweight and at risk of overweight adolescent girls. Materials and Methods: The study subjects consist of 140 female students recruited from two high schools, who were randomly allocated to the intervention (n=70 and control (n=70 groups. The data collection instrument included sections on socio-demographic status, transportation method, physical status, and knowledge and attitudes of the students towards nutrition, which was designed according to HBM. As the intervention, model-based educational program was implemented through six 60-minute sessions, focusing on the overweight and at-risk students. Results were compared in the beginning, and three months after the intervention to find the possible impacts. Results: Average score of model structures and self-esteem of students in both groups had no significant difference at baseline, but immediately after the intervention and 3 months after treatment, the mean component scores were significantly higher in intervention group than controls (P

  16. The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.

    Science.gov (United States)

    Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H

    2018-02-21

    The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.

  17. Community-Specific BMI Cutoff Points for South Indian Females

    Directory of Open Access Journals (Sweden)

    K. B. Kishore Mohan

    2011-01-01

    Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

  18. Prospectively measured lifestyle factors and BMI explain differences in health-related quality of life between colorectal cancer patients with and without comorbid diabetes

    DEFF Research Database (Denmark)

    Vissers, Pauline A J; Thong, Melissa S Y; Pouwer, Frans

    2016-01-01

    predictors of HRQoL. Additional adjustment for comorbidity further attenuated the main effect of DM on HRQoL. CONCLUSIONS: Diabetes was not independently associated with HRQoL but deteriorated HRQoL among CRCDM+ patients seem to be explained by an unhealthier lifestyle and other comorbid conditions. Moreover......PURPOSE: This study aimed to assess the longitudinal association between lifestyle factors, body mass index (BMI), and health-related quality of life (HRQoL) among colorectal cancer patients with (CRCDM+) and without diabetes (CRCDM-). METHODS: Data from a longitudinal study among CRC patients...... diagnosed between 2000 and 2009 were used. Clinical characteristics were retrieved from the Netherlands Cancer Registry and questionnaires were sent in 2010, 2011, and 2012 using the Patient Reported Outcomes Following Initial Treatment and Long term Evaluation of Survivorship (PROFILES) registry. Lifestyle...

  19. Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

    Science.gov (United States)

    Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

    2013-12-01

    Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

  20. BMI change during puberty and the risk of heart failure.

    Science.gov (United States)

    Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

    2018-03-12

    Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

  1. Food brand recognition and BMI in preschoolers.

    Science.gov (United States)

    Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally

    2017-07-01

    Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Females, younger patients and patients with high BMI have the highest pre-operative knee awareness measured using the Forgotten Joint Score

    DEFF Research Database (Denmark)

    Li, Dana; Troelsen, A; Ingelsrud, L

    2018-01-01

    PURPOSE: The Forgotten Joint Score (FJS) is a novel measurement for patients' awareness of their knee in daily life. By identifying factors that could explain pre-operative FJS levels, the clinician could better prioritize and single out patients who would benefit most from TKA. The aim of this s...

  3. Body image, BMI, and physical activity in girls and boys aged 14-16 years.

    Science.gov (United States)

    Kantanista, Adam; Osiński, Wiesław; Borowiec, Joanna; Tomczak, Maciej; Król-Zielińska, Magdalena

    2015-09-01

    The aim of this study was to investigate the relationship between body image, body mass index (BMI), and physical activity in adolescents. The study included 1702 girls and 1547 boys aged 14-16 years. Moderate-to-vigorous physical activity (MVPA) was evaluated by the Physical Activity Screening Measure. Body image was assessed using the Feelings and Attitudes Towards the Body Scale, and participants' BMI was determined based on measured height and weight. Compared to boys, girls reported more negative body image (pboys than in girls. These findings suggest that body image, rather than BMI, is important in undertaking physical activity in adolescents and should be considered when preparing programs aimed at improving physical activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Food and drinking patterns as predictors of 6-year BMI-adjusted changes in waist circumference

    DEFF Research Database (Denmark)

    Halkjær, Jytte; Sørensen, Thorkild I A; Tjønneland, Anne

    2004-01-01

    Few studies have investigated the prospective associations between diet or drinking patterns and abdominal obesity; we therefore investigated whether food and beverage groups or patterns predicted 6-year changes in waist circumference (WC) and whether these associations were independent...... of concurrent changes in BMI as a measure of general obesity. The subjects were 2300 middle-aged men and women with repeated measurements of dietary intake, BMI and WC from 1982 to 1993. Intakes from ten food groups and from coffee, tea, wine, beer and spirits were assessed; gender-specific food factors were......, but the associations were weakened, especially for women, after adjustment for BMI changes. None of the food factors was associated with WC changes. Based on the present study, we conclude that very few food items and no food patterns seem to predict changes in WC, whereas high intakes of beer and spirits among women...

  5. BMI and waist circumference cut-offs for corresponding levels of insulin sensitivity in a Middle Eastern immigrant versus a native Swedish population - the MEDIM population based study.

    Science.gov (United States)

    Bennet, Louise; Stenkula, Karin; Cushman, Samuel W; Brismar, Kerstin

    2016-12-09

    The aim of this study was to identify corresponding body mass index (BMI) and waist circumference cut-offs for equivalent levels of insulin sensitivity in a Middle Eastern immigrant population compared with native Swedes. Citizens of Malmö, Sweden aged 30 to 75 years, who were born in Iraq or Sweden, were in 2010-2012 invited to participate in a health examination including anthropometrics, oral glucose tolerance test, fasting samples and interviews concerning sociodemographic factors and lifestyle behaviours. In total, 1176 individuals born in Iraq and 688 born in Sweden, without previously diagnosed type 2 diabetes, participated in the study. In normal weight participants (BMI Middle Eastern populations.

  6. Associations between toddlers' and parents' BMI, in relation to family socio-demography: a cross-sectional study.

    Science.gov (United States)

    Lindkvist, Marie; Ivarsson, Anneli; Silfverdal, Sven Arne; Eurenius, Eva

    2015-12-17

    It is well established that the pregnancy and the first years of life are important for future childhood health and body weight. Even though current evidence suggests that both parents are important for childhood health, the influence that parents' BMI and socio-demography has on toddlers' BMI has so far received little attention. This study aimed to increase our knowledge on the association between toddlers' and parents' BMI, in relation to family socio-demography. Further, the aim was to investigate the interaction between the mothers' and fathers' BMI in relation to their child's BMI. A total of 697 children with a median age of 18 months (range 16-24 months) participated in the study along with their mothers (n = 697) and fathers (n = 674). As regards representability, our parental sample had a lower proportion of immigrants and the parents were more gainfully employed compared to parents in the rest of Sweden (when the child was 18 months old). The parents completed a questionnaire on parental and child health. Data on parental weight, height, and socio-demographics were recorded along with the child's weight and height measured at an ordinary child health care visit. We used the thresholds for children's BMI that were recommended for surveillance by the Royal College of Paediatrics and Child Health in 2012 based on the WHO reference population. Among the toddlers, 33 % had a BMI above the WHO 85(th) percentile and 14 % had a BMI above the WHO 95(th) percentile. The probability of a toddler having a BMI above the WHO 95(th) percentile was significantly increased if either the mother or father was overweight (BMI ≥ 25 kg/m(2)). Furthermore, we found a positive synergistic effect between the mother and father being overweight and their child having a BMI above the WHO 85(th) percentile. No associations were found between the toddlers' BMI and the family's socio-demographics, but there were associations between the parents' BMI and the family

  7. Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

    Science.gov (United States)

    Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

    2018-02-01

    Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

  8. Effect of inhaled corticosteroid use on weight (BMI) in pediatric patients with moderate-severe asthma.

    Science.gov (United States)

    Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney

    2018-04-19

    Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.

  9. Association between infancy BMI peak and body composition and blood pressure at age 5-6 years

    NARCIS (Netherlands)

    Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

    2013-01-01

    The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and

  10. Software-based acoustical measurements

    CERN Document Server

    Miyara, Federico

    2017-01-01

    This textbook provides a detailed introduction to the use of software in combination with simple and economical hardware (a sound level meter with calibrated AC output and a digital recording system) to obtain sophisticated measurements usually requiring expensive equipment. It emphasizes the use of free, open source, and multiplatform software. Many commercial acoustical measurement systems use software algorithms as an integral component; however the methods are not disclosed. This book enables the reader to develop useful algorithms and provides insight into the use of digital audio editing tools to document features in the signal. Topics covered include acoustical measurement principles, in-depth critical study of uncertainty applied to acoustical measurements, digital signal processing from the basics, and metrologically-oriented spectral and statistical analysis of signals. The student will gain a deep understanding of the use of software for measurement purposes; the ability to implement software-based...

  11. BMI, total and abdominal fat distribution, and cardiovascular risk factors in school-age children.

    Science.gov (United States)

    Gishti, Olta; Gaillard, Romy; Durmus, Busra; Abrahamse, Marieke; van der Beek, Eline M; Hofman, Albert; Franco, Oscar H; de Jonge, Layla L; Jaddoe, Vincent W V

    2015-05-01

    More specific total body and abdominal fat mass measures might be stronger associated with cardiovascular risk factors in childhood, than BMI. We examined the independent associations of total and abdominal fat measures with cardiovascular risk factors in school age children. We performed a population-based cohort study among 6,523 children. At the age of 6 y, we measured childhood BMI, and general and abdominal fat mass, using dual-energy X-ray absorptiometry, and ultrasound and cardiovascular risk factors. Conditional on BMI, higher fat mass percentage and abdominal fat mass were associated with higher blood pressure, total- and low-density lipoprotein (LDL)-cholesterol, insulin and c-peptide levels, but with lower left ventricular mass and high-density lipoprotein (HDL)-cholesterol (P values children. Higher childhood adiposity measures were associated with increased odds of cardiovascular risk factors clustering, with the strongest effect for fat mass percentage (odds ratios: 3.01 (95% confidence interval: 2.67, 3.9). Our results suggest that general and abdominal fat measures are associated with cardiovascular risk factors in childhood, independent from BMI. These measures may provide additional information for identification of children with an adverse cardiovascular profile.

  12. Strain measurement based battery testing

    Science.gov (United States)

    Xu, Jeff Qiang; Steiber, Joe; Wall, Craig M.; Smith, Robert; Ng, Cheuk

    2017-05-23

    A method and system for strain-based estimation of the state of health of a battery, from an initial state to an aged state, is provided. A strain gauge is applied to the battery. A first strain measurement is performed on the battery, using the strain gauge, at a selected charge capacity of the battery and at the initial state of the battery. A second strain measurement is performed on the battery, using the strain gauge, at the selected charge capacity of the battery and at the aged state of the battery. The capacity degradation of the battery is estimated as the difference between the first and second strain measurements divided by the first strain measurement.

  13. Television, sleep, outdoor play and BMI in young children: the GECKO Drenthe cohort.

    Science.gov (United States)

    Sijtsma, Anna; Koller, Marjory; Sauer, Pieter J J; Corpeleijn, Eva

    2015-05-01

    In this study, we investigated the interplay between screen time, sleep duration, outdoor play, having a television in the bedroom and the number of televisions at home and their association with body mass index (BMI) in preschool children. All participants, 3-4 years of age (n = 759), were part of the Groningen expert center for kids with obesity (GECKO) Drenthe birth cohort. Weight and height were measured. Total screen time, number of televisions at home, a television in the bedroom, sleep duration and time of outdoor play were self-reported by parents in a questionnaire. Ordinary least square (OLS) regression-based path analysis was used to estimate direct and indirect effects on BMI in mediation models. A television in the bedroom or more televisions at home gave a higher screen time, which were associated with decreased sleep duration and resulted in higher BMI (indirect effect = 0.0115, 95% bootstrap interval = 0.0016; 0.0368 and indirect effect = 0.0026, 95% bootstrap interval = 0.0004; 0.0078, respectively). In contrast to the direct effect of screen time, sleep duration and a television in the bedroom on BMI, no direct effect was found for outdoor play and number or televisions at home on BMI. Short sleep duration, long screen time and a television in the bedroom were associated with the presence of overweight in preschool children.

  14. Alternative regression models to assess increase in childhood BMI

    OpenAIRE

    Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

    2008-01-01

    Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...

  15. BMI and BMI SDS in childhood: annual increments and conditional change

    OpenAIRE

    Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

    2016-01-01

    Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

  16. Intuitive eating: associations with physical activity motivation and BMI.

    Science.gov (United States)

    Gast, Julie; Campbell Nielson, Amy; Hunt, Anne; Leiker, Jason J

    2015-01-01

    To determine whether university women who demonstrated internal motivation related to eating behavior may also be internally motivated to participate in regular physical activity (PA) and have a lower body mass index (BMI) when controlling for age. Traditional approaches for health promotion related to healthy weight include restrictive eating and exercise prescription. Examining motivation for eating and PA may prove an effective alternative for achieving or maintaining healthy weight for university women. Design was a cross-sectional study. Study setting was a large, public university in the western United States. Subjects . Study subjects were 200 undergraduate women with a mean age of 19 years, mostly white (90%) and of healthy weight (69%, with a BMI range of 18.5-24.9). Study measures were the Intuitive Eating Scale and the Behavioral Regulation in Exercise Questionnaire. Correlations and regression models were used. Intuitive eating was examined in the sample as a whole and among subgroups of respondents grouped based on tertile rankings of intuitive eating scores. There was evidence that women who demonstrated internal motivation related to eating were also internally motivated to participate in regular PA. Women who reported being internally motivated to eat were significantly more likely to engage in PA for pleasure and to view PA as part of their self-concept. Women who reported high levels of intuitive eating had significantly lower BMI scores than those reporting medium or low levels when controlling for age. For women to achieve or maintain a healthy weight, it may be best for health professionals to examine motivation for eating and PA rather than the encouragement of restrictive eating and exercise prescriptions.

  17. Childhood BMI growth trajectories and endometrial cancer risk

    DEFF Research Database (Denmark)

    Aarestrup, Julie; Gamborg, Michael; Tilling, Kate

    2017-01-01

    Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...

  18. Changes in parent motivation predicts changes in body mass index z-score (zBMI) and dietary intake among preschoolers enrolled in a family-based obesity intervention.

    Science.gov (United States)

    Van Allen, Jason; Kuhl, Elizabeth S; Filigno, Stephanie S; Clifford, Lisa M; Connor, Jared M; Stark, Lori J

    2014-10-01

    To examine whether changes in parent motivation over the course of a pediatric obesity intervention are significantly associated with long-term changes in treatment outcomes.   Study hypotheses were tested with a secondary data analysis of a randomized controlled trial (N = 42). Study analyses tested whether baseline to posttreatment change in total score for a self-report parent motivation measure (Parent Motivation Inventory [PMI]) was significantly associated with baseline to 6-month follow-up changes in body mass index z-score (zBMI), dietary variables, and physical activity.   Increases in PMI were significantly associated with decreased zBMI, decreased consumption of sugar-sweetened beverages and sweets, and increased consumption of artificially sweetened beverages.   Given that increases in parent motivation were associated with some treatment benefits, future research should evaluate the impact of directly assessing and targeting parent motivation on weight outcomes for preschoolers participating in a weight management program. © The Author 2014. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Reduced cortical thickness associated with visceral fat and BMI

    Directory of Open Access Journals (Sweden)

    Ralf Veit

    2014-01-01

    Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

  20. Optimum BMI cut points to screen asian americans for type 2 diabetes.

    Science.gov (United States)

    Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

    2015-05-01

    Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  1. Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years

    Science.gov (United States)

    Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

    2013-01-01

    Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605

  2. Is BMI a relevant marker of fat mass in 4 year old children? Results from the MINISTOP trial.

    Science.gov (United States)

    Delisle Nyström, Christine; Henriksson, Pontus; Ek, Anna; Henriksson, Hanna; Ortega, Francisco B; Ruiz, Jonatan R; Löf, Marie

    2018-03-20

    Due to the increase in childhood obesity, identifying children with excess body fat as early as possible is essential. Body mass index (BMI) is commonly used as a marker of body fat in children, adolescents, and adults, yet whether BMI is a valid marker of body fat in pre-school aged children remains to be confirmed. Therefore, we analyzed the associations of BMI with fat and fat-free mass in healthy 4-year-old Swedish children. The study comprised of 303 children (135 girls) participating in the MINISTOP obesity prevention trial. Fat and fat-free mass were measured using air displacement plethysmography and we computed fat mass index (FMI) and fat free mass index (FFMI) as fat and fat free mass (kg)/height 2 (m). BMI was positively yet weakly associated with percent fat mass (boys: r 2  = 0.120, P Children classified as normal weight had a wide range of percent fat mass (12.3 to 35.3%) and FMI (1.75 to 5.78 kg/m 2 ). BMI was strongly associated to both FMI and FFMI. Therefore, caution is needed when interpreting body fat status based on BMI values in pre-school children.

  3. Potential for waist-to-height ratio to detect overfat adolescents from a Pacific Island, even those within the normal BMI range.

    Science.gov (United States)

    Frayon, Stéphane; Cavaloc, Yolande; Wattelez, Guillaume; Cherrier, Sophie; Lerrant, Yannick; Ashwell, Margaret; Galy, Olivier

    2017-12-15

    Waist-to-height ratio (WHtR) is a simple anthropometric proxy for central body fat; it is easy to use from a health education perspective. A WHtR value >0.5 has been proposed as a first level indicator of health risk. The first aim of this study was to compare WHtR with values based on body mass index (BMI) in their prediction of the percentage of body fat (%BF) in a multi-ethnic population of adolescents from New-Caledonia (age 11-16year). Secondly, to see whether WHtR >0.5 could be used to detect overfat subjects whose BMI was in the normal range. Body fat percentage (%BF, based on skinfold measurements), BMI and WHtR were calculated for New Caledonian adolescents from different ethnic backgrounds. The relationship between %BF, BMI and WHtR was determined using quadratic models and from linear regression equations. The sensitivity and specificity of WHtR for detecting overfat adolescents (%BF >25% in boys and >30% in girls) were assessed and compared with those from the BMI-based classification. WHtR showed better correlation with %BF than BMI-based measurements. WHtR >0.5 was also more accurate than BMI in detecting overfat adolescents. Moreover, using this boundary value, 8% of adolescents in the normal BMI range were shown to be over-fat. WHtR is a good anthropometric proxy to detect overfat adolescents. Detecting overfat adolescents within the normal BMI range is particularly important for preventing non communicable diseases. We therefore recommend using WHtR for health education programs in the Pacific area and more generally. Copyright © 2017 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  4. Modification of Bisphenol-A Based Bismaleimide Resin (BPA-BMI) with an Allyl-Terminated Hyperbranched Polyimide (AT-PAEKI)

    National Research Council Canada - National Science Library

    Qin, Haihu; Mather, Patrick T; Baek, Jong-Beom; Tan, Loon-Seng

    2006-01-01

    As a continuation of previous work involving synthesis of an allyl-functionalized hyperbranched polyimide, AT-PAEKI, we have studied the use of this reactive polymer as a modifier of bisphenol-A based...

  5. Smoking, physical exercise, BMI and late foetal death

    DEFF Research Database (Denmark)

    Morales-Suárez-Varela, Maria; Nohr, Ellen A; Bech, Bodil H

    2016-01-01

    The aim of this paper was to estimate the effect of maternal and paternal smoking on foetal death (miscarriage and stillbirth) and to estimate potential interactions with physical exercise and pre-pregnancy body mass index. We selected 87,930 pregnancies from the population-based Danish National......) for predominantly late foetal death (miscarriage and stillbirth). An interaction contrast ratio was used to assess potential effect measure modification of smoking by physical exercise and body mass index. The adjusted hazard ratio of foetal death was 1.22 (95 % CI 1.02-1.46) for couples where both parents smoked...... with a slightly higher hazard ratio for foetal death if both parents smoked. This study suggests that smoking may increase the negative effect of a high BMI on foetal death, but results were not statistically significant for the interaction between smoking and physical exercise....

  6. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  7. NUTRITIONAL ESTIMATES OF SCHOOL GOING CHILDREN BASED ON ANTHROPOMETRIC MEASUREMENTS: STUDY FROM A RURAL AREA OF VARANASI

    Directory of Open Access Journals (Sweden)

    M K Gupta

    2011-12-01

    Full Text Available Background: With the adoption of western lifestyle the problem of overweight and obesity is gradually increasing in children, while problem of malnutrition is persisting continuously in the country. With this background a school based cross sectional study was conducted to assess the nutritional status of school going children in a rural area: Chiraigaon block of Varanasi. Study period: July 2010 to September 2010 Methods: A school-based study with cross-sectional design was adopted. A total of 1448 school children were examined from 3 middle-schools that were selected by simple random sampling method. Height and weight of the children were measured, and BMI and other parameters were assessed. Results: On applying the BMI-for-age criteria, twelve percent of the children (12.4% boys and 11.1% girls were found underweight while 5.4% were overweight or obese (5.71% of the boys and 4.63% of the girls. But when the previous WHO’s BMI classification was used, 86.5% children had BMI <18.5 (88.4% of total boys and 81.9% of all girls. Conclusion: Nutritional status of school going children based on WHO criteria of BMI for age has been satisfactory. However, this approach needs scientific validation by undertaking a multi-centric study.

  8. Change in BMI accurately predicted by social exposure to acquaintances.

    Science.gov (United States)

    Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

    2013-01-01

    Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

  9. Change in BMI accurately predicted by social exposure to acquaintances.

    Directory of Open Access Journals (Sweden)

    Rahman O Oloritun

    Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

  10. BMI-for-age in South Asian children of 0-20 years in the Netherlands: secular changes and misclassification by WHO growth references.

    Science.gov (United States)

    de Wilde, J A; Dekker, M; Middelkoop, B J C

    2018-03-01

    South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. To compare the BMI distribution of contemporary South Asian 0-20 year olds in the Netherlands with: (1) The South Asian norm reference (secular trends); and (2) The WHO child growth standard and reference. The BMI-for-age distribution of 6677 routine measurements of 3322 South Asian children, aged 0-20 years, was described with the LMS method and BMI z-scores. The BMI distribution in South Asian 0-4 year olds was almost similar to the norm reference (mean BMI z-score = 0.11, skewness = 0.31, SD = 1.0), whereas in 5-19 year olds the distribution had shifted upwards (mean = 0.53) and widened (skewness = -0.12, SD = 1.08). Overweight (incl. obesity) and obesity peaked at 8-10 years, at 45-48% and 35-37%, respectively. Relative to the WHO references, the BMI distribution was left-shifted at ages 0-4 years (mean BMI z-score = -0.46, skewness = 0.23, SD = 0.98) and widened at ages 5-20 years (mean = 0.05; skewness = -0.02, SD = 1.40). At most ages, thinness rates were significantly higher and obesity rates lower than based on South Asian norms. A secular change of BMI-for-age in South Asian children mostly affected children >4 years. WHO references likely under-estimate overweight and obesity rates in South Asian children.

  11. BMI at birth and overweight at age four.

    Science.gov (United States)

    Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

    Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  12. Eating tasty food to cope. Longitudinal association with BMI.

    Science.gov (United States)

    Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

    2015-04-01

    The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

    Science.gov (United States)

    Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

    2018-03-01

    High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Relationship of glycemic and triglycerides with BMI in diabetic patients

    International Nuclear Information System (INIS)

    Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.

    2010-01-01

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  15. Relationship of glycemic and triglycerides with BMI in diabetic patients

    Energy Technology Data Exchange (ETDEWEB)

    Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology

    2010-04-15

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  16. Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.

    Science.gov (United States)

    Stommel, Manfred; Schoenborn, Charlotte A

    2010-09-01

    When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.

  17. Differences in the association between childhood trauma and BMI in ...

    African Journals Online (AJOL)

    between childhood trauma and BMI in black and white South African women ... finding, including measures of body image and body size satisfaction that may explain these findings. Keywords: Childhood trauma questionnaire; Body fat; Body image; Sexual abuse; Ethnicity, ... Self-reported exposure to childhood trauma was.

  18. Status of radiation-based measurement technology

    International Nuclear Information System (INIS)

    Moon, B. S.; Lee, J. W.; Chung, C. E.; Hong, S. B.; Kim, J. T.; Park, W. M.; Kim, J. Y.

    1999-03-01

    This report describes the status of measurement equipment using radiation source and new technologies in this field. This report includes the development status in Korea together with a brief description of the technology development and application status in ten countries including France, America, and Japan. Also this report describes technical factors related to radiation-based measurement and trends of new technologies. Measurement principles are also described for the equipment that is widely used among radiation-based measurement, such as level measurement, density measurement, basis weight measurement, moisture measurement, and thickness measurement. (author). 7 refs., 2 tabs., 21 figs

  19. Use of BMI as marker of adiposity in a metabolic syndrome severity score: derivation and validation in predicting long-term disease outcomes.

    Science.gov (United States)

    Gurka, Matthew J; Filipp, Stephanie L; Musani, Solomon K; Sims, Mario; DeBoer, Mark D

    2018-02-01

    Estimates of adiposity in evaluating the metabolic syndrome (MetS) have traditionally utilized measures of waist circumference (WC), whereas body mass index (BMI) is more commonly used clinically. Our objective was to determine if a MetS severity Z-score employing BMI as its measure of adiposity (MetS-Z-BMI) would perform similarly to a WC-based score (MetS-Z-WC) in predicting future disease. To formulate the MetS-Z-BMI, we performed confirmatory factor analysis on a sex- and race/ethnicity-specific basis on MetS-related data for 6870 adult participants of the National Health and Nutrition Survey 1999-2010. We then validated this score and compared it to MetS-Z-WC in assessing correlations with future coronary heart disease (CHD) and Type 2 diabetes mellitus (T2DM) using Cox proportional hazard analysis of 13,094 participants of the Atherosclerosis Risk in Communities study and Jackson Heart Study. Loading factors, which represent the relative contribution of each component to the latent MetS factor, were lower for BMI than for WC in formulating the two respective scores (MetS-Z-BMI and MetS-Z-WC). Nevertheless, MetS-Z-BMI and MetS-Z-WC exhibited similar hazard ratios (HR) toward future disease. For each one standard-deviation-unit increase in MetS-Z-BMI, HR for CHD was 1.76 (95% confidence interval [CI]: 1.65, 1.88) and HR for T2DM was 3.39 (CI 3.16, 3.63) (both p BMI scores in their associations with future CHD and T2DM. A MetS severity Z-score utilizing BMI as its measure of adiposity operated similarly to a WC-based score in predicting future CHD and T2DM, suggesting overall similarity in MetS-based risk as estimated by both measures of adiposity. This indicates potential clinical usefulness of MetS-Z-BMI in assessing and following MetS-related risk over time. Copyright © 2018. Published by Elsevier Inc.

  20. The measurement of maternal adiposity.

    LENUS (Irish Health Repository)

    Fattah, C

    2012-02-01

    The issue of maternal obesity has become a major public health problem. Internationally, the diagnosis of obesity is based on body mass index (BMI) that is, weight in kg\\/height in m2. While epidemiological associations have been shown between different BMI categories and adverse clinical outcomes, there is also a growing realisation that BMI has significant limitations. In this review, we assess current methods to measure body fat and, in particular, their application in pregnant women.

  1. SQUID-based measuring systems

    Indian Academy of Sciences (India)

    field produced by a given two-dimensional current density distribution is inverted using the Fourier transform technique. Keywords ... Superconducting quantum interference devices (SQUIDs) are the most sensitive detectors for measurement of ... omagnetic prospecting, detection of gravity waves etc. Judging the importance ...

  2. European wet deposition maps based on measurements

    NARCIS (Netherlands)

    Leeuwen EP van; Erisman JW; Draaijers GPJ; Potma CJM; Pul WAJ van; LLO

    1995-01-01

    To date, wet deposition maps on a European scale have been based on long-range transport model results. For most components wet deposition maps based on measurements are only available on national scales. Wet deposition maps of acidifying components and base cations based on measurements are needed

  3. Spectrophotometer-Based Color Measurements

    Science.gov (United States)

    2017-10-24

    equipment. There are several American Society for Testing and Materials ( ASTM ) chapters covering the use of spectrometers for color measurements (refs. 3...Perkin Elmer software and procedures described in ASTM chapter E308 (ref. 3). All spectral data was stored on the computer. A summary of the color...similarity, or lack thereof, between two colors (ref. 5). In this report, the Euclidean distance metric, E, is used and recommended in ASTM D2244

  4. Percutaneous Nephrolithotomy in Patients With BMI >50: Single Surgeon Outcomes and Feasibility.

    Science.gov (United States)

    Streeper, Necole M; Radtke, Andrew C; Penniston, Kristina L; McDermott, John C; Nakada, Stephen Y

    2016-01-01

    To evaluate the use of percutaneous nephrolithotomy (PNL) and technical approach in the super obese population (body mass index [BMI] ≥ 50). We performed a retrospective review of 31 consecutive PNL cases with a BMI > 50 from a single surgeon (SYN) from 1995 to 2013. Procedures were performed in the prone position, and upper pole access was used. Operative time, length of hospital stay, stone burden, complication rates, and stone-free rates were measured. Of the 31 patients who underwent PNL (age 51.2 ± 12; 71% female), the mean BMI was 59.1 ± 6 kg/m(2) (range 50.4-71.7 kg/m(2)). Mean stone burden was 3.8 cm ± 2. The majority of patients (90.3%) had an upper pole puncture site for access with an operative time of 122.1 ± 75 minutes. The technique was similar to non-obese patients; however, there was a need for extra-long instrumentation. The overall stone-free rate was 71%, with utilization of a second-look PNL in 11 cases. The complication rate, Clavien grade 3 or higher, was 9.7% (3 of 31). PNL is technically feasible, safe, and effective in patients with a BMI ≥ 50. The complication rate, length of hospital stay, and stone-free rate with use of second-look PNL in super obese patients are comparable to severely obese patients. Intervention should not be automatically ruled out or delayed based on the patient's BMI alone. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Shifting Patterns of BMI and Skinfold Fatness among US Children: 1985/87 vs. 2012

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2016-12-01

    Full Text Available Background: Childhood obesity has been recognized as a major public health concern. The purpose of this study was to determine specific shifting patterns of BMI and skinfold fatness across different age and sex groups between 1985/87 and 2012. Methods: The data of 9,366 children aged 8-15 years from two nationally representative surveys, i.e., 1985/87 National Children and Youth Fitness Study I & II and 2012 National Health and Nutrition Examination Survey National Youth Fitness Survey, were analyzed. Specifically, changes of BMI-based obesity prevalence and shifting patterns of BMI, height, weight, skinfold body fat percentage (skinfold-fat%, subscapular skinfold, and triceps skinfold from 1985/87 to 2012 were estimated by age and sex using the 1985/87 quartiles as the baseline. Results: Significantly increased obesity prevalence were reconfirmed for both boys (12.12%, P <.001 and girls (3.53%, P <.001 from 1985/87 to 2012. Except for height, all other measures in 2012 experienced an unbalanced shifting pattern, mainly from other quartiles into the 4th quartile of 1985/87. Conclusion: The shifting of both boys’ and girls’ BMI and skinfold-fat% were all concentrated in the 4th quartile of 1985/87, indicating not only that there was a significant increase in BMI and skinfold-fat% in the U.S. children from 1985/87 to 2012, but also into the overweight and obese subgroups, which serves as a serious warning for childhood obesity epidemic and public health.

  6. Neurodevelopmental problems and extremes in BMI

    Directory of Open Access Journals (Sweden)

    Nóra Kerekes

    2015-07-01

    Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

  7. The link between BMI and waist circumference in northern Iranian ...

    African Journals Online (AJOL)

    Background and Objectives: Waist circumference and not body mass index explains a greater variance in obesity-related health risk. The present study assesses the link between BMI and WC in Iranian adults. Methods: In a population based cross- sectional study on 3600 adults, northern Iran, we investigated the link ...

  8. Maternal Prepregnancy BMI and Risk of Cerebral Palsy in Offspring

    DEFF Research Database (Denmark)

    Forthun, Ingeborg; Wilcox, Allen J; Strandberg-Larsen, Katrine

    2016-01-01

    OBJECTIVES: To investigate the association between maternal pre-pregnancy BMI and risk of cerebral palsy (CP) in offspring. METHODS: The study population consisted of 188 788 children in the Mothers and Babies in Norway and Denmark CP study, using data from 2 population-based, prospective birth...

  9. Physical activity modifies the FTO effect on BMI change in Japanese adolescents.

    Science.gov (United States)

    Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro

    2018-04-14

    Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Alternative regression models to assess increase in childhood BMI

    Directory of Open Access Journals (Sweden)

    Mansmann Ulrich

    2008-09-01

    Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

  11. Alternative regression models to assess increase in childhood BMI.

    Science.gov (United States)

    Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

    2008-09-08

    Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

  12. Interactive Effects of Early Exclusive Breastfeeding and Pre-Pregnancy Maternal Weight Status on Young Children's BMI - A Chinese Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Hong Mei

    Full Text Available To assess if the maternal pre-pregnancy weight status (MPWS alters the association of early infant feeding pattern (at one and third months with infant body mass index (BMI in the first two years of life.A cohort of 2,220 neonates were recruited in a community-based study conducted in China. Body weight and length were measured at birth, at age one and two, with BMI calculated accordingly. The BMI z-scores (BMI-Z were computed according to the World Health Organization Growth Standard (2006. Feeding patterns were classified as exclusive breastfeeding (EBF, mixed feeding (MF, and formula feeding (FF. General linear models (GLM were employed to estimate main and interaction effects of EBF and MPWS on children's BMI-Z.No main effect of MPWS was found on child BMI-Z at ages one and two, nor the feeding patterns. An interaction between MPWS and feeding patterns was detected (p<0.05. For children who were formula fed during the first month, those who were born to overweight/obesity (OW/OB mothers had a significantly greater BMI-Z at ages one and two, compared with those with underweight/normal weight (UW/NW mothers. FF children had greater BMI-Z at ages one and two compared with their EBF and MF counterparts, when they were born to OW/OB mothers.Maternal pre-pregnancy weight control and early initiation of EBF for children are essential for healthy development in children's BMI, hence the prevention of early life obesity.

  13. Bluetooth-based distributed measurement system

    International Nuclear Information System (INIS)

    Tang Baoping; Chen Zhuo; Wei Yuguo; Qin Xiaofeng

    2007-01-01

    A novel distributed wireless measurement system, which is consisted of a base station, wireless intelligent sensors and relay nodes etc, is established by combining of Bluetooth-based wireless transmission, virtual instrument, intelligent sensor, and network. The intelligent sensors mounted on the equipments to be measured acquire various parameters and the Bluetooth relay nodes get the acquired data modulated and sent to the base station, where data analysis and processing are done so that the operational condition of the equipment can be evaluated. The establishment of the distributed measurement system is discussed with a measurement flow chart for the distributed measurement system based on Bluetooth technology, and the advantages and disadvantages of the system are analyzed at the end of the paper and the measurement system has successfully been used in Daqing oilfield, China for measurement of parameters, such as temperature, flow rate and oil pressure at an electromotor-pump unit

  14. Bluetooth-based distributed measurement system

    Science.gov (United States)

    Tang, Baoping; Chen, Zhuo; Wei, Yuguo; Qin, Xiaofeng

    2007-07-01

    A novel distributed wireless measurement system, which is consisted of a base station, wireless intelligent sensors and relay nodes etc, is established by combining of Bluetooth-based wireless transmission, virtual instrument, intelligent sensor, and network. The intelligent sensors mounted on the equipments to be measured acquire various parameters and the Bluetooth relay nodes get the acquired data modulated and sent to the base station, where data analysis and processing are done so that the operational condition of the equipment can be evaluated. The establishment of the distributed measurement system is discussed with a measurement flow chart for the distributed measurement system based on Bluetooth technology, and the advantages and disadvantages of the system are analyzed at the end of the paper and the measurement system has successfully been used in Daqing oilfield, China for measurement of parameters, such as temperature, flow rate and oil pressure at an electromotor-pump unit.

  15. Bluetooth-based distributed measurement system

    Energy Technology Data Exchange (ETDEWEB)

    Tang Baoping; Chen Zhuo; Wei Yuguo; Qin Xiaofeng [Department of Mechatronics, College of Mechanical Engineering, Chongqing University, Chongqing, 400030 (China)

    2007-07-15

    A novel distributed wireless measurement system, which is consisted of a base station, wireless intelligent sensors and relay nodes etc, is established by combining of Bluetooth-based wireless transmission, virtual instrument, intelligent sensor, and network. The intelligent sensors mounted on the equipments to be measured acquire various parameters and the Bluetooth relay nodes get the acquired data modulated and sent to the base station, where data analysis and processing are done so that the operational condition of the equipment can be evaluated. The establishment of the distributed measurement system is discussed with a measurement flow chart for the distributed measurement system based on Bluetooth technology, and the advantages and disadvantages of the system are analyzed at the end of the paper and the measurement system has successfully been used in Daqing oilfield, China for measurement of parameters, such as temperature, flow rate and oil pressure at an electromotor-pump unit.

  16. Associations of genetic risk scores based on adult adiposity pathways with childhood growth and adiposity measures

    NARCIS (Netherlands)

    C. Monnereau; S. Vogelezang; C.J. Kruithof (Claudia); V.W.V. Jaddoe (Vincent); J.F. Felix (Janine)

    2016-01-01

    textabstractBackground: Results from genome-wide association studies (GWAS) identified many loci and biological pathways that influence adult body mass index (BMI). We aimed to identify if biological pathways related to adult BMI also affect infant growth and childhood adiposity measures. Methods:

  17. Physical activity reduces the influence of genetic effects on BMI and waist circumference: a study in young adult twins.

    Science.gov (United States)

    Mustelin, L; Silventoinen, K; Pietiläinen, K; Rissanen, A; Kaprio, J

    2009-01-01

    Both obesity and exercise behavior are influenced by genetic and environmental factors. However, whether obesity and physical inactivity share the same genetic vs environmental etiology has rarely been studied. We therefore analyzed these complex relationships, and also examined whether physical activity modifies the degree of genetic influence on body mass index (BMI) and waist circumference (WC). The FinnTwin16 Study is a population-based, longitudinal study of five consecutive birth cohorts (1975-1979) of Finnish twins. Data on height, weight, WC and physical activity of 4343 subjects at the average age of 25 (range, 22-27 years) years were obtained by a questionnaire and self-measurement of WC. Quantitative genetic analyses based on linear structural equations were carried out by the Mx statistical package. The modifying effect of physical activity on genetic and environmental influences was analyzed using gene-environment interaction models. The overall heritability estimates were 79% in males and 78% in females for BMI, 56 and 71% for WC and 55 and 54% for physical activity, respectively. There was an inverse relationship between physical activity and WC in males (r = -0.12) and females (r=-0.18), and between physical activity and BMI in females (r = -0.12). Physical activity significantly modified the heritability of BMI and WC, with a high level of physical activity decreasing the additive genetic component in BMI and WC. Physically active subjects were leaner than sedentary ones, and physical activity reduced the influence of genetic factors to develop high BMI and WC. This suggests that the individuals at greatest genetic risk for obesity would benefit the most from physical activity.

  18. Longitudinal association between marital disruption and child BMI and obesity.

    Science.gov (United States)

    Arkes, Jeremy

    2012-08-01

    This research examines whether family disruptions (i.e., divorces and separation) contribute to children's weight problems. The sample consists of 7,299 observations for 2,333 children, aged 5-14, over the 1986-2006 period, from a US representative sample from the Child and Young Adult Survey accompanying the National Longitudinal Survey of Youth (NLSY). The study uses individual-fixed-effects models in a longitudinal framework to compare children's BMI and weight problems before and after a disruption. Furthermore, besides doing a before-after comparison for children, the study also estimates the effects at various periods relative to the disruption in order to examine whether children are affected before the disruption and whether any effects change as time passes from the disruption, as some effects may be temporary or slow to develop. Despite having a larger sample than the previous studies, the results provide no evidence that, on average, children's BMI and BMI percentile scores (measured with continuous outcomes) are affected before the disruption, after the disruption, and as time passes from the disruption, relative to a baseline period a few years before the disruption. However, children experiencing a family disruption do have an increased risk of obesity (having a BMI percentile score of 95 or higher) in the two years leading up to the disruption as well as after the disruption, and as time passes from the disruption.

