Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Directory of Open Access Journals (Sweden)
Dorcas J Orengo
Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.
Directory of Open Access Journals (Sweden)
Alonso Ángel
2006-03-01
Full Text Available Abstract Background Papillomaviruses (PVs infect stratified squamous epithelia in warm-blooded vertebrates and have undergone a complex evolutionary process. The control of the expression of the early ORFs in PVs depends on the binding of cellular and viral transcription factors to the upstream regulatory region (URR of the virus. It is believed that there is a core of transcription factor binding sites (TFBS common to all PVs, with additional individual differences, although most of the available information focuses only on a handful of viruses. Results We have studied the URR of sixty-one PVs, covering twenty different hosts. We have predicted the TFBS present in the URR and analysed these results by principal component analysis and genetic algorithms. The number and nature of TFBS in the URR might be much broader than thus far described, and different PVs have different repertoires of TFBS. Conclusion There are common fingerprints in the URR in PVs that infect primates, although the ancestors of these viruses diverged a long time ago. Additionally, there are obvious differences between the URR of alpha and beta PVs, despite these PVs infect similar histological cell types in the same host, i.e. human. A thorough analysis of the TFBS in the URR might provide crucial information about the differential biology of cancer-associated PVs.
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
International Nuclear Information System (INIS)
Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.
1987-01-01
Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Conservation of the LexA repressor binding site in Deinococcus radiodurans
Directory of Open Access Journals (Sweden)
Khan Feroz
2008-03-01
Full Text Available The LexA protein is a transcriptional repressor of the bacterial SOS DNA repair system, which comprises a set of DNA repair and cellular survival genes that are induced in response to DNA damage. Its varied DNA binding motifs have been characterized and reported in the Escherichia coli, Bacillus subtilis, rhizobia family members, marine magnetotactic bacterium, Salmonella typhimurium and recently in Mycobacterium tuberculosis and this motifs information has been used in our theoretical analysis to detect its novel regulated genes in radio-resistant Deinococcus radiodurans genome. This bacterium showed presence of SOS-box like consensus sequence in the upstream sequences of 3166 genes with >60% motif score similarity percentage (MSSP on both strands. Attempts to identify LexA-binding sites and the composition of the putative SOS regulon in D. radiodurans have been unsuccessful so far. To resolve the problem we performed theoretical analysis with modifications on reported data set of genes related to DNA repair (61 genes, stress response (145 genes and some unusual predicted operons (21 clusters. Expression of some of the predicted SOS-box regulated operon members then was examined through the previously reported microarray data which confirm the expression of only single predicted operon i.e. DRB0143 (AAA superfamily NTPase related to 5-methylcytosine specific restriction enzyme subunit McrB and DRB0144 (homolog of the McrC subunit of the McrBC restriction modification system. The methodology involved weight matrix construction through CONSENSUS algorithm using information of conserved upstream sequences of eight known genes including dinB, tagC, lexA, recA, uvrB, yneA of B. subtilis while lexA and recA of D. radiodurans through phylogenetic footprinting method and later detection of similar conserved SOS-box like LexA binding motifs through both RSAT & PoSSuMsearch programs. The resultant DNA consensus sequence had highly conserved 14 bp SOS
[3]tetrahydrotrazodone binding. Association with serotonin binding sites
International Nuclear Information System (INIS)
Kendall, D.A.; Taylor, D.P.; Enna, S.J.
1983-01-01
High (17 nM) and low (603 nM) affinity binding sites for [ 3 ]tetrahydrotrazodone ([ 3 ] THT), a biologically active analogue of trazodone, have been identified in rat brain membranes. The substrate specificity, concentration, and subcellular and regional distributions of these sites suggest that they may represent a component of the serotonin transmitter system. Pharmacological analysis of [ 3 ]THT binding, coupled with brain lesion and drug treatment experiments, revealed that, unlike other antidepressants, [ 3 ] THT does not attach to either a biogenic amine transporter or serotonin binding sites. Rather, it would appear that [ 3 ]THT may be an antagonist ligand for the serotonin binding site. This probe may prove of value in defining the mechanism of action of trazodone and in further characterizing serotonin receptors
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open
Thioredoxin binding site of phosphoribulokinase overlaps the catalytic site
International Nuclear Information System (INIS)
Porter, M.A.; Hartman, F.C.
1986-01-01
The ATP-regulatory binding site of phosphoribulokinase was studied using bromoacetylethanolamine phosphate (BrAcNHEtOP). BrAcNHEtOP binds to the active-regulatory binding site of the protein. Following trypsin degradation of the labeled protein, fragments were separated by HPLC and sequenced. (DT)
Directory of Open Access Journals (Sweden)
Hasnain Seyed
2004-09-01
Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase
LIBRA: LIgand Binding site Recognition Application.
Hung, Le Viet; Caprari, Silvia; Bizai, Massimiliano; Toti, Daniele; Polticelli, Fabio
2015-12-15
In recent years, structural genomics and ab initio molecular modeling activities are leading to the availability of a large number of structural models of proteins whose biochemical function is not known. The aim of this study was the development of a novel software tool that, given a protein's structural model, predicts the presence and identity of active sites and/or ligand binding sites. The algorithm implemented by ligand binding site recognition application (LIBRA) is based on a graph theory approach to find the largest subset of similar residues between an input protein and a collection of known functional sites. The algorithm makes use of two predefined databases for active sites and ligand binding sites, respectively, derived from the Catalytic Site Atlas and the Protein Data Bank. Tests indicate that LIBRA is able to identify the correct binding/active site in 90% of the cases analyzed, 90% of which feature the identified site as ranking first. As far as ligand binding site recognition is concerned, LIBRA outperforms other structure-based ligand binding sites detection tools with which it has been compared. The application, developed in Java SE 7 with a Swing GUI embedding a JMol applet, can be run on any OS equipped with a suitable Java Virtual Machine (JVM), and is available at the following URL: http://www.computationalbiology.it/software/LIBRAv1.zip. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Adaptive evolution of transcription factor binding sites
Directory of Open Access Journals (Sweden)
Berg Johannes
2004-10-01
Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.
Bitopic Ligands and Metastable Binding Sites
DEFF Research Database (Denmark)
Fronik, Philipp; Gaiser, Birgit I; Sejer Pedersen, Daniel
2017-01-01
of orthosteric binding sites. Bitopic ligands have been employed to address the selectivity problem by combining (linking) an orthosteric ligand with an allosteric modulator, theoretically leading to high-affinity subtype selective ligands. However, it remains a challenge to identify suitable allosteric binding...... that have been reported to date, this type of bitopic ligands would be composed of two identical pharmacophores. Herein, we outline the concept of bitopic ligands, review metastable binding sites, and discuss their potential as a new source of allosteric binding sites....
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Bax, Daniel V; Mahalingam, Yashithra; Cain, Stuart
2007-01-01
We have defined the molecular basis of cell adhesion to fibrillin-1, the major structural component of extracellular microfibrils that are associated with elastic fibres. Using human dermal fibroblasts, and recombinant domain swap fragments containing the Arg-Gly-Asp motif, we have demonstrated...... a requirement for upstream domains for integrin-alpha(5)beta(1)-mediated cell adhesion and migration. An adjacent heparin-binding site, which supports focal adhesion formation, was mapped to the fibrillin-1 TB5 motif. Site-directed mutagenesis revealed two arginine residues that are crucial for heparin binding...
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter
International Nuclear Information System (INIS)
Dahabieh, Matthew S.; Ooms, Marcel; Malcolm, Tom; Simon, Viviana; Sadowski, Ivan
2011-01-01
Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutations in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
International Nuclear Information System (INIS)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.; Holan, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial [ 3 H]diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli [ 3 H]diazepam binding are those that are active in displacing [ 3 H]benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligand spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Mu opioid receptor binding sites in human brain
International Nuclear Information System (INIS)
Pilapil, C.; Welner, S.; Magnan, J.; Zamir, N.; Quirion, R.
1986-01-01
Our experiments focused on the examination of the distribution of mu opioid receptor binding sites in normal human brain using the highly selective ligand [ 3 H]DAGO, in both membrane binding assay and in vitro receptor autoradiography. Mu opioid binding sites are very discretely distributed in human brain with high densities of sites found in the posterior amygdala, caudate, putamen, hypothalamus and certain cortical areas. Moreover the autoradiographic distribution of [ 3 H]DAGO binding sites clearly reveals the discrete lamination (layers I and III-IV) of mu sites in cortical areas
Yasuhiko, Yukuto; Kitajima, Satoshi; Takahashi, Yu; Oginuma, Masayuki; Kagiwada, Harumi; Kanno, Jun; Saga, Yumiko
2008-11-01
The T-box transcription factor Tbx6 controls the expression of Mesp2, which encodes a basic helix-loop-helix transcription factor that has crucial roles in somitogenesis. In cultured cells, Tbx6 binding to the Mesp2 enhancer region is essential for the activation of Mesp2 by Notch signaling. However, it is not known whether this binding is required in vivo. Here we report that an Mesp2 enhancer knockout mouse bearing mutations in two crucial Tbx6 binding sites does not express Mesp2 in the presomitic mesoderm. This absence leads to impaired skeletal segmentation identical to that reported for Mesp2-null mice, indicating that these Tbx6 binding sites are indispensable for Mesp2 expression. T-box binding to the consensus sequences in the Mesp2 upstream region was confirmed by chromatin immunoprecipitation assays. Further enhancer analyses indicated that the number and spatial organization of the T-box binding sites are critical for initiating Mesp2 transcription via Notch signaling. We also generated a knock-in mouse in which the endogenous Mesp2 enhancer was replaced by the core enhancer of medaka mespb, an ortholog of mouse Mesp2. The homozygous enhancer knock-in mouse was viable and showed normal skeletal segmentation, indicating that the medaka mespb enhancer functionally replaced the mouse Mesp2 enhancer. These results demonstrate that there is significant evolutionary conservation of Mesp regulatory mechanisms between fish and mice.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
LIGAND-BINDING SITES ON THE MYCOBACTERIUM TUBERCULOSIS UREASE
Directory of Open Access Journals (Sweden)
Lisnyak Yu. V.
2017-10-01
Full Text Available Introduction. Mycobacterium tuberculosis is the causative agent of tuberculosis that remains a serious medical and social health problem. Despite intensive efforts have been made in the past decade, there are no new efficient anti-tuberculosis drugs today, and that need is growing due to the spread of drug-resistant strains of M.tuberculosis. M. tuberculosis urease (MTU, being an important factor of the bacterium viability and virulence, is an attractive target for anti-tuberculosis drugs acting by inhibition of urease activity. However, the commercially available urease inhibitors are toxic and unstable, that prevent their clinical use. Therefore, new more potent anti-tuberculosis drugs inhibiting new targets are urgently needed. A useful tool for the search of novel inhibitors is a computational drug design. The inhibitor design is significantly easier if binding sites on the enzyme are identified in advance. This paper aimed to determine the probable ligand binding sites on the surface of M. tuberculosis urease. Methods. To identify ligand binding sites on MTU surface, сomputational solvent mapping method FTSite was applied by the use of MTU homology model we have built earlier. The method places molecular probes (small organic molecules containing various functional groups on a dense grid defined around the enzyme, and for each probe finds favorable positions. The selected poses are refined by free energy minimization, the low energy conformations are clustered, and the clusters are ranked on the basis of the average free energy. FTSite server outputs the protein residues delineating a binding sites and the probe molecules representing each cluster. To predict allosteric pockets on MTU, AlloPred and AlloSite servers were applied. AlloPred uses the normal mode analysis (NMA and models how the dynamics of a protein would be altered in the presence of a modulator at a specific pocket. Pockets on the enzyme are predicted using the Fpocket
RBPmap: a web server for mapping binding sites of RNA-binding proteins.
Paz, Inbal; Kosti, Idit; Ares, Manuel; Cline, Melissa; Mandel-Gutfreund, Yael
2014-07-01
Regulation of gene expression is executed in many cases by RNA-binding proteins (RBPs) that bind to mRNAs as well as to non-coding RNAs. RBPs recognize their RNA target via specific binding sites on the RNA. Predicting the binding sites of RBPs is known to be a major challenge. We present a new webserver, RBPmap, freely accessible through the website http://rbpmap.technion.ac.il/ for accurate prediction and mapping of RBP binding sites. RBPmap has been developed specifically for mapping RBPs in human, mouse and Drosophila melanogaster genomes, though it supports other organisms too. RBPmap enables the users to select motifs from a large database of experimentally defined motifs. In addition, users can provide any motif of interest, given as either a consensus or a PSSM. The algorithm for mapping the motifs is based on a Weighted-Rank approach, which considers the clustering propensity of the binding sites and the overall tendency of regulatory regions to be conserved. In addition, RBPmap incorporates a position-specific background model, designed uniquely for different genomic regions, such as splice sites, 5' and 3' UTRs, non-coding RNA and intergenic regions. RBPmap was tested on high-throughput RNA-binding experiments and was proved to be highly accurate. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Autoradiographic localization of benzomorphan binding sites in rat brain
Energy Technology Data Exchange (ETDEWEB)
Crain, B.J.; Kwenjen Chang; McNamara, J.O.; Valdes, F.