  19. Exercise mitigates cumulative associations between stress and BMI in girls age 10–19

    Science.gov (United States)

    Prather, Aric A.; Epel, Elissa S.; Loharuka, Sheila; Adler, Nancy E.; Laraia, Barbara

    2015-01-01

    Objective Long-term psychological stress is associated with BMI increases in children as they transition to adulthood, while long-term maintenance of physical activity can slow excess weight gain. We hypothesized that in addition to these main effects, long-term physical activity mitigates the relationship between long-term stress and BMI increase. Methods The NHLBI Growth and Health Study enrolled 2,379 10-year-old Black and White girls, following them annually for 10 measurement points. Growth curve modeling captured the dynamics of BMI, measured yearly, and stress and physical activity, measured every other year. Results At average levels of activity and stress, with all covariates remaining fixed, average BMI at baseline was 19.74 (SE = 0.38) and increased 0.64 BMI (SE= 0.01, p psychological stress. PMID:26301595

  20. Effects of social mobility from childhood to adolescence on BMI.

    Science.gov (United States)

    Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely

    2016-04-01

    Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.

  1. Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

    Science.gov (United States)

    Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

    2017-03-01

    Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

  2. Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

    Science.gov (United States)

    Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

    2017-11-01

    Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

  3. Raised BMI cut-off for overweight in Greenland Inuit--a review.

    Science.gov (United States)

    Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

    2013-01-01

    Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.

  4. Correlation between BMI and motor coordination in children.

    Science.gov (United States)

    Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P

    2012-01-01

    To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  5. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  6. BMI, body fat and waist-to-height ratio of stunted v. non-stunted Indian children: a case-control study.

    Science.gov (United States)

    Savanur, Mitravinda S; Ghugre, Padmini S

    2016-06-01

    To compare the BMI, body fat and waist-to-height ratio (WHtR) of stunted and non-stunted children following different growth trajectories from low socio-economic strata in Mumbai, India. Cross-sectional, case-control study. Weight, height, skinfold thicknesses and waist circumference were measured. Information regarding the duration of breast-feeding, age at initiation of complementary feeding and income was obtained. Birth weight was obtained from records. BMI, body fat, WHtR and change in weight sd were calculated. Children who were beneficiaries of anganwadis, Mumbai city, India. Three hundred and thirty children aged 2-4 years were selected in each of the stunted and non-stunted groups after matching for age and sex. After adjusting for birth weight, change in weight sd, duration of breast-feeding, age at complementary feeding initiation and income, stunted children had significantly higher body fat, WHtR and BMI than the non-stunted (Pchildren were classified based on their change in weight sd. Stunted children with no change in weight sd had higher mean body fat, BMI (Pchildren had higher BMI and WHtR than the non-stunted (both Pchildren had higher BMI than the non-stunted (Pfat in young children. Such a tendency, if continued during later childhood and adolescence, can increase the risk of obesity and non-communicable diseases.

  7. Process Optimization of Bismaleimide (BMI) Resin Infused Carbon Fiber Composite

    Science.gov (United States)

    Ehrlich, Joshua W.; Tate, LaNetra C.; Cox, Sarah B.; Taylor, Brian J.; Wright, M. Clara; Caraccio, Anne J.; Sampson, Jeffery W.

    2013-01-01

    Bismaleimide (BMI) resins are an attractive new addition to world-wide composite applications. This type of thermosetting polyimide provides several unique characteristics such as excellent physical property retention at elevated temperatures and in wet environments, constant electrical properties over a vast array of temperature settings, and nonflammability properties as well. This makes BMI a popular choice in advance composites and electronics applications [I]. Bismaleimide-2 (BMI-2) resin was used to infuse intermediate modulus 7 (IM7) based carbon fiber. Two panel configurations consisting of 4 plies with [+45deg, 90deg]2 and [0deg]4 orientations were fabricated. For tensile testing, a [90deg]4 configuration was tested by rotating the [0deg]4 configirration to lie orthogonal with the load direction of the test fixture. Curing of the BMI-2/IM7 system utilized an optimal infusion process which focused on the integration of the manufacturer-recommended ramp rates,. hold times, and cure temperatures. Completion of the cure cycle for the BMI-2/IM7 composite yielded a product with multiple surface voids determined through visual and metallographic observation. Although the curing cycle was the same for the three panellayups, the surface voids that remained within the material post-cure were different in abundance, shape, and size. For tensile testing, the [0deg]4 layup had a 19.9% and 21.7% greater average tensile strain performance compared to the [90deg]4 and [+45deg, 90deg, 90deg,-45degg] layups, respectively, at failure. For tensile stress performance, the [0deg]4 layup had a 5.8% and 34.0% greater average performance% than the [90deg]4 and [+45deg, 90deg, 90deg,-45deg] layups.

  8. The effects of media, self-esteem, and BMI on youth's unhealthy weight control behaviors.

    Science.gov (United States)

    Mayer-Brown, Sarah; Lawless, Casey; Fedele, David; Dumont-Driscoll, Marilyn; Janicke, David M

    2016-04-01

    Youth engage in a variety of methods to manage their weight, including unhealthy weight control behaviors (UWCBs). The purpose of this study was to examine factors associated with youth's engagement in UWCBs, including media influence, youth's BMI z-score and self-esteem. Participants were 179 youth, aged 10-17, attending a primary care clinic appointment. Youth completed questionnaires assessing frequency of UWCBs, global self-worth, and perception of media influence to lose weight. BMI z-score was calculated based on height and weight measurements obtained from medical charts. The SPSS macro, PROCESS, was used to conduct moderation analyses. Over 40% of youth endorsed using at least one UWCB in the past year. Girls reported using more UWCBs and engaging in UWCBs more frequently than boys. For boys, media influence to lose weight was only related to UWCB frequency for those with a BMI z-score of 1.23 and above. For girls, media influence was only related to UWCB frequency for those with low to average levels of global self-worth. Girls' and boys' use of UWCBs is impacted by different factors. Prevention efforts should consider targeting factors, such as weight status and self-esteem, which are uniquely associated with gender. Copyright © 2015. Published by Elsevier Ltd.

  9. Body Mass Index (BMI) Trajectories in Infancy Differ by Population Ancestry and May Presage Disparities in Early Childhood Obesity

    Science.gov (United States)

    Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.

    2015-01-01

    Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051

  10. The common FTO variant rs9939609 is not associated with BMI in a longitudinal study on a cohort of Swedish men born 1920-1924

    Directory of Open Access Journals (Sweden)

    Lannfelt Lars

    2009-12-01

    Full Text Available Abstract Background Common FTO (fat mass and obesity associated gene variants have recently been strongly associated with body mass index and obesity in several large studies. Here we set out to examine the association of the FTO variant rs9939609 with BMI in a 32 year follow up study of men born 1920-1924. Moreover, we analyzed the effect of physical activity on the different genotypes. Methods The FTO rs9936609 was genotyped using an Illumina golden gate assay. BMI was calculated using standard methods and body fat was estimated by measuring skinfold thickness using a Harpenden caliper. Physical activity was assessed using a four question medical questionnaire. Results FTO rs9939609 was genotyped in 1153 elderly Swedish men taking part of a population-based cohort study, the ULSAM cohort. The risk of obesity and differences in BMI according to genotype at the ages of 50, 60, 70, 77 and 82 were investigated. We found no increased risk of obesity and no association with BMI at any age with the FTO rs9939609 variant. We found however interaction between physical activity at the age of 50 years and genotype on BMI levels (p = 0.039 and there was a clear trend towards larger BMI differences between the TT and AA carriers as well as between AT and AA carriers in the less physically active subjects. Conclusion Here we found that the well established obesity risk allele for a common variant in FTO does not associate with increased BMI levels in a Swedish population of adult men which reached adulthood before the appearance of today's obesogenic enviroment. There is an interaction between physical activity and the effect of the FTO genotype on BMI levels suggesting that lack of physical activity is a requirement for an association of FTO gene variants to obesity.

  11. Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measurement studies in 128·9 million children, adolescents, and adults

    OpenAIRE

    Faeh, David; Staub, Kaspar; Rühli, Frank J; et al

    2017-01-01

    Abstract Background: Underweight, overweight, and obesity in childhood and adolescence are associated with adverse health consequences throughout the life-course. Our aim was to estimate worldwide trends in mean body-mass index (BMI) and a comprehensive set of BMI categories that cover underweight to obesity in children and adolescents, and to compare trends with those of adults. Methods: We pooled 2416 population-based studies with measurements of height and weight on 128·9 million p...

  12. Genetic Influences on Growth Traits of BMI

    DEFF Research Database (Denmark)

    Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

    2008-01-01

    Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

  13. The German Version of the Dutch Eating Behavior Questionnaire: Psychometric Properties, Measurement Invariance, and Population-Based Norms.

    Science.gov (United States)

    Nagl, Michaela; Hilbert, Anja; de Zwaan, Martina; Braehler, Elmar; Kersting, Anette

    The Dutch Eating Behavior Questionnaire is an internationally widely used instrument assessing different eating styles that may contribute to weight gain and overweight: emotional eating, external eating, and restraint. This study aimed to evaluate the psychometric properties of the 30-item German version of the DEBQ including its measurement invariance across gender, age, and BMI-status in a representative German population sample. Furthermore, we examined the distribution of eating styles in the general population and provide population-based norms for DEBQ scales. A representative sample of the German general population (N = 2513, age ≥ 14 years) was assessed with the German version of the DEBQ along with information on sociodemographic characteristics and body weight and height. The German version of the DEQB demonstrates good item characteristics and reliability (restraint: α = .92, emotional eating: α = .94, external eating: α = .89). The 3-factor structure of the DEBQ could be replicated in exploratory and confirmatory factor analyses and results of multi-group confirmatory factor analyses supported its metric and scalar measurement invariance across gender, age, and BMI-status. External eating was the most prevalent eating style in the German general population. Women scored higher on emotional and restrained eating scales than men, and overweight individuals scored higher in all three eating styles compared to normal weight individuals. Small differences across age were found for external eating. Norms were provided according to gender, age, and BMI-status. Our findings suggest that the German version of the DEBQ has good reliability and construct validity, and is suitable to reliably measure eating styles across age, gender, and BMI-status. Furthermore, the results demonstrate a considerable variation of eating styles across gender and BMI-status.

  14. Integrated genomic and BMI analysis for type 2 diabetes risk assessment.

    Directory of Open Access Journals (Sweden)

    Dayanara eLebrón-Aldea

    2015-03-01

    Full Text Available Type 2 Diabetes (T2D is a chronic disease arising from the development of insulin absence or resistance within the body, and a complex interplay of environmental and genetic factors. The incidence of T2D has increased throughout the last few decades, together with the occurrence of the obesity epidemic. The consideration of variants identified by Genome Wide Association Studies (GWAS into risk assessment models for T2D could aid in the identification of at-risk patients who could benefit from preventive medicine. In this study, we build several risk assessment models, and evaluated them with two different classification approaches (Logistic Regression and Neural Networks, to measure the effect of including genetic information in the prediction of T2D. We used data from to the Original and the Offspring cohorts of the Framingham Heart Study, which provides phenotypic and genetic information for 5,245 subjects (4,306 controls and 939 cases. Models were built by using several covariates: gender, exposure time, cohort, body mass index (BMI, and 65 established T2D-associated SNPs. We fitted Logistic Regressions and Bayesian Regularized Neural Network and then assessed their predictive ability by using a ten-fold cross validation. We found that the inclusion of genetic information into the risk assessment models increased the predictive ability by 2%, when compared to the baseline model. Furthermore, the models that included BMI at the onset of diabetes as a possible effector, gave an improvement of 6% in the area under the curve derived from the ROC analysis. The highest AUC achieved (0.75 belonged to the model that included BMI, and a genetic score based on the 65 established T2D-associated SNPs. Finally, the inclusion of SNPs and BMI raised predictive ability in all models as expected; however, results from the AUC in Neural Networks and Logistic Regression did not differ significantly in their prediction accuracy.

  15. Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.

    Science.gov (United States)

    Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H

    2013-06-01

    Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  16. Korean Clinic Based Outcome Measure Studies

    OpenAIRE

    Jongbae Park

    2003-01-01

    Background: Evidence based medicine has become main tools for medical practice. However, conducting a highly ranked in the evidence hierarchy pyramid is not easy or feasible at all times and places. There remains a room for descriptive clinical outcome measure studies with admitting the limit of the intepretation. Aims: Presents three Korean clinic based outcome measure studies with a view to encouraging Korean clinicians to conduct similar studies. Methods: Three studies are presented...

  17. Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

    Science.gov (United States)

    Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

    2016-04-01

    While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

  18. Genetic and environmental effects on body mass index from infancy to the onset of adulthood: an individual-based pooled analysis of 45 twin cohorts participating in the COllaborative project of Development of Anthropometrical measures in Twins (CODATwins) study.

    Science.gov (United States)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo; Hur, Yoon-Mi; Yokoyama, Yoshie; Honda, Chika; Hjelmborg, Jacob vB; Möller, Sören; Ooki, Syuichi; Aaltonen, Sari; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Busjahn, Andreas; Kandler, Christian; Saudino, Kimberly J; Jang, Kerry L; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Gao, Wenjing; Yu, Canqing; Li, Liming; Corley, Robin P; Huibregtse, Brooke M; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth Jf; Heikkilä, Kauko; Wardle, Jane; Llewellyn, Clare H; Fisher, Abigail; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; He, Mingguang; Ding, Xiaohu; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Tarnoki, Adam D; Tarnoki, David L; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Burt, S Alexandra; Klump, Kelly L; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Gatz, Margaret; Butler, David A; Bartels, Meike; van Beijsterveldt, Toos Cem; Craig, Jeffrey M; Saffery, Richard; Freitas, Duarte L; Maia, José Antonio; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Chong, Youngsook; Swan, Gary E; Krasnow, Ruth; Magnusson, Patrik Ke; Pedersen, Nancy L; Tynelius, Per; Lichtenstein, Paul; Haworth, Claire Ma; Plomin, Robert; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Harden, K Paige; Tucker-Drob, Elliot M; Öncel, Sevgi Y; Aliev, Fazil; Spector, Timothy; Mangino, Massimo; Lachance, Genevieve; Baker, Laura A; Tuvblad, Catherine; Duncan, Glen E; Buchwald, Dedra; Willemsen, Gonneke; Rasmussen, Finn; Goldberg, Jack H; Sørensen, Thorkild Ia; Boomsma, Dorret I; Kaprio, Jaakko

    2016-08-01

    Both genetic and environmental factors are known to affect body mass index (BMI), but detailed understanding of how their effects differ during childhood and adolescence is lacking. We analyzed the genetic and environmental contributions to BMI variation from infancy to early adulthood and the ways they differ by sex and geographic regions representing high (North America and Australia), moderate (Europe), and low levels (East Asia) of obesogenic environments. Data were available for 87,782 complete twin pairs from 0.5 to 19.5 y of age from 45 cohorts. Analyses were based on 383,092 BMI measurements. Variation in BMI was decomposed into genetic and environmental components through genetic structural equation modeling. The variance of BMI increased from 5 y of age along with increasing mean BMI. The proportion of BMI variation explained by additive genetic factors was lowest at 4 y of age in boys (a(2) = 0.42) and girls (a(2) = 0.41) and then generally increased to 0.75 in both sexes at 19 y of age. This was because of a stronger influence of environmental factors shared by co-twins in midchildhood. After 15 y of age, the effect of shared environment was not observed. The sex-specific expression of genetic factors was seen in infancy but was most prominent at 13 y of age and older. The variance of BMI was highest in North America and Australia and lowest in East Asia, but the relative proportion of genetic variation to total variation remained roughly similar across different regions. Environmental factors shared by co-twins affect BMI in childhood, but little evidence for their contribution was found in late adolescence. Our results suggest that genetic factors play a major role in the variation of BMI in adolescence among populations of different ethnicities exposed to different environmental factors related to obesity. © 2016 American Society for Nutrition.

  19. To Assess the Effect of Maternal BMI on Obstetrical Outcome

    Science.gov (United States)

    Lakhanpal, Shuchi; Aggarwal, Asha; Kaur, Gurcharan

    2012-06-01

    AIMS: To assess the effect of maternal BMI on complications in pregnancy, mode of delivery, complications of labour and delivery.METHODS:A crossectional study was carried out in the Obst and Gynae department, Kasturba Hospital, Delhi. The study enrolled 100 pregnant women. They were divided into 2 groups based on their BMI, more than or equal to 30.0 kg/m2 were categorized as obese and less than 30 kg/m2 as non obese respectively. Maternal complications in both types of patients were studied.RESULTS:CONCLUSION: As the obstetrical outcome is significantly altered due to obesity, we can improve maternal outcome by overcoming obesity. As obesity is a modifiable risk factor, preconception counseling creating awareness regarding health risk associated with obesity should be encouraged and obstetrical complications reduced.

  20. Simplified method of clinical phenotyping for older men and women using established field-based measures.

    Science.gov (United States)

    Fukuda, David H; Smith-Ryan, Abbie E; Kendall, Kristina L; Moon, Jordan R; Stout, Jeffrey R

    2013-12-01

    The purpose of this investigation was to determine body composition classification using field-based testing measurements in healthy elderly men and women. The use of isoperformance curves is presented as a method for this determination. Baseline values from 107 healthy Caucasian men and women, over the age of 65years old, who participated in a separate longitudinal study, were used for this investigation. Field-based measurements of age, height, weight, body mass index (BMI), and handgrip strength were recorded on an individual basis. Relative skeletal muscle index (RSMI) and body fat percentage (FAT%) were determined by dual-energy X-ray absorptiometry (DXA) for each participant. Sarcopenia cut-off values for RSMI of 7.26kg·m(-2) for men and 5.45kg·m(-2) for women and elderly obesity cut-off values for FAT% of 27% for men and 38% for women were used. Individuals above the RSMI cut-off and below the FAT% cut-off were classified in the normal phenotype category, while individuals below the RSMI cut-off and above the FAT% cut-off were classified in the sarcopenic-obese phenotype category. Prediction equations for RSMI and FAT% from sex, BMI, and handgrip strength values were developed using multiple regression analysis. The prediction equations were validated using double cross-validation. The final regression equation developed to predict FAT% from sex, BMI, and handgrip strength resulted in a strong relationship (adjusted R(2)=0.741) to DXA values with a low standard error of the estimate (SEE=3.994%). The final regression equation developed to predict RSMI from the field-based testing measures also resulted in a strong relationship (adjusted R(2)=0.841) to DXA values with a low standard error of the estimate (SEE=0.544kg·m(-2)). Isoperformance curves were developed from the relationship between BMI and handgrip strength for men and women with the aforementioned clinical phenotype classification criteria. These visual representations were used to aid in the

  1. Social disparities in BMI trajectories across adulthood by gender, race/ethnicity and lifetime socio-economic position: 1986-2004.

    Science.gov (United States)

    Clarke, Philippa; O'Malley, Patrick M; Johnston, Lloyd D; Schulenberg, John E

    2009-04-01

    The prevalence of obesity and overweight is rapidly increasing in industrialized countries, with long-term health and social consequences. There is also a strong social patterning of obesity and overweight, with a higher prevalence among women, racial/ethnic minorities and those from a lower socio-economic position (SEP). Most of the existing work in this area, however, is based on cross-sectional data or single cohort studies. No national studies to date have examined how social disparities in obesity and overweight differ by age and historical period using longitudinal data with repeated measures. We used panel data from the nationally representative Monitoring the Future Study (1986-2004) to examine social disparities in trajectories of body mass index (BMI) over adulthood (age 18-45). Self-reported height and weight were collected in this annual US survey of high-school seniors, followed biennially since 1976. Using growth curve models, we analysed BMI trajectories over adulthood by gender, race/ethnicity and lifetime SEP (measured by parents' education and respondent's education). BMI trajectories exhibit a curvilinear rate of change from age 18 to 45, but there was a strong period effect, such that weight gain was more rapid for more recent cohorts. As a result, successive cohorts become overweight (BMI>25) at increasingly earlier points in the life course. BMI scores were also consistently higher for women, racial/ethnic minority groups and those from a lower SEP. However, BMI scores for socially advantaged groups in recent cohorts were actually higher than those for their socially disadvantaged counterparts who were born 10 years earlier. Results highlight the importance of social status and socio-economic resources for maintaining optimal weight. Yet, even those in advantaged social positions have experienced an increase in BMI in recent years.

  2. BMI in relation to sperm count

    DEFF Research Database (Denmark)

    Sermondade, N; Faure, C; Fezeu, L

    2013-01-01

    BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...

  3. Sex differences in heritability of BMI

    DEFF Research Database (Denmark)

    Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O

    2003-01-01

    pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....

  4. Palo Verde Unit 3 BMI nozzle modification

    International Nuclear Information System (INIS)

    Waskey, D.

    2015-01-01

    The 61 BMI (Bottom Mount Instrumentation) nozzles of the unit 3 of the Palo Verde plant have been examined through ASME Code Case N722. The nozzle 3 was the only one with leakage noted. The ultrasound testing results are characteristic of PWSCC (Primary Water Stress Corrosion Cracking). The initiation likely occurred at a weld defect which was exposed to the primary water environment resulting in PWSCC. All other nozzles (60) showed no unacceptable indications. Concerning nozzle 3 one crack in J-groove weld connected large defect to primary water. An environmental model has been used to simulate and optimize the repair. The AREVA crew was on site 18 days after contract award and the job was completed in 12 days, 30 hours ahead of baseline schedule. This series of slides describes the examination of the BMI nozzles, the repair steps, and alternative design concepts

  5. Measurement-based reliability/performability models

    Science.gov (United States)

    Hsueh, Mei-Chen

    1987-01-01

    Measurement-based models based on real error-data collected on a multiprocessor system are described. Model development from the raw error-data to the estimation of cumulative reward is also described. A workload/reliability model is developed based on low-level error and resource usage data collected on an IBM 3081 system during its normal operation in order to evaluate the resource usage/error/recovery process in a large mainframe system. Thus, both normal and erroneous behavior of the system are modeled. The results provide an understanding of the different types of errors and recovery processes. The measured data show that the holding times in key operational and error states are not simple exponentials and that a semi-Markov process is necessary to model the system behavior. A sensitivity analysis is performed to investigate the significance of using a semi-Markov process, as opposed to a Markov process, to model the measured system.

  6. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  7. Trajectories of BMI change impact glucose and insulin metabolism.

    Science.gov (United States)

    Walsh, E I; Shaw, J; Cherbuin, N

    2018-03-01

    The aim of this study was to examine, in a community setting, whether trajectory of weight change over twelve years is associated with glucose and insulin metabolism at twelve years. Participants were 532 community-living middle-aged and elderly adults from the Personality and Total Health (PATH) Through Life study. They spanned the full weight range (underweight/normal/overweight/obese). Latent class analysis and multivariate generalised linear models were used to investigate the association of Body Mass Index (BMI, kg/m 2 ) trajectory over twelve years with plasma insulin (μlU/ml), plasma glucose (mmol/L), and HOMA2 insulin resistance and beta cell function at follow-up. All models were adjusted for age, gender, hypertension, pre-clinical diabetes status (normal fasting glucose or impaired fasting glucose) and physical activity. Four weight trajectories were extracted; constant normal (mean baseline BMI = 25; follow-up BMI = 25), constant high (mean baseline BMI = 36; follow-up BMI = 37), increase (mean baseline BMI = 26; follow-up BMI = 32) and decrease (mean baseline BMI = 34; follow-up BMI = 28). At any given current BMI, individuals in the constant high and increase trajectories had significantly higher plasma insulin, greater insulin resistance, and higher beta cell function than those in the constant normal trajectory. Individuals in the decrease trajectory did not differ from the constant normal trajectory. Current BMI significantly interacted with preceding BMI trajectory in its association with plasma insulin, insulin resistance, and beta cell function. The trajectory of preceding weight has an independent effect on blood glucose metabolism beyond body weight measured at any given point in time. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier

  8. An USB-based time measurement system

    International Nuclear Information System (INIS)

    Qin Xi; Liu Shubin; An Qi

    2010-01-01

    In this paper,we report the electronics of a timing measurement system of PTB(portable TDC board), which is a handy tool based on USB interface, customized for high precision time measurements without any crates. The time digitization is based on the High Performance TDC Chip (HPTDC). The real-time compensation for HPTDC outputs and the USB master logic are implemented in an ALTERA's Cyclone FPGA. The architecture design and logic design are described in detail. Test of the system showed a time resolution of 13.3 ps. (authors)

  9. Toward Measuring Network Aesthetics Based on Symmetry

    Directory of Open Access Journals (Sweden)

    Zengqiang Chen

    2017-05-01

    Full Text Available In this exploratory paper, we discuss quantitative graph-theoretical measures of network aesthetics. Related work in this area has typically focused on geometrical features (e.g., line crossings or edge bendiness of drawings or visual representations of graphs which purportedly affect an observer’s perception. Here we take a very different approach, abandoning reliance on geometrical properties, and apply information-theoretic measures to abstract graphs and networks directly (rather than to their visual representaions as a means of capturing classical appreciation of structural symmetry. Examples are used solely to motivate the approach to measurement, and to elucidate our symmetry-based mathematical theory of network aesthetics.

  10. Accuracy of magnetic resonance based susceptibility measurements

    Science.gov (United States)

    Erdevig, Hannah E.; Russek, Stephen E.; Carnicka, Slavka; Stupic, Karl F.; Keenan, Kathryn E.

    2017-05-01

    Magnetic Resonance Imaging (MRI) is increasingly used to map the magnetic susceptibility of tissue to identify cerebral microbleeds associated with traumatic brain injury and pathological iron deposits associated with neurodegenerative diseases such as Parkinson's and Alzheimer's disease. Accurate measurements of susceptibility are important for determining oxygen and iron content in blood vessels and brain tissue for use in noninvasive clinical diagnosis and treatment assessments. Induced magnetic fields with amplitude on the order of 100 nT, can be detected using MRI phase images. The induced field distributions can then be inverted to obtain quantitative susceptibility maps. The focus of this research was to determine the accuracy of MRI-based susceptibility measurements using simple phantom geometries and to compare the susceptibility measurements with magnetometry measurements where SI-traceable standards are available. The susceptibilities of paramagnetic salt solutions in cylindrical containers were measured as a function of orientation relative to the static MRI field. The observed induced fields as a function of orientation of the cylinder were in good agreement with simple models. The MRI susceptibility measurements were compared with SQUID magnetometry using NIST-traceable standards. MRI can accurately measure relative magnetic susceptibilities while SQUID magnetometry measures absolute magnetic susceptibility. Given the accuracy of moment measurements of tissue mimicking samples, and the need to look at small differences in tissue properties, the use of existing NIST standard reference materials to calibrate MRI reference structures is problematic and better reference materials are required.

  11. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  12. Comparison of ICD code-based diagnosis of obesity with measured obesity in children and the implications for health care cost estimates.

    Science.gov (United States)

    Kuhle, Stefan; Kirk, Sara F L; Ohinmaa, Arto; Veugelers, Paul J

    2011-12-21

    Administrative health databases are a valuable research tool to assess health care utilization at the population level. However, their use in obesity research limited due to the lack of data on body weight. A potential workaround is to use the ICD code of obesity to identify obese individuals. The objective of the current study was to investigate the sensitivity and specificity of an ICD code-based diagnosis of obesity from administrative health data relative to the gold standard measured BMI. Linkage of a population-based survey with anthropometric measures in elementary school children in 2003 with longitudinal administrative health data (physician visits and hospital discharges 1992-2006) from the Canadian province of Nova Scotia. Measured obesity was defined based on the CDC cut-offs applied to the measured BMI. An ICD code-based diagnosis obesity was defined as one or more ICD-9 (278) or ICD-10 code (E66-E68) of obesity from a physician visit or a hospital stay. Sensitivity and specificity were calculated and health care cost estimates based on measured obesity and ICD-based obesity were compared. The sensitivity of an ICD code-based obesity diagnosis was 7.4% using ICD codes between 2002 and 2004. Those correctly identified had a higher BMI and had higher health care utilization and costs. An ICD diagnosis of obesity in Canadian administrative health data grossly underestimates the true prevalence of childhood obesity and overestimates the health care cost differential between obese and non-obese children.

  13. Differential models of twin correlations in skew for body-mass index (BMI).

    Science.gov (United States)

    Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric

    2018-01-01

    Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.

  14. The association between BMI and health-related quality of life in the US population: sex, age and ethnicity matters.

    Science.gov (United States)

    Laxy, M; Teuner, C; Holle, R; Kurz, C

    2018-03-01

    Obesity is a major public health problem. Detailed knowledge about the relationship between body mass index (BMI) and health-related quality of life (HRQL) is important for deriving effective and cost-effective prevention and weight management strategies. This study aims to describe the sex-, age- and ethnicity-specific association between BMI and HRQL in the US adult population. Analyses are based on pooled cross-sectional data from 41 459 participants of the Medical Expenditure Panel Survey (MEPS) Household Component (HC) for the years 2000-2003. BMI was calculated using self-reported height and weight, and HRQL was assessed with the EuroQol five-dimensional questionnaire. Generalized additive models were fitted with a smooth function for BMI and a smooth-factor interaction for BMI with sex adjusted for age, ethnicity, poverty, smoking and physical activity. Models were further stratified by age and ethnicity. The association between BMI and HRQL is inverse U-shaped with a HRQL high point at a BMI of 22 kg m -2 in women and a HRQL high plateau at BMI values of 22-30 kg m -2 in men. Men aged 50 years and older with a BMI of 29 kg m -2 reported on average five-point higher visual analog scale (VAS) scores than peers with a BMI of 20 kg m -2 . The inverse U-shaped association is more pronounced in older people, and the BMI-HRQL relationship differs between ethnicities. In Hispanics, the BMI associated with the highest HRQL is higher than in white people and, in black women, the BMI-HRQL association has an almost linear negative slope. The results show that a more differentiated use of BMI cutoffs in scientific discussions and daily practice is indicated. The findings should be considered in the design of future weight loss and weight management programs.

  15. Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.

    Science.gov (United States)

    Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S

    2014-11-01

    A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much

  16. A SVD Based Image Complexity Measure

    DEFF Research Database (Denmark)

    Gustafsson, David Karl John; Pedersen, Kim Steenstrup; Nielsen, Mads

    2009-01-01

    Images are composed of geometric structures and texture, and different image processing tools - such as denoising, segmentation and registration - are suitable for different types of image contents. Characterization of the image content in terms of geometric structure and texture is an important...... problem that one is often faced with. We propose a patch based complexity measure, based on how well the patch can be approximated using singular value decomposition. As such the image complexity is determined by the complexity of the patches. The concept is demonstrated on sequences from the newly...... collected DIKU Multi-Scale image database....

  17. Ordinal-Measure Based Shape Correspondence

    Directory of Open Access Journals (Sweden)

    Faouzi Alaya Cheikh

    2002-04-01

    Full Text Available We present a novel approach to shape similarity estimation based on distance transformation and ordinal correlation. The proposed method operates in three steps: object alignment, contour to multilevel image transformation, and similarity evaluation. This approach is suitable for use in shape classification, content-based image retrieval and performance evaluation of segmentation algorithms. The two latter applications are addressed in this papers. Simulation results show that in both applications our proposed measure performs quite well in quantifying shape similarity. The scores obtained using this technique reflect well the correspondence between object contours as humans perceive it.

  18. Attenuated associations between increasing BMI and unfavorable lipid profiles in Chinese Buddhist vegetarians.

    Science.gov (United States)

    Zhang, Hui-Jie; Han, Peng; Sun, Su-Yun; Wang, Li-Ying; Yan, Bing; Zhang, Jin-Hua; Zhang, Wei; Yang, Shu-Yu; Li, Xue-Jun

    2013-01-01

    Obesity is related to hyperlipidemia and risk of cardiovascular disease. Health benefits of vegetarian diets have well-documented in the Western countries where both obesity and hyperlipidemia were prevalent. We studied the association between BMI and various lipid/lipoprotein measures, as well as between BMI and predicted coronary heart disease probability in lean, low risk populations in Southern China. The study included 170 Buddhist monks (vegetarians) and 126 omnivore men. Interaction between BMI and vegetarian status was tested in the multivariable regression analysis adjusting for age, education, smoking, alcohol drinking, and physical activity. Compared with omnivores, vegetarians had significantly lower mean BMI, blood pressures, total cholesterol, low density lipoprotein cholesterol, high density lipoprotein cholesterol, total cholesterol to high density lipoprotein ratio, triglycerides, apolipoprotein B and A-I, as well as lower predicted probability of coronary heart disease. Higher BMI was associated with unfavorable lipid/lipoprotein profile and predicted probability of coronary heart disease in both vegetarians and omnivores. However, the associations were significantly diminished in Buddhist vegetarians. Vegetarian diets not only lower BMI, but also attenuate the BMI-related increases of atherogenic lipid/ lipoprotein and the probability of coronary heart disease.

  19. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

    Science.gov (United States)

    Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

    2018-01-01

    The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

  20. Green maritime transportation: Market based measures

    DEFF Research Database (Denmark)

    Psaraftis, Harilaos N.

    2016-01-01

    The purpose of this chapter is to introduce the concept of Market Based Measures (MBMs) to reduce Green House Gas (GHG) emissions from ships, and review several distinct MBM proposals that have been under consideration by the International Maritime Organization (IMO). The chapter discusses the me...... the mechanisms used by MBMs, and explores how the concept of the Marginal Abatement Cost (MAC) can be linked to MBMs. It also attempts to discuss the pros and cons of the submitted proposals....

  1. Statistical inference based on divergence measures

    CERN Document Server

    Pardo, Leandro

    2005-01-01

    The idea of using functionals of Information Theory, such as entropies or divergences, in statistical inference is not new. However, in spite of the fact that divergence statistics have become a very good alternative to the classical likelihood ratio test and the Pearson-type statistic in discrete models, many statisticians remain unaware of this powerful approach.Statistical Inference Based on Divergence Measures explores classical problems of statistical inference, such as estimation and hypothesis testing, on the basis of measures of entropy and divergence. The first two chapters form an overview, from a statistical perspective, of the most important measures of entropy and divergence and study their properties. The author then examines the statistical analysis of discrete multivariate data with emphasis is on problems in contingency tables and loglinear models using phi-divergence test statistics as well as minimum phi-divergence estimators. The final chapter looks at testing in general populations, prese...

  2. Bioimpedance measurement based evaluation of wound healing.

    Science.gov (United States)

    Kekonen, Atte; Bergelin, Mikael; Eriksson, Jan-Erik; Vaalasti, Annikki; Ylänen, Heimo; Viik, Jari

    2017-06-22

    Our group has developed a bipolar bioimpedance measurement-based method for determining the state of wound healing. The objective of this study was to assess the capability of the method. To assess the performance of the method, we arranged a follow-up study of four acute wounds. The wounds were measured using the method and photographed throughout the healing process. Initially the bioimpedance of the wounds was significantly lower than the impedance of the undamaged skin, used as a baseline. Gradually, as healing progressed, the wound impedance increased and finally reached the impedance of the undamaged skin. The clinical appearance of the wounds examined in this study corresponded well with the parameters derived from the bioimpedance data. Hard-to-heal wounds are a significant and growing socioeconomic burden, especially in the developed countries, due to aging populations and to the increasing prevalence of various lifestyle related diseases. The assessment and the monitoring of chronic wounds are mainly based on visual inspection by medical professionals. The dressings covering the wound must be removed before assessment; this may disturb the wound healing process and significantly increases the work effort of the medical staff. There is a need for an objective and quantitative method for determining the status of a wound without removing the wound dressings. This study provided evidence of the capability of the bioimpedance based method for assessing the wound status. In the future measurements with the method should be extended to concern hard-to-heal wounds.

  3. Sagittal abdominal diameter shows better correlation with cardiovascular risk factors than waist circumference and BMI

    OpenAIRE

    de Souza, Natalia Cavalheri; de Oliveira, Erick Prado

    2013-01-01

    Background Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). Objective To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. Methods A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87?...

  4. Quantitative Analysis and Comparison of BMI among Han, Tibetan, and Uygur University Students in Northwest China

    OpenAIRE

    Jingya, Bai; Ye, He; Jing, Wang; Xi, Huanjiu; Tao, Hai

    2013-01-01

    Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students’ physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BM...

  5. Comparison of Aorta-sacral Promontory Distance with Age and BMI in Female Patients Undergoing CT

    OpenAIRE

    Sneha Mary Varghese; Suresh Sukumar; Abhimanyu Pradhan

    2017-01-01

    Introduction: Sacral colpopexy is the gold standard procedure for pelvic organ prolapse. During sacral colpopexy, various complications such as haemorrhage can occur. Careful dissection of presacral space is essential to minimize complications. Aim: The aim of the study was to compare patient age and Body Mass Index (BMI) with Computed Tomography (CT) measured aorta-sacral promontory distance. Materials and Methods: From 172 samples data such as age and BMI of female patients aged 18 ye...

  6. Animal-based measures for welfare assessment

    Directory of Open Access Journals (Sweden)

    Agostino Sevi

    2010-01-01

    Full Text Available Animal welfare assessment can’t be irrespective of measures taken on animals. Indeed, housing parametersrelatedtostructures, designandmicro-environment, evenifreliable parameters related to structures, design and micro-environment, even if reliable and easier to take, can only identify conditions which could be detrimental to animal welfare, but can’t predict poor welfare in animals per se. Welfare assessment through animal-based measures is almost complex, given that animals’ responses to stressful conditions largely depend on the nature, length and intensity of challenges and on physiological status, age, genetic susceptibility and previous experience of animals. Welfare assessment requires a multi-disciplinary approach and the monitoring of productive, ethological, endocrine, immunological and pathological param- eters to be exhaustive and reliable. So many measures are needed, because stresses can act only on some of the mentioned parameters or on all of them but at different times and degree. Under this point of view, the main aim of research is to find feasible and most responsive indicators of poor animal welfare. In last decades, studies focused on the following parameters for animal wel- fare assessment indexes of biological efficiency, responses to behavioral tests, cortisol secretion, neutrophil to lymphocyte ratio, lymphocyte proliferation, production of antigen specific IgG and cytokine release, somatic cell count and acute phase proteins. Recently, a lot of studies have been addressed to reduce handling and constraint of animals for taking measures to be used in welfare assessment, since such procedures can induce stress in animals and undermined the reliability of measures taken for welfare assessment. Range of animal-based measures for welfare assessment is much wider under experimental condition than at on-farm level. In welfare monitoring on-farm the main aim is to find feasible measures of proved validity and reliability

  7. Prospective associations between sedentary lifestyle and BMI in midlife

    DEFF Research Database (Denmark)

    Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

    2006-01-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

  8. Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

    Science.gov (United States)

    Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

    2017-01-01

    Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

  9. Measuring globalization-based acculturation in Ladakh

    DEFF Research Database (Denmark)

    Ozer, Simon; Schwartz, Seth

    2016-01-01

    Theories and methodologies within acculturation psychology have been advanced in orderto capture the complex process of intercultural contact in various contexts. Differentiatingglobalization-based acculturation from immigrant-based acculturation has broadened thefield of acculturation psychology...... to include groups who are exposed to global culturalstreams without international migration. The globalization-based acculturation process inthe North Indian region of Ladakh appears to be a tricultural encounter, suggesting anaddendum to the bidimensional acculturation model for this group (and perhaps...... for othersas well). This study explores the development, usability, and validity of a tridimensionalacculturation measure aiming to capture the multicultural orientations initiated by theprocess of globalization in Ladakh. The tridimensional acculturation scale was found to fitthe data significantly better...

  10. Property-Based Software Engineering Measurement

    Science.gov (United States)

    Briand, Lionel C.; Morasca, Sandro; Basili, Victor R.

    1997-01-01

    Little theory exists in the field of software system measurement. Concepts such as complexity, coupling, cohesion or even size are very often subject to interpretation and appear to have inconsistent definitions in the literature. As a consequence, there is little guidance provided to the analyst attempting to define proper measures for specific problems. Many controversies in the literature are simply misunderstandings and stem from the fact that some people talk about different measurement concepts under the same label (complexity is the most common case). There is a need to define unambiguously the most important measurement concepts used in the measurement of software products. One way of doing so is to define precisely what mathematical properties characterize these concepts, regardless of the specific software artifacts to which these concepts are applied. Such a mathematical framework could generate a consensus in the software engineering community and provide a means for better communication among researchers, better guidelines for analysts, and better evaluation methods for commercial static analyzers for practitioners. In this paper, we propose a mathematical framework which is generic, because it is not specific to any particular software artifact and rigorous, because it is based on precise mathematical concepts. We use this framework to propose definitions of several important measurement concepts (size, length, complexity, cohesion, coupling). It does not intend to be complete or fully objective; other frameworks could have been proposed and different choices could have been made. However, we believe that the formalisms and properties we introduce are convenient and intuitive. This framework contributes constructively to a firmer theoretical ground of software measurement.

  11. Universal equation for estimating ideal body weight and body weight at any BMI.

    Science.gov (United States)

    Peterson, Courtney M; Thomas, Diana M; Blackburn, George L; Heymsfield, Steven B

    2016-05-01

    Ideal body weight (IBW) equations and body mass index (BMI) ranges have both been used to delineate healthy or normal weight ranges, although these 2 different approaches are at odds with each other. In particular, past IBW equations are misaligned with BMI values, and unlike BMI, the equations have failed to recognize that there is a range of ideal or target body weights. For the first time, to our knowledge, we merged the concepts of a linear IBW equation and of defining target body weights in terms of BMI. With the use of calculus and approximations, we derived an easy-to-use linear equation that clinicians can use to calculate both IBW and body weight at any target BMI value. We measured the empirical accuracy of the equation with the use of NHANES data and performed a comparative analysis with past IBW equations. Our linear equation allowed us to calculate body weights for any BMI and height with a mean empirical accuracy of 0.5-0.7% on the basis of NHANES data. Moreover, we showed that our body weight equation directly aligns with BMI values for both men and women, which avoids the overestimation and underestimation problems at the upper and lower ends of the height spectrum that have plagued past IBW equations. Our linear equation increases the sophistication of IBW equations by replacing them with a single universal equation that calculates both IBW and body weight at any target BMI and height. Therefore, our equation is compatible with BMI and can be applied with the use of mental math or a calculator without the need for an app, which makes it a useful tool for both health practitioners and the general public. © 2016 American Society for Nutrition.

  12. Raised BMI cut-off for overweight in Greenland Inuit – a review

    Science.gov (United States)

    Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

    2013-01-01

    Background Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI. PMID:23986904

  13. Raised BMI cut-off for overweight in Greenland Inuit – a review

    Directory of Open Access Journals (Sweden)

    Stig Andersen

    2013-08-01

    Full Text Available Background. Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI, a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI.

  14. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  15. Maternal BMI during Pregnancy: Effect on trace elements Status and ...

    African Journals Online (AJOL)

    Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...

  16. Self-control mediates the relationship between time perspective and BMI.

    Science.gov (United States)

    Price, Menna; Higgs, Suzanne; Lee, Michelle

    2017-01-01

    Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Bidirectional associations between mothers' and fathers' parenting consistency and child bmi

    OpenAIRE

    Jansen, Pauline; Giallo, Rebecca; Westrupp, Elizabeth; Wake, Melissa; Nicholson, Jan

    2013-01-01

    textabstractBACKGROUND: Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. METHODS: Participants were 4002 children and their parents in the population-based Longitudinal Study of...

  18. Prevalence of elevated mean arterial pressure and how fitness moderates its association with BMI in youth.

    Science.gov (United States)

    Ogunleye, Ayodele A; Sandercock, Gavin R; Voss, Christine; Eisenmann, Joey C; Reed, Katharine

    2013-11-01

    Cardiorespiratory fitness is known to be cardioprotective and its association with the components of the metabolic syndrome in children is becoming clearer. The aim of the present study was to examine the extent to which cardiorespiratory fitness may offset the weight-related association with mean arterial pressure (MAP) in schoolchildren. Cross-sectional study. Schoolchildren from the East of England, U.K. A total of 5983 (48% females) schoolchildren, 10 to 16 years of age, had height, weight and blood pressure measured by standard procedures and cardiorespiratory fitness assessed by the 20 m shuttle-run test. Participants were classified as fit or unfit using internationally accepted fitness cut-off points; and as normal weight, overweight or obese based on BMI, again using international cut-off points. Age-adjusted ANCOVA was used to determine the main effects and interaction of fitness and BMI on MAP Z-score. Logistic regression models were used to estimate odds ratios of elevated MAP. Prevalence of elevated MAP in schoolchildren was 14.8% overall and 35.7% in those who were obese-unfit. Approximately 21% of participants were overweight and 5% obese, while 23% were classified as unfit. MAP generally increased across BMI categories and was higher in the aerobically unfit participants. Obese-fit males had lower MAP compared with obese-unfit males (P < 0.001); this trend was similar in females (P = 0.05). Increasing fitness level may have a positive impact on the weight-related elevations of MAP seen in obese and overweight schoolchildren.

  19. Korean Clinic Based Outcome Measure Studies

    Directory of Open Access Journals (Sweden)

    Jongbae Park

    2003-02-01

    Full Text Available Background: Evidence based medicine has become main tools for medical practice. However, conducting a highly ranked in the evidence hierarchy pyramid is not easy or feasible at all times and places. There remains a room for descriptive clinical outcome measure studies with admitting the limit of the intepretation. Aims: Presents three Korean clinic based outcome measure studies with a view to encouraging Korean clinicians to conduct similar studies. Methods: Three studies are presented briefly here including 1 Quality of Life of liver cancer patients after 8 Constitutional acupuncture; 2 Developing a Korean version of Measuring yourself Medical Outcome profile (MYMOP; and 3 Survey on 5 Shu points: a pilot In the first study, we have included 4 primary or secondary liver cancer patients collecting their diagnostic X-ray film and clinical data f개m their hospital, and asked them to fill in the European Organization Research and Treatment of Cancer, Quality of Life Questionnaire before the commencement of the treatment. The acupuncture treatment is set up format but not disclosed yet. The translation and developing a Korean version of outcome measures that is Korean clinician friendly has been sought for MYMOP is one of the most appropriate one. The permission was granted, the translation into Korean was done, then back translated into English only based on the Korean translation by the researcher who is bilingual in both languages. The back translation was compared by the original developer of MYMOP and confirmed usable. In order to test the existence of acupoints and meridians through popular forms of Korean acupuncture regimes, we aim at collecting opinions from 101 Korean clinicians that have used those forms. The questions asked include most effective symptoms, 5 Shu points, points those are least likely to use due to either adverse events or the lack of effectiveness, theoretical reasons for the above proposals, proposing outcome measures

  20. Cardiorespiratory fitness, BMI, and risk of hypertension: the HYPGENE study.

    Science.gov (United States)

    Rankinen, Tuomo; Church, Timothy S; Rice, Treva; Bouchard, Claude; Blair, Steven N

    2007-10-01

    Cardiorespiratory fitness and regular physical activity are inversely associated with the risk of hypertension, and exercise training has been shown to lower elevated blood pressure (BP). Genetic factors contribute significantly to the interindividual differences in endurance training-induced changes in BP. However, similar data on the genotype-by-fitness interactions on the risk of hypertension are scarce. In 2000, we started a systematic collection of blood samples from all consenting subjects of the Aerobics Center Longitudinal Study (ACLS) with a goal to generate a resource for studies addressing genotype-by-fitness interaction effects on various health-related end points. Here, we introduce the rationale and design of the first study based on the ACLS genetics resource focusing on hypertension as the health outcome (HYPGENE study), and we report the associations of cardiorespiratory fitness and body mass index (BMI) with the risk of hypertension. All HYPGENE subjects (N = 1234) were healthy and normotensive at their first clinic visit. Cases (N = 629) developed hypertension during the follow-up period (mean 8.7 yr), whereas controls (N = 605) remained normotensive (mean follow-up 10.1 yr). Cardiorespiratory fitness was the strongest predictor of the hypertension risk, with each maximal metabolic equivalent unit being associated with a 19% lower risk (95% confidence interval [95% CI], 12-24%). Each baseline BMI unit was associated with a 9% higher hypertension risk (95% CI, 4-13%). However, the association of BMI was greatly attenuated (odds ratio 1.04 [95% CI, 0.99-1.09]) when fitness also was included in the model. The HYPGENE study will provide an excellent resource to address hypotheses regarding the genetic basis of hypertension while taking cardiorespiratory fitness level into account.

  1. Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

    Science.gov (United States)

    Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

    2014-01-01

    Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

  2. Eating behaviour patterns and BMI in Portuguese higher education students.

    Science.gov (United States)

    Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

    2013-12-01

    Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  4. Measuring Modularity in Open Source Code Bases

    Directory of Open Access Journals (Sweden)

    Roberto Milev

    2009-03-01

    Full Text Available Modularity of an open source software code base has been associated with growth of the software development community, the incentives for voluntary code contribution, and a reduction in the number of users who take code without contributing back to the community. As a theoretical construct, modularity links OSS to other domains of research, including organization theory, the economics of industry structure, and new product development. However, measuring the modularity of an OSS design has proven difficult, especially for large and complex systems. In this article, we describe some preliminary results of recent research at Carleton University that examines the evolving modularity of large-scale software systems. We describe a measurement method and a new modularity metric for comparing code bases of different size, introduce an open source toolkit that implements this method and metric, and provide an analysis of the evolution of the Apache Tomcat application server as an illustrative example of the insights gained from this approach. Although these results are preliminary, they open the door to further cross-discipline research that quantitatively links the concerns of business managers, entrepreneurs, policy-makers, and open source software developers.

  5. Maternal and offspring intelligence in relation to BMI across childhood and adolescence.

    Science.gov (United States)

    Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R

    2018-01-30

    The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous

  6. Modeling the dynamics of BMI changes during adolescence. The Oporto Growth, Health and Performance Study.

    Science.gov (United States)

    de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R

    2015-07-01

    The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.

  7. The Role of BMI in Hip Fracture Surgery.

    Science.gov (United States)

    Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

    2018-01-01

    Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

  8. Physical activity and its related motivational attributes in adolescents with different BMI.

    Science.gov (United States)

    Hwang, J; Kim, Y H

    2013-03-01

    A number of obesity studies have been focused on identifying the relationships between socioeconomic status and physical activity involvement. In behavioral medicine, the limited data are available on obese people's physical activity and its related psychological predictors based on psychological theories. To identify the differences in physical activity and its related motivational attributes among normal weight, overweight, and obese adolescents and to find the effect of body mass index (BMI) and the Self-Determination Theory (SDT) constructs in predicting physical activity. One thousand seventy-one students ranging from seventh to ninth grades were randomly selected from three junior high schools in Seoul (359 normal weight students, 468 overweight students, and 244 obese students). A Korean version of Behavioral Regulation in Exercise Questionnaire-2 and Leisure Time Exercise Questionnaire were applied to measure the participants' motivational attributes and physical activity. Overweight and obese adolescents showed higher scores on amotivation and externally motivated regulations for physical activity than their normal weight counterparts. Internal regulation was more significant for physical activity in normal weight adolescent. However, there was no difference in physical activity among the three groups. Additionally, the findings identified that BMI and the SDT constructs were significant to explain physical activity. This study offers fundamental knowledge in gaining a clearer understanding of the types of motivation most likely to contribute to the initiation and promotion of physical activity in overweight and obese adolescents.

  9. Combining Body Mass Index With Measures of Central Obesity in the Assessment of Mortality in Subjects With Coronary Disease

    DEFF Research Database (Denmark)

    Coutinho, Thais; Goel, Kashish; Corrêa de Sá, Daniel

    2013-01-01

    This study sought to assess the mortality risk of patients with coronary artery disease (CAD) based ona combination of body mass index (BMI) with measures of central obesity.......This study sought to assess the mortality risk of patients with coronary artery disease (CAD) based ona combination of body mass index (BMI) with measures of central obesity....

  10. Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

    Science.gov (United States)

    Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

    2017-09-01

    The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

  11. Characteristics of screen media use associated with higher BMI in young adolescents.

    Science.gov (United States)

    Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael

    2013-05-01

    This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.

  12. Linear systems a measurement based approach

    CERN Document Server

    Bhattacharyya, S P; Mohsenizadeh, D N

    2014-01-01

    This brief presents recent results obtained on the analysis, synthesis and design of systems described by linear equations. It is well known that linear equations arise in most branches of science and engineering as well as social, biological and economic systems. The novelty of this approach is that no models of the system are assumed to be available, nor are they required. Instead, a few measurements made on the system can be processed strategically to directly extract design values that meet specifications without constructing a model of the system, implicitly or explicitly. These new concepts are illustrated by applying them to linear DC and AC circuits, mechanical, civil and hydraulic systems, signal flow block diagrams and control systems. These applications are preliminary and suggest many open problems. The results presented in this brief are the latest effort in this direction and the authors hope these will lead to attractive alternatives to model-based design of engineering and other systems.

  13. Overweight or obese BMI is associated with earlier, but not later survival after common acute illnesses.

    Science.gov (United States)

    Prescott, Hallie C; Chang, Virginia W

    2018-02-06

    Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.

  14. Maternal depression and child BMI: longitudinal findings from a US sample.

    Science.gov (United States)

    Duarte, C S; Shen, S; Wu, P; Must, A

    2012-04-01

    To examine the association between maternal depression and child body mass index (BMI) from Kindergarten (K) to fifth grade. Analysis of four waves of data from the Early Childhood Longitudinal Study - Kindergarten spanning K to fifth grade. Maternal depressive symptoms (MDSs) were measured by a brief version of the Center for Epidemiological Studies Depression scale. Data were analyzed using multiple regression analyses, adjusting for key covariates and potential confounders. The analytic sample was restricted to children of normal birth weight. The relationship between MDS and child BMI varies by child gender and age. Among girls, severe MDS at K was related to lower BMI at third grade (but not later at fifth grade) and to an increase in BMI from K to third and K to fifth grades. Among boys, severe MDS at K was related to higher boys' BMI at fifth grade. When severe MDS occurred at third grade, it was related to higher BMI at fifth grade among girls whereas no statistically significant relationship was found for boys. Low levels of physical activity in comparison to peers at fifth grade and more screen time on weekends at third grade are likely mediators of the relationship between MDS and child BMI among girls, while among boys the relationship appears to be mediated by unhealthy eating habits. Our findings, indicating developmental and gender differences in the relationship between maternal depression and child BMI, if confirmed, suggest that interventions addressing maternal depression may have concomitant impact on childhood obesity. © 2012 The Authors. Pediatric Obesity © 2012 International Association for the Study of Obesity.

  15. Heterogeneity Measurement Based on Distance Measure for Polarimetric SAR Data

    Science.gov (United States)

    Xing, Xiaoli; Chen, Qihao; Liu, Xiuguo

    2018-04-01

    To effectively test the scene heterogeneity for polarimetric synthetic aperture radar (PolSAR) data, in this paper, the distance measure is introduced by utilizing the similarity between the sample and pixels. Moreover, given the influence of the distribution and modeling texture, the K distance measure is deduced according to the Wishart distance measure. Specifically, the average of the pixels in the local window replaces the class center coherency or covariance matrix. The Wishart and K distance measure are calculated between the average matrix and the pixels. Then, the ratio of the standard deviation to the mean is established for the Wishart and K distance measure, and the two features are defined and applied to reflect the complexity of the scene. The proposed heterogeneity measure is proceeded by integrating the two features using the Pauli basis. The experiments conducted on the single-look and multilook PolSAR data demonstrate the effectiveness of the proposed method for the detection of the scene heterogeneity.

  16. A Multi-Component Day-Camp Weight-Loss Program Is Effective in Reducing BMI in Children after One Year: A Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Kristian Traberg Larsen

    Full Text Available The objective of the present study was to evaluate the effectiveness of a one-year multi-component immersive day-camp weight-loss intervention for children with overweight and obesity. The study design was a parallel-group randomized controlled trial. One hundred fifteen 11-13-year-old children with overweight and obesity were randomized into either: A six-week day-camp intervention arm focusing on increased physical activity, and healthy diet followed by a subsequent one-year family-based intervention, or a standard intervention arm consisting of one weekly exercise session for six weeks. Body mass index (BMI was the primary outcome. BMI z-score, clustered cardiovascular risk z-score, and body composition were secondary outcomes. All outcomes were measured at baseline, six week-, and 52 week follow-up. After six weeks, children from the day-camp intervention arm had improved their BMI (-2.2 kg/m2 (95% CI -2.6 to -1.7, P<0.001 and all secondary outcomes when compared to the children from the standard intervention arm. After 52 weeks, the day-camp intervention arm had a lower BMI (-1.2 kg/m2 (95% CI -1.8 to -0.5, P = 0.001, and BMI z-score (-0.20 (95% CI -0.35 to -0.05, P = 0.008, and clustered cardiovascular risk z-score (-0.23 (95% CI -0.37 to -0.08, P = 0.002 compared to the standard intervention arm. No group differences were detected in body composition after 52 weeks. This study shows that the day-camp intervention arm is effective in reducing BMI and improving the metabolic health of children with overweight and obesity. However, the effects seem to be diminishing over time.

  17. Summer effects on body mass index (BMI gain and growth patterns of American Indian children from kindergarten to first grade: a prospective study

    Directory of Open Access Journals (Sweden)

    Zhang Jianduan

    2011-12-01

    Full Text Available Abstract Background Overweight and obesity are highly prevalent among American Indian children, especially those living on reservations. There is little scientific evidence about the effects of summer vacation on obesity development in children. The purpose of this study was to investigate the effects of summer vacation between kindergarten and first grade on growth in height, weight, and body mass index (BMI for a sample of American Indian children. Methods Children had their height and weight measured in four rounds of data collection (yielded three intervals: kindergarten, summer vacation, and first grade as part of a school-based obesity prevention trial (Bright Start in a Northern Plains Indian Reservation. Demographic variables were collected at baseline from parent surveys. Growth velocities (Z-score units/year for BMI, weight, and height were estimated and compared for each interval using generalized linear mixed models. Results The children were taller and heavier than median of same age counterparts. Height Z-scores were positively associated with increasing weight status category. The mean weight velocity during summer was significantly less than during the school year. More rapid growth velocity in height during summer than during school year was observed. Obese children gained less adjusted-BMI in the first grade after gaining more than their counterparts during the previous two intervals. No statistically significant interval effects were found for height and BMI velocities. Conclusions There was no indication of a significant summer effect on children's BMI. Rather than seasonal or school-related patterns, the predominant pattern indicated by weight-Z and BMI-Z velocities might be related to age or maturation. Trial registration Bright Start: Obesity Prevention in American Indian Children Clinical Trial Govt ID# NCT00123032

  18. Using satellite-based measurements to explore ...

    Science.gov (United States)

    New particle formation (NPF) can potentially alter regional climate by increasing aerosol particle (hereafter particle) number concentrations and ultimately cloud condensation nuclei. The large scales on which NPF is manifest indicate potential to use satellite-based (inherently spatially averaged) measurements of atmospheric conditions to diagnose the occurrence of NPF and NPF characteristics. We demonstrate the potential for using satellite-measurements of insolation (UV), trace gas concentrations (sulfur dioxide (SO2), nitrogen dioxide (NO2), ammonia (NH3), formaldehyde (HCHO), ozone (O3)), aerosol optical properties (aerosol optical depth (AOD), Ångström exponent (AE)), and a proxy of biogenic volatile organic compound emissions (leaf area index (LAI), temperature (T)) as predictors for NPF characteristics: formation rates, growth rates, survival probabilities, and ultrafine particle (UFP) concentrations at five locations across North America. NPF at all sites is most frequent in spring, exhibits a one-day autocorrelation, and is associated with low condensational sink (AOD×AE) and HCHO concentrations, and high UV. However, there are important site-to-site variations in NPF frequency and characteristics, and in which of the predictor variables (particularly gas concentrations) significantly contribute to the explanatory power of regression models built to predict those characteristics. This finding may provide a partial explanation for the reported spatia

  19. Relationship between 8/9-yr-old school children BMI, parents' BMI and educational level: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Pilato Valentina

    2011-07-01

    Full Text Available Abstract Background Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES of families in Tuscany. Methods The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health and consisted of 1,751 (922 males and 855 females 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. Results The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p Conclusion Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.

  20. Vapreotide: BMY 41606, RC 160, Sanvar.

    Science.gov (United States)

    2003-01-01

    Vapreotide [Octastatin, Sanvar, RC 160, BMY 41606] is a somatostatin analogue developed at Tulane University School of Medicine, New Orleans, USA, which holds patent rights for vapreotide. Vapreotide provides a much higher metabolic stability than its parent compound. Vapreotide was licensed to Debiopharm for development in Europe. Vapreotide is usually administered SC although a slow-release IM formulation is also available. Other sustained-release formulations are under development. H3 Pharma plans to sign agreements for all indications in the core markets of North America, Europe and in non-core geographic regions during 2003. H3 Pharma will also seek to obtain registration and early market entry in non-core countries with help from partners. Sanvar Immediate Release (IR) has been submitted for approval within the European Union for the treatment of acute oesophageal variceal bleeding (EVB). Sanvar IR has been awarded orphan drug status in the US for EVB. In July 2003, H3 Pharma received written confirmation from the US FDA that the dossier for Sanvar is fileable for registration in the United States for the treatment of esophageal variceal bleeding (EVB). The Sanvar IR (immediate-release) formulation is expected to enter the US market by late 2004. H3 Pharma expects to file for Latin American registration for this indication in the second half of 2003, with registrations in other regions to follow. Sanvar SR has been submitted for Orphan Drug designation.

  1. Cortisol in human milk predicts child BMI.

    Science.gov (United States)

    Hahn-Holbrook, Jennifer; Le, Tran Bao; Chung, Anna; Davis, Elysia Poggi; Glynn, Laura M

    2016-12-01

    Breastfeeding has been linked to lower rates of childhood obesity. Human milk contains cortisol, known to regulate glucose storage and metabolism. The aim of this study was to to test the hypothesis that early exposure to cortisol in human breast milk helps to modulate infant body mass index (BMI) trajectories over the first 2 years of life. Growth curve modeling was used to examine whether infant exposure to cortisol in human milk at 3 months predicted changes in child body mass index percentile (BMIP) at 6, 12, and 24 months of age in 51 breastfeeding mother-child pairs. Infants exposed to higher milk cortisol levels at 3 months were less likely to exhibit BMIP gains over the first 2 years of life, compared with infants exposed to lower milk cortisol. By age 2, infants exposed to higher milk cortisol levels had lower BMIPs than infants exposed to lower milk cortisol. Milk cortisol was a stronger predictor of BMIP change in girls than boys. Cortisol exposure through human milk may help to program metabolic functioning and childhood obesity risk. Further, because infant formula contains only trace amounts of glucocorticoids, these findings suggest that cortisol in milk is a novel biological pathway through which breastfeeding may protect against later obesity. © 2016 The Obesity Society.

  2. The Association between BMI and Different Frailty Domains: A U-Shaped Curve?

    Science.gov (United States)

    Rietman, M L; van der A, D L; van Oostrom, S H; Picavet, H S J; Dollé, M E T; van Steeg, H; Verschuren, W M M; Spijkerman, A M W

    2018-01-01

    Previous studies showed a U-shaped association between BMI and (physical) frailty. We studied the association between BMI and physical, cognitive, psychological, and social frailty. Furthermore, the overlap between and prevalence of these frailty domains was examined. Cross-sectional study. The Doetinchem Cohort Study is a longitudinal population-based study starting in 1987-1991 examining men and women aged 20-59 with follow-up examinations every 5 yrs. For the current analyses, we used data from round 5 (2008-2012) with 4019 participants aged 41-81 yrs. Physical frailty was defined as having ≥ 2 of 4 frailty criteria from the Frailty Phenotype (unintentional weight loss, exhaustion, physical activity, handgrip strength). Cognitive frailty was defined as the BMI was divided into four classes. Analyses were adjusted for sex, age, level of education, and smoking. A U-shaped association was observed between BMI and physical frailty, a small linear association for BMI and cognitive frailty and no association between BMI and psychological and social frailty. The four frailty domains showed only a small proportion of overlap. The prevalence of physical, cognitive and social frailty increased with age, whereas psychological frailty did not. We confirm that not only underweight but also obesity is associated with physical frailty. Obesity also seems to be associated with cognitive frailty. Further, frailty prevention should focus on multiple domains and target individuals at a younger age (<65yrs).

  3. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  4. Multiparty correlation measure based on the cumulant

    International Nuclear Information System (INIS)

    Zhou, D. L.; Zeng, B.; Xu, Z.; You, L.

    2006-01-01

    We propose a genuine multiparty correlation measure for a multiparty quantum system as the trace norm of the cumulant of the state. The legitimacy of our multiparty correlation measure is explicitly demonstrated by proving it satisfies the five basic conditions required for a correlation measure. As an application we construct an efficient algorithm for the calculation of our measures for all stabilizer states

  5. Adrenocortical regulation, eating in the absence of hunger and BMI in young children.

    Science.gov (United States)

    Francis, L A; Granger, D A; Susman, E J

    2013-05-01

    The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5-9years (N=43). Saliva was collected before and after the Trier Social Stress Test for Children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60min post-TSST-C. Age- and sex-specific BMI scores were calculated from measured height and weight, and eating in the absence of hunger was assessed using weighed food intake during a behavioral procedure. We also included a measure of parents' report of child impulsivity, as well as family demographic information. Participants were stratified by age into younger (5-7years) and older (8-9years) groups. In younger children, parents' reports of child impulsivity were significantly and positively associated with BMI; cortisol AUCi was not associated with BMI or eating in the absence of hunger. In older children, however, greater stress-related cortisol AUCi was related to higher BMI scores and greater energy intake in the absence of hunger. The results suggest that cortisol AUCi in response to psychosocial stress may be linked to problems with energy balance in children, with some variation by age. Published by Elsevier Ltd.

  6. The Development of Associations Among BMI, Body Dissatisfaction, and Weight and Shape Concern in Adolescent Boys and Girls

    Science.gov (United States)

    Calzo, Jerel P.; Sonneville, Kendrin R.; Haines, Jess; Blood, Emily A.; Field, Alison E.; Austin, S. Bryn

    2012-01-01

    Purpose To examine how the associations among BMI and body dissatisfaction and weight and shape concern evolve from late childhood through late adolescence in boys and girls. Methods We analyze data from 9–18-year-olds from the Growing Up Today Study, a national prospective cohort of U.S. Youth (n= 16,882, yielding 59,750 repeated measures observations during five waves of data collection). Generalized additive models produced curves of association for body dissatisfaction and weight concern across BMI percentiles. Generalized estimating equations (adjusting for correlated within-subject repeated measures, sibling clusters, pubertal maturation, and region of residence) tested main and interactive effects of BMI, age, and gender. Results Girls above the 50th BMI percentile reported greater body dissatisfaction than girls below the 50th percentile. By contrast, boys who reported the most body dissatisfaction were either above the 75th BMI percentile (approaching overweight) or below the 10th percentile (approaching underweight). Body dissatisfaction increased with age for both girls and boys, but the gender-specific patterns of BMI effects remained constant. Male and female participants in the overweight/obese BMI range reported the greatest weight concern, but among older adolescents (particularly girls), healthy weight became increasingly associated with greater weight and shape concern. Conclusions Body dissatisfaction and weight and shape concern intensify across adolescence, but associations between the constructs and BMI remain gender-specific. Findings have important implications for eating disorder risk assessment and prevention. PMID:23084175

  7. Trends in BMI of urban Australian adults, 1980-2000

    DEFF Research Database (Denmark)

    Walls, Helen L; Wolfe, Rory; Haby, Michelle M

    2010-01-01

    of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...

  8. Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

    Science.gov (United States)

    Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

    2017-05-01

    Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

  9. Does high optimism protect against the inter-generational transmission of high BMI? The Cardiovascular Risk in Young Finns Study.

    Science.gov (United States)

    Serlachius, Anna; Pulkki-Råback, Laura; Juonala, Markus; Sabin, Matthew; Lehtimäki, Terho; Raitakari, Olli; Elovainio, Marko

    2017-09-01

    The transmission of overweight from one generation to the next is well established, however little is known about what psychosocial factors may protect against this familial risk. The aim of this study was to examine whether optimism plays a role in the intergenerational transmission of obesity. Our sample included 1043 participants from the prospective Cardiovascular Risk in Young FINNS Study. Optimism was measured in early adulthood (2001) when the cohort was aged 24-39years. BMI was measured in 2001 (baseline) and 2012 when they were aged 35-50years. Parental BMI was measured in 1980. Hierarchical linear regression and logistic regression were used to examine the association between optimism and future BMI/obesity, and whether an interaction existed between optimism and parental BMI when predicting BMI/obesity 11years later. High optimism in young adulthood demonstrated a negative relationship with high BMI in mid-adulthood, but only in women (β=-0.127, p=0.001). The optimism×maternal BMI interaction term was a significant predictor of future BMI in women (β=-0.588, p=0.036). The logistic regression results confirmed that high optimism predicted reduced obesity in women (OR=0.68, 95% CI, 0.55-0.86), however the optimism × maternal obesity interaction term was not a significant predictor (OR=0.50, 95% CI, 0.10-2.48). Our findings supported our hypothesis that high optimism mitigated the intergenerational transmission of high BMI, but only in women. These findings also provided evidence that positive psychosocial factors such as optimism are associated with long-term protective effects on BMI in women. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. BMI modulates calorie-dependent dopamine changes in accumbens from glucose intake.

    Directory of Open Access Journals (Sweden)

    Gene-Jack Wang

    Full Text Available Dopamine mediates the rewarding effects of food that can lead to overeating and obesity, which then trigger metabolic neuroadaptations that further perpetuate excessive food consumption. We tested the hypothesis that the dopamine response to calorie intake (independent of palatability in striatal brain regions is attenuated with increases in weight.We used positron emission tomography with [11C]raclopride to measure dopamine changes triggered by calorie intake by contrasting the effects of an artificial sweetener (sucralose devoid of calories to that of glucose to assess their association with body mass index (BMI in nineteen healthy participants (BMI range 21-35.Neither the measured blood glucose concentrations prior to the sucralose and the glucose challenge days, nor the glucose concentrations following the glucose challenge vary as a function of BMI. In contrast the dopamine changes in ventral striatum (assessed as changes in non-displaceable binding potential of [11C]raclopride triggered by calorie intake (contrast glucose - sucralose were significantly correlated with BMI (r = 0.68 indicating opposite responses in lean than in obese individuals. Specifically whereas in normal weight individuals (BMI <25 consumption of calories was associated with increases in dopamine in the ventral striatum in obese individuals it was associated with decreases in dopamine.These findings show reduced dopamine release in ventral striatum with calorie consumption in obese subjects, which might contribute to their excessive food intake to compensate for the deficit between the expected and the actual response to food consumption.

  11. Effects of injected dose, BMI and scanner type on NECR and image noise in PET imaging

    International Nuclear Information System (INIS)

    Chang Tingting; Chang Guoping; Clark, John W Jr; Kohlmyer, Steve; Rohren, Eric; Mawlawi, Osama R

    2011-01-01

    Noise equivalent count rate (NECR) and image noise are two different but related metrics that have been used to predict and assess image quality, respectively. The aim of this study is to investigate, using patient studies, the relationships between injected dose (ID), body mass index (BMI) and scanner type on NECR and image noise measurements in PET imaging. Two groups of 90 patients each were imaged on a GE DSTE and a DRX PET/CT scanner, respectively. The patients in each group were divided into nine subgroups according to three BMI (20-24.9, 25-29.9, 30-45 kg m -2 ) and three ID (296-444, 444-555, 555-740 MBq) ranges, resulting in ten patients/subgroup. All PET data were acquired in 3D mode and reconstructed using the VuePoint HD (registered) fully 3D OSEM algorithm (2 iterations, 21(DRX) or 20 (DSTE) subsets). NECR and image noise measurements for bed positions covering the liver were calculated for each patient. NECR was calculated from the trues, randoms and scatter events recorded in the DICOM header of each patient study, while image noise was determined as the standard deviation of 50 non-neighboring voxels in the liver of each patient. A t-test compared the NECR and image noise for different scanners but with the same BMI and ID. An ANOVA test on the other hand was used to compare the results of patients with different BMI but the same ID and scanner type as well as different ID but the same BMI and scanner type. As expected the t-test showed a significant difference in NECR between the two scanners for all BMI and ID subgroups. However, contrary to what is expected no such findings were observed for image noise measurement. The ANOVA results showed a statistically significant difference in both NECR and image noise among the different BMI for each ID and scanner subgroup. However, there was no statistically significant difference in NECR and image noise across different ID for each BMI and scanner subgroup. Although the GE DRX PET/CT scanner has better

  12. Low fundamental movement skill proficiency is associated with high BMI and body fatness in girls but not boys aged 6-11 years old.

    Science.gov (United States)

    Duncan, Michael J; Bryant, Elizabeth; Stodden, David

    2017-11-01

    This study examined differences in children's body mass index (BMI) and body fatness (BF%) as a function of gender and fundamental movement skill (FMS) proficiency. Following ethics approval and parental consent, 248, 6-11 year-old children (112 boys, 136 girls) underwent assessment of 7 FMS: sprint run, side gallop, hop, kick, catch, throw and vertical jump. FMS tertiles ("high", "medium" or "low" FMS) were created based on the summed components of the FMS. Skinfold measures were used to calculate BF%. Physical activity (PA) was assessed using pedometry and maturation predicted using anthropometry. Data were analysed using a 2 (Gender) × 3 (FMS tertile) ways analysis of covariance (ANCOVA), controlling for age, maturation and PA. Age (P = .001) and maturation (P = .006) were associated with BMI. Girls classified as high FMS proficiency had significantly lower BMI compared to girls with low and medium FMS proficiency. Age (P = .0001) and maturation (P = .007) were associated with BF%. BF% was also higher for girls with low FMS compared to those with medium and high FMS. BF% and BMI were not different across FMS tertile in boys. Such findings suggest focusing on FMS may be especially important for healthy weight, particularly in girls.

  13. Observing Maternal Restriction of Food with 3–5-Year-Old Children: Relationships with Temperament and Later Body Mass Index (BMI

    Directory of Open Access Journals (Sweden)

    Claire V. Farrow

    2018-06-01

    Full Text Available Overt parental restriction of food has previously been associated with child weight; however, most research has relied on self-reported feeding behaviour, or observations which give little opportunity to observe restriction of food. Using a novel lab-based observational technique to increase the opportunity to observe maternal feeding restriction, we explored the relationships between maternal restriction, child responses to restriction and child temperament with child body mass index (BMI Z-scores over time. Sixty-two mother child dyads were recruited to the study when their children were aged 3–5 years and were followed up 2 years later (N = 39 dyads. Families were observed during a feeding interaction in the laboratory where cookies were offered with the main meal to increase the opportunity for maternal restriction of food. Feeding observations were coded and child temperament and BMI were measured. Controlling for current child BMI Z-scores, greater maternal verbal and physical restriction of food at 3–5 years was related to higher child BMI Z-scores at 5–7 years. More emotional children were less likely to experience restriction and less likely to accept attempts to restrict their food intake. Further research should consider children’s reactions to parental feeding behaviours in greater depth and explore how feeding practices interact with child temperament in the prediction of changes in child weight.

  14. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

    Science.gov (United States)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-22

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

    International Nuclear Information System (INIS)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-01

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

  16. Inter-individual inequality in BMI: An analysis of Indonesian Family Life Surveys (1993–2007

    Directory of Open Access Journals (Sweden)

    Masoud Vaezghasemi

    2016-12-01

    Full Text Available Widening inequalities in mean Body Mass Index (BMI between social and economic groups are well documented. However, whether changes in mean BMI are followed by changes in dispersion (or variance and whether these inequalities are also occurring within social groups or across individuals remain understudied. In addition, a substantial body of literature exists on the global increase in mean BMI and prevalence of overweight and obesity. However, whether this weight gain is shared proportionately across the whole spectrum of BMI distribution, also remains understudied. We examined changes in the distribution of BMI at the population level over time to understand how changes in the dispersion reflect between-group compared to within-group inequalities in weight gain. Moreover, we investigated the entire distribution of BMI to determine in which percentiles the most weight gain is occurring over time. Utilizing four waves (from 1993 to 2007 of Indonesian Family Life Surveys (IFLS, we estimated changes in the mean and the variance of BMI over time and across various socioeconomic groups based on education and households’ expenditure per capita in 53,648 men and women aged 20–50 years. An increase in mean and standard deviation was observed among men (by 4.3% and 25%, respectively and women (by 7.3% and 20%, respectively over time. Quantile-Quantile plots showed that higher percentiles had greater increases in BMI compared to the segment of the population at lower percentiles. While between socioeconomic group differences decreased over time, within-group differences increased and were more prominent among individuals with poor education and lower per capita expenditures. Population changes in BMI cannot be fully described by average trends or single parameters such as the mean BMI. Moreover, greater increases in within-group dispersion compared with between-group differences imply that growing inequalities are not merely driven by these

  17. Eating frequency in relation to BMI in very young children: a longitudinal analysis.

    Science.gov (United States)

    Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara

    2017-06-01

    Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.

  18. Physical activity, BMI and metabolic risk in Portuguese adolescents

    Directory of Open Access Journals (Sweden)

    Fernanda Karina dos Santos

    2016-03-01

    Full Text Available DOI: http://dx.doi.org/10.5007/1980-0037.2016v18n1p103   It has been reported, in the last decades, a significant decrease in physical activity (PA levels, with a consequent increase in obesity and metabolic risk factors among youth. The aims of this study were to describe PA levels, the prevalence of overweight/obesity and metabolic risk factors, and to examine the association between PA and body mass index (BMI with metabolic risk among Portuguese youth. The sample comprises 212 Portuguese adolescents (12-16 years old. Height and weight were measured. PA was estimated with the Bouchard questionnaire (3 days recall, as well as with the use of a pedometer (used for 5 consecutive days. Metabolic risk factors comprised fasting glucose, triglycerides, HDL-cholesterol, systolic blood pressure and waist circumference. Subjects were classified as normal weight, overweight or obese according to BMI; the maturational status was indirectly estimated with the maturity offset procedure. A continuous metabolic risk score was computed (zMR and PA values were divided into tertiles. Qui-square test, t-test and ANOVA were used in statistical analyses. SPSS 18.0 and WinPepi softwares were used and p<0.05. A moderate to high prevalence of overweight/obesity and HDL-cholesterol was found, as well as a high prevalence of high blood pressure and low to moderate PA levels among Portuguese youth. The relationship between BMI and zMR showed that obese adolescents have higher zMR when compared to normal weight or overweight adolescents. This finding suggests that increased levels of PA and reduction in the prevalence of overweight/obesity may have a positive role against the development of metabolic risk factors.

  19. Orthogonality Measurement for Homogenous Projects-Bases

    Science.gov (United States)

    Ivan, Ion; Sandu, Andrei; Popa, Marius

    2009-01-01

    The homogenous projects-base concept is defined. Next, the necessary steps to create a homogenous projects-base are presented. A metric system is built, which then will be used for analyzing projects. The indicators which are meaningful for analyzing a homogenous projects-base are selected. The given hypothesis is experimentally verified. The…

  20. BMI may underestimate the socioeconomic gradient in true obesity

    NARCIS (Netherlands)

    van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.

    2013-01-01

    Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity

  1. Positive parenting mitigates the effects of poor self-regulation on BMI trajectories from age 4 to 15 years

    Science.gov (United States)

    Connell, Lauren E.; Francis, Lori A.

    2014-01-01

    Objective This study sought to determine whether parenting style moderated the effects of delay of gratification on BMI trajectories from age 4 to 15 years. Methods Longitudinal data were analyzed on 778 children drawn from the Study of Early Child Care and Youth Development. Parenting style (authoritative, authoritarian, permissive, neglectful) was created from measures of mothers’ sensitivity and expectations for self-control when children were age 4 years. Self-regulation was also measured at 4 years using a well-known delay of gratification protocol. BMI was calculated from measured height and weight at each time point. Mixed modeling was used to test the interaction of parenting styles and ability to delay gratification on BMI trajectories from 4 to 15 years. Results There was a significant interaction effect of parenting and ability to delay on BMI growth from 4 to 15 years for boys. Boys who had authoritarian mothers and failed to delay gratification had a significantly steeper rate of growth in BMI from childhood through adolescence than children in any other parenting x delay group. Conclusions Authoritative and permissive parenting styles were protective against more rapid BMI gains for boys who could not delay gratification. Ability to delay gratification was protective against BMI gains for boys who had parents with authoritarian or neglectful parenting styles. PMID:23977874

  2. Postnatal BMI changes in children with different birthweights: A trial study for detecting early predictive factors for pediatric obesity

    Science.gov (United States)

    Nakagawa, Yuichi; Nakanishi, Toshiki; Satake, Eiichiro; Matsushita, Rie; Saegusa, Hirokazu; Kubota, Akira; Natsume, Hiromune; Shibata, Yukinobu; Fujisawa, Yasuko

    2018-01-01

    Abstract. The purpose of this study was to clarify the degree of early postnatal growth by birthweight and detect early predictive factors for pediatric obesity. Body mass index (BMI) and degree of obesity were examined in children in the fourth year of elementary school and second year of junior high school. Their BMI at birth and three years of age were also examined. Based on birthweight, participants were divided into three groups: low ( 3500 g). Furthermore, according to the degree of obesity, they were divided into two groups: obese (20% ≤) and non-obese (20% >). The change of BMI from birth to three years of age (ΔBMI) showed a strong inverse relationship with birthweight and was significantly different among the three birthweight groups (low > middle > high). The ΔBMI and BMI at three years of age were higher in obese than in non-obese children and showed significant positive correlations with the degree of obesity. Early postnatal growth might be determined by birthweight and was higher in obese than in non-obese children. The ΔBMI from birth to three years of age and BMI at age of three years could be predictive factors for pediatric obesity. PMID:29403153

  3. Are BMI and Sedentariness Correlated? A Multilevel Study in Children

    Directory of Open Access Journals (Sweden)

    Thayse Natacha Gomes

    2015-07-01

    Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

  4. Quantitative Analysis and Comparison of BMI among Han, Tibetan, and Uygur University Students in Northwest China

    Directory of Open Access Journals (Sweden)

    Bai Jingya

    2013-01-01

    Full Text Available Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students’ physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China.