1985-07-17
The benzomorphan subpopulation of opiate binding sites was labeled by (TH)diprenorphine in the presence of unlabeled ligands selected to quench and delta opiate binding sites. The distribution of benzomorphan binding sites was then localized autoradiographically. The distribution differs from the distributions of , delta and kappa opiate binding and is quite similar to the distribution of US -endorphin immunoreactivity. These observations support the hypothesis, based on biochemical studies in brain membranes, that benzomorphan binding sites may represent the ligand recognition sites of putative epsilon receptors. (Auth.). 34 refs.; 3 figs.
Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan
2013-01-01
Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
Energy Technology Data Exchange (ETDEWEB)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.; Stemmler, T.L.; Gil, J.A.; Mateos, L.M.; Rosen, B.P.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, and the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.
Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.
Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M
2016-01-13
Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Domain-based small molecule binding site annotation
Directory of Open Access Journals (Sweden)
Dumontier Michel
2006-03-01
Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By
Energy Technology Data Exchange (ETDEWEB)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C. (Parke-Davis Research Unit, Addenbrookes Hospital Site, Cambridge (England))
1991-07-01
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE bound with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.
Detection of secondary binding sites in proteins using fragment screening.
Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren
2015-12-29
Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.
Cost-efficient remediation of an upstream oilfield battery site
Energy Technology Data Exchange (ETDEWEB)
Siebert, L.D. [Imperial Oil Resources Canada, Calgary, AB (Canada); Bedard, G.; Pouliot, M.; Soucy, F.; Faucher, C.; Corbin, R. [Biogenie Inc., Quebec City, PQ (Canada)
2003-07-01
The soil at an oilfield battery site, located 18 kilometres (km) northwest of Devon, Alberta has been contaminated with crude oil and salt, following years of operation. Surrounding the site is flat farmland intended for future agricultural production. A remedial program aimed at complying with Tier I criteria of the Alberta Soil and Water Quality Guidelines for Hydrocarbons at Upstream Oil and Gas Facilities (ASWQG) of Alberta Environment, was developed and implemented. Characterization of the site was carried out in 1997 to delineate a salt plume, followed by a second sampling campaign in 1999, which all together revealed three impacted areas. A supplementary characterization was performed in 2001 by Biogenie in an effort to better determine the nature and level of petroleum contamination and more accurately evaluate the volume of contaminated soil. A three-dimensional Visualization software integrating a Kriging geostatistical model was used for this purpose. The results indicated that an estimated 8,800 cubic metres of contaminated soil would need to be excavated and treated. The next phase involved an evaluation of the various remedial options, which was accomplished using a biotreatability study. The remediation program selected involved the excavation of the contaminated soil and segregation of source material, the ex-situ Biopile treatment of the source material to meet Class II landfill criteria, and the ex-situ Biopile treatment of the contaminated soil followed by its use as backfill on site. The biotreatability study proved to be a strategic tool in the remediation effort. 1 tab., 2 figs.
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
Energy Technology Data Exchange (ETDEWEB)
Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)
2014-07-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
International Nuclear Information System (INIS)
Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.
2014-01-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states
An overview of the prediction of protein DNA-binding sites.
Si, Jingna; Zhao, Rui; Wu, Rongling
2015-03-06
Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.
Binding-site assessment by virtual fragment screening.
Directory of Open Access Journals (Sweden)
Niu Huang
2010-04-01
Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.
An Overview of the Prediction of Protein DNA-Binding Sites
Directory of Open Access Journals (Sweden)
Jingna Si
2015-03-01
Full Text Available Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.
Localization of gonadotropin binding sites in human ovarian neoplasms
International Nuclear Information System (INIS)
Nakano, R.; Kitayama, S.; Yamoto, M.; Shima, K.; Ooshima, A.
1989-01-01
The binding of human luteinizing hormone and human follicle-stimulating hormone to ovarian tumor biopsy specimens from 29 patients was analyzed. The binding sites for human luteinizing hormone were demonstrated in one tumor of epithelial origin (mucinous cystadenoma) and in one of sex cord-stromal origin (theca cell tumor). The binding sites for human follicle-stimulating hormone were found in three tumors of epithelial origin (serous cystadenoma and mucinous cystadenoma) and in two of sex cord-stromal origin (theca cell tumor and theca-granulosa cell tumor). The surface-binding autoradiographic study revealed that the binding sites for gonadotropins were localized in the stromal tissue. The results suggest that gonadotropic hormones may play a role in the growth and differentiation of a certain type of human ovarian neoplasms
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
A tool for calculating binding-site residues on proteins from PDB structures
Directory of Open Access Journals (Sweden)
Hu Jing
2009-08-01
Full Text Available Abstract Background In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB that consists of the protein of interest and its interacting partner(s and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. Results In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. Conclusion The developed tool is very useful for the research on protein binding site analysis and prediction.
Directory of Open Access Journals (Sweden)
Oscar Harari
2010-07-01
Full Text Available Transcriptional regulators recognize specific DNA sequences. Because these sequences are embedded in the background of genomic DNA, it is hard to identify the key cis-regulatory elements that determine disparate patterns of gene expression. The detection of the intra- and inter-species differences among these sequences is crucial for understanding the molecular basis of both differential gene expression and evolution. Here, we address this problem by investigating the target promoters controlled by the DNA-binding PhoP protein, which governs virulence and Mg(2+ homeostasis in several bacterial species. PhoP is particularly interesting; it is highly conserved in different gamma/enterobacteria, regulating not only ancestral genes but also governing the expression of dozens of horizontally acquired genes that differ from species to species. Our approach consists of decomposing the DNA binding site sequences for a given regulator into families of motifs (i.e., termed submotifs using a machine learning method inspired by the "Divide & Conquer" strategy. By partitioning a motif into sub-patterns, computational advantages for classification were produced, resulting in the discovery of new members of a regulon, and alleviating the problem of distinguishing functional sites in chromatin immunoprecipitation and DNA microarray genome-wide analysis. Moreover, we found that certain partitions were useful in revealing biological properties of binding site sequences, including modular gains and losses of PhoP binding sites through evolutionary turnover events, as well as conservation in distant species. The high conservation of PhoP submotifs within gamma/enterobacteria, as well as the regulatory protein that recognizes them, suggests that the major cause of divergence between related species is not due to the binding sites, as was previously suggested for other regulators. Instead, the divergence may be attributed to the fast evolution of orthologous target
Site-directed alkylation of multiple opioid receptors. I. Binding selectivity
International Nuclear Information System (INIS)
James, I.F.; Goldstein, A.
1984-01-01
A method for measuring and expressing the binding selectivity of ligands for mu, delta, and kappa opioid binding sites is reported. Radioligands are used that are partially selective for these sites in combination with membrane preparations enriched in each site. Enrichment was obtained by treatment of membranes with the alkylating agent beta-chlornaltrexamine in the presence of appropriate protecting ligands. After enrichment for mu receptors, [ 3 H] dihydromorphine bound to a single type of site as judged by the slope of competition binding curves. After enrichment for delta or kappa receptors, binding sites for [ 3 H] [D-Ala2, D-Leu5]enkephalin and [3H]ethylketocyclazocine, respectively, were still not homogeneous. There were residual mu sites in delta-enriched membranes but no evidence for residual mu or delta sites in kappa-enriched membranes were found. This method was used to identify ligands that are highly selective for each of the three types of sites
DeepSite: protein-binding site predictor using 3D-convolutional neural networks.
Jiménez, J; Doerr, S; Martínez-Rosell, G; Rose, A S; De Fabritiis, G
2017-10-01
An important step in structure-based drug design consists in the prediction of druggable binding sites. Several algorithms for detecting binding cavities, those likely to bind to a small drug compound, have been developed over the years by clever exploitation of geometric, chemical and evolutionary features of the protein. Here we present a novel knowledge-based approach that uses state-of-the-art convolutional neural networks, where the algorithm is learned by examples. In total, 7622 proteins from the scPDB database of binding sites have been evaluated using both a distance and a volumetric overlap approach. Our machine-learning based method demonstrates superior performance to two other competitive algorithmic strategies. DeepSite is freely available at www.playmolecule.org. Users can submit either a PDB ID or PDB file for pocket detection to our NVIDIA GPU-equipped servers through a WebGL graphical interface. gianni.defabritiis@upf.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites.
Directory of Open Access Journals (Sweden)
Daniel M Dupont
Full Text Available Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126 with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA. We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A controlling uPA activities. One of the aptamers (upanap-126 binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12 binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and
Suspended sediments from upstream tributaries as the source of downstream river sites
Haddadchi, Arman; Olley, Jon
2014-05-01
Understanding the efficiency with which sediment eroded from different sources is transported to the catchment outlet is a key knowledge gap that is critical to our ability to accurately target and prioritise management actions to reduce sediment delivery. Sediment fingerprinting has proven to be an efficient approach to determine the sources of sediment. This study examines the suspended sediment sources from Emu Creek catchment, south eastern Queensland, Australia. In addition to collect suspended sediments from different sites of the streams after the confluence of tributaries and outlet of the catchment, time integrated suspended samples from upper tributaries were used as the source of sediment, instead of using hillslope and channel bank samples. Totally, 35 time-integrated samplers were used to compute the contribution of suspended sediments from different upstream waterways to the downstream sediment sites. Three size fractions of materials including fine sand (63-210 μm), silt (10-63 μm) and fine silt and clay (<10 μm) were used to find the effect of particle size on the contribution of upper sediments as the sources of sediment after river confluences. And then samples were analysed by ICP-MS and -OES to find 41 sediment fingerprints. According to the results of Student's T-distribution mixing model, small creeks in the middle and lower part of the catchment were major source in different size fractions, especially in silt (10-63 μm) samples. Gowrie Creek as covers southern-upstream part of the catchment was a major contributor at the outlet of the catchment in finest size fraction (<10 μm) Large differences between the contributions of suspended sediments from upper tributaries in different size fractions necessitate the selection of appropriate size fraction on sediment tracing in the catchment and also major effect of particle size on the movement and deposition of sediments.
Multiple [3H]-nemonapride binding sites in calf brain.
Helmeste, D M; Tang, S W; Li, M; Fang, H
1997-07-01
[3H]-Nemonapride has been the ligand of choice to label D4 dopamine receptors. Its specificity was questioned when it was discovered that sigma (sigma) sites were also labeled by [3H]-nemonapride. To further characterize the binding of [3H]-nemonapride, three areas of calf brain (striatum, frontal cortex and cerebellum) were examined. In all three areas, [3H]-nemonapride labeled multiple sites. Dopaminergic and sigma sites were the most prominent. The sigma binding profile was sigma-1 like with a Ki binding profile as follows (in order of decreasing potency): haloperidol, PPAP, pentazocine, DTG, U-50488, R(+)-3-PPP. Experiments using sulpiride and pentazocine to block striatal dopaminergic and sigma sites, respectively, revealed additional, not previously characterized binding sites for [3H]-nemonapride. One component which was present in striatum but not in frontal cortex or cerebellum, had affinity for some neuroleptics and WB-4101, but not for typical serotonergic agents. Thus, [3H]-nemonapride has no selectivity for dopamine receptors unless stringent experimental conditions are met.
Gibiansky, Leonid; Gibiansky, Ekaterina
2017-10-01
The paper extended the TMDD model to drugs with two identical binding sites (2-1 TMDD). The quasi-steady-state (2-1 QSS), quasi-equilibrium (2-1 QE), irreversible binding (2-1 IB), and Michaelis-Menten (2-1 MM) approximations of the model were derived. Using simulations, the 2-1 QSS approximation was compared with the full 2-1 TMDD model. As expected and similarly to the standard TMDD for monoclonal antibodies (mAb), 2-1 QSS predictions were nearly identical to 2-1 TMDD predictions, except for times of fast changes following initiation of dosing, when equilibrium has not yet been reached. To illustrate properties of new equations and approximations, several variations of population PK data for mAbs with soluble (slow elimination of the complex) or membrane-bound (fast elimination of the complex) targets were simulated from a full 2-1 TMDD model and fitted to 2-1 TMDD models, to its approximations, and to the standard (1-1) QSS model. For a mAb with a soluble target, it was demonstrated that the 2-1 QSS model provided nearly identical description of the observed (simulated) free drug and total target concentrations, although there was some minor bias in predictions of unobserved free target concentrations. The standard QSS approximation also provided a good description of the observed data, but was not able to distinguish between free drug concentrations (with no target attached and both binding site free) and partially bound drug concentrations (with one of the binding sites occupied by the target). For a mAb with a membrane-bound target, the 2-1 MM approximation adequately described the data. The 2-1 QSS approximation converged 10 times faster than the full 2-1 TMDD, and its run time was comparable with the standard QSS model.
Structural Fingerprints of Transcription Factor Binding Site Regions
Directory of Open Access Journals (Sweden)
Peter Willett
2009-03-01
Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.
Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord
1984-11-30
MEDICAL CENTER WILFORD HALL AIR FORCE MEDICAL CENTER Title of Thesis: "Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord" Name of...that the use of any copyrighted material in the dissertation manuscript entitled: "Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord...University of the Health Sciences 11 Abstract Title of Thesis: Heterogenity of Opioid Binding Sites In Guinea Pig Spinal Cord Gary Dean Zarr MAJ/ANC
Human chorionic ganodotropin binding sites in the human endometrium
International Nuclear Information System (INIS)
Bhattacharya, S.; Banerjee, J.; Sen, S.; Manna, P.R.
1993-01-01
The existence of high-affinity and low-capacity specific binding sites for luteinizing hormone/human chorionic gonadotropin (hCG) has been reported in porcine, rabbit and rat uteri. The authors have identified the hCG binding sites in the human endometrium collected from 35-42-year-old ovulatory and anovulatory women. The binding characteristics of hCG to endometrial tissue preparations from ovulatory and anovulatory women showed saturability with high affinity and low capacity. Scatchard plot analysis showed the dissociation constant of specific binding sites in the ovulatory women to be 3.5x10 -10 mol/l and in anovulatory women to be 3.1x10 -10 mol/l. The maximum binding capacity varied considerably between ovulatory and anovulatory endometrium. Among the divalent metal ions tested Zn 2+ effected a remarkable increase in [ 125 I]hCG binding to the endometrium, whereas Mn 2+ showed a marginal increase and other metal ions did not have any effect. Data obtained with human endometrium indicate an influence of the functional state of the ovary on [ 125 I]hCG binding to endometrium. 14 refs., 3 figs
Transcription factor binding sites prediction based on modified nucleosomes.
Directory of Open Access Journals (Sweden)
Mohammad Talebzadeh
Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Directory of Open Access Journals (Sweden)
Masfique Mehedi
Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz
2013-01-01
Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
International Nuclear Information System (INIS)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-01-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective 125 I-labeled OT antagonist ( 125 I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of 125 I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experiments showed first that 125 I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
Energy Technology Data Exchange (ETDEWEB)
Stoeckel, M.E.; Freund-Mercier, M.J. (Centre National de la Recherche Scientifique, Strasbourg (France))
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experiments showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.
Receptor-ligand binding sites and virtual screening.
Hattotuwagama, Channa K; Davies, Matthew N; Flower, Darren R
2006-01-01
Within the pharmaceutical industry, the ultimate source of continuing profitability is the unremitting process of drug discovery. To be profitable, drugs must be marketable: legally novel, safe and relatively free of side effects, efficacious, and ideally inexpensive to produce. While drug discovery was once typified by a haphazard and empirical process, it is now increasingly driven by both knowledge of the receptor-mediated basis of disease and how drug molecules interact with receptors and the wider physiome. Medicinal chemistry postulates that to understand a congeneric ligand series, or set thereof, is to understand the nature and requirements of a ligand binding site. Likewise, structural molecular biology posits that to understand a binding site is to understand the nature of ligands bound therein. Reality sits somewhere between these extremes, yet subsumes them both. Complementary to rules of ligand design, arising through decades of medicinal chemistry, structural biology and computational chemistry are able to elucidate the nature of binding site-ligand interactions, facilitating, at both pragmatic and conceptual levels, the drug discovery process.
Probing binding hot spots at protein-RNA recognition sites.
Barik, Amita; Nithin, Chandran; Karampudi, Naga Bhushana Rao; Mukherjee, Sunandan; Bahadur, Ranjit Prasad
2016-01-29
We use evolutionary conservation derived from structure alignment of polypeptide sequences along with structural and physicochemical attributes of protein-RNA interfaces to probe the binding hot spots at protein-RNA recognition sites. We find that the degree of conservation varies across the RNA binding proteins; some evolve rapidly compared to others. Additionally, irrespective of the structural class of the complexes, residues at the RNA binding sites are evolutionary better conserved than those at the solvent exposed surfaces. For recognitions involving duplex RNA, residues interacting with the major groove are better conserved than those interacting with the minor groove. We identify multi-interface residues participating simultaneously in protein-protein and protein-RNA interfaces in complexes where more than one polypeptide is involved in RNA recognition, and show that they are better conserved compared to any other RNA binding residues. We find that the residues at water preservation site are better conserved than those at hydrated or at dehydrated sites. Finally, we develop a Random Forests model using structural and physicochemical attributes for predicting binding hot spots. The model accurately predicts 80% of the instances of experimental ΔΔG values in a particular class, and provides a stepping-stone towards the engineering of protein-RNA recognition sites with desired affinity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Using TESS to predict transcription factor binding sites in DNA sequence.
Schug, Jonathan
2008-03-01
This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.
Pactamycin binding site on archaebacterial and eukaryotic ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.G.
1987-01-01
The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics
Bifunctional avidin with covalently modifiable ligand binding site.
Directory of Open Access Journals (Sweden)
Jenni Leppiniemi
Full Text Available The extensive use of avidin and streptavidin in life sciences originates from the extraordinary tight biotin-binding affinity of these tetrameric proteins. Numerous studies have been performed to modify the biotin-binding affinity of (streptavidin to improve the existing applications. Even so, (streptavidin greatly favours its natural ligand, biotin. Here we engineered the biotin-binding pocket of avidin with a single point mutation S16C and thus introduced a chemically active thiol group, which could be covalently coupled with thiol-reactive molecules. This approach was applied to the previously reported bivalent dual chain avidin by modifying one binding site while preserving the other one intact. Maleimide was then coupled to the modified binding site resulting in a decrease in biotin affinity. Furthermore, we showed that this thiol could be covalently coupled to other maleimide derivatives, for instance fluorescent labels, allowing intratetrameric FRET. The bifunctional avidins described here provide improved and novel tools for applications such as the biofunctionalization of surfaces.
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Directory of Open Access Journals (Sweden)
Keishi Yamasaki
Full Text Available A wide variety of drugs bind to human serum albumin (HSA at its two principal sites, namely site I and site II. A number of reports indicate that drug binding to these two binding sites are not completely independent, and that interactions between ligands of these two discrete sites can play a role. In this study, the effect of the binding of long-chain fatty acids on the interactive binding between dansyl-L-asparagine (DNSA; site I ligand and ibuprofen (site II ligand at pH6.5 was examined. Binding experiments showed that the binding of sodium oleate (Ole to HSA induces conformational changes in the molecule, which, in turn, changes the individual binding of DNSA and ibuprofen, as well as the mode of interaction between these two ligands from a 'competitive-like' allosteric interaction in the case of the defatted HSA conformer to a 'nearly independent' binding in the case of non-defatted HSA conformer. Circular dichroism measurements indicated that ibuprofen and Ole are likely to modify the spatial orientation of DNSA at its binding site. Docking simulations suggest that the long-distance electric repulsion between DNSA and ibuprofen on defatted HSA contributes to a 'competitive-like' allosteric interaction, whereas extending the distance between ligands and/or increasing the flexibility or size of the DNSA binding site in fatted HSA evokes a change in the interaction mode to 'nearly independent' binding. The present findings provide further insights into the structural dynamics of HSA upon the binding of fatty acids, and its effects on drug binding and drug-drug interactions that occur on HSA.
Oligomycin frames a common drug-binding site in the ATP synthase
Energy Technology Data Exchange (ETDEWEB)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric; Mueller, David M. (Rosalind)
2015-12-01
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100% conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.
Demonstration of specific binding sites for 3H-RRR-alpha-tocopherol on human erythrocytes
International Nuclear Information System (INIS)
Kitabchi, A.E.; Wimalasena, J.
1982-01-01
Previous work from our laboratory demonstrated specific binding sites for 3 H-RRR-alpha-tocopherol ( 3 H-d alpha T) in membranes of rat adrenal cells. As tocopherol deficiency is associated with increased susceptibility of red blood cells to hemolysis, we investigated tocopherol binding sites in human RBCs. Erythrocytes were found to have specific binding sites for 3 H-d alpha T that exhibited saturability and time and cell-concentration dependence as well as reversibility of binding. Kinetic studies of binding demonstrated two binding sites--one with high affinity (Ka of 2.6 x 10(7) M-1), low capacity (7,600 sites per cell) and the other with low affinity (1.2 x 10(6) M-1), high capacity (150,000 sites per cell). In order to localize the binding sites further, RBCs were fractionated and greater than 90% of the tocopherol binding was located in the membranes. Similar to the findings in intact RBCs, the membranes exhibited two binding sites with a respective Ka of 3.3 x 10(7) M-1 and 1.5 x 10(6) M-1. Specificity data for binding demonstrated 10% binding for RRR-gamma-tocopherol, but not other tocopherol analog exhibited competition for 3 H-d alpha T binding sites. Instability data suggested a protein nature for these binding sites. Preliminary studies on Triton X-100 solubilized fractions resolved the binding sites to a major component with an Mr of 65,000 and a minor component with an Mr of 125,000. We conclude that human erythrocyte membranes contain specific binding sites for RRR-alpha-tocopherol. These sites may be of physiologic significance in the function of tocopherol on the red blood cell membrane
Position specific variation in the rate of evolution intranscription factor binding sites
Energy Technology Data Exchange (ETDEWEB)
Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.
2003-08-28
The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative
Characterization of a second ligand binding site of the insulin receptor
International Nuclear Information System (INIS)
Hao Caili; Whittaker, Linda; Whittaker, Jonathan
2006-01-01
Insulin binding to its receptor is characterized by high affinity, curvilinear Scatchard plots, and negative cooperativity. These properties may be the consequence of binding of insulin to two receptor binding sites. The N-terminal L1 domain and the C-terminus of the α subunit contain one binding site. To locate a second site, we examined the binding properties of chimeric receptors in which the L1 and L2 domains and the first Fibronectin Type III repeat of the insulin-like growth factor-I receptor were replaced by corresponding regions of the insulin receptor. Substitutions of the L2 domain and the first Fibronectin Type III repeat together with the L1 domain produced 80- and 300-fold increases in affinity for insulin. Fusion of these domains to human immunoglobulin Fc fragment produced a protein which bound insulin with a K d of 2.9 nM. These data strongly suggest that these domains contain an insulin binding site
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
International Nuclear Information System (INIS)
Nye, J.S.
1988-01-01
The mechanism by which delta 9 tetrahydrocannabinol (delta 9 THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5'-Trimethylammonium-delta 8 THC (TMA) is a positively charged analog of delta- 8 THC modified on the 5' carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of [ 3 H]-5'-trimethylammonium-delta- 8 THC ([ 3 H]TMA) to rat neuronal membranes. [ 3 H]TMA binds saturably and reversibly to brain membranes with high affinity to apparently one class of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of [ 3 H]TMA binding activity of approximately 60,000 daltons apparent molecular weight
Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan
2014-01-01
Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.
Khorshid, Mohsen; Rodak, Christoph; Zavolan, Mihaela
2011-01-01
The stability, localization and translation rate of mRNAs are regulated by a multitude of RNA-binding proteins (RBPs) that find their targets directly or with the help of guide RNAs. Among the experimental methods for mapping RBP binding sites, cross-linking and immunoprecipitation (CLIP) coupled with deep sequencing provides transcriptome-wide coverage as well as high resolution. However, partly due to their vast volume, the data that were so far generated in CLIP experiments have not been put in a form that enables fast and interactive exploration of binding sites. To address this need, we have developed the CLIPZ database and analysis environment. Binding site data for RBPs such as Argonaute 1-4, Insulin-like growth factor II mRNA-binding protein 1-3, TNRC6 proteins A-C, Pumilio 2, Quaking and Polypyrimidine tract binding protein can be visualized at the level of the genome and of individual transcripts. Individual users can upload their own sequence data sets while being able to limit the access to these data to specific users, and analyses of the public and private data sets can be performed interactively. CLIPZ, available at http://www.clipz.unibas.ch, aims to provide an open access repository of information for post-transcriptional regulatory elements.
Directory of Open Access Journals (Sweden)
Nima Najand
Full Text Available We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.
Opioid binding site in EL-4 thymoma cell line
International Nuclear Information System (INIS)
Fiorica, E.; Spector, S.
1988-01-01
Using EL-4 thymoma cell-line we found a binding site similar to the k opioid receptor of the nervous system. The Scatchard analysis of the binding of [ 3 H] bremazocine indicated a single site with a K/sub D/ = 60 +/- 17 nM and Bmax = 2.7 +/- 0.8 pmols/10 6 cells. To characterize this binding site, competition studies were performed using selective compounds for the various opioid receptors. The k agonist U-50,488H was the most potent displacer of [ 3 H] bremazocine with an IC 50 value = 0.57μM. The two steroisomers levorphanol and dextrorphan showed the same affinity for this site. While morphine, [D-Pen 2 , D-Pen 5 ] enkephalin and β-endorphin failed to displace, except at very high concentrations, codeine demonstrated a IC 50 = 60μM, that was similar to naloxone. 32 references, 3 figures, 2 tables
Cloud computing for protein-ligand binding site comparison.
Hung, Che-Lun; Hua, Guan-Jie
2013-01-01
The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.