  5. Quantitative Analysis and Comparison of BMI among Han, Tibetan, and Uygur University Students in Northwest China

    Science.gov (United States)

    Jingya, Bai; Ye, He; Jing, Wang; Xi, Huanjiu; Tao, Hai

    2013-01-01

    Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students' physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC) were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China. PMID:24453807

  6. Quality of life and BMI changes in youth participating in an integrated pediatric obesity treatment program.

    Science.gov (United States)

    Pratt, Keeley J; Lazorick, Suzanne; Lamson, Angela L; Ivanescu, Andrada; Collier, David N

    2013-07-10

    Changes in Quality of Life (QOL) measures over time with treatment of obesity have not previously been described for youth. We describe the changes from baseline through two follow up visits in youth QOL (assessed by the Pediatric Quality Life Inventory, PedsQL4.0), teen depression (assessed by the Patient Health Questionnaire, PHQ9A), Body Mass Index (BMI) and BMI z-score. We also report caregiver proxy ratings of youth QOL. A sample of 267 pairs of youth and caregiver participants were recruited at their first visit to an outpatient weight-treatment clinic that provides care integrated between a physician, dietician, and mental health provider; of the 267, 113 attended a visit two (V2) follow-up appointment, and 48 attended visit three (V3). We investigated multiple factors longitudinally experienced by youth who are overweight and their caregivers across up to three different integrated care visits. We determined relationships at baseline in QOL, PHQ9A, and BMI z-score, as well as changes in variables over time using linear mixed models with time as a covariate. Overall across three visits the results indicate that youth had slight declines in relative BMI, significant increases in their QOL and improvements in depression. We encourage clinicians and researchers to track youth longitudinally throughout treatment to investigate not only youth's BMI changes, but also psychosocial changes including QOL.

  7. Laser-based measuring equipment controlled by microcomputer

    International Nuclear Information System (INIS)

    Miron, N.; Sporea, D.; Velculescu, V.G.; Petre, M.

    1988-03-01

    Some laser-based measuring equipment controlled by microcomputer developed for industrial and scientific purposes are described. These equipments are intended for dial indicators verification, graduated rules measurement, and for very accurate measurement of the gravitational constant. (authors)

  8. Adrenocortical Regulation, Eating in the Absence of Hunger and BMI in Young Children

    OpenAIRE

    Francis, L. A.; Granger, D. A.; Susman, E. J.

    2012-01-01

    The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5 to 9 years (N = 43). Saliva was collected before and after the Trier Social Stress Test for children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60 minutes post-TSST-C. Age- and sex-specific BMI scores were cal...

  9. Relationship between 8/9-yr-old school children BMI, parents' BMI and educational level: a cross sectional survey.

    Science.gov (United States)

    Lazzeri, Giacomo; Pammolli, Andrea; Pilato, Valentina; Giacchi, Mariano V

    2011-07-19

    Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES) of families in Tuscany. The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health) and consisted of 1,751 (922 males and 855 females) 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI) categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p parents' educational level and child obesity, the lowest educational level corresponding to the highest prevalence of obese children: 9.3% for mothers with a low educational level compared to 5.8% for mothers with a high educational level (p = 0.15); similarly, the corresponding prevalence for fathers was 9.5% compared to 4.5% (p = 0.03). Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.

  10. BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

    2018-02-01

    B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

  11. ENERGY CONSUMPTION, THE DISTRIBUTION OF MACRONUTRIENTS AND BMI IN MOTHERS AND THEIR MEXICAN SCHOOLCHILDREN.

    Science.gov (United States)

    Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R

    2015-12-01

    to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  12. BMI and Body Fat Mass Is Inversely Associated with Vitamin D Levels in Older Individuals

    NARCIS (Netherlands)

    Oliai Araghi, S.; van Dijk, S. C.; Ham, A. C.; Brouwer-Brolsma, E. M.; Enneman, A. W.; Sohl, E.; Swart, K. M. A.; van der Zwaluw, N. L.; van Wijngaarden, J. P.; Dhonukshe-Rutten, R. A. M.; van Schoor, N. M.; Zillikens, M. C.; Lips, P.; de Groot, L.; Uitterlinden, A. G.; van der Velde, N.

    2015-01-01

    To assess the association between obesity (measured by Body Mass Index (BMI) and fat percentage) and serum 25(OH)D levels in older persons. Cross-sectional analysis of data from 'the B-PROOF study' (B-vitamins for the Prevention Of Osteoporotic Fractures). 2842 participants aged 65 years and older.

  13. BMI and body fat mass is inversely associated with vitamin D levels in older individuals

    NARCIS (Netherlands)

    Araghi, S.O.; Dijk, van S.C.; Ham, A.C.; Brouwer, E.M.; Enneman, A.W.; Sohl, E.; Swart, K.M.A.; Zwaluw, van der N.L.; Wijngaarden, van J.P.; Dhonukshe-Rutten, R.A.M.; Groot, de C.P.G.M.

    2015-01-01

    Objectives: To assess the association between obesity (measured by Body Mass Index (BMI) and fat percentage) and serum 25(OH)D levels in older persons. Design: Cross-sectional analysis of data from ‘the B-PROOF study’ (B-vitamins for the Prevention Of Osteoporotic Fractures). Participants: 2842

  14. Does the sex of one's co-twin affect height and BMI in adulthood?

    DEFF Research Database (Denmark)

    Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero

    2017-01-01

    BACKGROUND: The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and th...

  15. Parkinson's disease detection based on dysphonia measurements

    Science.gov (United States)

    Lahmiri, Salim

    2017-04-01

    Assessing dysphonic symptoms is a noninvasive and effective approach to detect Parkinson's disease (PD) in patients. The main purpose of this study is to investigate the effect of different dysphonia measurements on PD detection by support vector machine (SVM). Seven categories of dysphonia measurements are considered. Experimental results from ten-fold cross-validation technique demonstrate that vocal fundamental frequency statistics yield the highest accuracy of 88 % ± 0.04. When all dysphonia measurements are employed, the SVM classifier achieves 94 % ± 0.03 accuracy. A refinement of the original patterns space by removing dysphonia measurements with similar variation across healthy and PD subjects allows achieving 97.03 % ± 0.03 accuracy. The latter performance is larger than what is reported in the literature on the same dataset with ten-fold cross-validation technique. Finally, it was found that measures of ratio of noise to tonal components in the voice are the most suitable dysphonic symptoms to detect PD subjects as they achieve 99.64 % ± 0.01 specificity. This finding is highly promising for understanding PD symptoms.

  16. The mediating role of dichotomous thinking and emotional eating in the relationship between depression and BMI.

    Science.gov (United States)

    Antoniou, Evangelia E; Bongers, Peggy; Jansen, Anita

    2017-08-01

    Obesity and depression have important health implications. Although there is knowledge about the moderators of the depression-obesity association, our understanding of the potential behavioral and cognitive mediators that may explain the relationship between depression and obesity, is scarcely researched. The aim of this study is to investigate the mediating role of emotional eating and dichotomous thinking in the depression-obesity relationship. Data on 205 individuals from a community-based study conducted at Maastricht University, Netherlands were used. Self-reported data on depression, emotional eating and dichotomous thinking were collected and BMI scores were calculated in a cross-sectional research design. Correlations between variables were calculated. The primary analysis tested the hypothesis that depression has an effect on BMI through dichotomous thinking and emotional eating. A two-mediator model was used to predict the direct and indirect effects of emotional eating and dichotomous thinking on the depression-BMI relationship. Depression was positively correlated with BMI (r=0.21, p=0.005), emotional eating (r=0.38, pemotional eating were positively correlated with BMI (r=0.35, pemotional eating (Z=3.92 pemotional eating and dichotomous thinking might be useful in guiding assessment and treatment protocols for weight management. The present study adds to the existing literature on the role of dysfunctional cognitions and emotions on eating behavior, and particularly to the factors that may impede people's ability to control their eating. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Impact of non-physician health professionals' BMI on obesity care and beliefs.

    Science.gov (United States)

    Bleich, Sara N; Bandara, Sachini; Bennett, Wendy L; Cooper, Lisa A; Gudzune, Kimberly A

    2014-12-01

    Examine the impact of non-physician health professional body mass index (BMI) on obesity care, self-efficacy, and perceptions of patient trust in weight loss advice. A national cross-sectional Internet-based survey of 500 US non-physician health professionals specializing in nutrition, nursing, behavioral/mental health, exercise, and pharmacy collected between January 20 and February 5, 2014 was analyzed. Normal-BMI professionals were more likely than overweight/obese professionals to report success in helping patients achieve clinically significant weight loss (52% vs. 29%, P = 0.01). No differences by health professional BMI about the appropriate patient body weight for weight-related care (initiate weight loss discussions and success in helping patients lose weight), confidence in ability to help patients lose weight, or in perceived patient trust in their advice were observed. Most health professionals (71%) do not feel successful in helping patients lose weight until they are morbidly obese, regardless of BMI. Normal-BMI non-physician health professionals report being more successful than overweight and obese health professionals at helping obese patients lose weight. More research is needed to understand how to improve self-efficacy for delivering obesity care, particularly among overweight and class I obese patients. © 2014 The Obesity Society.

  18. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

    Directory of Open Access Journals (Sweden)

    Tenna Ruest Haarmark Nielsen

    Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

  19. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  20. Prediction of BMI by impulsivity, eating behavior and activity level

    Directory of Open Access Journals (Sweden)

    Jiang Xiaxia

    2016-01-01

    Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

  1. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  2. Prospective associations between sedentary lifestyle and BMI in midlife.

    Science.gov (United States)

    Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

    2006-08-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

  3. Parental nonstandard work schedules during infancy and children's BMI trajectories

    Directory of Open Access Journals (Sweden)

    Afshin Zilanawala

    2017-09-01

    Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.

  4. Ground-based measurements of ionospheric dynamics

    Science.gov (United States)

    Kouba, Daniel; Chum, Jaroslav

    2018-05-01

    Different methods are used to research and monitor the ionospheric dynamics using ground measurements: Digisonde Drift Measurements (DDM) and Continuous Doppler Sounding (CDS). For the first time, we present comparison between both methods on specific examples. Both methods provide information about the vertical drift velocity component. The DDM provides more information about the drift velocity vector and detected reflection points. However, the method is limited by the relatively low time resolution. In contrast, the strength of CDS is its high time resolution. The discussed methods can be used for real-time monitoring of medium scale travelling ionospheric disturbances. We conclude that it is advantageous to use both methods simultaneously if possible. The CDS is then applied for the disturbance detection and analysis, and the DDM is applied for the reflection height control.

  5. Pilates versus resistance exercise on the serum levels of hs-CRP, in the abdominal circumference and body mass index (BMI in elderly individuals

    Directory of Open Access Journals (Sweden)

    Maria Adesilda Silva Pestana

    2016-06-01

    Full Text Available Recent studies have shown that the elderly exhibit a subclinical state of inflammation associated with increased adipose tissue and several comorbidities. To compare the effects of mat Pilates based exercises and resistance exercise on the serum levels of reactive C protein of high sensitivity (hs-CRP, in the abdominal circumference (AC and the body mass index (BMI in the elderly. It is a randomised clinical trial with a sample of 78 elderly individuals (median age 69 years. The active independent variable investigated was nature of treatment intervention (Pilates mat based exercises vs resistance exercise, and the dependent variables were hs-CRP level, AC and BMI. The statistical analysis used Wilcoxon signed rank and Mann-Whitney tests. The correlation between the continuous variables was assessed using Spearman’s coefficient of correlation. The data were analysed using SPSS software version 17.0, and probability values lower than 5% (p< 0.05 were considered statistically significant. Mat Pilates based exercises exhibited reductions in serum hs-CPR level (Wilcoxon signed rank test; z = -2.466, p = 0.01, BMI (Wilcoxon signed rank test; z = -3.295, p = 0.001 and AC (Wilcoxon signed rank test; z = -3.398, p = 0.01. Mat Pilates based exercises promoted a significant reduction of the serum hs-CRP levels and anthropometric measurements in elderly individuals.

  6. Obesity-risk behaviours and their associations with body mass index (BMI) in Korean American children.

    Science.gov (United States)

    Jang, Myoungock; Grey, Margaret; Sadler, Lois; Jeon, Sangchoon; Nam, Soohyun; Song, Hee-Jung; Whittemore, Robin

    2017-08-03

    To describe obesity-risk behaviours (diet, physical activity and sedentary behaviour) and examine the relationships of the obesity-risk behaviours with body mass index (BMI) in school-aged Korean American children. Korean American children have a risk of becoming overweight or obese and developing obesity-related complications; however, there is limited research about obesity-risk behaviours in Korean American children. A cross-sectional study. Obesity-risk behaviours of children were assessed with well-validated self-report questionnaires (i.e., Elementary-level School-based Nutrition Monitoring Questionnaire) from children and their mothers. Height and weight of children were measured. Data were analysed with bivariate and multivariate analyses using mixed effects models to incorporate the correlation within siblings. A total of 170 Korean American children (mean age 10.9 [2.0] years; 52.4% girls; mean BMI 19.3 [3.2]; 28.7% ≥85 percentiles) participated in the study. Only 38.3% of Korean American children met established recommendations of five fruits/vegetables per day; 56.5% met recommendations for more than 3 days per week of vigorous physical activity; and 40.8% met recommendations for obesity in Korean American children and initiate clinical interventions to improve obesity-risk behaviours, especially sedentary behaviour, in Korean American children. Clinical assessment and management of the risk of developing overweight and obesity as well as obesity-related behaviours are important to improve obesity-related complications in overall Korean Americans. © 2017 John Wiley & Sons Ltd.

  7. Parental Activity as Influence on Childrenˋs BMI Percentiles and Physical Activity

    Directory of Open Access Journals (Sweden)

    Nanette Erkelenz, Susanne Kobel, Sarah Kettner, Clemens Drenowatz, Jürgen M. Steinacker and the Research Group "Join the Healthy Boat - Primary School"

    2014-09-01

    Full Text Available Parents play a crucial role in the development of their children’s lifestyle and health behaviour. This study aims to examine associations between parental physical activity (PA and children’s BMI percentiles (BMIPCT, moderate to vigorous PA (MVPA as well as participation in organised sports. Height and body weight was measured in 1615 in German children (7.1 ± 0.6 years, 50.3% male and converted to BMIPCT. Parental BMI was calculated based on self-reported height and body weight. Children’s MVPA and sports participation as well as parental PA were assessed via parental questionnaire. Analysis of covariance (ANCOVA, controlling for age and family income was used to examine the association between parental and children’s PA levels as well as BMIPCT. 39.7% of the parents classified themselves as physically active and 8.3% of children were classified as overweight or obese. Lower BMIPCT were observed with both parents being physically active (44.5 ± 26.3 vs. 50.2 ± 26.9 and 52.0 ± 28.4, respectively. There was no association between parental and children’s PA levels but children with at least one active parent displayed a higher participation in organised sports (102.0 ± 96.6 and 117.7 ± 123.6 vs. 73.7 ± 100.0, respectively. Children of active parents were less likely to be overweight and obese. The lack of association between subjectively assessed parental PA and child MVPA suggests that parental support for PA in children is more important than parents being a role model. More active parents, however, may be more likely to facilitate participation in organised sports. These results underline the importance of the inclusion of parents in health promotion and obesity prevention programmes in children.

  8. Statistical Measures for Usage-Based Linguistics

    Science.gov (United States)

    Gries, Stefan Th.; Ellis, Nick C.

    2015-01-01

    The advent of usage-/exemplar-based approaches has resulted in a major change in the theoretical landscape of linguistics, but also in the range of methodologies that are brought to bear on the study of language acquisition/learning, structure, and use. In particular, methods from corpus linguistics are now frequently used to study distributional…

  9. The validity of self-reported vs. measured body weight and height and the effect of self-perception.

    Science.gov (United States)

    Gokler, Mehmet Enes; Bugrul, Necati; Sarı, Ahu Ozturk; Metintas, Selma

    2018-01-01

    The objective was to assess the validity of self-reported body weight and height and the possible influence of self-perception of body mass index (BMI) status on the actual BMI during the adolescent period. This cross sectional study was conducted on 3918 high school students. Accurate BMI perception occurred when the student's self-perception of their BMI status did not differ from their actual BMI based on measured height and weight. Agreement between the measured and self-reported body height and weight and BMI values was determined using the Bland-Altman metod. To determine the effects of "a good level of agreement", hierarchical logistic regression models were used. Among male students who reported their BMI in the normal region, 2.8% were measured as overweight while 0.6% of them were measured as obese. For females in the same group, these percentages were 1.3% and 0.4% respectively. Among male students who perceived their BMI in the normal region, 8.5% were measured as overweight while 0.4% of them were measured as obese. For females these percentages were 25.6% and 1.8% respectively. According to logistic regression analysis, residence and accurate BMI perception were significantly associated with "good agreement" ( p ≤ 0.001). The results of this study demonstrated that in determining obesity and overweight statuses, non-accurate weight perception is a potential risk for students.

  10. Novel measurement-based indoor cellular radio system design

    OpenAIRE

    Aragón-Zavala, A

    2008-01-01

    A scaleable, measurement-based radio methodology has been created to use for the design, planing and optimisation of in door cellular radio systems. The development of this measurement-based methodology was performed having in mind that measurements are of ten required to valiate radio coverage in a building. Therefore, the concept of using care fully calibrated measurements to design and optimise a system is feasible since these measurements can easily be obtained prior to system deployment ...

  11. Miniaturized diffraction based interferometric distance measurement sensor

    Science.gov (United States)

    Kim, Byungki

    In this thesis, new metrology hardware is designed, fabricated, and tested to provide improvements over current MEMS metrology. The metrology system is a micromachined scanning interferometer (muSI) having a sub-nm resolution in a compact design. The proposed microinterferometer forms a phase sensitive diffraction grating with interferomeric sensitivity, while adding the capability of better lateral resolution by focusing the laser to a smaller spot size. A detailed diffraction model of the microinterferometer was developed to simulate the device performance and to suggest the location of photo detectors for integrated optoelectronics. A particular device is fabricated on a fused silica substrate using aluminum to form the deformable diffraction grating fingers and AZ P4620 photo resist (PR) for the microlens. The details of the fabrication processes are presented. The structure also enables optoelectronics to be integrated so that the interferometer with photo detectors can fit in an area that is 1 mm x 1 mm. The scanning results using a fixed grating muSI demonstrated that it could measure vibration profile as well as static vertical (less than a half wave length) and lateral dimension of MEMS. The muSI, which is integrated with photo diodes, demonstrated its operation by scanning a cMUT. The PID control has been tested and resulted in improvement in scanned images. The integrated muSI demonstrated that the deformable grating could be used to tune the measurement keep the interferometer in quadrature for highest sensitivity.

  12. Development of microcontroller based water flow measurement

    Science.gov (United States)

    Munir, Muhammad Miftahul; Surachman, Arif; Fathonah, Indra Wahyudin; Billah, Muhammad Aziz; Khairurrijal, Mahfudz, Hernawan; Rimawan, Ririn; Lestari, Slamet

    2015-04-01

    A digital instrument for measuring water flow was developed using an AT89S52 microcontroller, DS1302 real time clock (RTC), and EEPROM for an external memory. The sensor used for probing the current was a propeller that will rotate if immersed in a water flow. After rotating one rotation, the sensor sends one pulse and the number of pulses are counted for a certain time of counting. The measurement data, i.e. the number of pulses per unit time, are converted into water flow velocity (m/s) through a mathematical formula. The microcontroller counts the pulse sent by the sensor and the number of counted pulses are stored into the EEPROM memory. The time interval for counting is provided by the RTC and can be set by the operator. The instrument was tested under various time intervals ranging from 10 to 40 seconds and several standard propellers owned by Experimental Station for Hydraulic Structure and Geotechnics (BHGK), Research Institute for Water Resources (Pusair). Using the same propellers and water flows, it was shown that water flow velocities obtained from the developed digital instrument and those found by the provided analog one are almost similar.

  13. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  14. Gender expression associated with BMI in a prospective cohort study of US adolescents.

    Science.gov (United States)

    Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

    2016-02-01

    To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

  15. The Impact of Sleep-Disordered Breathing on Body Mass Index (BMI): The Sleep Heart Health Study (SHHS).

    Science.gov (United States)

    Brown, Mark A; Goodwin, James L; Silva, Graciela E; Behari, Ajay; Newman, Anne B; Punjabi, Naresh M; Resnick, Helaine E; Robbins, John A; Quan, Stuart F

    2011-12-08

    INTRODUCTION: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB). However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS) were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors. METHODS: A full-montage unattended home polysomnogram (PSG) and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI) was categorized using clinical thresholds: sleep apnea), and ≥ 15 (moderate to severe sleep apnea). Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates. RESULTS: Mean (SD) age was 62.2 years (10.14), 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD) change of 0.53 (2.62) kg/m(2) (p=0.071). A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m(2) (p=0.055) and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m(2) (plosing weight.

  16. Bridge continuous deformation measurement technology based on fiber optic gyro

    Science.gov (United States)

    Gan, Weibing; Hu, Wenbin; Liu, Fang; Tang, Jianguang; Li, Sheng; Yang, Yan

    2016-03-01

    Bridge is an important part of modern transportation systems and deformation is a key index for bridge's safety evaluation. To achieve the long span bridge curve measurement rapidly and timely and accurately locate the bridge maximum deformation, the continuous deformation measurement system (CDMS) based on inertial platform is presented and validated in this paper. Firstly, based on various bridge deformation measurement methods, the method of deformation measurement based on the fiber optic gyro (FOG) is introduced. Secondly, the basic measurement principle based on FOG is presented and the continuous curve trajectory is derived by the formula. Then the measurement accuracy is analyzed in theory and the relevant factors are presented to ensure the measurement accuracy. Finally, the deformation measurement experiments are conducted on a bridge across the Yangtze River. Experimental results show that the presented deformation measurement method is feasible, practical, and reliable; the system can accurately and quickly locate the maximum deformation and has extensive and broad application prospects.

  17. Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.

    Science.gov (United States)

    Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M

    2017-01-01

    This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Education modifies genetic and environmental influences on BMI

    DEFF Research Database (Denmark)

    Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel

    2011-01-01

    environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...

  19. A Transdermal Measurement Platform Based on Microfluidics

    Directory of Open Access Journals (Sweden)

    Wen-Ying Huang

    2017-01-01

    Full Text Available The Franz diffusion cell is one of the most widely used devices to evaluate transdermal drug delivery. However, this static and nonflowing system has some limitations, such as a relatively large solution volume and skin area and the development of gas bubbles during sampling. To overcome these disadvantages, this study provides a proof of concept for miniaturizing models of transdermal delivery by using a microfluidic chip combined with a diffusion cell. The proposed diffusion microchip system requires only 80 μL of sample solution and provides flow circulation. Two model compounds, Coomassie Brilliant Blue G-250 and potassium ferricyanide, were successfully tested for transdermal delivery experiments. The diffusion rate is high for a high sample concentration or a large membrane pore size. The developed diffusion microchip system, which is feasible, can be applied for transdermal measurement in the future.

  20. The association between consumption of breakfast cereals and BMI in schoolchildren aged 12-17 years: The VYRONAS study

    OpenAIRE

    Kosti, Rena I.; Panagiotakos, Demosthenes B.; Zampelas, Antonis; Mihas, Costas; Alevizos, Alevizos; Leonard, Clare; Tountas, Yannis; Mariolis, Anargiros

    2017-01-01

    Abstract Objective To evaluate whether consumption of breakfast cereals is associated with BMI in a sample of Greek adolescents. Design A cross-sectional health and nutrition survey. Setting and subjects During 2004-5, 2008 schoolchildren aged 12-17 years were selected from twelve schools located in Vyronas region (Athens metropolitan area). Height and weight were measured and BMI was calculated. A semi-quantitative FFQ was applied and multiple logistic regression analysis was used. Results O...

  1. Joint Effects of Physical Activity and BMI on Risk of Hypertension in Women: A Longitudinal Study

    Directory of Open Access Journals (Sweden)

    Caroline Jackson

    2014-01-01

    Full Text Available Introduction. There is debate as to whether physical activity counteracts the adverse effect of weight on health outcomes. We investigated how physical activity modifies the effect of body mass index (BMI on hypertension risk. Methods. BMI, physical activity, and hypertension were measured at baseline and at three-year interval for 14 years (from 1996 to 2010, in 10,339 participants in the Australian Longitudinal Study on Women’s Health. Generalised estimating equation models for binary repeated measures were performed to determine the individual and joint effects of BMI and physical activity on incident hypertension. Results. At baseline (mean age 47.6±1.5 SD, 57% were healthy weight, 28% overweight, and 14% obese. Increasing BMI and decreasing physical activity were associated with increased risk of hypertension. Physical activity attenuated the positive association between weight and risk of hypertension, especially for obese women. Compared to healthy weight high active women, risk of hypertension in obese high active women was 3.4 times greater (OR 3.43, 95% CI 2.68, 4.39 and in obese inactive women 4.9 times greater (OR 4.91, 95% CI 3.92, 6.13. Conclusions. Both physical activity and maintenance of a healthy body weight are associated with lower risk of hypertension. Physical activity reduced but did not remove the effect of obesity on hypertension risk.

  2. BMI predicts emotion-driven impulsivity and cognitive inflexibility in adolescents with excess weight.

    Science.gov (United States)

    Delgado-Rico, Elena; Río-Valle, Jacqueline S; González-Jiménez, Emilio; Campoy, Cristina; Verdejo-García, Antonio

    2012-08-01

    Adolescent obesity is increasingly viewed as a brain-related dysfunction, whereby reward-driven urges for pleasurable foods "hijack" response selection systems, such that behavioral control progressively shifts from impulsivity to compulsivity. In this study, we aimed to examine the link between personality factors (sensitivity to reward (SR) and punishment (SP), BMI, and outcome measures of impulsivity vs. flexibility in--otherwise healthy--excessive weight adolescents. Sixty-three adolescents (aged 12-17) classified as obese (n = 26), overweight (n = 16), or normal weight (n = 21) participated in the study. We used psychometric assessments of the SR and SP motivational systems, impulsivity (using the UPPS-P scale), and neurocognitive measures with discriminant validity to dissociate inhibition vs. flexibility deficits (using the process-approach version of the Stroop test). We tested the relative contribution of age, SR/SP, and BMI on estimates of impulsivity and inhibition vs. switching performance using multistep hierarchical regression models. BMI significantly predicted elevations in emotion-driven impulsivity (positive and negative urgency) and inferior flexibility performance in adolescents with excess weight--exceeding the predictive capacity of SR and SP. SR was the main predictor of elevations in sensation seeking and lack of premeditation. These findings demonstrate that increases in BMI are specifically associated with elevations in emotion-driven impulsivity and cognitive inflexibility, supporting a dimensional path in which adolescents with excess weight increase their proneness to overindulge when under strong affective states, and their difficulties to switch or reverse habitual behavioral patterns.

  3. Competency-Based Education: A Framework for Measuring Quality Courses

    Science.gov (United States)

    Krause, Jackie; Dias, Laura Portolese; Schedler, Chris

    2015-01-01

    The growth of competency-based education in an online environment requires the development and measurement of quality competency-based courses. While quality measures for online courses have been developed and standardized, they do not directly align with emerging best practices and principles in the design of quality competency-based online…

  4. Smoking and Socio-demographic correlates of BMI

    Directory of Open Access Journals (Sweden)

    Peizhi Wang

    2016-06-01

    Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

  5. Prediction intervals for future BMI values of individual children - a non-parametric approach by quantile boosting

    Directory of Open Access Journals (Sweden)

    Mayr Andreas

    2012-01-01

    Full Text Available Abstract Background The construction of prediction intervals (PIs for future body mass index (BMI values of individual children based on a recent German birth cohort study with n = 2007 children is problematic for standard parametric approaches, as the BMI distribution in childhood is typically skewed depending on age. Methods We avoid distributional assumptions by directly modelling the borders of PIs by additive quantile regression, estimated by boosting. We point out the concept of conditional coverage to prove the accuracy of PIs. As conditional coverage can hardly be evaluated in practical applications, we conduct a simulation study before fitting child- and covariate-specific PIs for future BMI values and BMI patterns for the present data. Results The results of our simulation study suggest that PIs fitted by quantile boosting cover future observations with the predefined coverage probability and outperform the benchmark approach. For the prediction of future BMI values, quantile boosting automatically selects informative covariates and adapts to the age-specific skewness of the BMI distribution. The lengths of the estimated PIs are child-specific and increase, as expected, with the age of the child. Conclusions Quantile boosting is a promising approach to construct PIs with correct conditional coverage in a non-parametric way. It is in particular suitable for the prediction of BMI patterns depending on covariates, since it provides an interpretable predictor structure, inherent variable selection properties and can even account for longitudinal data structures.

  6. Calibration Base Lines for Electronic Distance Measuring Instruments (EDMI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A calibration base line (CBL) is a precisely measured, straight-line course of approximately 1,400 m used to calibrate Electronic Distance Measuring Instruments...

  7. Fourier transform based scalable image quality measure.

    Science.gov (United States)

    Narwaria, Manish; Lin, Weisi; McLoughlin, Ian; Emmanuel, Sabu; Chia, Liang-Tien

    2012-08-01

    We present a new image quality assessment (IQA) algorithm based on the phase and magnitude of the 2D (twodimensional) Discrete Fourier Transform (DFT). The basic idea is to compare the phase and magnitude of the reference and distorted images to compute the quality score. However, it is well known that the Human Visual Systems (HVSs) sensitivity to different frequency components is not the same. We accommodate this fact via a simple yet effective strategy of nonuniform binning of the frequency components. This process also leads to reduced space representation of the image thereby enabling the reduced-reference (RR) prospects of the proposed scheme. We employ linear regression to integrate the effects of the changes in phase and magnitude. In this way, the required weights are determined via proper training and hence more convincing and effective. Lastly, using the fact that phase usually conveys more information than magnitude, we use only the phase for RR quality assessment. This provides the crucial advantage of further reduction in the required amount of reference image information. The proposed method is therefore further scalable for RR scenarios. We report extensive experimental results using a total of 9 publicly available databases: 7 image (with a total of 3832 distorted images with diverse distortions) and 2 video databases (totally 228 distorted videos). These show that the proposed method is overall better than several of the existing fullreference (FR) algorithms and two RR algorithms. Additionally, there is a graceful degradation in prediction performance as the amount of reference image information is reduced thereby confirming its scalability prospects. To enable comparisons and future study, a Matlab implementation of the proposed algorithm is available at http://www.ntu.edu.sg/home/wslin/reduced_phase.rar.

  8. Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

    Science.gov (United States)

    Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

    Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

  9. The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT

    International Nuclear Information System (INIS)

    Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng

    2011-01-01

    Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)

  10. Triangulation-based edge measurement using polyview optics

    Science.gov (United States)

    Li, Yinan; Kästner, Markus; Reithmeier, Eduard

    2018-04-01

    Laser triangulation sensors as non-contact measurement devices are widely used in industry and research for profile measurements and quantitative inspections. Some technical applications e.g. edge measurements usually require a configuration of a single sensor and a translation stage or a configuration of multiple sensors, so that they can measure a large measurement range that is out of the scope of a single sensor. However, the cost of both configurations is high, due to the additional rotational axis or additional sensor. This paper provides a special measurement system for measurement of great curved surfaces based on a single sensor configuration. Utilizing a self-designed polyview optics and calibration process, the proposed measurement system allows an over 180° FOV (field of view) with a precise measurement accuracy as well as an advantage of low cost. The detailed capability of this measurement system based on experimental data is discussed in this paper.

  11. Cost of fertility treatment and live birth outcome in women of different ages and BMI.

    Science.gov (United States)

    Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya

    2014-10-10

    What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent

  12. Family and population-based studies of variation within the ghrelin receptor locus in relation to measures of obesity

    DEFF Research Database (Denmark)

    Gjesing, Anette P.; Larsen, Lesli Hingstrup; Torekov, Signe Sørensen

    2010-01-01

    -carriers (mean BMI: 28+/-5 kg/m(2)) (p>0.05) could be shown. CONCLUSIONS/SIGNIFICANCE: In a population-based study sample of 15,854 Danes no association between GHSR genotypes and measures of obesity and overweight was found. Also, analyses of GHSR haplotypes lack consistent associations with obesity related......BACKGROUND: The growth hormone secretagogue receptor (GHSR) is mediating hunger sensation when stimulated by its natural ligand ghrelin. In the present study, we tested the hypothesis that common and rare variation in the GHSR locus are related to increased prevalence of obesity and overweight...... among Whites. METHODOLOGY/PRINCIPAL FINDINGS: In a population-based study sample of 15,854 unrelated, middle-aged Danes, seven variants were genotyped to capture common variation in an 11 kbp region including GHSR. These were investigated for their individual and haplotypic association with obesity...

  13. History and measurement of the base and derived units

    CERN Document Server

    Treese, Steven A

    2018-01-01

    This book discusses how and why historical measurement units developed, and reviews useful methods for making conversions as well as situations in which dimensional analysis can be used. It starts from the history of length measurement, which is one of the oldest measures used by humans. It highlights the importance of area measurement, briefly discussing the methods for determining areas mathematically and by measurement. The book continues on to detail the development of measures for volume, mass, weight, time, temperature, angle, electrical units, amounts of substances, and light intensity. The seven SI/metric base units are highlighted, as well as a number of other units that have historically been used as base units. Providing a comprehensive reference for interconversion among the commonly measured quantities in the different measurement systems with engineering accuracy, it also examines the relationships among base units in fields such as mechanical/thermal, electromagnetic and physical flow rates and...

  14. Diagnostic performance of BMI percentiles to identify adolescents with metabolic syndrome.

    Science.gov (United States)

    Laurson, Kelly R; Welk, Gregory J; Eisenmann, Joey C

    2014-02-01

    To compare the diagnostic performance of the Centers for Disease Control and Prevention (CDC) and FITNESSGRAM (FGram) BMI standards for quantifying metabolic risk in youth. Adolescents in the NHANES (n = 3385) were measured for anthropometric variables and metabolic risk factors. BMI percentiles were calculated, and youth were categorized by weight status (using CDC and FGram thresholds). Participants were also categorized by presence or absence of metabolic syndrome. The CDC and FGram standards were compared by prevalence of metabolic abnormalities, various diagnostic criteria, and odds of metabolic syndrome. Receiver operating characteristic curves were also created to identify optimal BMI percentiles to detect metabolic syndrome. The prevalence of metabolic syndrome in obese youth was 19% to 35%, compared with <2% in the normal-weight groups. The odds of metabolic syndrome for obese boys and girls were 46 to 67 and 19 to 22 times greater, respectively, than for normal-weight youth. The receiver operating characteristic analyses identified optimal thresholds similar to the CDC standards for boys and the FGram standards for girls. Overall, BMI thresholds were more strongly associated with metabolic syndrome in boys than in girls. Both the CDC and FGram standards are predictive of metabolic syndrome. The diagnostic utility of the CDC thresholds outperformed the FGram values for boys, whereas FGram standards were slightly better thresholds for girls. The use of a common set of thresholds for school and clinical applications would provide advantages for public health and clinical research and practice.

  15. The relationship between the BMI and the emotional status of Alexandria University students, Egypt.

    Science.gov (United States)

    Abdel Sadek, Heba A; Abu-Nazel, Mervat W; Shata, Zeinab N; Abd El-Fatah, Nesrin K

    2016-09-01

    Although the relationship between obesity and depression has been researched extensively, the relation of the wide range of body-weight problems, as indicated by the BMI, to emotional health problems has received little attention. To assess the rate of concomitant co-occurrence of emotional health and weight problems in Alexandria University students, and to investigate the relationship between their BMI and emotional status. A cross-sectional study was carried out on 842 university students (17-27 years), enrolled in four faculties of Alexandria University, Egypt, during the academic year 2012-2013. Participants of both sexes were interviewed to collect sociodemographic data. Weight and height were measured, and then the BMI was calculated and classified into underweight, normal weight, overweight, and obese according to age-corresponding and sex-corresponding standards. The Arabic version of Depression Anxiety Stress Scales was used to assess the emotional status of students. The curve of fit was used to test the statistical quadratic trend. Co-occurrence of depression, anxiety, or stress with any weight problem was prevalent among 7.4, 6.7, and 9.6% of the students, respectively. Obese and underweight students recorded higher rates of emotional problems compared with normal and overweight students, revealing a U-shaped relationship between the BMI and emotional states (R=0.01). This relationship was significant only for anxiety and stress (Pstudents, where sex differences were evident. University preventive strategies and treatment services should address such alarming coexisting problems among youth.

  16. Smoking and BMI as a risk factor of cardiovascular disease at a doctors in Tuzla canton

    Directory of Open Access Journals (Sweden)

    Merisa Imamović Kuluglić

    2012-09-01

    Full Text Available Introduction: Cardiovascular diseases are becoming the leading social and medical problem of civilization, given the trend indicates an increase of morbidity, disability and mortality from this diseases. The aim ofour study was to determine the frequency of smoking and increased BMI, as a risk factor for cardiovascular disease in doctors in the Tuzla Canton and correlate values of BMI by the doctor smokers and nonsmokers.Methods: The study was conducted in 13 medical centers in the area of Tuzla canton in the second quarter of 2009. Two groups were formed by randomization of 150 doctors non-smokers and 150 doctors smokersfrom a total of 366 doctors of both sexes, age over 25 years. The study involved doctors who smoke tobacco 5 or more years. The methods of anthropometric measurements and questionnaires were used in study.Results: The results showed that the total number of doctors surveyed, 44.81% were smokers, with more women smokers (28.7% than men (21.3% smokers (p=0.011. We found that there is a signifi cant statistical difference between subjects with BMI higher than 25 and subjects with normal weight, in the group of smokers (p = 0.0001.Conclusion: It can be concluded that the frequency of smoking in the total number of surveyed doctors, is signifi cant. The increased value of BMI (over 25 is present in large number of subjects (with the larger percentage subjects of smokers.

  17. Longitudinal associations between BMI, waist circumference, and cardiometabolic risk in US youth: monitoring implications.

    Science.gov (United States)

    Jago, R; Mendoza, J A; Chen, T; Baranowski, T

    2013-03-01

    This study examined whether change in body mass index (BMI) or waist circumference (WC) is associated with change in cardiometabolic risk factors and differences between cardiovascular disease specific and diabetes specific risk factors among adolescents. We also sought to examine any differences by gender or baseline body mass status. The article is a longitudinal analysis of pre- and post-data collected in the HEALTHY trial. Participants were 4,603 ethnically diverse adolescents who provided complete data at 6th and 8th grade assessments. The main outcome measures were percent change in the following cardiometabolic risk factors: fasting triglycerides, systolic and diastolic blood pressure, high density lipoprotein cholesterol, and glucose as well as a clustered metabolic risk score. Main exposures were change in BMI or WC z-score. Models were run stratified by gender; secondary models were additionally stratified by baseline BMI group (normal, overweight, or obese). Analysis showed that when cardiometabolic risk factors were treated as continuous variables, there was strong evidence (P fasting glucose and the combined risk factor score for both boys and girls. There was some evidence that change in WC z-score was associated with some cardiovascular risk factors, but change in WC z-score was consistently associated with changes in fasting glucose. In conclusion, routine monitoring of BMI should be continued by health professionals, but additional information on disease risk may be provided by assessing WC. Copyright © 2013 The Obesity Society.

  18. Restaurants in the Neighborhood, Eating Away from Home and BMI in China.

    Directory of Open Access Journals (Sweden)

    Xu Tian

    Full Text Available To investigate the association between environmental risk factors, eating away from home, and increasing BMI of Chinese adults.Participants were selected from the recent four waves (2004, 2006, 2009, and 2011 of the China Health and Nutrition Survey (CHNS. 10633 participants, including 5084 men and 5549 women, were used in the analysis. 24-h dietary recall data for three consecutive days with information on the time and place of consumption were collected. Nearby restaurants were measured by the number of fast food outlets, indoor restaurants, and food stands in the neighborhood. Random effects multivariable regression was used to assess associations between these variables.People living in neighborhoods with large numbers of indoor restaurants are more likely to eat away from home (p<0.05. Higher frequency of eating away from home is positively associated with BMI, but this effect is only significant for men (p<0.05. Moreover, while eating dinner or breakfast away from home contributes to BMI increase for men (p<0.05, no such association is found for lunch.Eating dinner and breakfast away from home is positively associated with BMI for Chinese men. Labeling energy and portion size for the dishes served in indoor restaurants is recommended in China.

  19. Restaurants in the Neighborhood, Eating Away from Home and BMI in China.

    Science.gov (United States)

    Tian, Xu; Zhong, Li; von Cramon-Taubadel, Stephan; Tu, Huakang; Wang, Hui

    2016-01-01

    To investigate the association between environmental risk factors, eating away from home, and increasing BMI of Chinese adults. Participants were selected from the recent four waves (2004, 2006, 2009, and 2011) of the China Health and Nutrition Survey (CHNS). 10633 participants, including 5084 men and 5549 women, were used in the analysis. 24-h dietary recall data for three consecutive days with information on the time and place of consumption were collected. Nearby restaurants were measured by the number of fast food outlets, indoor restaurants, and food stands in the neighborhood. Random effects multivariable regression was used to assess associations between these variables. People living in neighborhoods with large numbers of indoor restaurants are more likely to eat away from home (paway from home is positively associated with BMI, but this effect is only significant for men (paway from home contributes to BMI increase for men (paway from home is positively associated with BMI for Chinese men. Labeling energy and portion size for the dishes served in indoor restaurants is recommended in China.

  20. Mechanism by which BMI influences leisure-time physical activity behavior.

    Science.gov (United States)

    Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand

    2008-06-01

    The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.

  1. Dinner rituals that correlate with child and adult BMI.

    Science.gov (United States)

    Wansink, Brian; van Kleef, Ellen

    2014-05-01

    What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

  2. Relationship between BMI and blood pressure in girls and boys.

    Science.gov (United States)

    Gundogdu, Zuhal

    2008-10-01

    To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.

  3. The Reliability of Randomly Generated Math Curriculum-Based Measurements

    Science.gov (United States)

    Strait, Gerald G.; Smith, Bradley H.; Pender, Carolyn; Malone, Patrick S.; Roberts, Jarod; Hall, John D.

    2015-01-01

    "Curriculum-Based Measurement" (CBM) is a direct method of academic assessment used to screen and evaluate students' skills and monitor their responses to academic instruction and intervention. Interventioncentral.org offers a math worksheet generator at no cost that creates randomly generated "math curriculum-based measures"…

  4. Smoking, physical exercise, BMI and late foetal death: a study within the Danish National Birth Cohort.

    Science.gov (United States)

    Morales-Suárez-Varela, Maria; Nohr, Ellen A; Bech, Bodil H; Wu, Chunsen; Olsen, Jørn

    2016-10-01

    The aim of this paper was to estimate the effect of maternal and paternal smoking on foetal death (miscarriage and stillbirth) and to estimate potential interactions with physical exercise and pre-pregnancy body mass index. We selected 87,930 pregnancies from the population-based Danish National Birth Cohort. Information about lifestyle, occupational, medical and obstetric factors was obtained from a telephone interview and data on pregnancy outcomes came from the Danish population based registries. Cox regression was used to estimate the hazard ratios (adjusted for potential confounders) for predominantly late foetal death (miscarriage and stillbirth). An interaction contrast ratio was used to assess potential effect measure modification of smoking by physical exercise and body mass index. The adjusted hazard ratio of foetal death was 1.22 (95 % CI 1.02-1.46) for couples where both parents smoked compared to non-smoking parents (miscarriage: 1.18, 95 % CI 0.96-1.44; stillbirth: 1.32, 95 % CI 0.93-1.89). On the additive scale, we detected a small positive interaction for stillbirth between smoking and body mass index (overweight women). In conclusion, smoking during pregnancy was associated with a slightly higher hazard ratio for foetal death if both parents smoked. This study suggests that smoking may increase the negative effect of a high BMI on foetal death, but results were not statistically significant for the interaction between smoking and physical exercise.

  5. Waist-to-height ratio, waist circumference and BMI as indicators of percentage fat mass and cardiometabolic risk factors in children aged 3-7 years

    NARCIS (Netherlands)

    Sijtsma, Anna; Bocca, Gianni; L'abée, Carianne; Liem, Eryn T; Sauer, Pieter J J; Corpeleijn, Eva

    Objective: To assess whether waist-to-height-ratio (WHtR) is a better estimate of body fat percentage (BF %) and a better indicator of cardiometabolic risk factors than BMI or waist circumference (WC) in young children. Methods: WHtR, WC and BMI were measured by trained staff according to

  6. Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.

    Science.gov (United States)

    Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E

    2018-03-13

    The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  7. Performance-Based Measurement: Action for Organizations and HPT Accountability

    Science.gov (United States)

    Larbi-Apau, Josephine A.; Moseley, James L.

    2010-01-01

    Basic measurements and applications of six selected general but critical operational performance-based indicators--effectiveness, efficiency, productivity, profitability, return on investment, and benefit-cost ratio--are presented. With each measurement, goals and potential impact are explored. Errors, risks, limitations to measurements, and a…

  8. Subcopula-based measure of asymmetric association for contingency tables.

    Science.gov (United States)

    Wei, Zheng; Kim, Daeyoung

    2017-10-30

    For the analysis of a two-way contingency table, a new asymmetric association measure is developed. The proposed method uses the subcopula-based regression between the discrete variables to measure the asymmetric predictive powers of the variables of interest. Unlike the existing measures of asymmetric association, the subcopula-based measure is insensitive to the number of categories in a variable, and thus, the magnitude of the proposed measure can be interpreted as the degree of asymmetric association in the contingency table. The theoretical properties of the proposed subcopula-based asymmetric association measure are investigated. We illustrate the performance and advantages of the proposed measure using simulation studies and real data examples. Copyright © 2017 John Wiley & Sons, Ltd.

  9. BMI is not a good indicator for metabolic risk in adolescent girls

    Science.gov (United States)

    BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...

  10. Challenging the role of social norms regarding body weight as an explanation for weight, height, and BMI misreporting biases: Development and application of a new approach to examining misreporting and misclassification bias in surveys

    LENUS (Irish Health Repository)

    Brestoff, Jonathan R

    2011-05-18

    Abstract Background Cultural pressures to be thin and tall are postulated to cause people to misreport their body weight and height towards more socially normative (i.e., desirable) values, but a paucity of direct evidence supports this idea. We developed a novel non-linear approach to examining weight, height, and BMI misreporting biases and used this approach to examine the association between socially non-normative weight and misreporting biases in adults. Methods The Survey of Lifestyles, Attitudes, and Nutrition 2007 (SLÁN 2007), a nationally representative survey of the Republic of Ireland (N = 1942 analyzed) was used. Self-reported weight (height) was classified as under-reported by ≥2.0 kg (2.0 cm), over-reported by ≥2.0 kg (2.0 cm), or accurately reported within 2.0 kg (2.0 cm) to account for technical errors of measurement and short-term fluctuations in measured weight (height). A simulation strategy was used to define self-report-based BMI as under-estimated by more than 1.40 kg\\/m2, over-estimated by more than 1.40 kg\\/m2, or accurately estimated within 1.40 kg\\/m2. Patterns of biases in self-reported weight, height, and BMI were explored. Logistic regression was used to identify factors associated with mis-estimated BMI and to calculate adjusted odds ratios (AOR) and 99% confidence intervals (99%CI). Results The patterns of bias contributing the most to BMI mis-estimation were consistently, in decreasing order of influence, (1) under-reported weight combined with over-reported height, (2) under-reported weight with accurately reported height, and (3) accurately reported weight with over-reported height. Average bias in self-report-based BMI was -1.34 kg\\/m2 overall and -0.49, -1.33, and -2.66 kg\\/m2 in normal, overweight, and obese categories, respectively. Despite the increasing degree of bias with progressively higher BMI categories, persons describing themselves as too heavy were, within any given BMI category, less likely to have under

  11. The relation of weight suppression and BMI to bulimic symptoms.

    Science.gov (United States)

    Butryn, Meghan L; Juarascio, Adrienne; Lowe, Michael R

    2011-11-01

    High levels of weight suppression have been associated with greater binge eating and weight gain as well as poorer treatment outcome in bulimia nervosa. This study examined the relationship between weight suppression and bulimia nervosa symptoms and explored how weight suppression might interact with body mass index (BMI) in accounting for level of symptomatology at presentation for treatment. Participants were 64 women with threshold or sub-threshold bulimia nervosa. A clinical interview assessed binge eating and purging. Weight suppression and the interaction between BMI and weight suppression predicted frequency of binge eating such that participants with low BMI and high weight suppression engaged in the most binge eating. High levels of weight suppression also predicted more frequent purging. Additional research is warranted to examine mediators of these relationships. Copyright © 2010 Wiley Periodicals, Inc.

  12. In a safety net population HPV4 vaccine adherence worsens as BMI increases.

    Directory of Open Access Journals (Sweden)

    Diane M Harper

    Full Text Available Obesity adversely inhibits antibody response to vaccination. Three doses of HPV4 may or may not provide adequate long term protection against HPV 16/18 in obese females. The aim of this study was to determine whether adherence to HPV4 vaccination in a safety net population was reduced with increasing body mass index (BMI.We designed a historical prospective study evaluating the number and dates of HPV4 dosing that occurred from July 1, 2006 through October 1, 2009 by the demographic characteristics of the 10-26 year old recipient females. The defined dosing intervals were adapted from the literature and obesity categories were defined by the WHO.1240 females with BMI measurements received at least one dose of HPV4; 38% were obese (class I, II and III and 25% were overweight. Females with normal BMI received on-time triplet dosing significantly more often than did the obese class II and III females (30% vs. 18%, p<0.001. Obese class II/III females have a significant 45% less chance of completing the on-time triplet HPV4 series than normal women (OR = 0.55, 95% CI: 0.37, 0.83. Pregnancy history has a significant influence on BMI and HPV4 dosing compliance in this safety net population where 71% had been gravid. Hispanic females were less likely to complete HPV4 dosing regardless of BMI (aOR = 0.39, 95% CI: 0.16, 0.95.Obesity, as well as gravidity and Hispanic race, are risk factors for lack of HPV4 vaccine adherence among young females in a safety net population.

  13. SEM based overlay measurement between resist and buried patterns

    Science.gov (United States)

    Inoue, Osamu; Okagawa, Yutaka; Hasumi, Kazuhisa; Shao, Chuanyu; Leray, Philippe; Lorusso, Gian; Baudemprez, Bart

    2016-03-01

    With the continuous shrink in pattern size and increased density, overlay control has become one of the most critical issues in semiconductor manufacturing. Recently, SEM based overlay of AEI (After Etch Inspection) wafer has been used for reference and optimization of optical overlay (both Image Based Overlay (IBO) and Diffraction Based Overlay (DBO)). Overlay measurement at AEI stage contributes monitor and forecast the yield after formation by etch and calibrate optical measurement tools. however those overlay value seems difficult directly for feedback to a scanner. Therefore, there is a clear need to have SEM based overlay measurements of ADI (After Develop Inspection) wafers in order to serve as reference for optical overlay and make necessary corrections before wafers go to etch. Furthermore, to make the corrections as accurate as possible, actual device like feature dimensions need to be measured post ADI. This device size measurement is very unique feature of CDSEM , which can be measured with smaller area. This is currently possible only with the CD-SEM. This device size measurement is very unique feature of CD-SEM , which can be measured with smaller area. In this study, we assess SEM based overlay measurement of ADI and AEI wafer by using a sample from an N10 process flow. First, we demonstrate SEM based overlay performance at AEI by using dual damascene process for Via 0 (V0) and metal 1 (M1) layer. We also discuss the overlay measurements between litho-etch-litho stages of a triple patterned M1 layer and double pattern V0. Second, to illustrate the complexities in image acquisition and measurement we will measure overlay between M1B resist and buried M1A-Hard mask trench. Finally, we will show how high accelerating voltage can detect buried pattern information by BSE (Back Scattering Electron). In this paper we discuss the merits of this method versus standard optical metrology based corrections.

  14. Observational attachment theory-based parenting measures predict children's attachment narratives independently from social learning theory-based measures.

    Science.gov (United States)

    Matias, Carla; O'Connor, Thomas G; Futh, Annabel; Scott, Stephen

    2014-01-01

    Conceptually and methodologically distinct models exist for assessing quality of parent-child relationships, but few studies contrast competing models or assess their overlap in predicting developmental outcomes. Using observational methodology, the current study examined the distinctiveness of attachment theory-based and social learning theory-based measures of parenting in predicting two key measures of child adjustment: security of attachment narratives and social acceptance in peer nominations. A total of 113 5-6-year-old children from ethnically diverse families participated. Parent-child relationships were rated using standard paradigms. Measures derived from attachment theory included sensitive responding and mutuality; measures derived from social learning theory included positive attending, directives, and criticism. Child outcomes were independently-rated attachment narrative representations and peer nominations. Results indicated that Attachment theory-based and Social Learning theory-based measures were modestly correlated; nonetheless, parent-child mutuality predicted secure child attachment narratives independently of social learning theory-based measures; in contrast, criticism predicted peer-nominated fighting independently of attachment theory-based measures. In young children, there is some evidence that attachment theory-based measures may be particularly predictive of attachment narratives; however, no single model of measuring parent-child relationships is likely to best predict multiple developmental outcomes. Assessment in research and applied settings may benefit from integration of different theoretical and methodological paradigms.

  15. The impact of sleep-disordered breathing on body mass index (BMI: the sleep heart health study (SHHS

    Directory of Open Access Journals (Sweden)

    Robbins JA

    2011-12-01

    Full Text Available Introduction: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB. However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors.Methods: A full-montage unattended home polysomnogram (PSG and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI was categorized using clinical thresholds: < 5 (normal, ≥ 5 to <15 (mild sleep apnea, and ³ 15 (moderate to severe sleep apnea. Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates.Results: Mean (SD age was 62.2 years (10.14, 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD change of 0.53 (2.62 kg/m2 (p=0.071. A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m2 (p=0.055 and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m2 (p<0.001 compared to those with baseline AHI of <5.Conclusion: Our findings suggest that there is a positive association between severity of SDB and subsequent increased BMI over approximately 5 years. This observation may help explain why persons with SDB have difficulty losing weight.

  16. Early Life Factors and Inter-Country Heterogeneity in BMI Growth Trajectories of European Children: The IDEFICS Study.

    Directory of Open Access Journals (Sweden)

    Claudia Börnhorst

    Full Text Available Starting from birth, this explorative study aimed to investigate between-country differences in body mass index (BMI trajectories and whether early life factors explain these differences.The sample included 7,644 children from seven European countries (Belgium, Cyprus, Germany, Hungary, Italy, Spain, Sweden participating in the multi-centre IDEFICS study. Information on early life factors and in total 53,409 repeated measurements of height and weight from 0 to <12 years of age were collected during the baseline (2007/2008 and follow-up examination (2009/2010 supplemented by records of routine child health visits. Country-specific BMI growth curves were estimated using fractional polynomial mixed effects models. Several covariates focussing on early life factors were added to the models to investigate their role in the between-countries differences.Large between-country differences were observed with Italian children showing significantly higher mean BMI values at all ages ≥ 3 years compared to the other countries. For instance, at age 11 years mean BMI values in Italian boys and girls were 22.3 [21.9;22.8; 99% confidence interval] and 22.0 [21.5;22.4], respectively, compared to a range of 18.4 [18.1;18.8] to 20.3 [19.8;20.7] in boys and 18.2 [17.8;18.6] to 20.3 [19.8;20.7] in girls in the other countries. After adjustment for early life factors, differences between country-specific BMI curves became smaller. Maternal BMI was the factor being most strongly associated with BMI growth (p<0.01 in all countries with associations increasing during childhood. Gestational weight gain (GWG was weakly associated with BMI at birth in all countries. In some countries, positive associations between BMI growth and children not being breastfed, mothers' smoking during pregnancy and low educational level of parents were found.Early life factors seem to explain only some of the inter-country variation in growth. Maternal BMI showed the strongest association

  17. Association of BMI with risk of CVD mortality and all-cause mortality.

    Science.gov (United States)

    Kee, Chee Cheong; Sumarni, Mohd Ghazali; Lim, Kuang Hock; Selvarajah, Sharmini; Haniff, Jamaiyah; Tee, Guat Hiong Helen; Gurpreet, Kaur; Faudzi, Yusoff Ahmad; Amal, Nasir Mustafa

    2017-05-01

    To determine the relationship between BMI and risk of CVD mortality and all-cause mortality among Malaysian adults. Population-based, retrospective cohort study. Participants were followed up for 5 years from 2006 to 2010. Mortality data were obtained via record linkages with the Malaysian National Registration Department. Multiple Cox regression was applied to compare risk of CVD and all-cause mortality between BMI categories adjusting for age, gender and ethnicity. Models were generated for all participants, all participants the first 2 years of follow-up, healthy participants, healthy never smokers, never smokers, current smokers and former smokers. All fourteen states in Malaysia. Malaysian adults (n 32 839) aged 18 years or above from the third National Health and Morbidity Survey. Total follow-up time was 153 814 person-years with 1035 deaths from all causes and 225 deaths from CVD. Underweight (BMIBMI ≥30·0 kg/m2) was associated with a heightened risk of CVD mortality. Overweight (BMI=25·0-29·9 kg/m2) was inversely associated with risk of all-cause mortality. Underweight was significantly associated with all-cause mortality in all models except for current smokers. Overweight was inversely associated with all-cause mortality in all participants. Although a positive trend was observed between BMI and CVD mortality in all participants, a significant association was observed only for severe obesity (BMI≥35·0 kg/m2). Underweight was associated with increased risk of all-cause mortality and obesity with increased risk of CVD mortality. Therefore, maintaining a normal BMI through leading an active lifestyle and healthy dietary habits should continue to be promoted.

  18. A Follow-up Study on BMI-SDS and Insulin Resistance in Overweight and Obese Children at Risk for Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Soulmaz Fazeli Farsani PharmD, MSc

    2015-01-01

    Full Text Available Objectives. To evaluate body mass index standard deviation score (BMI-SDS, insulin sensitivity, and progression to type 2 diabetes mellitus (T2DM in children at risk for T2DM approximately 3 years after being diagnosed with overweight/obesity and insulin resistance (measured by Homeostasis Model Assessment of Insulin Resistance [HOMA-IR]. Methods. Out of 86 invited children, 44 (mean age 15.4 ± 3.6 years participated. Medical history, physical examination, and laboratory workup were performed. Results. While the mean BMI-SDS significantly increased from 2.9 to 3.4, the mean HOMA-IR significantly decreased from 5.5 to 4.6 (baseline vs follow-up visit. Change in HOMA-IR was only due to a decrease in mean fasting plasma insulin (24.1 vs 21.1, P = .073. Conclusions. Although increase in BMI-SDS in these children is worrisome, the American Diabetes Association recommended screening interval of 3 years for children at risk for T2DM is not too long based on the fact that none of our study participants developed T2DM.

  19. Cyst-based measurements for assessing lymphangioleiomyomatosis in computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Lo, P., E-mail: pechinlo@mednet.edu.ucla; Brown, M. S.; Kim, H.; Kim, H.; Goldin, J. G. [Center for Computer Vision and Imaging Biomarkers, Department of Radiological Sciences, David Geffen School of Medicine, University of California, Los Angeles, California 90024 (United States); Argula, R.; Strange, C. [Division of Pulmonary and Critical Care Medicine, Medical University of South Carolina, Charleston, South Carolina 29425 (United States)

    2015-05-15

    Purpose: To investigate the efficacy of a new family of measurements made on individual pulmonary cysts extracted from computed tomography (CT) for assessing the severity of lymphangioleiomyomatosis (LAM). Methods: CT images were analyzed using thresholding to identify a cystic region of interest from chest CT of LAM patients. Individual cysts were then extracted from the cystic region by the watershed algorithm, which separates individual cysts based on subtle edges within the cystic regions. A family of measurements were then computed, which quantify the amount, distribution, and boundary appearance of the cysts. Sequential floating feature selection was used to select a small subset of features for quantification of the severity of LAM. Adjusted R{sup 2} from multiple linear regression and R{sup 2} from linear regression against measurements from spirometry were used to compare the performance of our proposed measurements with currently used density based CT measurements in the literature, namely, the relative area measure and the D measure. Results: Volumetric CT data, performed at total lung capacity and residual volume, from a total of 49 subjects enrolled in the MILES trial were used in our study. Our proposed measures had adjusted R{sup 2} ranging from 0.42 to 0.59 when regressing against the spirometry measures, with p < 0.05. For previously used density based CT measurements in the literature, the best R{sup 2} was 0.46 (for only one instance), with the majority being lower than 0.3 or p > 0.05. Conclusions: The proposed family of CT-based cyst measurements have better correlation with spirometric measures than previously used density based CT measurements. They show potential as a sensitive tool for quantitatively assessing the severity of LAM.

  20. Changes in BMI before and during economic development and subsequent risk of cardiovascular disease and total mortality: a 35-year follow-up study in China.

    Science.gov (United States)

    He, Yao; Lam, Tai Hing; Jiang, Bin; Li, Lan Sun; Sun, Dong Ling; Wu, Lei; Liu, Miao; Yang, Shan Shan; Wang, Yi Yan; Tobias, Deirdre K; Sun, Qi; Hu, Frank B

    2014-09-01

    It is unclear whether changes in BMI during rapid economic development influence subsequent mortality. We analyzed whether BMI in 1976 and 1994 and changes in BMI during 1976-1994 predict cardiovascular disease (CVD) and all-cause mortality in a 35-year follow-up cohort of 1,696 Chinese (1,124 men and 572 women, aged 35-65 years) in Xi'an, China. Participants were categorized as underweight (economic development was associated with elevated risks of all-cause and CVD mortality. Higher BMI measured before economic development was associated with lower mortality risk, whereas BMI measured afterward was associated with increased mortality. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  1. Association of Pre-pregnancy BMI and Postpartum Weight Retention Before Second Pregnancy, Washington State, 2003-2013.

    Science.gov (United States)

    Ketterl, Tyler G; Dundas, Nicolas J; Roncaioli, Steven A; Littman, Alyson J; Phipps, Amanda I

    2018-03-06

    Background Maternal overweight and obesity is one of the most common high-risk obstetric conditions associated with adverse birth outcomes. Smaller studies have suggested that pre-pregnancy body mass index (BMI) is associated with postpartum weight retention. Objective The primary objective of this study was to examine the association between pre-pregnancy BMI status and maternal weight retention. Study design We conducted a population-based retrospective cohort study using Washington State birth certificate data from 2003-2013. We included women who had two sequential births during this time period, with the second birth occurring within 18-36 months of the first singleton delivery date. BMI before a women's first pregnancy ("pre-pregnancy BMI") was categorized as normal (18.5-24.9 kg/m 2 ) and overweight/obese (25-40 kg/m 2 ). Women were classified as having returned to first pre-pregnancy BMI if their BMI before their second pregnancy was no more than 1 kg/m 2 more compared to their BMI before their first pregnancy. Analyses were stratified by gestational weight gain during the first pregnancy (below, met, exceeded recommended gestational weight gain). Results A total of 49,132 mothers were included in the study. Among women who met their recommended gestational weight gain, compared to mothers with a normal BMI, obese/overweight mothers were less likely to return to their pre-pregnancy BMI (76.5 vs 72.3%; RR Obese/Overweight  = 0.88; 95% CI: 0.85-0.92). A similar pattern was observed among women who exceeded their recommended gestational weight gain (62.6 vs 53.2%; RR Obese/Overweight  = 0.79, 95% CI: 0.78-0.80). Conclusion Pre-pregnancy BMI in the overweight/obese range is associated with a decreased likelihood of returning to pre-pregnancy BMI. Further research to support women during and after their pregnancy to promote behavior changes that prevent excessive weight gain during pregnancy and weight retention after birth is needed.

  2. Effect of BMI on Knee Joint Torques in Ergometer Rowing

    NARCIS (Netherlands)

    Roemer, Karen; Hortobagyi, Tibor; Richter, Chris; Munoz-Maldonado, Yolanda; Hamilton, Stephanie

    2013-01-01

    Although an authoritative panel recommended the use of ergometer rowing as a non-weight-bearing form of exercise for obese adults, the biomechanical characterization of ergometer rowing is strikingly absent. We examined the interaction between body mass index (BMI) relative to the lower extremity

  3. The Prevalence of Obesity as Indicated by BMI and Waist ...

    African Journals Online (AJOL)

    Background: The prevalence of overweight and obesity in most developed countries and in urban areas of many less developed countries has been increasing markedly over the past twenty years. This study\\'s aims were to determine the prevalence of obesity using BMI and waist circumference among Nigerian adults ...

  4. Differences in the association between childhood trauma and BMI in ...

    African Journals Online (AJOL)

    However,independent of BMI group, there were significant differences in socioeconomic status (SES) between black and white women (P<0.01). Total CTQ score, as well as the sub-scales, physical and emotional neglect, and physical and sexual abuse were higher in black than white women (all P<0.05), but these scores ...

  5. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  6. A comparative study on different BMI category and physical fitness ...

    African Journals Online (AJOL)

    A comparative study on different BMI category and physical fitness health related component of sedentary male youth in Terengganu. V Eswaramoorthi, M.R. Abdullah, H Juahir, A.B.H.M. Maliki, R.M. Musa, N.A. Kosni, N Alias, N.B. Raj, S.M.M. Rasid, A Adnan ...

  7. Fracture toughness measurements of WC-based hard metals

    International Nuclear Information System (INIS)

    Prakash, L.; Albert, B.

    1983-01-01

    The fracture toughness of WC-based cemented carbides was determined by different methods. The values obtained are dependent on the procedure of measurement. Each method thoughness of hard metals mutually. (orig.) [de

  8. Multivariate Methods Based Soft Measurement for Wine Quality Evaluation

    Directory of Open Access Journals (Sweden)

    Shen Yin

    2014-01-01

    a decision. However, since the physicochemical indexes of wine can to some extent reflect the quality of wine, the multivariate statistical methods based soft measure can help the oenologist in wine evaluation.

  9. BMI changes in children and adolescents attending a specialized childhood obesity center: a cohort study

    OpenAIRE

    Maggio, Albane BR; Saunders Gasser, Catherine; Gal-Duding, Claudine; Beghetti, Maurice; Martin, Xavier E; Farpour-Lambert, Nathalie J; Chamay-Weber, Catherine

    2013-01-01

    Background Multidisciplinary group therapies for obese children and adolescents are effective but difficult to implement. There is a crucial need to evaluate simpler management programs that target the obese child and his family. This study aimed to determine changes in body mass indexes (BMI) after individual family-based obesity intervention with a pediatrician in a specialized obesity center for child and adolescent. Methods This cohort study included 283 patients (3.3 to 17.1 years, mean ...

  10. Assessing the genetic overlap between BMI and cognitive function

    Science.gov (United States)

    Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J

    2016-01-01

    Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597

  11. Difficulty buying food, BMI, and eating habits in young children.

    Science.gov (United States)

    Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

    2018-01-22

    To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

  12. Body mass index (BMI) in the Saudi population of Gassim.

    Science.gov (United States)

    Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

    1998-01-01

    In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

  13. Calibration of Smartphone-Based Weather Measurements Using Pairwise Gossip

    Directory of Open Access Journals (Sweden)

    Jane Louie Fresco Zamora

    2015-01-01

    Full Text Available Accurate and reliable daily global weather reports are necessary for weather forecasting and climate analysis. However, the availability of these reports continues to decline due to the lack of economic support and policies in maintaining ground weather measurement systems from where these reports are obtained. Thus, to mitigate data scarcity, it is required to utilize weather information from existing sensors and built-in smartphone sensors. However, as smartphone usage often varies according to human activity, it is difficult to obtain accurate measurement data. In this paper, we present a heuristic-based pairwise gossip algorithm that will calibrate smartphone-based pressure sensors with respect to fixed weather stations as our referential ground truth. Based on actual measurements, we have verified that smartphone-based readings are unstable when observed during movement. Using our calibration algorithm on actual smartphone-based pressure readings, the updated values were significantly closer to the ground truth values.

  14. Calibration of Smartphone-Based Weather Measurements Using Pairwise Gossip.

    Science.gov (United States)

    Zamora, Jane Louie Fresco; Kashihara, Shigeru; Yamaguchi, Suguru

    2015-01-01

    Accurate and reliable daily global weather reports are necessary for weather forecasting and climate analysis. However, the availability of these reports continues to decline due to the lack of economic support and policies in maintaining ground weather measurement systems from where these reports are obtained. Thus, to mitigate data scarcity, it is required to utilize weather information from existing sensors and built-in smartphone sensors. However, as smartphone usage often varies according to human activity, it is difficult to obtain accurate measurement data. In this paper, we present a heuristic-based pairwise gossip algorithm that will calibrate smartphone-based pressure sensors with respect to fixed weather stations as our referential ground truth. Based on actual measurements, we have verified that smartphone-based readings are unstable when observed during movement. Using our calibration algorithm on actual smartphone-based pressure readings, the updated values were significantly closer to the ground truth values.

  15. Measuring Disorientation Based on the Needleman-Wunsch Algorithm

    Science.gov (United States)

    Güyer, Tolga; Atasoy, Bilal; Somyürek, Sibel

    2015-01-01

    This study offers a new method to measure navigation disorientation in web based systems which is powerful learning medium for distance and open education. The Needleman-Wunsch algorithm is used to measure disorientation in a more precise manner. The process combines theoretical and applied knowledge from two previously distinct research areas,…

  16. Maternal prepregnancy waist circumference and BMI in relation to gestational weight gain and breastfeeding behavior

    DEFF Research Database (Denmark)

    Kirkegaard, Helene; Nøhr, Ellen A; Rasmussen, Kathleen M

    2015-01-01

    BACKGROUND: Studies suggest that gestational weight gain (GWG) and breastfeeding behavior may influence long-term maternal abdominal fat mass. However, this could be confounded by abdominal fat mass before pregnancy because it is unknown whether abdominal fat mass, independently of body size......, affects GWG and breastfeeding behavior. OBJECTIVE: We investigated how maternal prepregnancy fat distribution, described by waist circumference (WC) and body mass index (BMI), is associated with GWG and breastfeeding behavior. DESIGN: We analyzed 1371 live births to 1024 women after enrollment...... in the Coronary Artery Risk Development in Young Adults study (1985-1996). For each birth, maternal prepregnancy BMI and WC were measured at year 0 (baseline), 2, 5, or 7 examinations. Recalled GWG and breastfeeding behavior were collected at years 7 and 10. GWG was analyzed by using linear regression...

  17. Monitoring cure properties of out-of-autoclave BMI composites using IFPI sensor

    Science.gov (United States)

    Kaur, Amardeep; Anandan, Sudharshan; Yuan, Lei; Watkins, Steve E.; Chandrashekhara, K.; Xiao, Hai; Phan, Nam

    2016-04-01

    A non-destructive technique for inspection of a Bismaleimide (BMI) composite is presented using an optical fiber sensor. High performance BMI composites are used for Aerospace application for their mechanical strength. They are also used as an alternative to toughened epoxy resins. A femtosecond-laser-inscribed Intrinsic Fabry-Perot Interferometer (IFPI) sensor is used to perform real time cure monitoring of a BMI composite. The composite is cured using the out-of-autoclave (OOA) process. The IFPI sensor was used for in-situ monitoring; different curing stages are analyzed throughout the curing process. Temperature-induced-strain was measured to analyze the cure properties. The IFPI structure comprises of two reflecting mirrors inscribed on the core of the fiber using a femtosecond-laser manufacturing process. The manufacturing process makes the sensor thermally stable and robust for embedded applications. The sensor can withstand very high temperatures of up to 850 °C. The temperature and strain sensitivities of embedded IFPI sensor were measured to be 1.4 pm/μepsilon and 0.6 pm/μepsilon respectively.

  18. Maternal BMI, IGF-I Levels, and Birth Weight in African American and White Infants

    Directory of Open Access Journals (Sweden)

    Adriana C. Vidal

    2013-01-01

    Full Text Available At birth, elevated IGF-I levels have been linked to birth weight extremes; high birth weight and low birth weight are risk factors for adult-onset chronic diseases including obesity, cardiovascular disease, and type 2 diabetes. We examined associations between plasma IGF-I levels and birth weight among infants born to African American and White obese and nonobese women. Prepregnancy weight and height were assessed among 251 pregnant women and anthropometric measurements of full term infants (≥37 weeks of gestation were taken at birth. Circulating IGF-I was measured by ELISA in umbilical cord blood plasma. Linear regression models were utilized to examine associations between birth weight and high IGF-I, using the bottom two tertiles as referents. Compared with infants with lower IGF-I levels (≤3rd tertile, those with higher IGF-I levels (>3rd tertile were 130 g heavier at birth, (β-coefficient=230, se=58.0, P=0.0001, after adjusting for gender, race/ethnicity, gestational age, delivery route, maternal BMI and smoking. Stratified analyses suggested that these associations are more pronounced in infants born to African American women and women with BMI ≥30 kg/m2; the cross product term for IGF-I and maternal BMI was statistically significant (P≤0.0004. Our findings suggest that the association between IGF-I levels and birth weight depends more on maternal obesity than African American race/ethnicity.

  19. Measurement properties of performance-based measures to assess physical function in hip and knee osteoarthritis

    DEFF Research Database (Denmark)

    Dobson, F; Hinman, R S; Hall, M

    2012-01-01

    OBJECTIVES: To systematically review the measurement properties of performance-based measures to assess physical function in people with hip and/or knee osteoarthritis (OA). METHODS: Electronic searches were performed in MEDLINE, CINAHL, Embase, and PsycINFO up to the end of June 2012. Two...... investigating measurement properties of performance measures, including responsiveness and interpretability in people with hip and/or knee OA, is needed. Consensus on which combination of measures will best assess physical function in people with hip/and or knee OA is urgently required....

  20. On-Line Voltage Stability Assessment based on PMU Measurements

    DEFF Research Database (Denmark)

    Garcia-Valle, Rodrigo; P. Da Silva, Luiz C.; Nielsen, Arne Hejde

    2009-01-01

    This paper presents a method for on-line monitoring of risk voltage collapse based on synchronised phasor measurement. As there is no room for intensive computation and analysis in real-time, the method is based on the combination of off-line computation and on-line monitoring, which are correlat...

  1. Correlation of Index Finger Length (2D with Height, Weight and BMI in Adult Bangladeshi Male

    Directory of Open Access Journals (Sweden)

    Karim Rezwan Hasan

    2017-05-01

    Full Text Available Background: Human hand is one of the most versatile parts of the human body which plays an important role in modern medical science and evolutionary biology. By virtue of evolution and genetic arrangements, digital lengths vary from person to person according to age, sex, races, occupation or even environmental influences. It has been found that the digital lengths and their ratios are not same in different sexes and even in both hands of same individual. Specially, index to ring digit lengths and their ratios which already have been proved to represent sexual dimorphism may differ in both hands of an individual and show positive correlations with other morphological attributes like height, weight and BMI. Objectives: To analyze the variation of index finger (2D length and its correlation with height, weight and BMI in adult Bangladeshi male. Materials and Methods: This cross-sectional analytical study was conducted in the department of Anatomy, Dhaka Medical College, Dhaka from July 2012 to June 2013 on 100 male MBBS students (20−25 years of age. With the help of digital vernier caliper measurements of index finger length (2D was recorded. Height and weight were measured by the stadiometer and weighing scale respectively. BMI was calculated from height and weight. Pearson’s correlation analysis was done to find out the correlation of index finger length with height, weight and BMI. Results: Significant correlation has been found between the lengths of index fingers (2D and height (p0.05. Conclusion: In this study, we found variation in index finger lengths of both hands of Bangladeshi male subjects, which needs further study and comparison.

  2. Blood Pressure Variation Throughout Pregnancy According to Early Gestational BMI: A Brazilian Cohort

    Directory of Open Access Journals (Sweden)

    Fernanda Rebelo

    2015-04-01

    Full Text Available Background: The maternal cardiovascular system undergoes progressive adaptations throughout pregnancy, causing blood pressure fluctuations. However, no consensus has been established on its normal variation in uncomplicated pregnancies. Objective: To describe the variation in systolic blood pressure (SBP and diastolic blood pressure (DBP levels during pregnancy according to early pregnancy body mass index (BMI. Methods: SBP and DBP were measured during the first, second and third trimesters and at 30-45 days postpartum in a prospective cohort of 189 women aged 20-40 years. BMI (kg/m2 was measured up to the 13th gestational week and classified as normal-weight (<25.0 or excessive weight (≥25.0. Longitudinal linear mixed-effects models were used for statistical analysis. Results: A decrease in SBP and DBP was observed from the first to the second trimester (βSBP=-0.394; 95%CI: -0.600- -0.188 and βDBP=-0.617; 95%CI: -0.780- -0.454, as was an increase in SBP and DBP up to 30-45 postpartum days (βSBP=0.010; 95%CI: 0.006-0.014 and βDBP=0.015; 95%CI: 0.012-0.018. Women with excessive weight at early pregnancy showed higher mean SBP in all gestational trimesters, and higher mean DBP in the first and third trimesters. Excessive early pregnancy BMI was positively associated with prospective changes in SBP (βSBP=7.055; 95%CI: 4.499-9.610 and in DBP (βDBP=3.201; 95%CI: 1.136-5.266. Conclusion: SBP and DBP decreased from the first to the second trimester and then increased up to the postpartum period. Women with excessive early pregnancy BMI had higher SBP and DBP than their normal-weight counterparts throughout pregnancy, but not in the postpartum period.

  3. Circulating Spexin Levels Negatively Correlate With Age, BMI, Fasting Glucose, and Triglycerides in Healthy Adult Women.

    Science.gov (United States)

    Lin, Cheng-Yuan; Huang, Tao; Zhao, Ling; Zhong, Linda L D; Lam, Wai Ching; Fan, Bao-Min; Bian, Zhao-Xiang

    2018-05-01

    Spexin is a newly identified neuropeptide that is involved in satiety control, glucose, and lipids metabolism. It has also been related to human diseases, such as obesity and type 2 diabetes. However, whether spexin changes with age or not is still unclear. The aim of this study is to investigate the relationship between circulating spexin levels and age and to study their interaction effects on body mass index (BMI), fasting glucose, and -lipids. This is a cross-sectional study, including 68 healthy adult women whose ages are in a wide range (minimum: 23; median: 38.5; maximum: 64). The serum spexin levels were measured by an enzyme-linked immunosorbent assay. Fasting glucose, total cholesterol, triglycerides (TG), alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine were measured by routine biochemical test. Shapiro-Wilk's test, Spearman and Pearson correlation analyses, χ 2 test, and two-way analysis of variance were used to interpret the data. Serum spexin levels are significantly correlated with age (Spearman r = -0.277, P = 0.022), BMI (Spearman r = -0.445, P glucose (Spearman r = -0.302, P = 0.014), and TG (Spearman r = -0.324, P = 0.008). Spexin levels independently predict the risk of high BMI and high fasting glucose. No interaction effects of spexin and age on BMI and fasting glucose were found. Circulating spexin levels decrease with age, suggesting a possible role of this peptide in aging-related functions and disorders. Further investigations are needed to expand the clinical significance of this finding.