International Nuclear Information System (INIS)
Craft, Willie Warren; Dutch, Rebecca Ellis
2005-01-01
The Hendra virus fusion (HeV F) protein is synthesized as a precursor, F 0 , and proteolytically cleaved into the mature F 1 and F 2 heterodimer, following an HDLVDGVK 109 motif. This cleavage event is required for fusogenic activity. To determine the amino acid requirements for processing of the HeV F protein, we constructed multiple mutants. Individual and simultaneous alanine substitutions of the eight residues immediately upstream of the cleavage site did not eliminate processing. A chimeric SV5 F protein in which the furin site was substituted for the VDGVK 109 motif of the HeV F protein was not processed but was expressed on the cell surface. Another chimeric SV5 F protein containing the HDLVDGVK 109 motif of the HeV F protein underwent partial cleavage. These data indicate that the upstream region can play a role in protease recognition, but is neither absolutely required nor sufficient for efficient processing of the HeV F protein
The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.
Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E
2017-12-05
Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha
DEFF Research Database (Denmark)
Hwang, C S; Mandrup, S; MacDougald, O A
1996-01-01
Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...
Differential Modulation of Annexin I Binding Sites on Monocytes and Neutrophils
Directory of Open Access Journals (Sweden)
H. S. Euzger
1999-01-01
Full Text Available Specific binding sites for the anti-inflammatory protein annexin I have been detected on the surface of human monocytes and polymorphonuclear leukocytes (PMN. These binding sites are proteinaceous in nature and are sensitive to cleavage by the proteolytic enzymes trypsin, collagenase, elastase and cathepsin G. When monocytes and PMN were isolated independently from peripheral blood, only the monocytes exhibited constitutive annexin I binding. However PMN acquired the capacity to bind annexin I following co-culture with monocytes. PMN incubation with sodium azide, but not protease inhibitors, partially blocked this process. A similar increase in annexin I binding capacity was also detected in PMN following adhesion to endothelial monolayers. We propose that a juxtacrine activation rather than a cleavage-mediated transfer is involved in this process. Removal of annexin I binding sites from monocytes with elastase rendered monocytes functionally insensitive to full length annexin I or to the annexin I-derived pharmacophore, peptide Ac2-26, assessed as suppression of the respiratory burst. These data indicate that the annexin I binding site on phagocytic cells may have an important function in the feedback control of the inflammatory response and their loss through cleavage could potentiate such responses.
PocketMatch: A new algorithm to compare binding sites in protein structures
Directory of Open Access Journals (Sweden)
Chandra Nagasuma
2008-12-01
Full Text Available Abstract Background Recognizing similarities and deriving relationships among protein molecules is a fundamental requirement in present-day biology. Similarities can be present at various levels which can be detected through comparison of protein sequences or their structural folds. In some cases similarities obscure at these levels could be present merely in the substructures at their binding sites. Inferring functional similarities between protein molecules by comparing their binding sites is still largely exploratory and not as yet a routine protocol. One of the main reasons for this is the limitation in the choice of appropriate analytical tools that can compare binding sites with high sensitivity. To benefit from the enormous amount of structural data that is being rapidly accumulated, it is essential to have high throughput tools that enable large scale binding site comparison. Results Here we present a new algorithm PocketMatch for comparison of binding sites in a frame invariant manner. Each binding site is represented by 90 lists of sorted distances capturing shape and chemical nature of the site. The sorted arrays are then aligned using an incremental alignment method and scored to obtain PMScores for pairs of sites. A comprehensive sensitivity analysis and an extensive validation of the algorithm have been carried out. A comparison with other site matching algorithms is also presented. Perturbation studies where the geometry of a given site was retained but the residue types were changed randomly, indicated that chance similarities were virtually non-existent. Our analysis also demonstrates that shape information alone is insufficient to discriminate between diverse binding sites, unless combined with chemical nature of amino acids. Conclusion A new algorithm has been developed to compare binding sites in accurate, efficient and high-throughput manner. Though the representation used is conceptually simplistic, we demonstrate that
Opioid binding site in EL-4 thymoma cell line
Energy Technology Data Exchange (ETDEWEB)
Fiorica, E.; Spector, S.
1988-01-01
Using EL-4 thymoma cell-line we found a binding site similar to the k opioid receptor of the nervous system. The Scatchard analysis of the binding of (/sup 3/H) bremazocine indicated a single site with a K/sub D/ = 60 +/- 17 nM and Bmax = 2.7 +/- 0.8 pmols/10/sup 6/ cells. To characterize this binding site, competition studies were performed using selective compounds for the various opioid receptors. The k agonist U-50,488H was the most potent displacer of (/sup 3/H) bremazocine with an IC/sub 50/ value = 0.57..mu..M. The two steroisomers levorphanol and dextrorphan showed the same affinity for this site. While morphine, (D-Pen/sup 2/, D-Pen/sup 5/) enkephalin and ..beta..-endorphin failed to displace, except at very high concentrations, codeine demonstrated a IC/sub 50/ = 60..mu..M, that was similar to naloxone. 32 references, 3 figures, 2 tables.
Two distinct affinity binding sites for IL-1 on human cell lines
International Nuclear Information System (INIS)
Bensimon, C.; Wakasugi, N.; Tagaya, Y.; Takakura, K.; Yodoi, J.; Tursz, T.; Wakasugi, H.
1989-01-01
We used two human cell lines, NK-like YT-C3 and an EBV-containing B cell line, 3B6, as models to study the receptor(s) for IL-1. Two distinct types of saturable binding sites were found on both cell lines at 37 degrees C. Between 1 pM and 100 pM of 125I-IL-1-alpha concentration, saturable binding sites were detected on the YT-C3 cells with a K of 4 x 10(-11) M. The K found for the IL-1-alpha binding sites on 3B6 cells was 7.5 x 10(-11) M. An additional binding curve was detected above 100 pM on YT-C3 cells with a K of 7 x 10(-9) M and on 3B6 cells with a K of 5 x 10(-9) M. Scatchard plot analysis revealed 600 sites/cell with high affinity binding and 7000 sites/cell with low affinity for YT-C3 cells and 300 sites/cell with high affinity binding and 6000 sites/cell with low affinity for 3B6 cells. At 37 degrees C, the internalization of 125I-labeled IL-1 occurred via both high and low affinity IL-1R on both YT-C3 and 3B6 cells, whereas the rates of internalization for high affinity binding sites on YT-C3 cells were predominant in comparison to that of low affinity binding sites. In chemical cross-linking studies of 125 I-IL-1-alpha to 3B6 and YT-C3 cells, two protein bands were immunoprecipitated with Mr around 85 to 90 kDa leading to an estimation of the Mr of the IL-1R around 68 to 72 kDa. In similar experiments, the Mr found for the IL-1R expressed on the murine T cell line EL4 was slightly higher (around 80 kDa). Whether these distinct affinity binding sites are shared by a single molecule or by various chains remains to be elucidated
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-07-01
The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
DEFF Research Database (Denmark)
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical...
Directory of Open Access Journals (Sweden)
Ronne Hans
2008-11-01
Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.
(-)PPAP: a new and selective ligand for sigma binding sites.
Glennon, R A; Battaglia, G; Smith, J D
1990-11-01
Most agents employed for the investigation of sigma (sigma) binding sites display relatively low affinity for these sites, bind both at sigma sites and at either phencyclidine (PCP) sites or dopamine receptors with similar affinity, and/or produce some dopaminergic activity in vivo. We describe a new agent, (-)PPAP or R(-)-N-(3-phenyl-n-propyl)-1-phenyl-2-aminopropane hydrochloride, that binds with high affinity and selectivity at sigma (IC50 = 24 nM) versus either PCP sites (IC50 greater than 75,000 nM) or D1 and D2 dopamine receptors (IC50 greater than 5,000 nM). The sigma affinity of this agent is comparable to that of the standard ligands (+)-3-PPP and DTG. Furthermore, although (-)PPAP is structurally related to amphetamine, it neither produces nor antagonizes amphetamine-like stimulus effect in rats trained to discriminate 1 mg/kg of S(+)amphetamine from saline.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
Energy Technology Data Exchange (ETDEWEB)
Makyio, Hisayoshi [Structural Biology Research Center, Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki, 305-0801 (Japan); Shimabukuro, Junpei; Suzuki, Tatsuya [Department of Applied Bioorganic Chemistry, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Institute for Integrated Cell-Material Sciences (WPI-iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Imamura, Akihiro; Ishida, Hideharu [Department of Applied Bioorganic Chemistry, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Kiso, Makoto [Department of Applied Bioorganic Chemistry, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Institute for Integrated Cell-Material Sciences (WPI-iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Ando, Hiromune, E-mail: hando@gifu-u.ac.jp [Department of Applied Bioorganic Chemistry, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Institute for Integrated Cell-Material Sciences (WPI-iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Kato, Ryuichi, E-mail: ryuichi.kato@kek.jp [Structural Biology Research Center, Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki, 305-0801 (Japan)
2016-08-26
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding site has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
International Nuclear Information System (INIS)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya; Imamura, Akihiro; Ishida, Hideharu; Kiso, Makoto; Ando, Hiromune; Kato, Ryuichi
2016-01-01
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding site has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.
2[125I]Iodomelatonin binding sites in spleens of guinea pigs
International Nuclear Information System (INIS)
Poon, A.M.S.; Pang, S.F.
1992-01-01
2-[ 125 I]Iodomelatonin was found to bind specifically to the membrane preparations of the spleens of guinea pigs with high affinity. The binding was rapid, stable, saturable and reversible. Scatchard analysis of the binding assays revealed an equilibrium dissociation constant (Kd) of 49.8±4.12 pmol/l and binding site density (Bmax) of 0.69±0.082 fmol/mg protein at mid-light. There was no significant change in the Kd or the Bmax at mid-dark. Kinetic analysis showed a Kd of 23.13±4.81 pmol/l, in agreement to that derived from the saturation studies. The 2-[ 125 I]iodomelatonin binding sites have the following order of potency: 2-iodomelatonin > melatonin > 6-chloromelatonin much-gt N-acetylserotonin, 6-hydroxymelatonin > 5-methoxytryptamine, 5-methoxytryptophol > serotonin, 5-methoxyindole-3-acetic acid > 5-hydroxytryptophol, 3-acetylindole, 1-acetylindole-3-carboxyaldehyde, L-tryptophan > tryptamine, 5-hydroxyindole-3-acetic acid. Differential centrifugation studies showed that the binding sites are localized mainly in the nuclear fraction, the rest are distributed in the microsomal fraction, mitochondrial fraction and cytosolic fraction. The demonstration of 2-[ 125 I]iodomelatonin binding sites in the spleen suggests the presence of melatonin receptors and a direct mechanism of action of melatonin on the immune system
Directory of Open Access Journals (Sweden)
Feng-Yu Wang
Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.
Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru
2017-11-01
We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.
Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian
2017-01-01
Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.
Conversion of MyoD to a Neurogenic Factor: Binding Site Specificity Determines Lineage
Directory of Open Access Journals (Sweden)
Abraham P. Fong
2015-03-01
Full Text Available MyoD and NeuroD2, master regulators of myogenesis and neurogenesis, bind to a “shared” E-box sequence (CAGCTG and a “private” sequence (CAGGTG or CAGATG, respectively. To determine whether private-site recognition is sufficient to confer lineage specification, we generated a MyoD mutant with the DNA-binding specificity of NeuroD2. This chimeric mutant gained binding to NeuroD2 private sites but maintained binding to a subset of MyoD-specific sites, activating part of both the muscle and neuronal programs. Sequence analysis revealed an enrichment for PBX/MEIS motifs at the subset of MyoD-specific sites bound by the chimera, and point mutations that prevent MyoD interaction with PBX/MEIS converted the chimera to a pure neurogenic factor. Therefore, redirecting MyoD binding from MyoD private sites to NeuroD2 private sites, despite preserved binding to the MyoD/NeuroD2 shared sites, is sufficient to change MyoD from a master regulator of myogenesis to a master regulator of neurogenesis.
Down-regulation of endothelin binding sites in rat vascular smooth muscle cells
International Nuclear Information System (INIS)
Roubert, P.; Gillard, V.; Plas, P.; Chabrier, P.E.; Braquet, P.
1990-01-01
In cultured rat aortic smooth muscle cells, [ 125 I]endothelin (ET-1) bound to an apparent single class of high affinity recognition sites with a dissociation constant of 1.84 +/- 0.29 nmol/L and a maximum binding of 62 +/- 10.5 fmol/10(6) cells. The binding was not affected by calcium antagonists or vasoactive substances, including angiotensin II, arginine vasopressin, atrial natriuretic factor and bradykinin. Exposure of the cells to ET-1 (0.01 nmol/L to 10 nmol/L) resulted in an apparent dose-dependent reduction of the number of endothelin binding sites with no significant modification of its binding affinity. The time course of the down-regulation of ET-1 binding sites showed that this effect was present after 30 min incubation and persisted after 18 h. This indicates that down-regulation of ET-1 binding sites can modulate the activity of ET-1 and suggests a rapid internalization of ET-1 in vascular cells
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DEFF Research Database (Denmark)
Fuglsang, Anja T; Borch, Jonas; Bych, Katrine
2003-01-01
14-3-3 proteins constitute a family of well conserved proteins interacting with a large number of phosphorylated binding partners in eukaryotic cells. The plant plasma membrane H+-ATPase is an unusual target in that a unique phosphothreonine motif (946YpTV, where pT represents phosphothreonine...... of the Arabidopsis plasma membrane H+-ATPase isoform 2 (AHA2). Following site-directed mutagenesis within the 45 C-terminal residues of AHA2, we conclude that, in addition to the 946YpTV motif, a number of residues located further upstream are required for phosphorylation-independent binding of 14-3-3. Among these...