  4. Long-term BMI and growth profiles in offspring of women with gestational diabetes.

    Science.gov (United States)

    Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

    2018-05-01

    Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM

  5. Dipole location using SQUID based measurements: Application to magnetocardiography

    Science.gov (United States)

    Mariyappa, N.; Parasakthi, C.; Sengottuvel, S.; Gireesan, K.; Patel, Rajesh; Janawadkar, M. P.; Sundar, C. S.; Radhakrishnan, T. S.

    2012-07-01

    We report a method of inferring the dipole location using iterative nonlinear least square optimization based on Levenberg-Marquardt algorithm, wherein, we use different sets of pseudo-random numbers as initial parameter values. The method has been applied to (i) the simulated data representing the calculated magnetic field distribution produced by a point dipole placed at a known position, (ii) the experimental data from SQUID based measurements of the magnetic field distribution produced by a source coil carrying current, and (iii) the actual experimentally measured magnetocardiograms of human subjects using a SQUID based system.

  6. Variable screening and ranking using sampling-based sensitivity measures

    International Nuclear Information System (INIS)

    Wu, Y-T.; Mohanty, Sitakanta

    2006-01-01

    This paper presents a methodology for screening insignificant random variables and ranking significant important random variables using sensitivity measures including two cumulative distribution function (CDF)-based and two mean-response based measures. The methodology features (1) using random samples to compute sensitivities and (2) using acceptance limits, derived from the test-of-hypothesis, to classify significant and insignificant random variables. Because no approximation is needed in either the form of the performance functions or the type of continuous distribution functions representing input variables, the sampling-based approach can handle highly nonlinear functions with non-normal variables. The main characteristics and effectiveness of the sampling-based sensitivity measures are investigated using both simple and complex examples. Because the number of samples needed does not depend on the number of variables, the methodology appears to be particularly suitable for problems with large, complex models that have large numbers of random variables but relatively few numbers of significant random variables

  7. Local high precision 3D measurement based on line laser measuring instrument

    Science.gov (United States)

    Zhang, Renwei; Liu, Wei; Lu, Yongkang; Zhang, Yang; Ma, Jianwei; Jia, Zhenyuan

    2018-03-01

    In order to realize the precision machining and assembly of the parts, the geometrical dimensions of the surface of the local assembly surfaces need to be strictly guaranteed. In this paper, a local high-precision three-dimensional measurement method based on line laser measuring instrument is proposed to achieve a high degree of accuracy of the three-dimensional reconstruction of the surface. Aiming at the problem of two-dimensional line laser measuring instrument which lacks one-dimensional high-precision information, a local three-dimensional profile measuring system based on an accurate single-axis controller is proposed. First of all, a three-dimensional data compensation method based on spatial multi-angle line laser measuring instrument is proposed to achieve the high-precision measurement of the default axis. Through the pretreatment of the 3D point cloud information, the measurement points can be restored accurately. Finally, the target spherical surface is needed to make local three-dimensional scanning measurements for accuracy verification. The experimental results show that this scheme can get the local three-dimensional information of the target quickly and accurately, and achieves the purpose of gaining the information and compensating the error for laser scanner information, and improves the local measurement accuracy.

  8. Measuring Software Test Verification for Complex Workpieces based on Virtual Gear Measuring Instrument

    Directory of Open Access Journals (Sweden)

    Yin Peili

    2017-08-01

    Full Text Available Validity and correctness test verification of the measuring software has been a thorny issue hindering the development of Gear Measuring Instrument (GMI. The main reason is that the software itself is difficult to separate from the rest of the measurement system for independent evaluation. This paper presents a Virtual Gear Measuring Instrument (VGMI to independently validate the measuring software. The triangular patch model with accurately controlled precision was taken as the virtual workpiece and a universal collision detection model was established. The whole process simulation of workpiece measurement is implemented by VGMI replacing GMI and the measuring software is tested in the proposed virtual environment. Taking involute profile measurement procedure as an example, the validity of the software is evaluated based on the simulation results; meanwhile, experiments using the same measuring software are carried out on the involute master in a GMI. The experiment results indicate a consistency of tooth profile deviation and calibration results, thus verifying the accuracy of gear measuring system which includes the measurement procedures. It is shown that the VGMI presented can be applied in the validation of measuring software, providing a new ideal platform for testing of complex workpiece-measuring software without calibrated artifacts.

  9. Decoding of top-down cognitive processing for SSVEP-controlled BMI

    Science.gov (United States)

    Min, Byoung-Kyong; Dähne, Sven; Ahn, Min-Hee; Noh, Yung-Kyun; Müller, Klaus-Robert

    2016-11-01

    We present a fast and accurate non-invasive brain-machine interface (BMI) based on demodulating steady-state visual evoked potentials (SSVEPs) in electroencephalography (EEG). Our study reports an SSVEP-BMI that, for the first time, decodes primarily based on top-down and not bottom-up visual information processing. The experimental setup presents a grid-shaped flickering line array that the participants observe while intentionally attending to a subset of flickering lines representing the shape of a letter. While the flickering pixels stimulate the participant’s visual cortex uniformly with equal probability, the participant’s intention groups the strokes and thus perceives a ‘letter Gestalt’. We observed decoding accuracy of 35.81% (up to 65.83%) with a regularized linear discriminant analysis; on average 2.05-fold, and up to 3.77-fold greater than chance levels in multi-class classification. Compared to the EEG signals, an electrooculogram (EOG) did not significantly contribute to decoding accuracies. Further analysis reveals that the top-down SSVEP paradigm shows the most focalised activation pattern around occipital visual areas; Granger causality analysis consistently revealed prefrontal top-down control over early visual processing. Taken together, the present paradigm provides the first neurophysiological evidence for the top-down SSVEP BMI paradigm, which potentially enables multi-class intentional control of EEG-BMIs without using gaze-shifting.

  10. The optimal value of BMI for the lowest risk of osteoporosis in postmenopausal women aged 40-88 years.

    Science.gov (United States)

    Skrzek, A; Kozieł, S; Ignasiak, Z

    2014-06-01

    The aim of this paper is to establish the optimal values of the body mass index (BMI) which would indicate the most favourable preservation of the bone mineral density in postmenopausal women. The material consists of the data of 369 healthy women aged between 40 and 88 years (mean age 67.84, SD=6.70) inhabitants of Wrocław, which were followed up between 2001 and 2006. The absolute measure of bone mineral density (BMD) of the femoral neck was assessed using dual energy X-ray absorptiometry (DEXA), expressed in g/(100mm(2)) and was transformed to T-score values. According to the value of BMI, the women were divided into eight groups, the reference group with value between 18.0 and 21.9kg/m(2) and seven other groups beginning with the value 22.0 with a 2-point interval. Postmenopausal status was defined according to the occurrence of menstruation within the last 360 days. The women with osteopenia and osteoporosis were pooled together and comprised the risk group, whereas the other women comprised the normal group (T-score values above -1.0). The adjusted odds ratio showed the highest value for intervals between 24.0 and 25.9 units of BMI, and the lowest value for interval 26.0-27.9 units of BMI. The Youden index showed the lowest value in the 26.0-27.9BMI kg/m(2) interval. For our sample the optimal value of BMI, with the lowest risk of osteopenia and/or osteoporosis was the value of 26.9kg/m(2). A further increase of BMI does not result in a favourable effect on the bones, it rather intensifies negative phenomena in the body resulting in the onset of many diseases. Copyright © 2014. Published by Elsevier GmbH.

  11. BMI and waist circumference; cross-sectional and prospective associations with blood pressure and cholesterol in 12-year-olds.

    Directory of Open Access Journals (Sweden)

    Marga B M Bekkers

    Full Text Available OBJECTIVE: Childhood and adolescent overweight, defined by body mass index (BMI are associated with an increased risk of cardiovascular disease in later life. Abdominal adiposity may be more important in associations with cardiovascular diseases but waist circumference (WC has been rarely studied in children. We studied associations between BMI and WC and blood pressure (BP and cholesterol in 12-year-old children and prospectively changes in BMI or WC status between age 8 and 12 years and BP and cholesterol at age 12. STUDY DESIGN: Weight, height, WC, BP and cholesterol concentrations were measured in 1432 children at age 12 years. Linear regression was used to study the associations between high BMI and large WC (>90(th percentile and BP and cholesterol. RESULTS: Systolic BP was 4.9 mmHg higher (95% (CI 2.5, 7.2 in girls and 4.2 mmHg (95%CI 1.9, 6.5 in boys with a high BMI. Large WC was also associated with higher systolic BP in girls (3.7 mmHg (95%CI 1.3, 6.1 and boys (3.5 mmHg (95%CI 1.2, 5.8. Diastolic BP and cholesterol concentrations were significantly positively (HDL cholesterol negatively associated with high BMI and large WC, too. Normal weight children with a history of overweight did not have higher blood pressure levels or adverse cholesterol concentrations than children that were normal weight at both ages. CONCLUSION: A high BMI and large WC were associated with higher BP levels and adverse cholesterol concentrations. WC should be taken into account when examining cardiovascular risk factors in children.

  12. pH measurements of FET-based (bio)chemical sensors using portable measurement system.

    Science.gov (United States)

    Voitsekhivska, T; Zorgiebel, F; Suthau, E; Wolter, K-J; Bock, K; Cuniberti, G

    2015-01-01

    In this study we demonstrate the sensing capabilities of a portable multiplex measurement system for FET-based (bio)chemical sensors with an integrated microfluidic interface. We therefore conducted pH measurements with Silicon Nanoribbon FET-based Sensors using different measurement procedures that are suitable for various applications. We have shown multiplexed measurements in aqueous medium for three different modes that are mutually specialized in fast data acquisition (constant drain current), calibration-less sensing (constant gate voltage) and in providing full information content (sweeping mode). Our system therefore allows surface charge sensing for a wide range of applications and is easily adaptable for multiplexed sensing with novel FET-based (bio)chemical sensors.

  13. Analysis of rocket flight stability based on optical image measurement

    Science.gov (United States)

    Cui, Shuhua; Liu, Junhu; Shen, Si; Wang, Min; Liu, Jun

    2018-02-01

    Based on the abundant optical image measurement data from the optical measurement information, this paper puts forward the method of evaluating the rocket flight stability performance by using the measurement data of the characteristics of the carrier rocket in imaging. On the basis of the method of measuring the characteristics of the carrier rocket, the attitude parameters of the rocket body in the coordinate system are calculated by using the measurements data of multiple high-speed television sets, and then the parameters are transferred to the rocket body attack angle and it is assessed whether the rocket has a good flight stability flying with a small attack angle. The measurement method and the mathematical algorithm steps through the data processing test, where you can intuitively observe the rocket flight stability state, and also can visually identify the guidance system or failure analysis.

  14. Three-dimensional hindfoot alignment measurements based on biplanar radiographs: comparison with standard radiographic measurements

    International Nuclear Information System (INIS)

    Sutter, Reto; Pfirrmann, Christian W.A.; Buck, Florian M.; Espinosa, Norman

    2013-01-01

    To establish a hindfoot alignment measurement technique based on low-dose biplanar radiographs and compare with hindfoot alignment measurements on long axial view radiographs, which is the current reference standard. Long axial view radiographs and low-dose biplanar radiographs of a phantom consisting of a human foot skeleton embedded in acrylic glass (phantom A) and a plastic model of a human foot in three different hindfoot positions (phantoms B1-B3) were imaged in different foot positions (20 internal to 20 external rotation). Two independent readers measured hindfoot alignment on long axial view radiographs and performed 3D hindfoot alignment measurements based on biplanar radiographs on two different occasions. Time for three-dimensional (3D) measurements was determined. Intraclass correlation coefficients (ICC) were calculated. Hindfoot alignment measurements on long axial view radiographs were characterized by a large positional variation, with a range of 14 /13 valgus to 22 /27 varus (reader 1/2 for phantom A), whereas the range of 3D hindfoot alignment measurements was 7.3 /6.0 to 9.0 /10.5 varus (reader 1/2 for phantom A), with a mean and standard deviation of 8.1 ± 0.6/8.7 ± 1.4 respectively. Interobserver agreement was high (ICC = 0.926 for phantom A, and ICC = 0.886 for phantoms B1-B3), and agreement between different readouts was high (ICC = 0.895-0.995 for reader 1, and ICC = 0.987-0.994 for reader 2) for 3D measurements. Mean duration of 3D measurements was 84 ± 15/113 ± 15 s for reader 1/2. Three-dimensional hindfoot alignment measurements based on biplanar radiographs were independent of foot positioning during image acquisition and reader independent. In this phantom study, the 3D measurements were substantially more precise than the standard radiographic measurements. (orig.)

  15. A New Laser Based Approach for Measuring Atmospheric Greenhouse Gases

    Directory of Open Access Journals (Sweden)

    Jeremy Dobler

    2013-11-01

    Full Text Available In 2012, we developed a proof-of-concept system for a new open-path laser absorption spectrometer concept for measuring atmospheric CO2. The measurement approach utilizes high-reliability all-fiber-based, continuous-wave laser technology, along with a unique all-digital lock-in amplifier method that, together, enables simultaneous transmission and reception of multiple fixed wavelengths of light. This new technique, which utilizes very little transmitted energy relative to conventional lidar systems, provides high signal-to-noise (SNR measurements, even in the presence of a large background signal. This proof-of-concept system, tested in both a laboratory environment and a limited number of field experiments over path lengths of 680 m and 1,600 m, demonstrated SNR values >1,000 for received signals of ~18 picoWatts averaged over 60 s. A SNR of 1,000 is equivalent to a measurement precision of ±0.001 or ~0.4 ppmv. The measurement method is expected to provide new capability for automated monitoring of greenhouse gas at fixed sites, such as carbon sequestration facilities, volcanoes, the short- and long-term assessment of urban plumes, and other similar applications. In addition, this concept enables active measurements of column amounts from a geosynchronous orbit for a network of ground-based receivers/stations that would complement other current and planned space-based measurement capabilities.

  16. Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives

    International Nuclear Information System (INIS)

    Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.

    2008-01-01

    To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)

  17. State-Dependent Decoding Algorithms Improve the Performance of a Bidirectional BMI in Anesthetized Rats

    Directory of Open Access Journals (Sweden)

    Vito De Feo

    2017-05-01

    Full Text Available Brain-machine interfaces (BMIs promise to improve the quality of life of patients suffering from sensory and motor disabilities by creating a direct communication channel between the brain and the external world. Yet, their performance is currently limited by the relatively small amount of information that can be decoded from neural activity recorded form the brain. We have recently proposed that such decoding performance may be improved when using state-dependent decoding algorithms that predict and discount the large component of the trial-to-trial variability of neural activity which is due to the dependence of neural responses on the network's current internal state. Here we tested this idea by using a bidirectional BMI to investigate the gain in performance arising from using a state-dependent decoding algorithm. This BMI, implemented in anesthetized rats, controlled the movement of a dynamical system using neural activity decoded from motor cortex and fed back to the brain the dynamical system's position by electrically microstimulating somatosensory cortex. We found that using state-dependent algorithms that tracked the dynamics of ongoing activity led to an increase in the amount of information extracted form neural activity by 22%, with a consequently increase in all of the indices measuring the BMI's performance in controlling the dynamical system. This suggests that state-dependent decoding algorithms may be used to enhance BMIs at moderate computational cost.

  18. State-Dependent Decoding Algorithms Improve the Performance of a Bidirectional BMI in Anesthetized Rats.

    Science.gov (United States)

    De Feo, Vito; Boi, Fabio; Safaai, Houman; Onken, Arno; Panzeri, Stefano; Vato, Alessandro

    2017-01-01

    Brain-machine interfaces (BMIs) promise to improve the quality of life of patients suffering from sensory and motor disabilities by creating a direct communication channel between the brain and the external world. Yet, their performance is currently limited by the relatively small amount of information that can be decoded from neural activity recorded form the brain. We have recently proposed that such decoding performance may be improved when using state-dependent decoding algorithms that predict and discount the large component of the trial-to-trial variability of neural activity which is due to the dependence of neural responses on the network's current internal state. Here we tested this idea by using a bidirectional BMI to investigate the gain in performance arising from using a state-dependent decoding algorithm. This BMI, implemented in anesthetized rats, controlled the movement of a dynamical system using neural activity decoded from motor cortex and fed back to the brain the dynamical system's position by electrically microstimulating somatosensory cortex. We found that using state-dependent algorithms that tracked the dynamics of ongoing activity led to an increase in the amount of information extracted form neural activity by 22%, with a consequently increase in all of the indices measuring the BMI's performance in controlling the dynamical system. This suggests that state-dependent decoding algorithms may be used to enhance BMIs at moderate computational cost.

  19. Measures of Competitive Intensity – Analysis Based on Literature Review

    Directory of Open Access Journals (Sweden)

    Dariusz Kwieciński

    2017-03-01

    Full Text Available Purpose: To systematize the existing approaches and tools used for measuring competitive intensity. Methodology: Systematic literature review along with critical literature review. Findings: Identifcation of two main approaches to measuring competition intensity: the frst pertains to research based on experts’ opinions and involves the use of questionnaires (primary sources, while the second is based on structural variables used with a variety of indexes (secondary sources. In addition, variables applied for the purpose of measuring the intensity of competition are divided into structural and behavioural. Research implications: Research implications are two-fold. Firstly, a distinction is made between various types of existing approaches to measuring competitive intensity. Secondly, research is carried out, inter alia, with regard to the actual object of certain measures, as opposed to their object stemming from commonly accepted defnitions. Practical implications: The issue of measuring competition intensity occupies a prominent place in the discussion on the effectiveness of inter-organizational relationships. The fndings outlined in this paper may help managers to develop/adopt the right approach supporting their strategic decisions. Originality: The paper provides a complex review of the existing methods and measures of competitive intensity. It systematizes recent knowledge about competitive intensity measurements.

  20. Waist circumference is a better predictor of risk for frailty than BMI in the community-dwelling elderly in Beijing.

    Science.gov (United States)

    Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu

    2018-03-27

    Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.

  1. Maternal BMI and migration status as predictors of childhood obesity in Mexico.

    Science.gov (United States)

    Jiménez-Cruz, A; Wojcicki, J M; Bacardí-Gascón, M; Castellón-Zaragoza, A; García-Gallardo, J L; Schwartz, N; Heyman, M B

    2011-01-01

    To assess the association of maternal migration to Baja California, body mass index (BMI) status, children's perceived food insecurity, and childhood lifestyle behaviors with overweight (BMI > 85% ile), obesity (BMI > 95% ile) and abdominal obesity (Waist Circumference > 90% ile). Convenience sampling methods were used to recruit a cross-sectional sample of 4th, 5th and 6th grade children and their parents at Tijuana and Tecate Public Schools. Children's and parents' weights and heights were measured. Children were considered to have migrant parents if parents were not born in Baja California. One hundred and twenty-two children and their parents were recruited. The mean age of the children was 10.1 ± 1.0 years. Forty nine per cent of children were overweight or obese. Children with obese parents (BMI > 30) had greater odds of being obese, Odds Ratio (OR) 4.9 (95% Confidence Interval (CI), 1.2-19, p = 0.03). Children with migrant parents had greater odds of being obese, OR= 3.7 (95% CI, 1.6-8.3), p = 0.01) and of having abdominal obesity, OR = 3.2 (95% CI, 1.4-7.1, p = 0.01). Children from migrant parents have greater risk of higher consumption of potato chips, OR = 8.0 (95% CI, 2.1-29.1, p = 0.01). Children from non-migrant parents had greater odds of being at risk of hunger. Parental obesity and migration are associated with increased risk of obesity among Mexican children. Children whose parents were born in Baja California have greater odds of being at risk of hunger. Further studies should evaluate the role of migration on risk for childhood obesity.

  2. Body Size Estimation from Early to Middle Childhood: Stability of Underestimation, BMI, and Gender Effects

    Directory of Open Access Journals (Sweden)

    Silje Steinsbekk

    2017-11-01

    Full Text Available Individuals who are overweight are more likely to underestimate their body size than those who are normal weight, and overweight underestimators are less likely to engage in weight loss efforts. Underestimation of body size might represent a barrier to prevention and treatment of overweight; thus insight in how underestimation of body size develops and tracks through the childhood years is needed. The aim of the present study was therefore to examine stability in children’s underestimation of body size, exploring predictors of underestimation over time. The prospective path from underestimation to BMI was also tested. In a Norwegian cohort of 6 year olds, followed up at ages 8 and 10 (analysis sample: n = 793 body size estimation was captured by the Children’s Body Image Scale, height and weight were measured and BMI calculated. Overall, children were more likely to underestimate than overestimate their body size. Individual stability in underestimation was modest, but significant. Higher BMI predicted future underestimation, even when previous underestimation was adjusted for, but there was no evidence for the opposite direction of influence. Boys were more likely than girls to underestimate their body size at ages 8 and 10 (age 8: 38.0% vs. 24.1%; Age 10: 57.9% vs. 30.8% and showed a steeper increase in underestimation with age compared to girls. In conclusion, the majority of 6, 8, and 10-year olds correctly estimate their body size (prevalence ranging from 40 to 70% depending on age and gender, although a substantial portion perceived themselves to be thinner than they actually were. Higher BMI forecasted future underestimation, but underestimation did not increase the risk for excessive weight gain in middle childhood.

  3. Association of Rotating Night Shift Work with BMI and Abdominal Obesity among Nurses and Midwives.

    Science.gov (United States)

    Peplonska, Beata; Bukowska, Agnieszka; Sobala, Wojciech

    2015-01-01

    Mounting epidemiological evidence suggests that night shift work may contribute to the etiology of increased body weight. The present study aimed to examine association between rotating night shift work and body mass index (BMI), and abdominal adiposity respectively among nurses and midwives. A cross-sectional study was conducted among 724 female nurses and midwives, aged 40-60 years (354 rotating night shift and 370 daytime workers) in Łódź, Poland, between 2008 and 2011. Information about occupational history and potential confounders was collected during personal interviews. Anthropometric measurements of body weight, height, waist (WC) and hip (HC) circumference were made, and body mass index (BMI), waist to hip ratio (WHR) and waist to height ratio (WHtR) were calculated. GLM regression models and multinomial logit regression models were fitted to explore the association between night shift work and anthropometric parameters, with adjustment for age, body silhouette at age 20, current smoking status, packyears, marital status, and menopausal hormone therapy use. Cumulative night shift work showed significant associations with BMI, WC, HC and WHtR, with BMI increasing by 0.477 kg/m2 per 1000 night duties and by 0.432 kg/m2 per 10000 night shift hours, WC increasing respectively by 1.089 cm and 0.99 cm, and HC by 0.72 cm and WHtR by 0.007 cm for both metrics. Both current and cumulative night work was associated with obesity (BMI≥30kg/m2), with OR=3.9 (95%CI:1.5-9.9), in women reporting eight or more night shifts per month. The results of the study support the previously reported relations between night shift work and development of obesity.

  4. Biometric identification based on novel frequency domain facial asymmetry measures

    Science.gov (United States)

    Mitra, Sinjini; Savvides, Marios; Vijaya Kumar, B. V. K.

    2005-03-01

    In the modern world, the ever-growing need to ensure a system's security has spurred the growth of the newly emerging technology of biometric identification. The present paper introduces a novel set of facial biometrics based on quantified facial asymmetry measures in the frequency domain. In particular, we show that these biometrics work well for face images showing expression variations and have the potential to do so in presence of illumination variations as well. A comparison of the recognition rates with those obtained from spatial domain asymmetry measures based on raw intensity values suggests that the frequency domain representation is more robust to intra-personal distortions and is a novel approach for performing biometric identification. In addition, some feature analysis based on statistical methods comparing the asymmetry measures across different individuals and across different expressions is presented.

  5. Phase Difference Measurement Method Based on Progressive Phase Shift

    Directory of Open Access Journals (Sweden)

    Min Zhang

    2018-06-01

    Full Text Available This paper proposes a method for phase difference measurement based on the principle of progressive phase shift (PPS. A phase difference measurement system based on PPS and implemented in the FPGA chip is proposed and tested. In the realized system, a fully programmable delay line (PDL is constructed, which provides accurate and stable delay, benefitting from the feed-back structure of the control module. The control module calibrates the delay according to process, voltage and temperature (PVT variations. Furthermore, a modified method based on double PPS is incorporated to improve the resolution. The obtained resolution is 25 ps. Moreover, to improve the resolution, the proposed method is implemented on the 20 nm Xilinx Kintex Ultrascale platform, and test results indicate that the obtained measurement error and clock synchronization error is within the range of ±5 ps.

  6. Modern gas-based temperature and pressure measurements

    CERN Document Server

    Pavese, Franco

    2013-01-01

    This 2nd edition volume of Modern Gas-Based Temperature and Pressure Measurements follows the first publication in 1992. It collects a much larger set of information, reference data, and bibliography in temperature and pressure metrology of gaseous substances, including the physical-chemical issues related to gaseous substances. The book provides solutions to practical applications where gases are used in different thermodynamic conditions. Modern Gas-Based Temperature and Pressure Measurements, 2nd edition is the only comprehensive survey of methods for pressure measurement in gaseous media used in the medium-to-low pressure range closely connected with thermometry. It assembles current information on thermometry and manometry that involve the use of gaseous substances which are likely to be valid methods for the future. As such, it is an important resource for the researcher. This edition is updated through the very latest scientific and technical developments of gas-based temperature and pressure measurem...

  7. The effects of pre-pregnancy BMI and maternal factors on the timing of adiposity rebound in offspring.

    Science.gov (United States)

    Linares, Jeannette; Corvalán, Camila; Galleguillos, Bárbara; Kain, Juliana; González, Laura; Uauy, Ricardo; Garmendia, María Luisa; Mericq, Verónica

    2016-06-01

    To assess the effect of pre-pregnancy body mass index (BMI), gestational weight gain (GWG), and other maternal factors on the timing of adiposity rebound (AR). In this study, 594 mothers (mothers who do not have diabetes and not underweight) from the longitudinal Growth and Obesity Chilean Cohort Study self-reported their weights at the beginning and end of their pregnancies, and their heights were measured. Pre-pregnancy BMI was categorized as normal weight, overweight, or obesity, and GWG was assessed according to Institute of Medicine guidelines. For children, weight and height measurements from 0 to 3 years were retrieved from records, and they were measured from age 4 to 7 years. BMI curves from 0 to 7 years were used to estimate the age at AR, which was categorized as early (7 years). The associations between pre-pregnancy BMI and GWG and early AR were tested using logistic regression models. In total, 33% of the mothers had excess pre-pregnancy weight, 31.2% exceeded Institute of Medicine recommendations, and 45% of children had early AR. The pre-pregnancy BMI and parity were associated with earlier AR (OR = 1.07, 95% CI = 1.02-1.11; OR = 0.86; 95% CI = 0.74-0.99, respectively), but GWG was unrelated. These results suggest that preventive strategies for promoting normal pre-pregnancy BMI, especially in women's first pregnancies, could delay the timing of AR, with protective metabolic effects on offspring. © 2016 The Obesity Society.

  8. Generalized phase retrieval algorithm based on information measures

    OpenAIRE

    Shioya, Hiroyuki; Gohara, Kazutoshi

    2006-01-01

    An iterative phase retrieval algorithm based on the maximum entropy method (MEM) is presented. Introducing a new generalized information measure, we derive a novel class of algorithms which includes the conventionally used error reduction algorithm and a MEM-type iterative algorithm which is presented for the first time. These different phase retrieval methods are unified on the basis of the framework of information measures used in information theory.

  9. A web-based tool for ranking landslide mitigation measures

    Science.gov (United States)

    Lacasse, S.; Vaciago, G.; Choi, Y. J.; Kalsnes, B.

    2012-04-01

    As part of the research done in the European project SafeLand "Living with landslide risk in Europe: Assessment, effects of global change, and risk management strategies", a compendium of structural and non-structural mitigation measures for different landslide types in Europe was prepared, and the measures were assembled into a web-based "toolbox". Emphasis was placed on providing a rational and flexible framework applicable to existing and future mitigation measures. The purpose of web-based toolbox is to assist decision-making and to guide the user in the choice of the most appropriate mitigation measures. The mitigation measures were classified into three categories, describing whether the mitigation measures addressed the landslide hazard, the vulnerability or the elements at risk themselves. The measures considered include structural measures reducing hazard and non-structural mitigation measures, reducing either the hazard or the consequences (or vulnerability and exposure of elements at risk). The structural measures include surface protection and control of surface erosion; measures modifying the slope geometry and/or mass distribution; measures modifying surface water regime - surface drainage; measures mo¬difying groundwater regime - deep drainage; measured modifying the mechanical charac¬teristics of unstable mass; transfer of loads to more competent strata; retaining structures (to modify slope geometry and/or to transfer stress to compe¬tent layer); deviating the path of landslide debris; dissipating the energy of debris flows; and arresting and containing landslide debris or rock fall. The non-structural mitigation measures, reducing either the hazard or the consequences: early warning systems; restricting or discouraging construction activities; increasing resistance or coping capacity of elements at risk; relocation of elements at risk; sharing of risk through insurance. The measures are described in the toolbox with fact sheets providing a

  10. Predictive Software Measures based on Z Specifications - A Case Study

    Directory of Open Access Journals (Sweden)

    Andreas Bollin

    2012-07-01

    Full Text Available Estimating the effort and quality of a system is a critical step at the beginning of every software project. It is necessary to have reliable ways of calculating these measures, and, it is even better when the calculation can be done as early as possible in the development life-cycle. Having this in mind, metrics for formal specifications are examined with a view to correlations to complexity and quality-based code measures. A case study, based on a Z specification and its implementation in ADA, analyzes the practicability of these metrics as predictors.

  11. Portable audio electronics for impedance-based measurements in microfluidics

    International Nuclear Information System (INIS)

    Wood, Paul; Sinton, David

    2010-01-01

    We demonstrate the use of audio electronics-based signals to perform on-chip electrochemical measurements. Cell phones and portable music players are examples of consumer electronics that are easily operated and are ubiquitous worldwide. Audio output (play) and input (record) signals are voltage based and contain frequency and amplitude information. A cell phone, laptop soundcard and two compact audio players are compared with respect to frequency response; the laptop soundcard provides the most uniform frequency response, while the cell phone performance is found to be insufficient. The audio signals in the common portable music players and laptop soundcard operate in the range of 20 Hz to 20 kHz and are found to be applicable, as voltage input and output signals, to impedance-based electrochemical measurements in microfluidic systems. Validated impedance-based measurements of concentration (0.1–50 mM), flow rate (2–120 µL min −1 ) and particle detection (32 µm diameter) are demonstrated. The prevailing, lossless, wave audio file format is found to be suitable for data transmission to and from external sources, such as a centralized lab, and the cost of all hardware (in addition to audio devices) is ∼10 USD. The utility demonstrated here, in combination with the ubiquitous nature of portable audio electronics, presents new opportunities for impedance-based measurements in portable microfluidic systems. (technical note)

  12. Principal Component Analysis Based Measure of Structural Holes

    Science.gov (United States)

    Deng, Shiguo; Zhang, Wenqing; Yang, Huijie

    2013-02-01

    Based upon principal component analysis, a new measure called compressibility coefficient is proposed to evaluate structural holes in networks. This measure incorporates a new effect from identical patterns in networks. It is found that compressibility coefficient for Watts-Strogatz small-world networks increases monotonically with the rewiring probability and saturates to that for the corresponding shuffled networks. While compressibility coefficient for extended Barabasi-Albert scale-free networks decreases monotonically with the preferential effect and is significantly large compared with that for corresponding shuffled networks. This measure is helpful in diverse research fields to evaluate global efficiency of networks.

  13. Patch near field acoustic holography based on particle velocity measurements

    DEFF Research Database (Denmark)

    Zhang, Yong-Bin; Jacobsen, Finn; Bi, Chuan-Xing

    2009-01-01

    Patch near field acoustic holography (PNAH) based on sound pressure measurements makes it possible to reconstruct the source field near a source by measuring the sound pressure at positions on a surface. that is comparable in size to the source region of concern. Particle velocity is an alternative...... examines the use of particle velocity as the input of PNAH. Because the particle velocity decays faster toward the edges of the measurement aperture than the pressure does and because the wave number ratio that enters into the inverse propagator from pressure to velocity amplifies high spatial frequencies...

  14. Confidence bounds of recurrence-based complexity measures

    International Nuclear Information System (INIS)

    Schinkel, Stefan; Marwan, N.; Dimigen, O.; Kurths, J.

    2009-01-01

    In the recent past, recurrence quantification analysis (RQA) has gained an increasing interest in various research areas. The complexity measures the RQA provides have been useful in describing and analysing a broad range of data. It is known to be rather robust to noise and nonstationarities. Yet, one key question in empirical research concerns the confidence bounds of measured data. In the present Letter we suggest a method for estimating the confidence bounds of recurrence-based complexity measures. We study the applicability of the suggested method with model and real-life data.

  15. Bread Water Content Measurement Based on Hyperspectral Imaging

    DEFF Research Database (Denmark)

    Liu, Zhi; Møller, Flemming

    2011-01-01

    Water content is one of the most important properties of the bread for tasting assesment or store monitoring. Traditional bread water content measurement methods mostly are processed manually, which is destructive and time consuming. This paper proposes an automated water content measurement...... for bread quality based on near-infrared hyperspectral imaging against the conventional manual loss-in-weight method. For this purpose, the hyperspectral components unmixing technology is used for measuring the water content quantitatively. And the definition on bread water content index is presented...

  16. Tethered balloon-based measurements of meteorological variables and aerosols

    Science.gov (United States)

    Sentell, R. J.; Storey, R. W.; Chang, J. J. C.; Jacobsen, S. J.

    1976-01-01

    Tethered balloon based measurements of the vertical distributions of temperature, humidity, wind speed, and aerosol concentrations were taken over a 4-hour period beginning at sunrise on June 29, 1976, at Wallops Island, Virginia. Twelve consecutive profiles of each variable were obtained from ground to about 500 meters. These measurements were in conjuction with a noise propagation study on remotely arrayed acoustic range (ROMAAR) at Wallops Flight Center. An organized listing of these vertical soundings is presented. The tethered balloon system configuration utilized for these measurements is described.

  17. Image based method for aberration measurement of lithographic tools

    Science.gov (United States)

    Xu, Shuang; Tao, Bo; Guo, Yongxing; Li, Gongfa

    2018-01-01

    Information of lens aberration of lithographic tools is important as it directly affects the intensity distribution in the image plane. Zernike polynomials are commonly used for a mathematical description of lens aberrations. Due to the advantage of lower cost and easier implementation of tools, image based measurement techniques have been widely used. Lithographic tools are typically partially coherent systems that can be described by a bilinear model, which entails time consuming calculations and does not lend a simple and intuitive relationship between lens aberrations and the resulted images. Previous methods for retrieving lens aberrations in such partially coherent systems involve through-focus image measurements and time-consuming iterative algorithms. In this work, we propose a method for aberration measurement in lithographic tools, which only requires measuring two images of intensity distribution. Two linear formulations are derived in matrix forms that directly relate the measured images to the unknown Zernike coefficients. Consequently, an efficient non-iterative solution is obtained.

  18. A complex network-based importance measure for mechatronics systems

    Science.gov (United States)

    Wang, Yanhui; Bi, Lifeng; Lin, Shuai; Li, Man; Shi, Hao

    2017-01-01

    In view of the negative impact of functional dependency, this paper attempts to provide an alternative importance measure called Improved-PageRank (IPR) for measuring the importance of components in mechatronics systems. IPR is a meaningful extension of the centrality measures in complex network, which considers usage reliability of components and functional dependency between components to increase importance measures usefulness. Our work makes two important contributions. First, this paper integrates the literature of mechatronic architecture and complex networks theory to define component network. Second, based on the notion of component network, a meaningful IPR is brought into the identifying of important components. In addition, the IPR component importance measures, and an algorithm to perform stochastic ordering of components due to the time-varying nature of usage reliability of components and functional dependency between components, are illustrated with a component network of bogie system that consists of 27 components.

  19. Drone based measurement system for radiofrequency exposure assessment.

    Science.gov (United States)

    Joseph, Wout; Aerts, Sam; Vandenbossche, Matthias; Thielens, Arno; Martens, Luc

    2016-03-10

    For the first time, a method to assess radiofrequency (RF) electromagnetic field (EMF) exposure of the general public in real environments with a true free-space antenna system is presented. Using lightweight electronics and multiple antennas placed on a drone, it is possible to perform exposure measurements. This technique will enable researchers to measure three-dimensional RF-EMF exposure patterns accurately in the future and at locations currently difficult to access. A measurement procedure and appropriate measurement settings have been developed. As an application, outdoor measurements are performed as a function of height up to 60 m for Global System for Mobile Communications (GSM) 900 MHz base station exposure. Bioelectromagnetics. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. Forecasting method in multilateration accuracy based on laser tracker measurement

    International Nuclear Information System (INIS)

    Aguado, Sergio; Santolaria, Jorge; Samper, David; José Aguilar, Juan

    2017-01-01

    Multilateration based on a laser tracker (LT) requires the measurement of a set of points from three or more positions. Although the LTs’ angular information is not used, multilateration produces a volume of measurement uncertainty. This paper presents two new coefficients from which to determine whether the measurement of a set of points, before performing the necessary measurements, will improve or worsen the accuracy of the multilateration results, avoiding unnecessary measurement, and reducing the time and economic cost required. The first specific coefficient measurement coefficient (MC LT ) is unique for each laser tracker. It determines the relationship between the radial and angular laser tracker measurement noise. Similarly, the second coefficient is related with specific conditions of measurement β . It is related with the spatial angle between the laser tracker positions α and its effect on error reduction. Both parameters MC LT and β are linked in error reduction limits. Beside these, a new methodology to determine the multilateration reduction limit according to the multilateration technique of an ideal laser tracker distribution and a random one are presented. It provides general rules and advice from synthetic tests that are validated through a real test carried out in a coordinate measurement machine. (paper)

  1. Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

    Science.gov (United States)

    Noahsen, Paneeraq; Andersen, Stig

    2013-01-01

    To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

  2. High-Resolution Genome-Wide Linkage Mapping Identifies Susceptibility Loci for BMI in the Chinese Population

    DEFF Research Database (Denmark)

    Zhang, Dong Feng; Pang, Zengchang; Li, Shuxia

    2012-01-01

    The genetic loci affecting the commonly used BMI have been intensively investigated using linkage approaches in multiple populations. This study aims at performing the first genome-wide linkage scan on BMI in the Chinese population in mainland China with hypothesis that heterogeneity in genetic...... linkage could exist in different ethnic populations. BMI was measured from 126 dizygotic twins in Qingdao municipality who were genotyped using high-resolution Affymetrix Genome-Wide Human SNP arrays containing about 1 million single-nucleotide polymorphisms (SNPs). Nonparametric linkage analysis...... in western countries. Multiple loci showing suggestive linkage were found on chromosome 1 (lod score 2.38 at 242 cM), chromosome 8 (2.48 at 95 cM), and chromosome 14 (2.2 at 89.4 cM). The strong linkage identified in the Chinese subjects that is consistent with that found in populations of European origin...

  3. Measurement channel of neutron flow based on software

    International Nuclear Information System (INIS)

    Rivero G, T.; Benitez R, J. S.

    2008-01-01

    The measurement of the thermal power in nuclear reactors is based mainly on the measurement of the neutron flow. The presence of these in the reactor core is associated to neutrons released by the fission reaction of the uranium-235. Once moderate, these neutrons are precursors of new fissions. This process it is known like chain reaction. Thus, the power to which works a nuclear reactor, he is proportional to the number of produced fissions and as these depend on released neutrons, also the power is proportional to the number of present neutrons. The measurement of the thermal power in a reactor is realized with called instruments nuclear channels. To low power (level source), these channels measure the individual counts of detected neutrons, whereas to a medium and high power, they measure the electrical current or fluctuation of the same one that generate the fission neutrons in ionization chambers especially designed to detect neutrons. For the case of TRIGA reactors, the measurement channels of neutron flow use discreet digital electronic technology makes some decades already. Recently new technological tools have arisen that allow developing new versions of nuclear channels of simple form and compacts. The present work consists of the development of a nuclear channel for TRIGA reactors based on the use of the correlated signal of a fission chamber for ample interval. This new measurement channel uses a data acquisition card of high speed and the data processing by software that to the being installed in a computer is created a virtual instrument, with what spreads in real time, in graphic and understandable form for the operator, the power indication to which it operates the nuclear reactor. This system when being based on software, offers a major versatility to realize changes in the signal processing and power monitoring algorithms. The experimental tests of neutronic power measurement show a reliable performance through seven decades of power, with a

  4. Waist circumference, BMI, and lung function in 8-year-old children : The PIAMA birth cohort study

    NARCIS (Netherlands)

    Bekkers, Marga B. M.; Wijga, Alet H.; de Jongste, Johan C.; Kerkhof, Marjan; Postma, Dirkje; Gehring, Ulrike; Smit, Henriette A.; Brunekreef, Bert

    Background Body mass index (BMI) and waist circumference (WC) may be associated with lung function in children, as observed in adults. Methods Height, weight, waist circumference, and lung function (FVC and FEV1) were measured during a medical examination in 1,058 eight-year-old children

  5. Dairy shows different associations with abdominal and BMI-defined overweight: Cross-sectional analyses exploring a variety of dairy products.

    Science.gov (United States)

    Brouwer-Brolsma, E M; Sluik, D; Singh-Povel, C M; Feskens, E J M

    2018-05-01

    Previous studies have suggested weight-regulatory properties for several dairy nutrients, but population-based studies on dairy and body weight are inconclusive. We explored cross-sectional associations between dairy consumption and indicators of overweight. We included 114,682 Dutch adults, aged ≥18 years. Dairy consumption was quantified by a food frequency questionnaire. Abdominal overweight was defined as waist circumference (WC) ≥88 cm (women) or ≥102 cm (men) (n = 37,391), overweight as BMI ≥25-30 kg/m 2 (n = 44,772) and obesity as BMI ≥30 kg/m 2 (n = 15,339). Associations were quantified by logistic (abdominal overweight, no/yes), multinomial logistic (BMI-defined overweight and obesity) and linear regression analyses (continuous measures of WC and BMI), and they were adjusted for relevant covariates. Total dairy showed a positive association with abdominal overweight (OR Q1 ref vs. Q5: 1.09; 95% CI: 1.04-1.14) and with BMI-defined overweight (OR Q5 1.13; 95% CI: 1.08-1.18) and obesity (OR Q5 1.09; 95% CI: 1.02-1.16). Skimmed, semi-skimmed and non-fermented dairy also showed positive associations with overweight categories. Full-fat dairy showed an inverse association with overweight and obesity (OR Q5 for obesity: 0.78; 95% CI: 0.73-0.83). Moreover, inverse associations were observed for yoghurt and custard and positive associations for milk, buttermilk, flavoured yoghurt drinks, cheese and cheese snacks. Fermented dairy, curd cheese and Dutch cheese did not show a consistent association with overweight categories. Total, skimmed, semi-skimmed and non-fermented dairy; milk; buttermilk; flavoured yoghurt drinks; total cheese and cheese snacks showed a positive association with overweight categories, whereas full-fat dairy, custard and yoghurt showed an inverse association with overweight categories. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human

  6. Social class differences in BMI among Danish women: applying Cockerham's health lifestyles approach and Bourdieu's theory of lifestyle.

    Science.gov (United States)

    Christensen, Vibeke T; Carpiano, Richard M

    2014-07-01

    Research on social class differences in obesity and weight-related outcomes has highlighted the need to consider how such class differences reflect the unequally distributed constellations of economic, cultural, and social resources that enable and constrain health-related habits and practices or health lifestyles. Motivated by this need, the present study applies a theoretical perspective that integrates Cockerham's (2005) health lifestyles theory with Bourdieu's (1984) theoretical scholarship on social class, lifestyles, and the body to analyzing class-based differences in body mass index (BMI) among adult female respondents of a 2007 Danish national survey (n = 1376). We test hypotheses concerning how respective levels of economic, cultural, and social capital that constitute women's social class membership are associated with BMI directly and via their influence on respondent's dietary-related values, preferences, behaviors, and exercise activities. Our analyses indicate that cultural and economic capital were both directly associated with BMI. Mediation analyses revealed that greater cultural and social capital were linked to higher BMI via interest in cooking; while all three forms of capital were associated with lower BMI via greater frequency of exercise. These findings provide evidence for the many-and sometimes contradictory-ways that social class can influence body weight. Identifying such patterns can inform the design of more effective population health interventions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Integrated method for the measurement of trace nitrogenous atmospheric bases

    Directory of Open Access Journals (Sweden)

    D. Key

    2011-12-01

    Full Text Available Nitrogenous atmospheric bases are thought to play a key role in the global nitrogen cycle, but their sources, transport, and sinks remain poorly understood. Of the many methods available to measure such compounds in ambient air, few meet the current need of being applicable to the complete range of potential analytes and fewer still are convenient to implement using instrumentation that is standard to most laboratories. In this work, an integrated approach to measuring trace, atmospheric, gaseous nitrogenous bases has been developed and validated. The method uses a simple acid scrubbing step to capture and concentrate the bases as their phosphite salts, which then are derivatized and analyzed using GC/MS and/or LC/MS. The advantages of both techniques in the context of the present measurements are discussed. The approach is sensitive, selective, reproducible, as well as convenient to implement and has been validated for different sampling strategies. The limits of detection for the families of tested compounds are suitable for ambient measurement applications (e.g., methylamine, 1 pptv; ethylamine, 2 pptv; morpholine, 1 pptv; aniline, 1 pptv; hydrazine, 0.1 pptv; methylhydrazine, 2 pptv, as supported by field measurements in an urban park and in the exhaust of on-road vehicles.

  8. Resource management in Diffserv measurement-based admission control PHR

    NARCIS (Netherlands)

    Westberg, L.; Heijenk, Geert; Karagiannis, Georgios; Oosthoek, S.; Partain, D.; Rexhepi, Vlora; Szabo, R.; Wallentin, P.; El Allali, H.

    2002-01-01

    The purpose of this draft is to present the Resource Management in Diffserv (RMD) Measurement-Based Admission Control (RIMA) Per Hop Reservation (PHR) protocol. The RIMA PHR protocol is used on a per-hop basis in a Differentiated Services (Diffserv) domain and extends the Diffserv Per Hop Behavior

  9. Assessing Children's Writing Products: The Role of Curriculum Based Measures

    Science.gov (United States)

    Dockrell, Julie E.; Connelly, Vincent; Walter, Kirsty; Critten, Sarah

    2015-01-01

    The assessment of children's writing raises technical and practical challenges. In this paper we examine the potential use of a curriculum based measure for writing (CBM-W) to assess the written texts of pupils in Key Stage 2 (M age 107 months, range 88 to 125). Two hundred and thirty six Year three, five and six pupils completed a standardized…

  10. Hydrogel-based sensor for CO2 measurements

    NARCIS (Netherlands)

    Herber, S.; Olthuis, Wouter; Bergveld, Piet; van den Berg, Albert

    2004-01-01

    A hydrogel-based sensor is presented for CO2 measurements. The sensor consists of a pressure sensor and porous silicon cover. A pH-sensitive hydrogel is confined between the two parts. Furthermore the porous cover contains a bicarbonate solution and a gaspermeable membrane. CO2 reacts with the

  11. Functional Size Measurement applied to UML-based user requirements

    NARCIS (Netherlands)

    van den Berg, Klaas; Dekkers, Ton; Oudshoorn, Rogier; Dekkers, T.

    There is a growing interest in applying standardized methods for Functional Size Measurement (FSM) to Functional User Requirements (FUR) based on models in the Unified Modelling Language (UML). No consensus exists on this issue. We analyzed the demands that FSM places on FURs. We propose a

  12. Noninvasive microbubble-based pressure measurements: a simulation study

    NARCIS (Netherlands)

    Postema, Michiel; Postema, M.A.B.; Bouakaz, Ayache; de Jong, N.

    2004-01-01

    This paper describes a noninvasive method to measure local hydrostatic pressures in fluid filled cavities. The method is based on the disappearance time of a gas bubble, as the disappearance time is related to the hydrostatic pressure. When a bubble shrinks, its response to ultrasound changes. From

  13. Metrology of human-based and other qualitative measurements

    Science.gov (United States)

    Pendrill, Leslie; Petersson, Niclas

    2016-09-01

    The metrology of human-based and other qualitative measurements is in its infancy—concepts such as traceability and uncertainty are as yet poorly developed. This paper reviews how a measurement system analysis approach, particularly invoking as performance metric the ability of a probe (such as a human being) acting as a measurement instrument to make a successful decision, can enable a more general metrological treatment of qualitative observations. Measures based on human observations are typically qualitative, not only in sectors, such as health care, services and safety, where the human factor is obvious, but also in customer perception of traditional products of all kinds. A principal challenge is that the usual tools of statistics normally employed for expressing measurement accuracy and uncertainty will probably not work reliably if relations between distances on different portions of scales are not fully known, as is typical of ordinal or other qualitative measurements. A key enabling insight is to connect the treatment of decision risks associated with measurement uncertainty to generalized linear modelling (GLM). Handling qualitative observations in this way unites information theory, the perceptive identification and choice paradigms of psychophysics. The Rasch invariant measure psychometric GLM approach in particular enables a proper treatment of ordinal data; a clear separation of probe and item attribute estimates; simple expressions for instrument sensitivity; etc. Examples include two aspects of the care of breast cancer patients, from diagnosis to rehabilitation. The Rasch approach leads in turn to opportunities of establishing metrological references for quality assurance of qualitative measurements. In psychometrics, one could imagine a certified reference for knowledge challenge, for example, a particular concept in understanding physics or for product quality of a certain health care service. Multivariate methods, such as Principal Component

  14. Metrology of human-based and other qualitative measurements

    International Nuclear Information System (INIS)

    Pendrill, Leslie; Petersson, Niclas

    2016-01-01

    The metrology of human-based and other qualitative measurements is in its infancy—concepts such as traceability and uncertainty are as yet poorly developed. This paper reviews how a measurement system analysis approach, particularly invoking as performance metric the ability of a probe (such as a human being) acting as a measurement instrument to make a successful decision, can enable a more general metrological treatment of qualitative observations. Measures based on human observations are typically qualitative, not only in sectors, such as health care, services and safety, where the human factor is obvious, but also in customer perception of traditional products of all kinds. A principal challenge is that the usual tools of statistics normally employed for expressing measurement accuracy and uncertainty will probably not work reliably if relations between distances on different portions of scales are not fully known, as is typical of ordinal or other qualitative measurements. A key enabling insight is to connect the treatment of decision risks associated with measurement uncertainty to generalized linear modelling (GLM). Handling qualitative observations in this way unites information theory, the perceptive identification and choice paradigms of psychophysics. The Rasch invariant measure psychometric GLM approach in particular enables a proper treatment of ordinal data; a clear separation of probe and item attribute estimates; simple expressions for instrument sensitivity; etc. Examples include two aspects of the care of breast cancer patients, from diagnosis to rehabilitation. The Rasch approach leads in turn to opportunities of establishing metrological references for quality assurance of qualitative measurements. In psychometrics, one could imagine a certified reference for knowledge challenge, for example, a particular concept in understanding physics or for product quality of a certain health care service. Multivariate methods, such as Principal Component

  15. Depth Measurement Based on Infrared Coded Structured Light

    Directory of Open Access Journals (Sweden)

    Tong Jia

    2014-01-01

    Full Text Available Depth measurement is a challenging problem in computer vision research. In this study, we first design a new grid pattern and develop a sequence coding and decoding algorithm to process the pattern. Second, we propose a linear fitting algorithm to derive the linear relationship between the object depth and pixel shift. Third, we obtain depth information on an object based on this linear relationship. Moreover, 3D reconstruction is implemented based on Delaunay triangulation algorithm. Finally, we utilize the regularity of the error curves to correct the system errors and improve the measurement accuracy. The experimental results show that the accuracy of depth measurement is related to the step length of moving object.

  16. Visual Peoplemeter: A Vision-based Television Audience Measurement System

    Directory of Open Access Journals (Sweden)

    SKELIN, A. K.

    2014-11-01

    Full Text Available Visual peoplemeter is a vision-based measurement system that objectively evaluates the attentive behavior for TV audience rating, thus offering solution to some of drawbacks of current manual logging peoplemeters. In this paper, some limitations of current audience measurement system are reviewed and a novel vision-based system aiming at passive metering of viewers is prototyped. The system uses camera mounted on a television as a sensing modality and applies advanced computer vision algorithms to detect and track a person, and to recognize attentional states. Feasibility of the system is evaluated on a secondary dataset. The results show that the proposed system can analyze viewer's attentive behavior, therefore enabling passive estimates of relevant audience measurement categories.

  17. Observer-based Coal Mill Control using Oxygen Measurements

    DEFF Research Database (Denmark)

    Andersen, Palle; Bendtsen, Jan Dimon; S., Tom

    2006-01-01

    This paper proposes a novel approach to coal flow estimation in pulverized coal mills, which utilizes measurements of oxygen content in the flue gas. Pulverized coal mills are typically not equipped with sensors that detect the amount of coal injected into the furnace. This makes control...... of the coal flow difficult, causing stability problems and limits the plant's load following capabilities. To alleviate this problem without having to rely on expensive flow measurement equipment, a novel observer-based approach is investigated. A Kalman filter based on measurements of combustion air flow led...... into the furnace and oxygen concentration in the flue gas is designed to estimate the actual coal flow injected into the furnace. With this estimate, it becomes possible to close an inner loop around the coal mill itself, thus giving a better disturbance rejection capability. The approach is validated against...

  18. Microcontroller Power Consumption Measurement Based on PSoC

    Directory of Open Access Journals (Sweden)

    S. P. Janković

    2016-06-01

    Full Text Available Microcontrollers are often used as central processing elements in embedded systems. Because of different sleep and performance modes that microcontrollers support, their power consumption may have a high dynamic range, over 100 dB. In this paper, a data acquisition (DAQ system for measuring and analyzing the power consumption of microcontrollers is presented. DAQ system consists of a current measurement circuit using potentiostat technique, a DAQ device based on system on chip PSoC 5LP and Python PC program for the analysis, storage and visualization of measured data. Both Successive Approximation Register (SAR and Delta-Sigma (DS ADCs contained in the PSoC 5LP are used for measuring voltage drop across the shunt resistor. SAR ADC samples data at a 10 times higher rate than DS ADC, so the input range of DS ADC can be adjusted based on data measured by SAR ADC, thus enabling the extension of current measuring range by 28%. Implemented DAQ device is connected with a computer through a USB port and tested with developed Python PC program.

  19. ICF-based classification and measurement of functioning.

    Science.gov (United States)

    Stucki, G; Kostanjsek, N; Ustün, B; Cieza, A

    2008-09-01

    If we aim towards a comprehensive understanding of human functioning and the development of comprehensive programs to optimize functioning of individuals and populations we need to develop suitable measures. The approval of the International Classification, Disability and Health (ICF) in 2001 by the 54th World Health Assembly as the first universally shared model and classification of functioning, disability and health marks, therefore an important step in the development of measurement instruments and ultimately for our understanding of functioning, disability and health. The acceptance and use of the ICF as a reference framework and classification has been facilitated by its development in a worldwide, comprehensive consensus process and the increasing evidence regarding its validity. However, the broad acceptance and use of the ICF as a reference framework and classification will also depend on the resolution of conceptual and methodological challenges relevant for the classification and measurement of functioning. This paper therefore describes first how the ICF categories can serve as building blocks for the measurement of functioning and then the current state of the development of ICF based practical tools and international standards such as the ICF Core Sets. Finally it illustrates how to map the world of measures to the ICF and vice versa and the methodological principles relevant for the transformation of information obtained with a clinical test or a patient-oriented instrument to the ICF as well as the development of ICF-based clinical and self-reported measurement instruments.

  20. Computer Vision Based Measurement of Wildfire Smoke Dynamics

    Directory of Open Access Journals (Sweden)

    BUGARIC, M.

    2015-02-01

    Full Text Available This article presents a novel method for measurement of wildfire smoke dynamics based on computer vision and augmented reality techniques. The aspect of smoke dynamics is an important feature in video smoke detection that could distinguish smoke from visually similar phenomena. However, most of the existing smoke detection systems are not capable of measuring the real-world size of the detected smoke regions. Using computer vision and GIS-based augmented reality, we measure the real dimensions of smoke plumes, and observe the change in size over time. The measurements are performed on offline video data with known camera parameters and location. The observed data is analyzed in order to create a classifier that could be used to eliminate certain categories of false alarms induced by phenomena with different dynamics than smoke. We carried out an offline evaluation where we measured the improvement in the detection process achieved using the proposed smoke dynamics characteristics. The results show a significant increase in algorithm performance, especially in terms of reducing false alarms rate. From this it follows that the proposed method for measurement of smoke dynamics could be used to improve existing smoke detection algorithms, or taken into account when designing new ones.

  1. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  2. Event- and interval-based measurement of stuttering: a review.

    Science.gov (United States)

    Valente, Ana Rita S; Jesus, Luis M T; Hall, Andreia; Leahy, Margaret

    2015-01-01

    Event- and interval-based measurements are two different ways of computing frequency of stuttering. Interval-based methodology emerged as an alternative measure to overcome problems associated with reproducibility in the event-based methodology. No review has been made to study the effect of methodological factors in interval-based absolute reliability data or to compute the agreement between the two methodologies in terms of inter-judge, intra-judge and accuracy (i.e., correspondence between raters' scores and an established criterion). To provide a review related to reproducibility of event-based and time-interval measurement, and to verify the effect of methodological factors (training, experience, interval duration, sample presentation order and judgment conditions) on agreement of time-interval measurement; in addition, to determine if it is possible to quantify the agreement between the two methodologies The first two authors searched for articles on ERIC, MEDLINE, PubMed, B-on, CENTRAL and Dissertation Abstracts during January-February 2013 and retrieved 495 articles. Forty-eight articles were selected for review. Content tables were constructed with the main findings. Articles related to event-based measurements revealed values of inter- and intra-judge greater than 0.70 and agreement percentages beyond 80%. The articles related to time-interval measures revealed that, in general, judges with more experience with stuttering presented significantly higher levels of intra- and inter-judge agreement. Inter- and intra-judge values were beyond the references for high reproducibility values for both methodologies. Accuracy (regarding the closeness of raters' judgements with an established criterion), intra- and inter-judge agreement were higher for trained groups when compared with non-trained groups. Sample presentation order and audio/video conditions did not result in differences in inter- or intra-judge results. A duration of 5 s for an interval appears to be

  3. [Training cortical signals by means of a BMI-EEG system, its evolution and intervention. A case report].

    Science.gov (United States)

    Monge-Pereira, E; Casatorres Perez-Higueras, I; Fernandez-Gonzalez, P; Ibanez-Pereda, J; Serrano, J I; Molina-Rueda, F

    2017-04-16

    In the last years, new technologies such as the brain-machine interfaces (BMI) have been incorporated in the rehabilitation process of subjects with stroke. These systems are able to detect motion intention, analyzing the cortical signals using different techniques such as the electroencephalography (EEG). This information could guide different interfaces such as robotic devices, electrical stimulation or virtual reality. A 40 years-old man with stroke with two months from the injury participated in this study. We used a BMI based on EEG. The subject's motion intention was analyzed calculating the event-related desynchronization. The upper limb motor function was evaluated with the Fugl-Meyer Assessment and the participant's satisfaction was evaluated using the QUEST 2.0. The intervention using a physical therapist as an interface was carried out without difficulty. The BMI systems detect cortical changes in a subacute stroke subject. These changes are coherent with the evolution observed using the Fugl-Meyer Assessment.

  4. A measurement-based performability model for a multiprocessor system

    Science.gov (United States)

    Ilsueh, M. C.; Iyer, Ravi K.; Trivedi, K. S.

    1987-01-01

    A measurement-based performability model based on real error-data collected on a multiprocessor system is described. Model development from the raw errror-data to the estimation of cumulative reward is described. Both normal and failure behavior of the system are characterized. The measured data show that the holding times in key operational and failure states are not simple exponential and that semi-Markov process is necessary to model the system behavior. A reward function, based on the service rate and the error rate in each state, is then defined in order to estimate the performability of the system and to depict the cost of different failure types and recovery procedures.

  5. The Trend of Mean BMI Values of US Adults, Birth Cohorts 1882-1986 Indicates that the Obesity Epidemic Began Earlier than Hitherto Thought

    OpenAIRE

    John Komlos; Marek Brabec

    2010-01-01

    The trend in the BMI values of the US population has not been estimated accurately because time series data are unavailable and because the focus has been on calculating period effects. In contrast to the prevailing strategies, we estimate the trend and rate of change of BMI values by birth cohorts stratified by gender and ethnicity born 1882-1986. We use loess additive regression models to estimate age and trend effects of BMI values of US-born black and white adults measured between 1959 an...

  6. An Energy-Based Similarity Measure for Time Series

    Directory of Open Access Journals (Sweden)

    Pierre Brunagel

    2007-11-01

    Full Text Available A new similarity measure, called SimilB, for time series analysis, based on the cross-ΨB-energy operator (2004, is introduced. ΨB is a nonlinear measure which quantifies the interaction between two time series. Compared to Euclidean distance (ED or the Pearson correlation coefficient (CC, SimilB includes the temporal information and relative changes of the time series using the first and second derivatives of the time series. SimilB is well suited for both nonstationary and stationary time series and particularly those presenting discontinuities. Some new properties of ΨB are presented. Particularly, we show that ΨB as similarity measure is robust to both scale and time shift. SimilB is illustrated with synthetic time series and an artificial dataset and compared to the CC and the ED measures.

  7. Temperature measuring system based on ADuC812 MCU

    International Nuclear Information System (INIS)

    Zhou Dongmei; Ge Liangquan; Cheng Feng; Li Jinfeng

    2009-01-01

    This paper introduces a temperature measuring system which is composed of a single chip microcomputer ADuC812, new type digital temperature sensor TMP100,LED display circuit and based on I 2 C bus. I 2 C bus which is invented by PHILIPS company needs only two signal lines (SDA, SCL), can realized perfect duplex synchronous data transmission. Using the method of hardware setting of device address, can completely avoid the disadvantages of device selection addressing, thus can make hardware system has simplifier and more flexible extension method. The key part of the system is composed of a single chip microcomputer ADuC812 which is compatible with MCS-51 and is invented by AD company in america. The software is compiled with 8051 assembly language. The data acquisitin single chip microcomputer measurement system with I 2 C bus fully shows the features of flexibility, precise and high integration. Proposed high accuracy measurement method to realize environment temperature measure. (authors)

  8. Towards minimal resources of measurement-based quantum computation

    International Nuclear Information System (INIS)

    Perdrix, Simon

    2007-01-01

    We improve the upper bound on the minimal resources required for measurement-only quantum computation (M A Nielsen 2003 Phys. Rev. A 308 96-100; D W Leung 2004 Int. J. Quantum Inform. 2 33; S Perdrix 2005 Int. J. Quantum Inform. 3 219-23). Minimizing the resources required for this model is a key issue for experimental realization of a quantum computer based on projective measurements. This new upper bound also allows one to reply in the negative to the open question presented by Perdrix (2004 Proc. Quantum Communication Measurement and Computing) about the existence of a trade-off between observable and ancillary qubits in measurement-only QC

  9. High Precision Infrared Temperature Measurement System Based on Distance Compensation

    Directory of Open Access Journals (Sweden)

    Chen Jing

    2017-01-01

    Full Text Available To meet the need of real-time remote monitoring of human body surface temperature for optical rehabilitation therapy, a non-contact high-precision real-time temperature measurement method based on distance compensation was proposed, and the system design was carried out. The microcontroller controls the infrared temperature measurement module and the laser range module to collect temperature and distance data. The compensation formula of temperature with distance wass fitted according to the least square method. Testing had been performed on different individuals to verify the accuracy of the system. The results indicate that the designed non-contact infrared temperature measurement system has a residual error of less than 0.2°C and the response time isless than 0.1s in the range of 0 to 60cm. This provides a reference for developing long-distance temperature measurement equipment in optical rehabilitation therapy.

  10. Measurable realistic image-based 3D mapping

    Science.gov (United States)

    Liu, W.; Wang, J.; Wang, J. J.; Ding, W.; Almagbile, A.

    2011-12-01

    Maps with 3D visual models are becoming a remarkable feature of 3D map services. High-resolution image data is obtained for the construction of 3D visualized models.The3D map not only provides the capabilities of 3D measurements and knowledge mining, but also provides the virtual experienceof places of interest, such as demonstrated in the Google Earth. Applications of 3D maps are expanding into the areas of architecture, property management, and urban environment monitoring. However, the reconstruction of high quality 3D models is time consuming, and requires robust hardware and powerful software to handle the enormous amount of data. This is especially for automatic implementation of 3D models and the representation of complicated surfacesthat still need improvements with in the visualisation techniques. The shortcoming of 3D model-based maps is the limitation of detailed coverage since a user can only view and measure objects that are already modelled in the virtual environment. This paper proposes and demonstrates a 3D map concept that is realistic and image-based, that enables geometric measurements and geo-location services. Additionally, image-based 3D maps provide more detailed information of the real world than 3D model-based maps. The image-based 3D maps use geo-referenced stereo images or panoramic images. The geometric relationships between objects in the images can be resolved from the geometric model of stereo images. The panoramic function makes 3D maps more interactive with users but also creates an interesting immersive circumstance. Actually, unmeasurable image-based 3D maps already exist, such as Google street view, but only provide virtual experiences in terms of photos. The topographic and terrain attributes, such as shapes and heights though are omitted. This paper also discusses the potential for using a low cost land Mobile Mapping System (MMS) to implement realistic image 3D mapping, and evaluates the positioning accuracy that a measureable

  11. Augment clinical measurement using a constraint-based esophageal model

    Science.gov (United States)

    Kou, Wenjun; Acharya, Shashank; Kahrilas, Peter; Patankar, Neelesh; Pandolfino, John

    2017-11-01

    Quantifying the mechanical properties of the esophageal wall is crucial to understanding impairments of trans-esophageal flow characteristic of several esophageal diseases. However, these data are unavailable owing to technological limitations of current clinical diagnostic instruments that instead display esophageal luminal cross sectional area based on intraluminal impedance change. In this work, we developed an esophageal model to predict bolus flow and the wall property based on clinical measurements. The model used the constraint-based immersed-boundary method developed previously by our group. Specifically, we first approximate the time-dependent wall geometry based on impedance planimetry data on luminal cross sectional area. We then fed these along with pressure data into the model and computed wall tension based on simulated pressure and flow fields, and the material property based on the strain-stress relationship. As examples, we applied this model to augment FLIP (Functional Luminal Imaging Probe) measurements in three clinical cases: a normal subject, achalasia, and eosinophilic esophagitis (EoE). Our findings suggest that the wall stiffness was greatest in the EoE case, followed by the achalasia case, and then the normal. This is supported by NIH Grant R01 DK56033 and R01 DK079902.

  12. Social factors and television use during meals and snacks is associated with higher BMI among pre-school children.

    Science.gov (United States)

    Dubois, Lise; Farmer, Anna; Girard, Manon; Peterson, Kelly

    2008-12-01

    The present paper examines the relationship between social factors, food consumption during television viewing, and overall television viewing and how these are associated with BMI when the role of familial and social factors are considered in a population-based birth cohort of pre-school children from Québec (Canada). The analyses were performed using data from the Longitudinal Study of Child Development in Québec (1998-2002) (LSCDQ). The study follows a representative sample (n 2103) of children born in 1998 in the Canadian province of Québec. A nutrition assessment was conducted on 1549 children aged 4.5 years and included a 24 h dietary recall, an eating behaviour and television viewing questionnaire, and a measurement of children's heights and weights. Statistical analyses were performed. Nearly one-quarter of children ate at least twice daily in front of the television. Children who consumed snacks while watching television on a daily basis had higher BMI than children who did so less frequently. Children who ate snacks in front of the television every day, or some times during the week, ate more carbohydrates (total), more fat and less protein, fewer fruits and vegetables, and drank soft drinks more often than children who never ate snacks in front of the television. Health professionals should target parents of children at risk of overweight/obesity with focused strategies to help children change the types of foods consumed during television viewing and to reduce the time spent watching television, particularly during meal times, which may change children's dietary intake and eating patterns.

  13. Measurement of energy efficiency based on economic foundations

    International Nuclear Information System (INIS)

    Filippini, Massimo; Hunt, Lester C.

    2015-01-01

    Energy efficiency policy is seen as a very important activity by almost all policy makers. In practical energy policy analysis, the typical indicator used as a proxy for energy efficiency is energy intensity. However, this simple indicator is not necessarily an accurate measure given changes in energy intensity are a function of changes in several factors as well as ‘true’ energy efficiency; hence, it is difficult to make conclusions for energy policy based upon simple energy intensity measures. Related to this, some published academic papers over the last few years have attempted to use empirical methods to measure the efficient use of energy based on the economic theory of production. However, these studies do not generally provide a systematic discussion of the theoretical basis nor the possible parametric empirical approaches that are available for estimating the level of energy efficiency. The objective of this paper, therefore, is to sketch out and explain from an economic perspective the theoretical framework as well as the empirical methods for measuring the level of energy efficiency. Additionally, in the second part of the paper, some of the empirical studies that have attempted to measure energy efficiency using such an economics approach are summarized and discussed.

  14. Self-guaranteed measurement-based quantum computation

    Science.gov (United States)

    Hayashi, Masahito; Hajdušek, Michal

    2018-05-01

    In order to guarantee the output of a quantum computation, we usually assume that the component devices are trusted. However, when the total computation process is large, it is not easy to guarantee the whole system when we have scaling effects, unexpected noise, or unaccounted for correlations between several subsystems. If we do not trust the measurement basis or the prepared entangled state, we do need to be worried about such uncertainties. To this end, we propose a self-guaranteed protocol for verification of quantum computation under the scheme of measurement-based quantum computation where no prior-trusted devices (measurement basis or entangled state) are needed. The approach we present enables the implementation of verifiable quantum computation using the measurement-based model in the context of a particular instance of delegated quantum computation where the server prepares the initial computational resource and sends it to the client, who drives the computation by single-qubit measurements. Applying self-testing procedures, we are able to verify the initial resource as well as the operation of the quantum devices and hence the computation itself. The overhead of our protocol scales with the size of the initial resource state to the power of 4 times the natural logarithm of the initial state's size.

  15. Evaluating airline energy efficiency: An integrated approach with Network Epsilon-based Measure and Network Slacks-based Measure

    International Nuclear Information System (INIS)

    Xu, Xin; Cui, Qiang

    2017-01-01

    This paper focuses on evaluating airline energy efficiency, which is firstly divided into four stages: Operations Stage, Fleet Maintenance Stage, Services Stage and Sales Stage. The new four-stage network structure of airline energy efficiency is a modification of existing models. A new approach, integrated with Network Epsilon-based Measure and Network Slacks-based Measure, is applied to assess the overall energy efficiency and divisional efficiency of 19 international airlines from 2008 to 2014. The influencing factors of airline energy efficiency are analyzed through the regression analysis. The results indicate the followings: 1. The integrated model can identify the benchmarking airlines in the overall system and stages. 2. Most airlines' energy efficiencies keep steady during the period, except for some sharply fluctuations. The efficiency decreases mainly centralized in the year 2008–2011, affected by the financial crisis in the USA. 3. The average age of fleet is positively correlated with the overall energy efficiency, and each divisional efficiency has different significant influencing factors. - Highlights: • An integrated approach with Network Epsilon-based Measure and Network Slacks-based Measure is developed. • 19 airlines' energy efficiencies are evaluated. • Garuda Indonesia has the highest overall energy efficiency.

  16. Link-Based Similarity Measures Using Reachability Vectors

    Directory of Open Access Journals (Sweden)

    Seok-Ho Yoon

    2014-01-01

    Full Text Available We present a novel approach for computing link-based similarities among objects accurately by utilizing the link information pertaining to the objects involved. We discuss the problems with previous link-based similarity measures and propose a novel approach for computing link based similarities that does not suffer from these problems. In the proposed approach each target object is represented by a vector. Each element of the vector corresponds to all the objects in the given data, and the value of each element denotes the weight for the corresponding object. As for this weight value, we propose to utilize the probability of reaching from the target object to the specific object, computed using the “Random Walk with Restart” strategy. Then, we define the similarity between two objects as the cosine similarity of the two vectors. In this paper, we provide examples to show that our approach does not suffer from the aforementioned problems. We also evaluate the performance of the proposed methods in comparison with existing link-based measures, qualitatively and quantitatively, with respect to two kinds of data sets, scientific papers and Web documents. Our experimental results indicate that the proposed methods significantly outperform the existing measures.

  17. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  18. The relationship between the parameters (Heart rate, Ejection fraction and BMI) and the maximum enhancement time of ascending aorta

    International Nuclear Information System (INIS)

    Jang, Young Ill; June, Woon Kwan; Dong, Kyeong Rae

    2007-01-01

    In this study, Bolus Tracking method was used to investigate the parameters affecting the time when contrast media is reached at 100 HU (T 100 ) and studied the relationship between parameters and T 100 because the time which is reached at aorta through antecubital vein after injecting contrast media is different from person to person. Using 64 MDCT, Cadiac CT, the data were obtained from 100 patients (male: 50, female: 50, age distribution: 21⁓81, average age: 57.5) during July and September, 2007 by injecting the contrast media at 4 ml∙sec -1 through their antecubital vein except having difficulties in stopping their breath and having arrhythmia. Using Somatom Sensation Cardiac 64 Siemens, patients’ height and weight were measured to know their mean Heart rate and BMI. Ejection Fraction was measured using Argus Program at Wizard Workstation. Variances of each parameter were analyzed depending on T 100 ’s variation with multiple comparison and the correlation of Heart rate, Ejection Fraction and BMI were analyzed, as well. According to T 100 ’s variation caused by Heart rate, Ejection Fraction and BMI variations, the higher patients’ Heart Rate and Ejection Fraction were, the faster T 100 ’s variations caused by Heart Rate and Ejection Fraction were. The lower their Heart Rate and Ejection Fraction were, the slower T 100 ’s variations were, but T 100 ’s variations caused by BMI were not affected. In the correlation between T 100 and parameters, Heart Rate (p⁄0.01) and Ejection Fraction (p⁄0.05) were significant, but BMI was not significant (p¤0.05). In the Heart Rate, Ejection Fraction and BMI depending on Fast (17 sec and less), Medium (18⁓21 sec), Slow (22 sec and over) Heart Rate was significant at Fast and Slow and Ejection Fraction was significant Fast and Slow as well as Medium and Slow (p⁄0.05), but BMI was not statistically significant. Of the parameters (Heart Rate, Ejection Fraction and BMI) which would affect T 100 , Heart

  19. Real cell overlay measurement through design based metrology

    Science.gov (United States)

    Yoo, Gyun; Kim, Jungchan; Park, Chanha; Lee, Taehyeong; Ji, Sunkeun; Jo, Gyoyeon; Yang, Hyunjo; Yim, Donggyu; Yamamoto, Masahiro; Maruyama, Kotaro; Park, Byungjun

    2014-04-01

    Until recent device nodes, lithography has been struggling to improve its resolution limit. Even though next generation lithography technology is now facing various difficulties, several innovative resolution enhancement technologies, based on 193nm wavelength, were introduced and implemented to keep the trend of device scaling. Scanner makers keep developing state-of-the-art exposure system which guarantees higher productivity and meets a more aggressive overlay specification. "The scaling reduction of the overlay error has been a simple matter of the capability of exposure tools. However, it is clear that the scanner contributions may no longer be the majority component in total overlay performance. The ability to control correctable overlay components is paramount to achieve the desired performance.(2)" In a manufacturing fab, the overlay error, determined by a conventional overlay measurement: by using an overlay mark based on IBO and DBO, often does not represent the physical placement error in the cell area of a memory device. The mismatch may arise from the size or pitch difference between the overlay mark and the cell pattern. Pattern distortion, caused by etching or CMP, also can be a source of the mismatch. Therefore, the requirement of a direct overlay measurement in the cell pattern gradually increases in the manufacturing field, and also in the development level. In order to overcome the mismatch between conventional overlay measurement and the real placement error of layer to layer in the cell area of a memory device, we suggest an alternative overlay measurement method utilizing by design, based metrology tool. A basic concept of this method is shown in figure1. A CD-SEM measurement of the overlay error between layer 1 and 2 could be the ideal method but it takes too long time to extract a lot of data from wafer level. An E-beam based DBM tool provides high speed to cover the whole wafer with high repeatability. It is enabled by using the design as a

  20. Defining a BMI Cut-Off Point for the Iranian Population: The Shiraz Heart Study.

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Babai

    Full Text Available In this study we evaluated and redefined the optimum body mass index (BMI cut-off point for the Iranian population based on metabolic syndrome (MeS risk factors. We further evaluated BMI cut-off points with and without waist circumference (WC as a cofactor of risk and compared the differences. This study is part of the largest surveillance programs conducted in Shiraz, Iran, termed the Shiraz Heart study. Our study sample included subjects between the ages of 20 to 65 years old. After excluding pregnant women, those with missing data and those with comorbid disease, a total of 12283 made up the study population. The participants underwent a series of tests and evaluations by trained professionals in accordance with WHO recommendations. Hypertension, abnormal fasting blood sugar (FBS, triglyceride (TG and high density lipoprotein cholesterol (HDL (in the context of the definition of metabolic syndrome were prevalent among 32.4%, 27.6%, 42.1 and 44.2% of our participants, respectively. Women displayed higher rates of overall obesity compared to men (based on the definition by the WHO as higher than 30 kg/m2. Regarding MeS, 38.9% of our population had the all symptoms of MeS which was more prevalent among women (41.5% vs. 36%. When excluding WC in the definition of MeS, results showed that males tend to show a higher rate of metabolic risk factors (19.2% vs. 15.6%. Results of multivariate analysis showed that parallel to an increase in BMI, the odds ratio (OR for acquiring each component of the metabolic syndrome increased (OR = 1.178; CI: 1.166-1.190. By excluding WC, the previous OR decreased (OR = 1.105; CI: 1.093-1.118. Receiver Operating Characteristic (ROC curve analysis showed that the optimum BMI cut-off point for predicting metabolic syndrome was 26.1 kg/m2 and 26.2 kg/m2 [Accuracy (Acc = 69% and 61%, respectively] for males and females, respectively. The overall BMI cut-off for both sexes was 26.2 kg/m2 (Acc = 65% with sensitivity and

  1. A Game Map Complexity Measure Based on Hamming Distance

    Science.gov (United States)

    Li, Yan; Su, Pan; Li, Wenliang

    With the booming of PC game market, Game AI has attracted more and more researches. The interesting and difficulty of a game are relative with the map used in game scenarios. Besides, the path-finding efficiency in a game is also impacted by the complexity of the used map. In this paper, a novel complexity measure based on Hamming distance, called the Hamming complexity, is introduced. This measure is able to estimate the complexity of binary tileworld. We experimentally demonstrated that Hamming complexity is highly relative with the efficiency of A* algorithm, and therefore it is a useful reference to the designer when developing a game map.

  2. A microprocessor based picture analysis system for automatic track measurements

    International Nuclear Information System (INIS)

    Heinrich, W.; Trakowski, W.; Beer, J.; Schucht, R.

    1982-01-01

    In the last few years picture analysis became a powerful technique for measurements of nuclear tracks in plastic detectors. For this purpose rather expensive commercial systems are available. Two inexpensive microprocessor based systems with different resolution were developed. The video pictures of particles seen through a microscope are digitized in real time and the picture analysis is done by software. The microscopes are equipped with stages driven by stepping motors, which are controlled by separate microprocessors. A PDP 11/03 supervises the operation of all microprocessors and stores the measured data on its mass storage devices. (author)

  3. Atmospheric profiles from active space-based radio measurements

    Science.gov (United States)

    Hardy, Kenneth R.; Hinson, David P.; Tyler, G. L.; Kursinski, E. R.

    1992-01-01

    The paper describes determinations of atmospheric profiles from space-based radio measurements and the retrieval methodology used, with special attention given to the measurement procedure and the characteristics of the soundings. It is speculated that reliable profiles of the terrestrial atmosphere can be obtained by the occultation technique from the surface to a height of about 60 km. With the full complement of 21 the Global Positioning System (GPS) satellites and one GPS receiver in sun synchronous polar orbit, a maximum of 42 soundings could be obtained for each complete orbit or about 670 per day, providing almost uniform global coverage.