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Exploring the composition of protein-ligand binding sites on a large scale.
Directory of Open Access Journals (Sweden)
Nickolay A Khazanov
Full Text Available The residue composition of a ligand binding site determines the interactions available for diffusion-mediated ligand binding, and understanding general composition of these sites is of great importance if we are to gain insight into the functional diversity of the proteome. Many structure-based drug design methods utilize such heuristic information for improving prediction or characterization of ligand-binding sites in proteins of unknown function. The Binding MOAD database if one of the largest curated sets of protein-ligand complexes, and provides a source of diverse, high-quality data for establishing general trends of residue composition from currently available protein structures. We present an analysis of 3,295 non-redundant proteins with 9,114 non-redundant binding sites to identify residues over-represented in binding regions versus the rest of the protein surface. The Binding MOAD database delineates biologically-relevant "valid" ligands from "invalid" small-molecule ligands bound to the protein. Invalids are present in the crystallization medium and serve no known biological function. Contacts are found to differ between these classes of ligands, indicating that residue composition of biologically relevant binding sites is distinct not only from the rest of the protein surface, but also from surface regions capable of opportunistic binding of non-functional small molecules. To confirm these trends, we perform a rigorous analysis of the variation of residue propensity with respect to the size of the dataset and the content bias inherent in structure sets obtained from a large protein structure database. The optimal size of the dataset for establishing general trends of residue propensities, as well as strategies for assessing the significance of such trends, are suggested for future studies of binding-site composition.
Location and nature of calcium-binding sites in salivary acidic proline-rich phosphoproteins
International Nuclear Information System (INIS)
Bennick, A.; McLaughlin, A.C.; Grey, A.A.; Madapallimattam, G.
1981-01-01
The location of the calcium-binding sites in the human acidic proline-rich proteins, salivary proteins A and C, was determined by equilibrium dialysis of the tryptic peptides with buffers containing 45 Ca. All the calcium-binding sites are located in the NH 2 -terminal tryptic peptide (TX peptide). The nature of the calcium binding sites in the TX peptide and native salivary proteins A and C, as well as dephosphorylated proteins was compared. Two types of sites can be distinguished in peptide TX. Type I sites have an apparent dissociation constant (K) of 38 μM and are responsible for the binding of 2.6 mol of Ca/mol of peptide. The corresponding figures for Type II sites are 780 μM and 5.3 mol of Ca/mol of peptide. In the native proteins, the amount of calcium bound at the type II sites decreases to 3.9 mol of Ca/mol of proteins A and C and K increases to 1100 μM. The amount of calcium bound at type I sites decreases to 1.5 mol/mol of protein A and 0.6 mol/mol of protein C, but there is no change in K. Dephosphorylation affects the calcium binding at both types of sites. The experiments indicate that the COOH-terminal parts of the native proteins affect the number and the nature of the protein calcium-binding sites. Proton and phosphorous NMR data demonstrate that β-COOH in aspartic acid, as well as phosphoserine, are part of the calcium-binding sites. The difference in calcium binding to salivary proteins A and C may be due at least partially to differences in the environment of one or more aspartic acids
Radiotracers for per studies of neurotransmitter binding sites: Design considerations
International Nuclear Information System (INIS)
Kilbourn, M.R.
1991-01-01
Neurotransmitter binding sites, such as receptors, neuronal uptake systems, and vesicular uptake systems, are important targets for new radiopharmaceutical design. Selection of potential radioligands can be guided by in vitro laboratory data including such characteristics as selectivity and affinity for specific binding sites. However, development of PET radiotracers for use in vivo must include considerations of in vivo pharmacokinetics and metabolism. Introduction of potential radioligands is further narrowed by the demands of the radiochemical synthesis, which must produce radioligands of high chemical and radiochemical purity and of high specific activity. This paper will review examples of previous and current attempts by radiopharmaceutical chemists to meet these demands for new positron emitter-labeled radioligands for PET studies of a wide array of neurotransmitter binding sites
Functional groups of macro-benthos of selected sites of upstream of Hron River and Hnilec River
International Nuclear Information System (INIS)
Rufusova, A.
2011-01-01
The author used six functional groups of macro-benthos based on 'species traits', which are indicated with the Greek letters α to ζ. In the work authors applied this method to the macroinvertebrate communities of selected sites of upstream of the Hron River and the Hnilec River. The method appropriately captured increasing gradient of anthropogenic changes in the direction of the river continuum. Although the method was used for Slovak rivers for the first time, it seems to be promising for use in the future. (author)
Flow-cytometric determination of high-density-lipoprotein binding sites on human leukocytes
International Nuclear Information System (INIS)
Schmitz, G.; Wulf, G.; Bruening, T.A.; Assmann, G.
1987-01-01
In this method, leukocytes were isolated from 6 mL of EDTA-blood by density-gradient centrifugation and subsequently incubated with rhodamine isothiocyanate (RITC)-conjugated high-density lipoproteins (HDL). The receptor-bound conjugate particles were determined by fluorescent flow cytometry and compared with 125 I-labeled HDL binding data for the same cells. Human granulocytes express the highest number of HDL binding sites (9.4 x 10(4)/cell), followed by monocytes (7.3 x 10(4)/cell) and lymphocytes (4.0 x 10(4)/cell). Compared with conventional analysis of binding of 125 I-labeled HDL in tissue-culture dishes, the present determination revealed significantly lower values for nonspecific binding. In competition studies, the conjugate competes for the same binding sites as 125 I-labeled HDL. With the use of tetranitromethane-treated HDL3, which fails to compete for the HDL receptor sites while nonspecific binding is not affected, we could clearly distinguish between 37 degrees C surface binding and specific 37 degrees C uptake of RITC-HDL3, confirming that the HDL receptor leads bound HDL particles into an intracellular pathway rather than acting as a docking type of receptor. Patients with familial dysbetalipoproteinemia showed a significantly higher number of HDL binding sites in the granulocyte population but normal in lymphocytes and monocytes, indicating increased uptake of cholesterol-containing lipoproteins. In patients with familial hypercholesterolemia, HDL binding was increased in all three cell types, indicating increased cholesterol uptake and increased cholesterol synthesis. The present method allows rapid determination of HDL binding sites in leukocytes from patients with various forms of hyper- and dyslipoproteinemias
Distribution of [3H]diadenosine tetraphosphate binding sites in rat brain
International Nuclear Information System (INIS)
Miras-Portugal, M.T.; Palacios, J.M.; Torres, M.; Cortes, R.; Rodriguez-Pascual, F.
1997-01-01
The distribution of the diadenosine tetraphosphate high-affinity binding sites has been studied in rat brain by an autoradiographic method using [ 3 H]diadenosine tetraphosphate as the ligand. The binding characteristics are comparable to those described in studies performed on rat brain synaptosomes. White matter is devoid of specific binding. The range of binding site densities in gray matter varies from 3 to 15 fmol/mg of tissue, exhibiting a widespread but heterogeneous distribution. The highest densities correspond to the seventh cranial nerve, medial superior olive, pontine nuclei, glomerular and external plexiform layers of the olfactory bulb, and the granule cell layer of the cerebellar cortex. Intermediate density levels of binding correspond to different cortical areas, several nuclei of the amygdala, and the oriens and pyramidal layers of the hippocampal formation.The localization of diadenosine tetraphosphate binding sites in the brain may provide information on the places where diadenosine polyphosphate compounds can be expected to function in the central nervous system. (Copyright (c) 1997 Elsevier Science B.V., Amsterdam. All rights reserved.)
Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting
2017-03-17
The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Chih-Hao Lu
2015-01-01
Full Text Available We developed a computational method to identify NAD- and FAD-binding sites in proteins. First, we extracted from the Protein Data Bank structures of proteins that bind to at least one of these ligands. NAD-/FAD-binding residue templates were then constructed by identifying binding residues through the ligand-binding database BioLiP. The fragment transformation method was used to identify structures within query proteins that resembled the ligand-binding templates. By comparing residue types and their relative spatial positions, potential binding sites were identified and a ligand-binding potential for each residue was calculated. Setting the false positive rate at 5%, our method predicted NAD- and FAD-binding sites at true positive rates of 67.1% and 68.4%, respectively. Our method provides excellent results for identifying FAD- and NAD-binding sites in proteins, and the most important is that the requirement of conservation of residue types and local structures in the FAD- and NAD-binding sites can be verified.
Quantitative autoradiography of [3H]ouabain binding sites in rat brain
International Nuclear Information System (INIS)
Spyropoulos, A.C.; Rainbow, T.C.
1984-01-01
In vitro quantitative autoradiography was used to localize in rat brain binding sites for [ 3 H]ouabain, an inhibitor of the Na + ,K + -ATPase. High levels of [ 3 H]ouabain sites were found in the superior and inferior colliculi, the mammillary nucleus, the interpeduncular nucleus, and in various divisions of the olfactory, auditory and somatomotor systems. The heterogeneous distribution of [ 3 H]ouabain binding closely parallels the regional brain glucose consumption as determined by the [ 14 C]deoxyglucose method. Lesion studies of the rat hippocampus using the excitotoxin, ibotenic acid, showed both a marked decrease of neuronal cell types on the injected side and a corresponding decrease in [ 3 H]ouabain binding, indicating that some of the [ 3 H]ouabain binding sites are localized to neurons. The close correlation between [ 3 H]ouabain binding and regional glucose utilization provides further evidence for a linkage between glucose utilization and the neuronal Na + ,K + -ATPase. (Auth.)
[Adenylate cyclase from rabbit heart: substrate binding site].
Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A
1981-08-01
The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.
International Nuclear Information System (INIS)
Mueller, H.; Fehr, J.
1986-01-01
The functional similarities between C-reactive protein (CRP) and IgG raised the question as to whether human phagocytes are stimulated by CRP in the same way as by binding of antigen-complexes or aggregated IgG to their Fc receptors. Studies with the use of highly purified 125 I-labeled CRP showed specific and saturable binding to human polymorphonuclear leukocytes (PNM) with a K/sub D/ of 10.5 +/- 5.7 x 10 -8 M only when carried out in heat-inactivated plasma. The number of specific binding sites per cell was estimated at 1 to 3 x 10 6 . Competitive inhibition of CRP binding by antigen-complexed or aggregated IgG suggests CRP binding sites to be associated IgG suggests CRP binding sites to be associated with PMN Fc receptors. Only when assayed in heat-inactivated plasma did CRP binding induce adherence of cells to tissue culture dishes. However, no metabolic and potentially cytotoxic simulation of PMN was detected during CRP plasma-dependent attachment to surfaces: induction of aggregation, release of secondary granule constituents, and activation of the hexose monophosphate pathway were not observed. These results imply that CRP-PMN interactions is dependent on an additional factor present in heat-inactivated plasma and is followed only by a complement-independent increase in PMN attachment to surfaces. Because CRP was found to be deposits at sites of tissue injury, the CRP-mediated adherence of PMN may be an important step in localizing an inflammatory focus
Characterization of Rous sarcoma virus polyadenylation site use in vitro
International Nuclear Information System (INIS)
Maciolek, Nicole L.; McNally, Mark T.
2008-01-01
Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSV poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation
Energy Technology Data Exchange (ETDEWEB)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David; Bohn, Alan J.; Lee, Peter S.; Anderson, Caitlin E.; Nieusma, Travis; Holstein, Carly A.; Garcia, Natalie K.; Hooper, Kathryn A.; Ravichandran, Rashmi; Nelson, Jorgen W.; Sheffler, William; Bloom, Jesse D.; Lee, Kelly K.; Ward, Andrew B.; Yager, Paul; Fuller, Deborah H.; Wilson, Ian A.; Baker , David (UWASH); (Scripps); (FHCRC)
2017-06-12
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein is designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.
Characterization of [3H] oxymorphone binding sites in mouse brain
DEFF Research Database (Denmark)
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza
2017-01-01
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear....... This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [3H]oxymorphone revealed high affinity binding sites in mouse......]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [3H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP...
Nonequivalence of alpha-bungarotoxin binding sites in the native nicotinic receptor molecule
International Nuclear Information System (INIS)
Conti-Tronconi, B.M.; Tang, F.; Walgrave, S.; Gallagher, W.
1990-01-01
In the native, membrane-bound form of the nicotinic acetylcholine receptor (M-AcChR) the two sites for the cholinergic antagonist alpha-bungarotoxin (alpha-BGT) have different binding properties. One site has high affinity, and the M-AcChR/alpha-BGT complexes thus formed dissociate very slowly, similar to the complexes formed with detergent-solubilized AcChR (S-AcChR). The second site has much lower affinity (KD approximately 59 +/- 35 nM) and forms quickly reversible complexes. The nondenaturing detergent Triton X-100 is known to solubilize the AcChR in a form unable, upon binding of cholinergic ligands, to open the ion channel and to become desensitized. Solubilization of the AcChR in Triton X-100 affects the binding properties of this second site and converts it to a high-affinity, slowly reversible site. Prolonged incubation of M-AcChR at 4 degrees C converts the low-affinity site to a high-affinity site similar to those observed in the presence of Triton X-100. Although the two sites have similar properties when the AcChR is solubilized in Triton X-100, their nonequivalence can be demonstrated by the effect on alpha-BGT binding of concanavalin A, which strongly reduces the association rate of one site only. The Bmax of alpha-BGT to either Triton-solubilized AcChR or M-AcChR is not affected by the presence of concanavalin A. Occupancy of the high-affinity, slowly reversible site in M-AcChR inhibits the Triton X-100 induced conversion to irreversibility of the second site. At difference with alpha-BGT, the long alpha-neurotoxin from Naja naja siamensis venom (alpha-NTX) binds with high affinity and in a very slowly reversible fashion to two sites in the M-AcChR. We confirm here that Triton-solubilized AcChR or M-AcChR binds in a very slowly reversible fashion the same amount of alpha-NTX
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
DEFF Research Database (Denmark)
Cuyvers, Sven; Dornez, Emmie; Abou Hachem, Maher
2012-01-01
Isothermal titration calorimetry and surface plasmon resonance were tested for their ability to study substrate binding to the active site (AS) and to the secondary binding site (SBS) of Bacillus subtilis xylanase A separately. To this end, three enzyme variants were compared. The first...
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Self-Assembly of Coordinative Supramolecular Polygons with Open Binding Sites.
Zheng, Yao-Rong; Wang, Ming; Kobayashi, Shiho; Stang, Peter J
2011-04-27
The design and synthesis of coordinative supramolecular polygons with open binding sites is described. Coordination-driven self-assembly of 2,6-bis(pyridin-4-ylethynyl)pyridine with 60° and 120° organoplatinum acceptors results in quantitative formation of a supramolecular rhomboid and hexagon, respectively, both bearing open pyridyl binding sites. The structures were determined by multinuclear ((31)P and (1)H) NMR spectroscopy and electrospray ionization (ESI) mass spectrometry, along with a computational study.
International Nuclear Information System (INIS)
Gates, T.S.; Zimmerman, R.P.; Mantyh, C.R.; Vigna, S.R.; Maggio, J.E.; Welton, M.L.; Passaro, E.P. Jr.; Mantyh, P.W.
1988-01-01
Quantitative receptor autoradiography was used to localize and quantify the distribution of binding sites for 125 I-radiolabeled substance P (SP), substance K (SK) and neuromedin K (NK) in the human GI tract using histologically normal tissue obtained from uninvolved margins of resections for carcinoma. The distribution of SP and SK binding sites is different for each gastrointestinal (GI) segment examined. Specific SP binding sites are expressed by arterioles and venules, myenteric plexus, external circular muscle, external longitudinal muscle, muscularis mucosa, epithelial cells of the mucosa, and the germinal centers of lymph nodules. SK binding sites are distributed in a pattern distinct from SP binding sites and are localized to the external circular muscle, external longitudinal muscle, and the muscularis mucosa. Binding sites for NK were not detected in any part of the human GI tract. These results demonstrate that: (1) surgical specimens from the human GI tract can be effectively processed for quantitative receptor autoradiography; (2) of the three mammalian tachykinins tested, SP and SK, but not NK binding sites are expressed in detectable levels in the human GI tract; (3) whereas SK receptor binding sites are expressed almost exclusively by smooth muscle, SP binding sites are expressed by smooth muscle cells, arterioles, venules, epithelial cells of the mucosa and cells associated with lymph nodules; and (4) both SP and SK binding sites expressed by smooth muscle are more stable than SP binding sites expressed by blood vessels, lymph nodules, and mucosal cells
Identification of an allosteric binding site for RORγt inhibition
Energy Technology Data Exchange (ETDEWEB)
Scheepstra, Marcel; Leysen, Seppe; vanAlmen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc (Merck); (Eindhoven)
2015-12-07
RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors.
International Nuclear Information System (INIS)
Kumar, K.P.; Chatterji, D.
1990-01-01
Terbium(III) upon complexation with guanosine 5'-triphosphate showed remarkable enhancement of fluorescence emission at 488 and 545 nm when excited at 295 nm. Analysis of the binding data yielded a value for the mean K d between Tb(III) and GTP of 0.2 μM, with three binding sites for TB(III) on GTP. 31 P and 1 H NMR measurements revealed that Tb(III) mainly binds the phosphate moiety of GTP. Fluorescence titration of the emission signals of the TbGTP complex with varying concentrations of Escherichia coli RNA polymerase resulted in a K d values of 4 μM between the TbGTP and the enzyme. It was observed that TbGTP can be incorporated in the place of GTP during E. coli RNA polymerase catalyzed abortive synthesis of dinucleotide tetraphosphate at T7A2 promoter. Both the substrate TbGTP and the inhibitor of the initiation of transcription rifampicin bind to the β-subunit of E. coli RNA polymerase. This allows the measurement of the fluorescence excited-state energy transfer from the donor TbGTP-RNA polymerase to the acceptor rifampicin. Both emission bands of Tb(III) overlap with the rifampicin absorption, and the distances at 50% efficiency of energy transfer were calculated to be 28 and 24 angstrom for the 488- and 545-nm emission bands, respectively. The distance between the substrate binding site and the rifampicin binding site on the β-subunit of E. coli RNA polymerase was measured to be around 30 angstrom. This suggest that the nature of inhibition of transcription by rifampicin is essentially noncompetitive with the substrate
The interaction of substituted benzamides with brain benzodiazepine binding sites in vitro.
Horton, R W; Lowther, S; Chivers, J; Jenner, P; Marsden, C D; Testa, B
1988-08-01
1. The interaction of substituted benzamides with brain benzodiazepine (BDZ) binding sites was examined by their ability to displace [3H]-flunitrazepam ([3H]-FNM) from specific binding sites in bovine cortical membranes in vitro. 2. Clebopride, Delagrange 2674, Delagrange 2335 and BRL 20627 displayed concentration-dependent displacement of [3H]-FNM with IC50 values of 73 nM, 132 nM, 7.7 microM and 5.9 microM, respectively. Other substituted benzamides including metoclopramide, sulpiride, tiapride, sultopride and cisapride were inactive at 10(-5) M. 3. Inhibition by clebopride and Delagrange 2674 of [3H]-FNM binding was apparently competitive and readily reversible. 4. In the presence of gamma-aminobutyric acid (GABA), the ability of diazepam and Delagrange 2674 to displace [3H]-Ro 15-1788 binding was increased 3.6 and 1.6 fold respectively, compared to the absence of GABA, while ethyl beta-carboline-3-carboxylate (beta CCE) and clebopride were less potent in the presence of GABA. 5. Diazepam was 30 fold less potent at displacing [3H]-Ro 15-1788 in membranes that had been photoaffinity labelled with FNM than in control membranes, whereas the potency of beta CCE did not differ. Clebopride and Delagrange 2674 showed a less than two fold loss of potency in photoaffinity labelled membranes. 6. The pattern of binding of clebopride and Delagrange 2674 in these in vitro tests is similar to that found previously with partial agonists or antagonists at BDZ binding sites. 7. Clebopride and Delagrange 2674 inhibited [3H]-FNM binding with similar potency in rat cerebellar and hippocampal membranes, suggesting they have no selectivity for BDZ1 and BDZ2 binding sites. 8. Clebopride and Delagrange 2674 are structurally dissimilar to other BDZ ligands and represent another chemical structure to probe brain BDZ binding sites.
Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.
The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.
Directory of Open Access Journals (Sweden)
Michal Brylinski
2014-09-01
Full Text Available Detecting similarities between ligand binding sites in the absence of global homology between target proteins has been recognized as one of the critical components of modern drug discovery. Local binding site alignments can be constructed using sequence order-independent techniques, however, to achieve a high accuracy, many current algorithms for binding site comparison require high-quality experimental protein structures, preferably in the bound conformational state. This, in turn, complicates proteome scale applications, where only various quality structure models are available for the majority of gene products. To improve the state-of-the-art, we developed eMatchSite, a new method for constructing sequence order-independent alignments of ligand binding sites in protein models. Large-scale benchmarking calculations using adenine-binding pockets in crystal structures demonstrate that eMatchSite generates accurate alignments for almost three times more protein pairs than SOIPPA. More importantly, eMatchSite offers a high tolerance to structural distortions in ligand binding regions in protein models. For example, the percentage of correctly aligned pairs of adenine-binding sites in weakly homologous protein models is only 4-9% lower than those aligned using crystal structures. This represents a significant improvement over other algorithms, e.g. the performance of eMatchSite in recognizing similar binding sites is 6% and 13% higher than that of SiteEngine using high- and moderate-quality protein models, respectively. Constructing biologically correct alignments using predicted ligand binding sites in protein models opens up the possibility to investigate drug-protein interaction networks for complete proteomes with prospective systems-level applications in polypharmacology and rational drug repositioning. eMatchSite is freely available to the academic community as a web-server and a stand-alone software distribution at http://www.brylinski.org/ematchsite.
A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel
DEFF Research Database (Denmark)
Long, Katherine S; Porse, Bo T
2003-01-01
, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....
Gephyrin-binding peptides visualize postsynaptic sites and modulate neurotransmission
DEFF Research Database (Denmark)
Maric, Hans Michael; Hausrat, Torben Johann; Neubert, Franziska
2017-01-01
is associated with perturbation of the basic physiological action. Here we pursue a fundamentally different approach, by instead targeting the intracellular receptor-gephyrin interaction. First, we defined the gephyrin peptide-binding consensus sequence, which facilitated the development of gephyrin super......-binding peptides and later effective affinity probes for the isolation of native gephyrin. Next, we demonstrated that fluorescent super-binding peptides could be used to directly visualize inhibitory postsynaptic sites for the first time in conventional and super-resolution microscopy. Finally, we demonstrate...
Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.
Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela
2013-07-01
Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.
Directory of Open Access Journals (Sweden)
Amy L Bauer
2010-11-01
Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.
Distribution of [{sup 3}H]diadenosine tetraphosphate binding sites in rat brain
Energy Technology Data Exchange (ETDEWEB)
Miras-Portugal, M.T. [Departamento de Bioquimica, Facultad de Veterinaria, Universidad Complutense, 28040 Madrid (Spain); Palacios, J.M. [Laboratorios Almirall, Research Center, Cardener 68, 08024 Barcelona (Spain); Torres, M. [Departamento de Bioquimica, Facultad de Veterinaria, Universidad Complutense, 28040 Madrid (Spain); Cortes, R. [Departamento de Neuroquimica, Centro de Investigacion y Desarrollo, CSIC Jordi Girona 18-26, 08034 Barcelona (Spain); Rodriguez-Pascual, F. [Departamento de Bioquimica, Facultad de Veterinaria, Universidad Complutense, 28040 Madrid (Spain)
1997-01-06
The distribution of the diadenosine tetraphosphate high-affinity binding sites has been studied in rat brain by an autoradiographic method using [{sup 3}H]diadenosine tetraphosphate as the ligand. The binding characteristics are comparable to those described in studies performed on rat brain synaptosomes. White matter is devoid of specific binding. The range of binding site densities in gray matter varies from 3 to 15 fmol/mg of tissue, exhibiting a widespread but heterogeneous distribution. The highest densities correspond to the seventh cranial nerve, medial superior olive, pontine nuclei, glomerular and external plexiform layers of the olfactory bulb, and the granule cell layer of the cerebellar cortex. Intermediate density levels of binding correspond to different cortical areas, several nuclei of the amygdala, and the oriens and pyramidal layers of the hippocampal formation.The localization of diadenosine tetraphosphate binding sites in the brain may provide information on the places where diadenosine polyphosphate compounds can be expected to function in the central nervous system. (Copyright (c) 1997 Elsevier Science B.V., Amsterdam. All rights reserved.)
International Nuclear Information System (INIS)
Greenamyre, J.T.; Young, A.B.; Penney, J.B.
1984-01-01
Quantitative autoradiography was used to determine the distribution of L-[3H]glutamate-binding sites in the rat central nervous system. Autoradiography was carried out in the presence of Cl- and Ca2+ ions. Scatchard plots and Hill coefficients of glutamate binding suggested that glutamate was interacting with a single population of sites having a K-D of about 300 nM and a capacity of 14.5 pmol/mg of protein. In displacement studies, ibotenate also appeared to bind to a single class of non-interacting sites with a KI of 28 microM. However, quisqualate displacement of [3H]glutamate binding revealed two well-resolved sites with KIS of 12 nM and 114 microM in striatum. These sites were unevenly distributed, representing different proportions of specific glutamate binding in different brain regions. The distribution of glutamate-binding sites correlated very well with the projection areas of putative glutamatergic pathways. This technique provides an extremely sensitive assay which can be used to gather detailed pharmacological and anatomical information about L-[3H]glutamate binding in the central nervous system
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
International Nuclear Information System (INIS)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.; Goberna, R.; Guerrero, J.M.
1991-01-01
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using [ 125 I]melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37 degree C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of [ 125 I]melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8 fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of [ 125 I]melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the [ 125 I]melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland
International Nuclear Information System (INIS)
Gillberg, P.-G.; Aquilonius, S.-M.