  4. Assessing Therapist Competence: Development of a Performance-Based Measure and Its Comparison With a Web-Based Measure.

    Science.gov (United States)

    Cooper, Zafra; Doll, Helen; Bailey-Straebler, Suzanne; Bohn, Kristin; de Vries, Dian; Murphy, Rebecca; O'Connor, Marianne E; Fairburn, Christopher G

    2017-10-31

    Recent research interest in how best to train therapists to deliver psychological treatments has highlighted the need for rigorous, but scalable, means of measuring therapist competence. There are at least two components involved in assessing therapist competence: the assessment of their knowledge of the treatment concerned, including how and when to use its strategies and procedures, and an evaluation of their ability to apply such knowledge skillfully in practice. While the assessment of therapists' knowledge has the potential to be completed efficiently on the Web, the assessment of skill has generally involved a labor-intensive process carried out by clinicians, and as such, may not be suitable for assessing training outcome in certain circumstances. The aims of this study were to develop and evaluate a role-play-based measure of skill suitable for assessing training outcome and to compare its performance with a highly scalable Web-based measure of applied knowledge. Using enhanced cognitive behavioral therapy (CBT-E) for eating disorders as an exemplar, clinical scenarios for role-play assessment were developed and piloted together with a rating scheme for assessing trainee therapists' performance. These scenarios were evaluated by examining the performance of 93 therapists from different professional backgrounds and at different levels of training in implementing CBT-E. These therapists also completed a previously developed Web-based measure of applied knowledge, and the ability of the Web-based measure to efficiently predict competence on the role-play measure was investigated. The role-play measure assessed performance at implementing a range of CBT-E procedures. The majority of the therapists rated their performance as moderately or closely resembling their usual clinical performance. Trained raters were able to achieve good-to-excellent reliability for averaged competence, with intraclass correlation coefficients ranging from .653 to 909. The measure was

  5. The correction of vibration in frequency scanning interferometry based absolute distance measurement system for dynamic measurements

    Science.gov (United States)

    Lu, Cheng; Liu, Guodong; Liu, Bingguo; Chen, Fengdong; Zhuang, Zhitao; Xu, Xinke; Gan, Yu

    2015-10-01

    Absolute distance measurement systems are of significant interest in the field of metrology, which could improve the manufacturing efficiency and accuracy of large assemblies in fields such as aircraft construction, automotive engineering, and the production of modern windmill blades. Frequency scanning interferometry demonstrates noticeable advantages as an absolute distance measurement system which has a high precision and doesn't depend on a cooperative target. In this paper , the influence of inevitable vibration in the frequency scanning interferometry based absolute distance measurement system is analyzed. The distance spectrum is broadened as the existence of Doppler effect caused by vibration, which will bring in a measurement error more than 103 times bigger than the changes of optical path difference. In order to decrease the influence of vibration, the changes of the optical path difference are monitored by a frequency stabilized laser, which runs parallel to the frequency scanning interferometry. The experiment has verified the effectiveness of this method.

  6. Developing a community-based flood resilience measurement standard

    Science.gov (United States)

    Keating, Adriana; Szoenyi, Michael; Chaplowe, Scott; McQuistan, Colin; Campbell, Karen

    2015-04-01

    Given the increased attention to resilience-strengthening in international humanitarian and development work, there has been concurrent interest in its measurement and the overall accountability of "resilience strengthening" initiatives. The literature is reaching beyond the polemic of defining resilience to its measurement. Similarly, donors are increasingly expecting organizations to go beyond claiming resilience programing to measuring and showing it. However, key questions must be asked, in particular "Resilience of whom and to what?". There is no one-size-fits-all solution. The approach to measuring resilience is dependent on the audience and the purpose of the measurement exercise. Deriving a resilience measurement system needs to be based on the question it seeks to answer and needs to be specific. This session highlights key lessons from the Zurich Flood Resilience Alliance approach to develop a flood resilience measurement standard to measure and assess the impact of community based flood resilience interventions, and to inform decision-making to enhance the effectiveness of these interventions. We draw on experience in methodology development to-date, together with lessons from application in two case study sites in Latin America. Attention will be given to the use of a consistent measurement methodology for community resilience to floods over time and place; challenges to measuring a complex and dynamic phenomenon such as community resilience; methodological implications of measuring community resilience versus impact on and contribution to this goal; and using measurement and tools such as cost-benefit analysis to prioritize and inform strategic decision making for resilience interventions. The measurement tool follows the five categories of the Sustainable Livelihoods Framework and the 4Rs of complex adaptive systems - robustness, rapidity, redundancy and resourcefulness -5C-4R. A recent white paper by the Zurich Flood Resilience Alliance traces the

  7. Secular and race/ethnic trends in glycemic outcomes by BMI in US adults: The role of waist circumference.

    Science.gov (United States)

    Albrecht, Sandra S; Mayer-Davis, Elizabeth; Popkin, Barry M

    2017-07-01

    For the same body mass index (BMI) level, waist circumference (WC) is higher in more recent years. How this impacts diabetes and prediabetes prevalence in the United States and for different race/ethnic groups is unknown. We examined prevalence differences in diabetes and prediabetes by BMI over time, investigated whether estimates were attenuated after adjusting for waist circumference, and evaluated implications of these patterns on race/ethnic disparities in glycemic outcomes. Data came from 12 614 participants aged 20 to 74 years from the National Health and Nutrition Examination Surveys (1988-1994 and 2007-2012). We estimated prevalence differences in diabetes and prediabetes by BMI over time in multivariable models. Relevant interactions evaluated race/ethnic differences. Among normal, overweight, and class I obese individuals, there were no significant differences in diabetes prevalence over time. However, among individuals with class II/III obesity, diabetes prevalence rose 7.6 percentage points in 2007-2012 vs 1988-1994. This estimate was partly attenuated after adjustment for mean waist circumference but not mean BMI. For prediabetes, prevalence was 10 to 13 percentage points higher over time at lower BMI values, with minimal attenuation after adjustment for WC. All patterns held within race/ethnic groups. Diabetes disparities among blacks and Mexican Americans relative to whites remained in both periods, regardless of BMI, and persisted after adjustment for WC. Diabetes prevalence rose over time among individuals with class II/III obesity and may be partly due to increasing waist circumference. Anthropometric measures did not appear to account for temporal increases in prediabetes, nor did they attenuate race/ethnic disparities in diabetes. Reasons underlying these trends require further investigation. Copyright © 2017 John Wiley & Sons, Ltd.

  8. The relationship between physical activity, fitness, physical complaints and BMI in German adults - results of a longitudinal study.

    Science.gov (United States)

    Tittlbach, Susanne A; Jekauc, Darko; Schmidt, Steffen C E; Woll, Alexander; Bös, Klaus

    2017-09-01

    This study's aims were to describe the development of physical activity, physical fitness (PF), subjective (physical complaints (PC)) and objective (Body mass index (BMI)) health measures and to examine the relationship between the development trajectories. In addition, the study also aimed to assess the influence of sociodemographic determinants (age, sex, socioeconomic status (SES)) in German adults over a period of 18 years. The longitudinal study population comprises of 721 men and women, aged 33-76 years over the study period. There was self-report of physical activity and PC and testing of physical fitness and BMI in each study year (1992, 1997, 2002 and 2010). Latent growth curve models were used to analyse the development. Physical activity slightly increased while fitness, PC and BMI worsened over the course of 18 years. Sex, age and SES play important roles concerning physical activity, fitness and health. Several integrative associations could be detected between physical activity, fitness, PC and BMI as well as their trajectories. In particular, high initial levels of physical activity and fitness protect from high PC and BMI.The slope of physical activity was not significantly associated with slopes of fitness, PC and BMI. However, increase of fitness resulted in decrease of PC. A general positive development regarding the amount of physical activity could be detected. However, if it is only an unsystematic increase of physical activity, this is not in itself enough to achieve health benefits. The strengthening of fitness should be focused when increasing physical activity, since only then a health benefit is possible.

  9. Does the prescriptive lifestyle of Seventh-day Adventists provide 'immunity' from the secular effects of changes in BMI?

    Science.gov (United States)

    Kent, Lillian M; Worsley, Anthony

    2009-04-01

    To examine the effect of Seventh-day Adventist (SDA) membership on 'immunity' to the secular effects of changes in BMI. Three independent, cross-sectional, screening surveys conducted by Sydney Adventist Hospital in 1976, 1986 and 1988 and a survey conducted among residents of Melbourne in 2006. Two hundred and fifty-two SDA and 464 non-SDA in 1976; 166 SDA and 291 non-SDA in 1986; 120 SDA and 300-non SDA in 1988; and 251 SDA and 294 non-SDA in 2006. Height and weight measured by hospital staff in 1976, 1986 and 1988; self-reported by respondents in 2006. The mean BMI of non-SDA men increased between 1986 and 2006 (P < 0.001) but did not change for SDA men or non-SDA women. Despite small increases in SDA women's mean BMI (P = 0.030) between 1988 and 2006, this was no different to that of SDA men and non-SDA women in 2006. The diet and eating patterns of SDA men and women were more 'prudent' than those of non-SDA men and women, including more fruit, vegetables, grains, nuts and legumes, and less alcohol, meat, sweetened drinks and coffee. Many of these factors were found to be predictors of lower BMI. The 'prudent' dietary and lifestyle prescriptions of SDA men appear to have 'immunised' them to the secular effects of changes that occurred among non-SDA men's BMI. The dietary and lifestyle trends of SDA women did not reflect the increase in their BMI observed in 2006.

  10. Observer-Based Fuel Control Using Oxygen Measurement

    DEFF Research Database (Denmark)

    Andersen, Palle; Bendtsen, Jan Dimon; Mortensen, Jan Henrik

    is constructed and validated against data obtained at the plant. A Kalman filter based on measurements of combustion air flow led into the furnace and oxygen concentration in the flue gas is designed to estimate the actual coal flow. With this estimate, it becomes possible to close an inner loop around the coal......This report describes an attempt to improve the existing control af coal mills used at the Danish power plant Nordjyllandsværket Unit 3. The coal mills are not equipped with coal flow sensors; thus an observer-based approach is investigated. A nonlinear differential equation model of the boiler...

  11. Fault Location Based on Synchronized Measurements: A Comprehensive Survey

    Science.gov (United States)

    Al-Mohammed, A. H.; Abido, M. A.

    2014-01-01

    This paper presents a comprehensive survey on transmission and distribution fault location algorithms that utilize synchronized measurements. Algorithms based on two-end synchronized measurements and fault location algorithms on three-terminal and multiterminal lines are reviewed. Series capacitors equipped with metal oxide varistors (MOVs), when set on a transmission line, create certain problems for line fault locators and, therefore, fault location on series-compensated lines is discussed. The paper reports the work carried out on adaptive fault location algorithms aiming at achieving better fault location accuracy. Work associated with fault location on power system networks, although limited, is also summarized. Additionally, the nonstandard high-frequency-related fault location techniques based on wavelet transform are discussed. Finally, the paper highlights the area for future research. PMID:24701191

  12. Fault Location Based on Synchronized Measurements: A Comprehensive Survey

    Directory of Open Access Journals (Sweden)

    A. H. Al-Mohammed

    2014-01-01

    Full Text Available This paper presents a comprehensive survey on transmission and distribution fault location algorithms that utilize synchronized measurements. Algorithms based on two-end synchronized measurements and fault location algorithms on three-terminal and multiterminal lines are reviewed. Series capacitors equipped with metal oxide varistors (MOVs, when set on a transmission line, create certain problems for line fault locators and, therefore, fault location on series-compensated lines is discussed. The paper reports the work carried out on adaptive fault location algorithms aiming at achieving better fault location accuracy. Work associated with fault location on power system networks, although limited, is also summarized. Additionally, the nonstandard high-frequency-related fault location techniques based on wavelet transform are discussed. Finally, the paper highlights the area for future research.

  13. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  14. The relationship between income, economic freedom, and BMI.

    Science.gov (United States)

    Lawson, R A; Murphy, R H; Williamson, C R

    2016-05-01

    What explains increases in BMI (and obesity) over time and across countries? Although many microeconomic forces are likely explanations, increasingly scholars are arguing that macroeconomic forces such as market liberalism and globalization are root causes of the obesity epidemic. The purpose of this paper is to examine the impact of economic freedom on obesity conditional on the level of income and other factors. We use an unbalanced pooled cross section of up to 135 countries for 1995 and 2000-2009. Our statistical model specifications include pooled OLS and fixed effects. First, we find that controlling for fixed effects siphons off much of the relationship previously documented between economic freedom and BMI. Second, economic freedom is associated with slightly higher BMIs but only for men in developing nations. Lastly, we show that economic freedom increases life expectancy for both men and women in developing countries. Therefore, policies aimed at reducing obesity that limit economic liberalism may come at the expense of life expectancy in the developing world. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  15. Automated pavement horizontal curve measurement methods based on inertial measurement unit and 3D profiling data

    Directory of Open Access Journals (Sweden)

    Wenting Luo

    2016-04-01

    Full Text Available Pavement horizontal curve is designed to serve as a transition between straight segments, and its presence may cause a series of driving-related safety issues to motorists and drivers. As is recognized that traditional methods for curve geometry investigation are time consuming, labor intensive, and inaccurate, this study attempts to develop a method that can automatically conduct horizontal curve identification and measurement at network level. The digital highway data vehicle (DHDV was utilized for data collection, in which three Euler angles, driving speed, and acceleration of survey vehicle were measured with an inertial measurement unit (IMU. The 3D profiling data used for cross slope calibration was obtained with PaveVision3D Ultra technology at 1 mm resolution. In this study, the curve identification was based on the variation of heading angle, and the curve radius was calculated with kinematic method, geometry method, and lateral acceleration method. In order to verify the accuracy of the three methods, the analysis of variance (ANOVA test was applied by using the control variable of curve radius measured by field test. Based on the measured curve radius, a curve safety analysis model was used to predict the crash rates and safe driving speeds at horizontal curves. Finally, a case study on 4.35 km road segment demonstrated that the proposed method could efficiently conduct network level analysis.

  16. An Improved Dissonance Measure Based on Auditory Memory

    DEFF Research Database (Denmark)

    Jensen, Kristoffer; Hjortkjær, Jens

    2012-01-01

    Dissonance is an important feature in music audio analysis. We present here a dissonance model that accounts for the temporal integration of dissonant events in auditory short term memory. We compare the memory-based dissonance extracted from musical audio sequences to the response of human...... listeners. In a number of tests, the memory model predicts listener’s response better than traditional dissonance measures....

  17. Deformation Measurements of Gabion Walls Using Image Based Modeling

    Directory of Open Access Journals (Sweden)

    Marek Fraštia

    2014-06-01

    Full Text Available The image based modeling finds use in applications where it is necessary to reconstructthe 3D surface of the observed object with a high level of detail. Previous experiments showrelatively high variability of the results depending on the camera type used, the processingsoftware, or the process evaluation. The authors tested the method of SFM (Structure fromMotion to determine the stability of gabion walls. The results of photogrammetricmeasurements were compared to precise geodetic point measurements.

  18. Biomass burning aerosols characterization from ground based and profiling measurements

    Science.gov (United States)

    Marin, Cristina; Vasilescu, Jeni; Marmureanu, Luminita; Ene, Dragos; Preda, Liliana; Mihailescu, Mona

    2018-04-01

    The study goal is to assess the chemical and optical properties of aerosols present in the lofted layers and at the ground. The biomass burning aerosols were evaluated in low level layers from multi-wavelength lidar measurements, while chemical composition at ground was assessed using an Aerosol Chemical Speciation Monitor (ACSM) and an Aethalometer. Classification of aerosol type and specific organic markers were used to explore the potential to sense the particles from the same origin at ground base and on profiles.

  19. Pulsed electric field sensor based on original waveform measurement

    International Nuclear Information System (INIS)

    Ma Liang; Wu Wei; Cheng Yinhui; Zhou Hui; Li Baozhong; Li Jinxi; Zhu Meng

    2010-01-01

    The paper introduces the differential and original waveform measurement principles for pulsed E-field, and develops an pulsed E-field sensor based on original waveform measurement along with its theoretical correction model. The sensor consists of antenna, integrator, amplifier and driver, optic-electric/electric-optic conversion module and transmission module. The time-domain calibration in TEM cell indicates that, its risetime response is shorter than 1.0 ns, and the output pulse width at 90% of the maximum amplitude is wider than 10.0 μs. The output amplitude of the sensor is linear to the electric field intensity in a dynamic range of 20 dB. The measurement capability can be extended to 10 V/m or 50 kV/m by changing the system's antenna and other relative modules. (authors)

  20. Arrester Resistive Current Measuring System Based on Heterogeneous Network

    Science.gov (United States)

    Zhang, Yun Hua; Li, Zai Lin; Yuan, Feng; Hou Pan, Feng; Guo, Zhan Nan; Han, Yue

    2018-03-01

    Metal Oxide Arrester (MOA) suffers from aging and poor insulation due to long-term impulse voltage and environmental impact, and the value and variation tendency of resistive current can reflect the health conditions of MOA. The common wired MOA detection need to use long cables, which is complicated to operate, and that wireless measurement methods are facing the problems of poor data synchronization and instability. Therefore a novel synchronous measurement system of arrester current resistive based on heterogeneous network is proposed, which simplifies the calculation process and improves synchronization, accuracy and stability and of the measuring system. This system combines LoRa wireless network, high speed wireless personal area network and the process layer communication, and realizes the detection of arrester working condition. Field test data shows that the system has the characteristics of high accuracy, strong anti-interference ability and good synchronization, which plays an important role in ensuring the stable operation of the power grid.

  1. Nano-displacement measurement based on virtual pinhole confocal method

    International Nuclear Information System (INIS)

    Li, Long; Kuang, Cuifang; Xue, Yi; Liu, Xu

    2013-01-01

    A virtual pinhole confocal system based on charge-coupled device (CCD) detection and image processing techniques is built to measure axial displacement with 10 nm resolution, preeminent flexibility and excellent robustness when facing spot drifting. Axial displacement of the sample surface is determined by capturing the confocal laser spot using a CCD detector and quantifying the energy collected by programmable virtual pinholes. Experiments indicate an applicable measuring range of 1000 nm (Gaussian fitting r = 0.9902) with a highly linear range of 500 nm (linear fitting r = 0.9993). A concentric subtraction algorithm is introduced to further enhance resolution. Factors affecting measuring precision, sensitivity and signal-to-noise ratio are discussed using theoretical deductions and diffraction simulations. The virtual pinhole technique has promising applications in surface profiling and confocal imaging applications which require easily-customizable pinhole configurations. (paper)

  2. Neurally based measurement and evaluation of environmental noise

    CERN Document Server

    Soeta, Yoshiharu

    2015-01-01

    This book deals with methods of measurement and evaluation of environmental noise based on an auditory neural and brain-oriented model. The model consists of the autocorrelation function (ACF) and the interaural cross-correlation function (IACF) mechanisms for signals arriving at the two ear entrances. Even when the sound pressure level of a noise is only about 35 dBA, people may feel annoyed due to the aspects of sound quality. These aspects can be formulated by the factors extracted from the ACF and IACF. Several examples of measuring environmental noise—from outdoor noise such as that of aircraft, traffic, and trains, and indoor noise such as caused by floor impact, toilets, and air-conditioning—are demonstrated. According to the noise measurement and evaluation, applications for sound design are discussed. This book provides an excellent resource for students, researchers, and practitioners in a wide range of fields, such as the automotive, railway, and electronics industries, and soundscape, architec...

  3. Experimental nonlocality-based randomness generation with nonprojective measurements

    Science.gov (United States)

    Gómez, S.; Mattar, A.; Gómez, E. S.; Cavalcanti, D.; Farías, O. Jiménez; Acín, A.; Lima, G.

    2018-04-01

    We report on an optical setup generating more than one bit of randomness from one entangled bit (i.e., a maximally entangled state of two qubits). The amount of randomness is certified through the observation of Bell nonlocal correlations. To attain this result we implemented a high-purity entanglement source and a nonprojective three-outcome measurement. Our implementation achieves a gain of 27% of randomness as compared with the standard methods using projective measurements. Additionally, we estimate the amount of randomness certified in a one-sided device-independent scenario, through the observation of Einstein-Podolsky-Rosen steering. Our results prove that nonprojective quantum measurements allow extending the limits for nonlocality-based certified randomness generation using current technology.

  4. Measurement of unattached radon progeny based in electrostatic deposition method

    International Nuclear Information System (INIS)

    Canoba, A.C.; Lopez, F.O.

    1999-01-01

    A method for the measurement of unattached radon progeny based on its electrostatic deposition onto wire screens, using only one pump, has been implemented and calibrated. The importance of being able of making use of this method is related with the special radiological significance that has the unattached fraction of the short-lived radon progeny. Because of this, the assessment of exposure could be directly related to dose with far greater accuracy than before. The advantages of this method are its simplicity, even with the tools needed for the sample collection, as well as the measurement instruments used. Also, the suitability of this method is enhanced by the fact that it can effectively be used with a simple measuring procedure such as the Kusnetz method. (author)

  5. Measurement system for nitrous oxide based on amperometric gas sensor

    Science.gov (United States)

    Siswoyo, S.; Persaud, K. C.; Phillips, V. R.; Sneath, R.

    2017-03-01

    It has been well known that nitrous oxide is an important greenhouse gas, so monitoring and control of its concentration and emission is very important. In this work a nitrous oxide measurement system has been developed consisting of an amperometric sensor and an appropriate lab-made potentiostat that capable measuring picoampere current ranges. The sensor was constructed using a gold microelectrode as working electrode surrounded by a silver wire as quasi reference electrode, with tetraethyl ammonium perchlorate and dimethylsulphoxide as supporting electrolyte and solvent respectively. The lab-made potentiostat was built incorporating a transimpedance amplifier capable of picoampere measurements. This also incorporated a microcontroller based data acquisition system, controlled by a host personal computer using a dedicated computer program. The system was capable of detecting N2O concentrations down to 0.07 % v/v.

  6. Evidence conflict measure based on OWA operator in open world.

    Directory of Open Access Journals (Sweden)

    Wen Jiang

    Full Text Available Dempster-Shafer evidence theory has been extensively used in many information fusion systems since it was proposed by Dempster and extended by Shafer. Many scholars have been conducted on conflict management of Dempster-Shafer evidence theory in past decades. However, how to determine a potent parameter to measure evidence conflict, when the given environment is in an open world, namely the frame of discernment is incomplete, is still an open issue. In this paper, a new method which combines generalized conflict coefficient, generalized evidence distance, and generalized interval correlation coefficient based on ordered weighted averaging (OWA operator, to measure the conflict of evidence is presented. Through ordered weighted average of these three parameters, the combinatorial coefficient can still measure the conflict effectively when one or two parameters are not valid. Several numerical examples demonstrate the effectiveness of the proposed method.

  7. Beam based measurement of beam position monitor electrode gains

    Directory of Open Access Journals (Sweden)

    D. L. Rubin

    2010-09-01

    Full Text Available Low emittance tuning at the Cornell Electron Storage Ring (CESR test accelerator depends on precision measurement of vertical dispersion and transverse coupling. The CESR beam position monitors (BPMs consist of four button electrodes, instrumented with electronics that allow acquisition of turn-by-turn data. The response to the beam will vary among the four electrodes due to differences in electronic gain and/or misalignment. This variation in the response of the BPM electrodes will couple real horizontal offset to apparent vertical position, and introduce spurious measurements of coupling and vertical dispersion. To alleviate this systematic effect, a beam based technique to measure the relative response of the four electrodes has been developed. With typical CESR parameters, simulations show that turn-by-turn BPM data can be used to determine electrode gains to within ∼0.1%.

  8. Beam based measurement of beam position monitor electrode gains

    Science.gov (United States)

    Rubin, D. L.; Billing, M.; Meller, R.; Palmer, M.; Rendina, M.; Rider, N.; Sagan, D.; Shanks, J.; Strohman, C.

    2010-09-01

    Low emittance tuning at the Cornell Electron Storage Ring (CESR) test accelerator depends on precision measurement of vertical dispersion and transverse coupling. The CESR beam position monitors (BPMs) consist of four button electrodes, instrumented with electronics that allow acquisition of turn-by-turn data. The response to the beam will vary among the four electrodes due to differences in electronic gain and/or misalignment. This variation in the response of the BPM electrodes will couple real horizontal offset to apparent vertical position, and introduce spurious measurements of coupling and vertical dispersion. To alleviate this systematic effect, a beam based technique to measure the relative response of the four electrodes has been developed. With typical CESR parameters, simulations show that turn-by-turn BPM data can be used to determine electrode gains to within ˜0.1%.

  9. Comparison of body mass index (BMI) with the CUN-BAE body adiposity estimator in the prediction of hypertension and type 2 diabetes

    OpenAIRE

    Martín, Vicente; Dávila Batista, Verónica; Castilla, Jesús; Godoy i García, Pere; Delgado Rodríguez, Miguel; Soldevila, Núria; Molina, Antonio J.; Fernandez Villa, Tania; Astray, Jenaro; Castro, Andy; Gonzalez-Candelas, Fernando; Mayoral, José María; Quintana, José María; Domínguez García, Àngela; Trilla García, Antoni

    2016-01-01

    Background Obesity is a world-wide epidemic whose prevalence is underestimated by BMI measurements, but CUN-BAE (Clínica Universidad de Navarra - Body Adiposity Estimator) estimates the percentage of body fat (BF) while incorporating information on sex and age, thus giving a better match. Our aim is to compare the BMI and CUN-BAE in determining the population attributable fraction (AFp) for obesity as a cause of chronic diseases. Methods We calculated the Pearson correlation coefficient betwe...

  10. Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

    Science.gov (United States)

    Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

    2017-05-01

    We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

  11. Body Mass Index (BMI) and All-Cause Mortality Pooling Project

    Science.gov (United States)

    The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.

  12. Risk of a venous thromboembolic episode due to caesarean section and BMI

    DEFF Research Database (Denmark)

    Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S

    2014-01-01

    BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....

  13. BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

    Science.gov (United States)

    Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

    2011-09-01

    The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

  14. Soil-Carbon Measurement System Based on Inelastic Neutron Scattering

    International Nuclear Information System (INIS)

    Orion, I.; Wielopolski, L.

    2002-01-01

    Increase in the atmospheric CO 2 is associated with concurrent increase in the amount of carbon sequestered in the soil. For better understanding of the carbon cycle it is imperative to establish a better and extensive database of the carbon concentrations in various soil types, in order to develop improved models for changes in the global climate. Non-invasive soil carbon measurement is based on Inelastic Neutron Scattering (INS). This method has been used successfully to measure total body carbon in human beings. The system consists of a pulsed neutron generator that is based on D-T reaction, which produces 14 MeV neutrons, a neutron flux monitoring detector and a couple of large NaI(Tl), 6'' diameter by 6'' high, spectrometers [4]. The threshold energy for INS reaction in carbon is 4.8 MeV. Following INS of 14 MeV neutrons in carbon 4.44 MeV photons are emitted and counted during a gate pulse period of 10 μsec. The repetition rate of the neutron generator is 104 pulses per sec. The gamma spectra are acquired only during the neutron generator gate pulses. The INS method for soil carbon content measurements provides a non-destructive, non-invasive tool, which can be optimized in order to develop a system for in field measurements

  15. Computer vision based nacre thickness measurement of Tahitian pearls

    Science.gov (United States)

    Loesdau, Martin; Chabrier, Sébastien; Gabillon, Alban

    2017-03-01

    The Tahitian Pearl is the most valuable export product of French Polynesia contributing with over 61 million Euros to more than 50% of the total export income. To maintain its excellent reputation on the international market, an obligatory quality control for every pearl deemed for exportation has been established by the local government. One of the controlled quality parameters is the pearls nacre thickness. The evaluation is currently done manually by experts that are visually analyzing X-ray images of the pearls. In this article, a computer vision based approach to automate this procedure is presented. Even though computer vision based approaches for pearl nacre thickness measurement exist in the literature, the very specific features of the Tahitian pearl, namely the large shape variety and the occurrence of cavities, have so far not been considered. The presented work closes the. Our method consists of segmenting the pearl from X-ray images with a model-based approach, segmenting the pearls nucleus with an own developed heuristic circle detection and segmenting possible cavities with region growing. Out of the obtained boundaries, the 2-dimensional nacre thickness profile can be calculated. A certainty measurement to consider imaging and segmentation imprecisions is included in the procedure. The proposed algorithms are tested on 298 manually evaluated Tahitian pearls, showing that it is generally possible to automatically evaluate the nacre thickness of Tahitian pearls with computer vision. Furthermore the results show that the automatic measurement is more precise and faster than the manual one.

  16. Measurements of Electromagnetic Fields Emitted from Cellular Base Stations in

    Directory of Open Access Journals (Sweden)

    K. J. Ali

    2013-05-01

    Full Text Available With increasing the usage of mobile communication devices and internet network information, the entry of private telecommunications companies in Iraq has been started since 2003. These companies began to build up cellular towers to accomplish the telecommunication works but they ignore the safety conditions imposed for the health and environment that are considered in random way. These negative health effects which may cause a health risk for life beings and environment pollution. The aim of this work is to determine the safe and unsafe ranges and discuss damage caused by radiation emitted from Asia cell base stations in Shirqat city and discuses the best ways in which can be minimize its exposure level to avoid its negative health effects. Practical measurements of power density around base stations has been accomplished by using a radiation survey meter type (Radio frequency EMF Strength Meter 480846 in two ways. The first way of measurements has been accomplished at a height of 2 meters above ground for different distances from (0-300 meters .The second way is at a distance of 150 meters for different levels from (2-15 meters above ground level. The maximum measured power density is about (3 mW/m2. Results indicate that the levels of power density are far below the RF radiation exposure of USSR safety standards levels. And that means these cellular base station don't cause negative the health effect for life being if the exposure is within the acceptable international standard levels.

  17. Assessing exclusive breastfeeding practices, dietary intakes and body mass index (BMI) of nursing mothers in Ekiti State of Nigeria.

    Science.gov (United States)

    Ijarotimi, Oluwole Steve

    2010-06-01

    Breastfeeding is an unequalled way of providing ideal food for the infants. The benefits of breastfeeding practices to infants and mothers are well documented. However, information on breastfeeding practices and its effect on body mass index (BMI) of mothers are scarce, particularly in Ekiti State of Nigeria. Therefore, the present study is designed to assess breastfeeding practices and its association with BMI of mothers. A descriptive and cross-sectional study was conducted among breastfeeding mothers that attended postnatal clinic of the state specialist hospitals and maternity centers in the study location. The specialist hospital and two-third of the nine maternity centers were purposively selected because of their health facilities and personnel. The mother-child pairs (200 respondents) were randomly selected from the study locations. Information on demographic characteristic, socio-economic parameters, nutritional knowledge of breastfeeding and dietary intakes of mothers were collected using questionnaires. BMI of mothers was determined as described by World Health Organization. Age distribution of mothers was between 25-34 years; and almost half of respondents had good educational background and were engaged in different occupations. The respondent monthly income ranged between = N = 3500 - 26000 ($26.92 - $200); and their dietary intakes varied between starchy and protein-based food. The result also showed that the respondent consumed enough nutrients to meet up the recommended daily allowance for protein, carbohydrate, fat, zinc, magnesium, sodium and phosphorous requirements. The BMI classifications showed that over three-fifth of respondents were normal, while the remaining were underweight (6%) and overweight/obese (26.5%). Also, large proportion of respondents engaged in exclusive breastfeeding and with good knowledge of breastfeeding practices. Statistically, exclusive breastfeeding practices had no correlation between the BMI and frequency of

  18. Using the theory of reasoned action to determine physicians' intention to measure body mass index in children and adolescents.

    Science.gov (United States)

    Khanna, Rahul; Kavookjian, Jan; Scott, Virginia Ginger; Kamal, Khalid M; Miller, Lesley-Ann N; Neal, William A

    2009-06-01

    Over the past few decades, childhood obesity has become a major public health issue in the United States. Numerous public and professional organizations recommend that physicians periodically screen for obesity in children and adolescents using the body mass index (BMI). However, studies have shown that physicians infrequently measure BMI in children and adolescents. The purpose of this study was to use the theory of reasoned action (TRA) to explain physicians' intentions to measure BMI in children and adolescents. The study objectives were to (1) determine if attitude and subjective norm predict physicians' intention to measure BMI in children and adolescents; (2) determine if family physicians and pediatricians differ in terms of theoretical factors; and (3) assess differences in behavioral beliefs, outcome evaluations, normative beliefs, and motivation to comply among physicians based on their level of intention to measure BMI. A cross-sectional mailed survey of 2590 physicians (family physicians and pediatricians) practicing in 4 states was conducted. A self-administered questionnaire was designed that included items related to the TRA constructs. The association between the theoretical constructs was examined using correlation and regression analyses. Student's t test was used to determine differences between family physicians and pediatricians on theoretical constructs and to compare the underlying beliefs of nonintenders with intenders. The usable response rate was 22.8%. Less than half (44%) of the physicians strongly intended to measure BMI in children and adolescents. Together, the TRA constructs attitude and subjective norm explained up to 49.9% of the variance in intention. Pediatricians had a significantly (P<.01) higher intention to measure BMI as compared to family physicians. There were significant (P<.01) behavioral and normative belief differences between physicians who intend and those who do not intend to measure BMI. The TRA is a useful model

  19. PPARγ gene polymorphism, C-reactive protein level, BMI and periodontitis in post-menopausal Japanese women.

    Science.gov (United States)

    Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa

    2016-03-01

    Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.

  20. Smartphone based hemispherical photography for canopy structure measurement

    Science.gov (United States)

    Wan, Xuefen; Cui, Jian; Jiang, Xueqin; Zhang, Jingwen; Yang, Yi; Zheng, Tao

    2018-01-01

    The canopy is the most direct and active interface layer of the interaction between plant and environment, and has important influence on energy exchange, biodiversity, ecosystem matter and climate change. The measurement about canopy structure of plant is an important foundation to analyze the pattern, process and operation mechanism of forest ecosystem. Through the study of canopy structure of plant, solar radiation, ambient wind speed, air temperature and humidity, soil evaporation, soil temperature and other forest environmental climate characteristics can be evaluated. Because of its accuracy and effectiveness, canopy structure measurement based on hemispherical photography has been widely studied. However, the traditional method of canopy structure hemispherical photogrammetry based on SLR camera and fisheye lens. This method is expensive and difficult to be used in some low-cost occasions. In recent years, smartphone technology has been developing rapidly. The smartphone not only has excellent image acquisition ability, but also has the considerable computational processing ability. In addition, the gyroscope and positioning function on the smartphone will also help to measure the structure of the canopy. In this paper, we present a smartphone based hemispherical photography system. The system consists of smart phones, low-cost fisheye lenses and PMMA adapters. We designed an Android based App to obtain the canopy hemisphere images through low-cost fisheye lenses and provide horizontal collimation information. In addition, the App will add the acquisition location tag obtained by GPS and auxiliary positioning method in hemisphere image information after the canopy structure hemisphere image acquisition. The system was tested in the urban forest after it was completed. The test results show that the smartphone based hemispherical photography system can effectively collect the high-resolution canopy structure image of the plant.

  1. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  2. A Feature-Based Structural Measure: An Image Similarity Measure for Face Recognition

    Directory of Open Access Journals (Sweden)

    Noor Abdalrazak Shnain

    2017-08-01

    Full Text Available Facial recognition is one of the most challenging and interesting problems within the field of computer vision and pattern recognition. During the last few years, it has gained special attention due to its importance in relation to current issues such as security, surveillance systems and forensics analysis. Despite this high level of attention to facial recognition, the success is still limited by certain conditions; there is no method which gives reliable results in all situations. In this paper, we propose an efficient similarity index that resolves the shortcomings of the existing measures of feature and structural similarity. This measure, called the Feature-Based Structural Measure (FSM, combines the best features of the well-known SSIM (structural similarity index measure and FSIM (feature similarity index measure approaches, striking a balance between performance for similar and dissimilar images of human faces. In addition to the statistical structural properties provided by SSIM, edge detection is incorporated in FSM as a distinctive structural feature. Its performance is tested for a wide range of PSNR (peak signal-to-noise ratio, using ORL (Olivetti Research Laboratory, now AT&T Laboratory Cambridge and FEI (Faculty of Industrial Engineering, São Bernardo do Campo, São Paulo, Brazil databases. The proposed measure is tested under conditions of Gaussian noise; simulation results show that the proposed FSM outperforms the well-known SSIM and FSIM approaches in its efficiency of similarity detection and recognition of human faces.

  3. Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina

    Directory of Open Access Journals (Sweden)

    Angela D. Liese

    2017-09-01

    Full Text Available Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI. We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc. with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61% or supercenters/warehouse clubs (27%. Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should

  4. Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina

    Science.gov (United States)

    Liese, Angela D.; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A.; Bell, Bethany A.; Wilcox, Sara

    2017-01-01

    Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing

  5. Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina.

    Science.gov (United States)

    Liese, Angela D; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A; Bell, Bethany A; Wilcox, Sara

    2017-09-16

    Low-income areas in which residents have poor access to healthy foods have been referred to as "food deserts." It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m². The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one's primary store was significantly associated with a 2.6 kg/m² higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m² lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing

  6. Novel Schemes for Measurement-Based Quantum Computation

    International Nuclear Information System (INIS)

    Gross, D.; Eisert, J.

    2007-01-01

    We establish a framework which allows one to construct novel schemes for measurement-based quantum computation. The technique develops tools from many-body physics--based on finitely correlated or projected entangled pair states--to go beyond the cluster-state based one-way computer. We identify resource states radically different from the cluster state, in that they exhibit nonvanishing correlations, can be prepared using nonmaximally entangling gates, or have very different local entanglement properties. In the computational models, randomness is compensated in a different manner. It is shown that there exist resource states which are locally arbitrarily close to a pure state. We comment on the possibility of tailoring computational models to specific physical systems

  7. Novel schemes for measurement-based quantum computation.

    Science.gov (United States)

    Gross, D; Eisert, J

    2007-06-01

    We establish a framework which allows one to construct novel schemes for measurement-based quantum computation. The technique develops tools from many-body physics-based on finitely correlated or projected entangled pair states-to go beyond the cluster-state based one-way computer. We identify resource states radically different from the cluster state, in that they exhibit nonvanishing correlations, can be prepared using nonmaximally entangling gates, or have very different local entanglement properties. In the computational models, randomness is compensated in a different manner. It is shown that there exist resource states which are locally arbitrarily close to a pure state. We comment on the possibility of tailoring computational models to specific physical systems.

  8. Trend in BMI z-score among Private Schools’ Students in Delhi using Multiple Imputation for Growth Curve Model

    Directory of Open Access Journals (Sweden)

    Vinay K Gupta

    2016-06-01

    Full Text Available Objective: The aim of the study is to assess the trend in mean BMI z-score among private schools’ students from their anthropometric records when there were missing values in the outcome. Methodology: The anthropometric measurements of student from class 1 to 12 were taken from the records of two private schools in Delhi, India from 2005 to 2010. These records comprise of an unbalanced longitudinal data that is not all the students had measurements recorded at each year. The trend in mean BMI z-score was estimated through growth curve model. Prior to that, missing values of BMI z-score were imputed through multiple imputation using the same model. A complete case analysis was also performed after excluding missing values to compare the results with those obtained from analysis of multiply imputed data. Results: The mean BMI z-score among school student significantly decreased over time in imputed data (β= -0.2030, se=0.0889, p=0.0232 after adjusting age, gender, class and school. Complete case analysis also shows a decrease in mean BMI z-score though it was not statistically significant (β= -0.2861, se=0.0987, p=0.065. Conclusions: The estimates obtained from multiple imputation analysis were better than those of complete data after excluding missing values in terms of lower standard errors. We showed that anthropometric measurements from schools records can be used to monitor the weight status of children and adolescents and multiple imputation using growth curve model can be useful while analyzing such data

  9. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  10. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  11. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  12. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  13. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  14. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  15. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  16. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  17. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  18. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  19. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  20. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  1. Developing safety performance functions incorporating reliability-based risk measures.

    Science.gov (United States)

    Ibrahim, Shewkar El-Bassiouni; Sayed, Tarek

    2011-11-01

    Current geometric design guides provide deterministic standards where the safety margin of the design output is generally unknown and there is little knowledge of the safety implications of deviating from these standards. Several studies have advocated probabilistic geometric design where reliability analysis can be used to account for the uncertainty in the design p