1985-01-01
Binding sites for the receptor ligands 3 H-quinuclidinylbenzilate, 3 H-alpha-bungarotoxin ( 3 H-alpha-Btx), 3 H-etorphine and 3 H-strychnine were localized autoradiographically at cervical, thoracic and lumbar levels of spinal cords from post-mortem human control subjects and subjects with amyotrophic lateral sclerosis (ALS). The highest densities of muscarinic binding sites were found in the motor neuron areas and in the substantia gelatinosa, while the grey matter binding was very low within Clarke's column. Both 3 H-alpha-Btx and opioid receptor binding sites were numerous within the substantia gelatinosa, while glycine receptor binding sites were more uniformly distribute within the spinal grey matter. In ALS cases, muscarinic receptor binding sites were markedly reduced in motor neuron areas and slightly reduced in the dorsal horn, while the other binding sites studied were relatively unchanged. (author)
International Nuclear Information System (INIS)
Gil, D.W.; Wolfe, B.B.
1986-01-01
Although it has been suggested by many investigators that subtypes of muscarinic cholinergic receptors exist, physical studies of solubilized receptors have indicated that only a single molecular species may exist. To test the hypothesis that the putative muscarinic receptor subtypes in rat forebrain are interconvertible states of the same receptor, the selective antagonist pirenzepine (PZ) was used to protect muscarinic receptors from blockade by the irreversible muscarinic receptor antagonist propylbenzilylcholine mustard (PBCM). If interconversion of high (M1) and low (M2) affinity binding sites for PZ occurs, incubation of cerebral cortical membranes with PBCM in the presence of PZ should not alter the proportions of M1 and M2 binding sites that are unalkylated (i.e., protected). If, on the other hand, the binding sites are not interconvertible, PZ should be able to selectively protect M1 sites and alter the proportions of unalkylated M1 and M2 binding sites. In the absence of PZ, treatment of cerebral cortical membranes with 20 nM PBCM at 4 degrees C for 50 min resulted in a 69% reduction in the density of M1 binding sites and a 55% reduction in the density of M2 binding sites with no change in the equilibrium dissociation constants of the radioligands [ 3 H]quinuclidinyl benzilate or [ 3 H]PZ. The reasons for this somewhat selective effect of PBCM are not apparent. In radioligand binding experiments using cerebral cortical membranes, PZ inhibited the binding of [ 3 H]quinuclidinyl benzilate in a biphasic manner
A web server for analysis, comparison and prediction of protein ligand binding sites.
Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S
2016-03-25
One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .
International Nuclear Information System (INIS)
Miller, J.A.; Velayo, N.L.; Dage, R.C.; Rampe, D.
1991-01-01
We examined the binding of the antidiabetic sulfonylurea [3H] glibenclamide to rat brain and heart membranes. High affinity binding was observed in adult rat forebrain (Kd = 137.3 pM, maximal binding site density = 91.8 fmol/mg of protein) and ventricle (Kd = 77.1 pM, maximal binding site density = 65.1 fmol/mg of protein). Binding site density increased approximately 250% in forebrain membranes during postnatal development but was constant in ventricular membranes. Quantitative autoradiography was used to examine the regional distribution of [3H] glibenclamide binding sites in sections from rat brain, spinal cord and heart. The greatest density of binding in adult brain was found in the substantia nigra and globus pallidus, whereas the other areas displayed heterogenous binding. In agreement with the membrane binding studies, 1-day-old rat brain had significantly fewer [3H]glibenclamide binding sites than adult brain. Additionally, the pattern of distribution of these sites was qualitatively different from that of the adult. In adult rat spinal cord, moderate binding densities were observed in spinal cord gray and displayed a rostral to caudal gradient. In adult rat heart, moderate binding densities were observed and the sites were distributed homogeneously. In conclusion, significant development of [3H]glibenclamide binding sites was seen in the brain but not the heart during postnatal maturation. Furthermore, a heterogeneous distribution of binding sites was observed in both the brain and spinal cord of adult rats
International Nuclear Information System (INIS)
Leslie, R.A.; McDonald, T.J.; Robertson, H.A.
1988-01-01
Peptide YY is a highly potent emetic when given intravenously in dogs. We hypothesized that the area postrema, a small brain stem nucleus that acts as a chemoreceptive trigger zone for vomiting and lies outside the blood-brain barrier, might have receptors that PYY would bind to, in order to mediate the emetic response. We prepared [ 125 I]PYY and used autoradiography to show that high affinity binding sites for this ligand were highly localized in the area postrema and related nuclei of the dog medulla oblongata. Furthermore, the distribution of [ 125 I]PYY binding sites in the rat medulla oblongata was very similar to that in the dog; the distribution of [ 125 I]PYY binding sites throughout the rat brain was seen to be similar to the distribution of [ 125 I]NPY binding sites
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
Energy Technology Data Exchange (ETDEWEB)
Ehteshami, Mehdi [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rasoulzadeh, Farzaneh [Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Mahboob, Soltanali [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rashidi, Mohammad-Reza, E-mail: rashidi@tbzmed.ac.ir [Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of)
2013-03-15
Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP-BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: Black-Right-Pointing-Pointer Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. Black-Right-Pointing-Pointer Involvement of a static quenching component in an overall dynamic quenching process. Black-Right-Pointing-Pointer Ability of quercetin and rutin to change the binding constants of 6-MP-BSA complex. Black-Right-Pointing-Pointer Binding of 6-MP to BSA through entropy-driven hydrophobic interactions.
International Nuclear Information System (INIS)
Leysen, J.E.
1981-01-01
In vitro binding studies to serotoninergic receptors were performed using 3 H-LSD, 3 H-5-HT and 3 H-spiperone. An overwiew is given on findings using these three ligands with respect to the following: localization of specific binding sites, in various animal species, the regional distribution in the brain and periphery, the subcellular and cellular distribution. Properties of the binding sites, influence of the composition of the assay medium, binding kinetic properties, receptor regulation in vivo. Identity of the binding sites, differences between site for various 3 H-ligands, pharmacological specificity of the membranous binding sites, chemical composition of the macromolecular complex constituting the binding site. Function of the receptor. Binding affinities of 44 compounds were measured in binding assays using 3 H-spiperone and 3 H-LSD with rat frontal cortex membrane preparations and using 3 H-5-HT and 3 H-LSD with rat hippocampal membrane preparations
Gibiansky, Leonid; Gibiansky, Ekaterina
2018-02-01
The emerging discipline of mathematical pharmacology occupies the space between advanced pharmacometrics and systems biology. A characteristic feature of the approach is application of advance mathematical methods to study the behavior of biological systems as described by mathematical (most often differential) equations. One of the early application of mathematical pharmacology (that was not called this name at the time) was formulation and investigation of the target-mediated drug disposition (TMDD) model and its approximations. The model was shown to be remarkably successful, not only in describing the observed data for drug-target interactions, but also in advancing the qualitative and quantitative understanding of those interactions and their role in pharmacokinetic and pharmacodynamic properties of biologics. The TMDD model in its original formulation describes the interaction of the drug that has one binding site with the target that also has only one binding site. Following the framework developed earlier for drugs with one-to-one binding, this work aims to describe a rigorous approach for working with similar systems and to apply it to drugs that bind to targets with two binding sites. The quasi-steady-state, quasi-equilibrium, irreversible binding, and Michaelis-Menten approximations of the model are also derived. These equations can be used, in particular, to predict concentrations of the partially bound target (RC). This could be clinically important if RC remains active and has slow internalization rate. In this case, introduction of the drug aimed to suppress target activity may lead to the opposite effect due to RC accumulation.
Eel calcitonin binding site distribution and antinociceptive activity in rats
International Nuclear Information System (INIS)
Guidobono, F.; Netti, C.; Sibilia, V.; Villa, I.; Zamboni, A.; Pecile, A.
1986-01-01
The distribution of binding site for [ 125 I]-eel-calcitonin (ECT) to rat central nervous system, studied by an autoradiographic technique, showed concentrations of binding in the diencephalon, the brain stem and the spinal cord. Large accumulations of grains were seen in the hypothalamus, the amygdala, in the fasciculus medialis prosencephali, in the fasciculus longitudinalis medialis, in the ventrolateral part of the periventricular gray matter, in the lemniscus medialis and in the raphe nuclei. The density of grains in the reticular formation and in the nucleus tractus spinalis nervi trigemini was more moderate. In the spinal cord, grains were scattered throughout the dorsal horns. Binding of the ligand was displaced equally by cold ECT and by salmon CT(sCT), indicating that both peptides bind to the same receptors. Human CT was much weaker than sCT in displacing [ 125 I]-ECT binding. The administration of ECT into the brain ventricles of rats dose-dependently induced a significant and long-lasting enhancement of hot-plate latencies comparable with that obtained with sCT. The antinociceptive activity induced by ECT is compatible with the topographical distribution of binding sites for the peptide and is a further indication that fish CTs are active in the mammalian brain
GABAA [gamma-aminobutyric acid] type binding sites on membranes of spermatozoa
International Nuclear Information System (INIS)
Erdoe, S.L.; Wekerle, L.
1990-01-01
The binding of [ 3 H] gamma-aminobutyric acid (GABA) to seminal membranes of swines and rams was examined. Specific, GABA binding was demonstrated in both species, which showed the features of GABA A type receptors. The affinity of binding was similar in both species, whereas the density of seminal GABA binding sites was 5 times higher in swine. Our findings suggest that GABA may have a direct effect on spermatozoa
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
Recognition of AT-Rich DNA Binding Sites by the MogR Repressor
Energy Technology Data Exchange (ETDEWEB)
Shen, Aimee; Higgins, Darren E.; Panne, Daniel; (Harvard-Med); (EMBL)
2009-07-22
The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity. The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.
International Nuclear Information System (INIS)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of [ 3 H] dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity [ 3 H]DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances [ 3 H]DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+)- pentazocine, has not been fully characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of [ 3 H]DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine
Evidence for a non-opioid sigma binding site din the guinea-pig myenteric plexus
International Nuclear Information System (INIS)
Roman, F.; Pascaud, X.; Vauche, D.; Junien, J.
1988-01-01
The presence of a binding site to (+)-( 3 H)SKF 10,047 was demonstrated in a guinea-pig myenteric plexus (MYP) membrane preparation. Specific binding to this receptor was saturable, reversible, linear with protein concentration and consisted of two components, a high affinity site and a low affinity site. Morphine and naloxone 10 -4 M were unable to displace (+)-( 3 H)SKF 10,047 binding. Haloperidol, imipramine, ethylketocyclazocine and propranolol were among the most potent compounds to inhibit this specific binding. These results suggest the presence of a non-opioid haloperidol sensitive sigma receptor in the MYP of the guinea-pig
Identification of an allosteric binding site for RORγt inhibition
Scheepstra, M.; Leysen, S.; van Almen, G.; Miller, J.R.; Piesvaux, J.; Kutilek, V.; van Eenennaam, H.; Zhang, H.; Barr, K.; Nagpal, S.; Soisson, S.M.; Kornienko, M.; Wiley, K.; Elsen, N.; Sharma, S.; Correll, C.C.; Trotter, B.W.; Stelt, van der M.; Oubrie, A.; Ottmann, C.; Parthasarathy, G.; Brunsveld, L.
2015-01-01
RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of
Copper(II) Binding Sites in N-Terminally Acetylated α-Synuclein: A Theoretical Rationalization.
Ramis, Rafael; Ortega-Castro, Joaquín; Vilanova, Bartolomé; Adrover, Miquel; Frau, Juan
2017-08-03
The interactions between N-terminally acetylated α-synuclein and Cu(II) at several binding sites have been studied with DFT calculations, specifically with the M06 hybrid functional and the ωB97X-D DFT-D functional. In previous experimental studies, Cu(II) was shown to bind several α-synuclein residues, including Met1-Asp2 and His50, forming square planar coordination complexes. Also, it was determined that a low-affinity binding site exists in the C-terminal domain, centered on Asp121. However, in the N-terminally acetylated protein, present in vivo, the Met1 site is blocked. In this work, we simplify the representation of the protein by modeling each experimentally found binding site as a complex between an N-terminally acetylated α-synuclein dipeptide (or several independent residues) and a Cu(II) cation, and compare the results with a number of additional, structurally analogous sites not experimentally found. This way of representing the binding sites, although extremely simple, allows us to reproduce experimental results and to provide a theoretical rationale to explain the preference of Cu(II) for certain sites, as well as explicit geometrical structures for the complexes formed. These results are important to understand the interactions between α-synuclein and Cu(II), one of the factors inducing structural changes in the protein and leading to aggregated forms of it which may play a role in neurodegeneration.
International Nuclear Information System (INIS)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-01-01
Forskolin labelled with [ 3 H] bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg 2+ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no further increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins
Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.
1985-01-01
Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tavagnacco, Letizia; Mason, Philip E; Schnupf, Udo; Pitici, Felicia; Zhong, Linghao; Himmel, Michael E; Crowley, Michael; Cesàro, Attilio; Brady, John W
2011-05-01
Molecular dynamics simulations were carried out for a system consisting of the carbohydrate-binding module (CBM) of the cellulase CBH I from Trichoderma reesei (Hypocrea jecorina) in a concentrated solution of β-D-glucopyranose, to determine whether there is any tendency for the sugar molecules to bind to the CBM. In spite of the general tendency of glucose to behave as an osmolyte, a marked tendency for the sugar molecules to bind to the protein was observed. However, the glucose molecules tended to bind only to specific sites on the protein. As expected, the hydrophobic face of the sugar molecules, comprising the axial H1, H3, and H5 aliphatic protons, tended to adhere to the flat faces of the three tyrosine side chains on the planar binding surface of the CBM. However, a significant tendency to bind to a groove-like feature on the upper surface of the CBM was also observed. These results would not be inconsistent with a model of the mechanism for this globular domain in which the cellodextrin chain being removed from the surface of crystalline cellulose passes over the upper surface of the CBM, presumably then available for hydrolysis in the active site tunnel of this processive cellulase. Copyright © 2011 Elsevier Ltd. All rights reserved.
Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.
Directory of Open Access Journals (Sweden)
Arnoldo J Müller-Molina
Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
de la Rica, Roberto; Matsui, Hiroshi
2009-01-01
Biomolecules such as enzymes and antibodies possess binding sites where the molecular architecture and the physicochemical properties are optimum for their interaction with a particular target, in some cases even differentiating between stereoisomers. Here, we mimic this exquisite specificity via the creation of a suitable chemical environment by fabricating artificial binding sites for the protein calmodulin (CaM). By downscaling well-known surface chemical modification methodologies to the nanometer scale via silicon nanopatterning, the Ca2+-CaM conformer was found to selectively bind the biomimetic binding sites. The methodology could be adapted to mimic other protein-receptor interactions for sensing and catalysis. PMID:19757782
Development of cholecystokinin binding sites in rat upper gastrointestinal tract
International Nuclear Information System (INIS)
Robinson, P.H.; Moran, T.H.; Goldrich, M.; McHugh, P.R.
1987-01-01
Autoradiography using 125 I-labeled Bolton Hunter-CCK-33 was used to study the distribution of cholecystokinin binding sites at different stages of development in the rat upper gastrointestinal tract. Cholecystokinin (CCK) binding was present in the distal stomach, esophagus, and gastroduodenal junction in the rat fetus of gestational age of 17 days. In the 20-day fetus, specific binding was found in the gastric mucosa, antral circular muscle, and pyloric sphincter. Mucosal binding declined during postnatal development and had disappeared by day 15. Antral binding declined sharply between day 10 and day 15 and disappeared by day 50. Pyloric muscle binding was present in fetal stomach and persisted in the adult. Pancreatic CCK binding was not observed before day 10. These results suggest that CCK may have a role in the control of gastric emptying and ingestive behavior in the neonatal rat
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p
Cortisol decreases 2[125I] iodomelatonin binding sites in the duck thymus
International Nuclear Information System (INIS)
Poon, A.M.S.; Liu, Z.M.; Tang, F.; Pang, S.F.
1994-01-01
The immunosuppressive effect of chronic glucocorticoid treatment on 2[ 125 I] iodomelatonin binding in the duck thymus was studied. Two-week-old ducks were injected intraperitoneally with either 1 mg of cortisol per day (experimental group) or an equivalent volume of vehicle (control group) in the middle of the light period for seven days. 2[ 125 I] iodomelatonin binding assays were performed on thymic membranes. Cortisol injection reduced the body weight gain, size of the bursa of Fabricius and absolute weights of the primary lymphoid organs but had no effect on the spleen weights. The relative weights of the spleen were increased while those of the primary lymphoid organs were unchanged. The density of the thymus 2[ 125 I] iodomelatonin binding sites was decreased while the affinity was not affected. The modulation of the thymic 2[ 125 I] iodomelatonin binding sites by changes in the immune status of the duck suggests that these binding sites represent physiologically relevant melatonin receptors and that melatonin exerts its action on the lymphoid tissues directly. The authors findings support the hypothesis that the thymus is the target site for the immunomodulatory interactions between the pineal melatonin and the adrenal steroids. A possible inhibitory influence of adrenal steroids on the immuno-enhancing effect of melatonin is also suggested. 34 refs., 3 tabs
Cholesterol-Binding Sites in GIRK Channels: The Devil is in the Details.
Rosenhouse-Dantsker, Avia
2018-01-01
In recent years, it has become evident that cholesterol plays a direct role in the modulation of a variety of ion channels. In most cases, cholesterol downregulates channel activity. In contrast, our earlier studies have demonstrated that atrial G protein inwardly rectifying potassium (GIRK) channels are upregulated by cholesterol. Recently, we have shown that hippocampal GIRK currents are also upregulated by cholesterol. A combined computational-experimental approach pointed to putative cholesterol-binding sites in the transmembrane domain of the GIRK2 channel, the primary subunit in hippocampal GIRK channels. In particular, the principal cholesterol-binding site was located in the center of the transmembrane domain in between the inner and outer α-helices of 2 adjacent subunits. Further studies pointed to a similar cholesterol-binding site in GIRK4, a major subunit in atrial GIRK channels. However, a close look at a sequence alignment of the transmembrane helices of the 2 channels reveals surprising differences among the residues that interact with the cholesterol molecule in these 2 channels. Here, we compare the residues that form putative cholesterol-binding sites in GIRK2 and GIRK4 and discuss the similarities and differences among them.
Dayan, Avraham; Babin, Gilad; Ganoth, Assaf; Kayouf, Nivin Samir; Nitoker Eliaz, Neta; Mukkala, Srijana; Tsfadia, Yossi; Fleminger, Gideon
2017-08-01
Titanium (Ti) and its alloys are widely used in orthodontic and orthopedic implants by virtue to their high biocompatibility, mechanical strength, and high resistance to corrosion. Biointegration of the implants with the tissue requires strong interactions, which involve biological molecules, proteins in particular, with metal oxide surfaces. An exocellular high-affinity titanium dioxide (TiO 2 )-binding protein (TiBP), purified from Rhodococcus ruber, has been previously studied in our lab. This protein was shown to be homologous with the orthologous cytoplasmic rhodococcal dihydrolipoamide dehydrogenase (rhDLDH). We have found that rhDLDH and its human homolog (hDLDH) share the TiO 2 -binding capabilities with TiBP. Intrigued by the unique TiO 2 -binding properties of hDLDH, we anticipated that it may serve as a molecular bridge between Ti-based medical structures and human tissues. The objective of the current study was to locate the region and the amino acids of the protein that mediate the protein-TiO 2 surface interaction. We demonstrated the role of acidic amino acids in the nonelectrostatic enzyme/dioxide interactions at neutral pH. The observation that the interaction of DLDH with various metal oxides is independent of their isoelectric values strengthens this notion. DLDH does not lose its enzymatic activity upon binding to TiO 2 , indicating that neither the enzyme undergoes major conformational changes nor the TiO 2 binding site is blocked. Docking predictions suggest that both rhDLDH and hDLDH bind TiO 2 through similar regions located far from the active site and the dimerization sites. The putative TiO 2 -binding regions of both the bacterial and human enzymes were found to contain a CHED (Cys, His, Glu, Asp) motif, which has been shown to participate in metal-binding sites in proteins. Copyright © 2017 John Wiley & Sons, Ltd.
Handing, Katarzyna B; Shabalin, Ivan G; Szlachta, Karol; Majorek, Karolina A; Minor, Wladek
2016-03-01
Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1Å. Cetirizine is bound in two sites--a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizine binding sites. We show that the residues forming the binding pockets in ESA are highly conserved in human serum albumin (HSA), and suggest that binding of cetirizine to HSA will be similar. In support of that hypothesis, we show that the dissociation constants for cetirizine binding to CBS2 in ESA and HSA are identical using tryptophan fluorescence quenching. Presence of lysine and arginine residues that have been previously reported to undergo nonenzymatic glycosylation in CBS1 and CBS2 suggests that cetirizine transport in patients with diabetes could be altered. A review of all available SA structures from the PDB shows that in addition to the novel drug binding site we present here (CBS1), there are two pockets on SA capable of binding drugs that do not overlap with fatty acid binding sites and have not been discussed in published reviews. Copyright © 2016 Elsevier Ltd. All rights reserved.
Syson, Karl; Stevenson, Clare E. M.; Miah, Farzana; Barclay, J. Elaine; Tang, Minhong; Gorelik, Andrii; Rashid, Abdul M.; Lawson, David M.; Bornemann, Stephen
2016-01-01
GlgE is a maltosyltransferase involved in α-glucan biosynthesis in bacteria that has been genetically validated as a target for tuberculosis therapies. Crystals of the Mycobacterium tuberculosis enzyme diffract at low resolution so most structural studies have been with the very similar Streptomyces coelicolor GlgE isoform 1. Although the donor binding site for α-maltose 1-phosphate had been previously structurally defined, the acceptor site had not. Using mutagenesis, kinetics, and protein crystallography of the S. coelicolor enzyme, we have now identified the +1 to +6 subsites of the acceptor/product, which overlap with the known cyclodextrin binding site. The sugar residues in the acceptor subsites +1 to +5 are oriented such that they disfavor the binding of malto-oligosaccharides that bear branches at their 6-positions, consistent with the known acceptor chain specificity of GlgE. A secondary binding site remote from the catalytic center was identified that is distinct from one reported for the M. tuberculosis enzyme. This new site is capable of binding a branched α-glucan and is most likely involved in guiding acceptors toward the donor site because its disruption kinetically compromises the ability of GlgE to extend polymeric substrates. However, disruption of this site, which is conserved in the Streptomyces venezuelae GlgE enzyme, did not affect the growth of S. venezuelae or the structure of the polymeric product. The acceptor subsites +1 to +4 in the S. coelicolor enzyme are well conserved in the M. tuberculosis enzyme so their identification could help inform the design of inhibitors with therapeutic potential. PMID:27531751
Penicillin-binding site on the Escherichia coli cell envelope
International Nuclear Information System (INIS)
Amaral, L.; Lee, Y.; Schwarz, U.; Lorian, V.
1986-01-01
The binding of 35 S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and free epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin
The binding sites for cocaine and dopamine in the dopamine transporter overlap
DEFF Research Database (Denmark)
Beuming, Thijs; Kniazeff, Julie; Bergmann, Marianne L
2008-01-01
Cocaine is a widely abused substance with psychostimulant effects that are attributed to inhibition of the dopamine transporter (DAT). We present molecular models for DAT binding of cocaine and cocaine analogs constructed from the high-resolution structure of the bacterial transporter homolog Leu......T. Our models suggest that the binding site for cocaine and cocaine analogs is deeply buried between transmembrane segments 1, 3, 6 and 8, and overlaps with the binding sites for the substrates dopamine and amphetamine, as well as for benztropine-like DAT inhibitors. We validated our models by detailed...... inhibition of dopamine transport by cocaine....
Asap: a framework for over-representation statistics for transcription factor binding sites
DEFF Research Database (Denmark)
Marstrand, Troels T; Frellsen, Jes; Moltke, Ida
2008-01-01
-founded choice. METHODOLOGY: We introduce a software package, Asap, for fast searching with position weight matrices that include several standard methods for assessing over-representation. We have compared the ability of these methods to detect over-represented transcription factor binding sites in artificial......BACKGROUND: In studies of gene regulation the efficient computational detection of over-represented transcription factor binding sites is an increasingly important aspect. Several published methods can be used for testing whether a set of hypothesised co-regulated genes share a common regulatory...... regime based on the occurrence of the modelled transcription factor binding sites. However there is little or no information available for guiding the end users choice of method. Furthermore it would be necessary to obtain several different software programs from various sources to make a well...
Development of cholecystokinin binding sites in rat upper gastrointestinal tract
Energy Technology Data Exchange (ETDEWEB)
Robinson, P.H.; Moran, T.H.; Goldrich, M.; McHugh, P.R.
1987-04-01
Autoradiography using /sup 125/I-labeled Bolton Hunter-CCK-33 was used to study the distribution of cholecystokinin binding sites at different stages of development in the rat upper gastrointestinal tract. Cholecystokinin (CCK) binding was present in the distal stomach, esophagus, and gastroduodenal junction in the rat fetus of gestational age of 17 days. In the 20-day fetus, specific binding was found in the gastric mucosa, antral circular muscle, and pyloric sphincter. Mucosal binding declined during postnatal development and had disappeared by day 15. Antral binding declined sharply between day 10 and day 15 and disappeared by day 50. Pyloric muscle binding was present in fetal stomach and persisted in the adult. Pancreatic CCK binding was not observed before day 10. These results suggest that CCK may have a role in the control of gastric emptying and ingestive behavior in the neonatal rat.
Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites
Brautigam, Chad A; Xing, Wenmin; Yang, Sheng; Henry, Lisa; Doolittle, Lynda K; Walz, Thomas
2017-01-01
The Rho GTPase Rac1 activates the WAVE regulatory complex (WRC) to drive Arp2/3 complex-mediated actin polymerization, which underpins diverse cellular processes. Here we report the structure of a WRC-Rac1 complex determined by cryo-electron microscopy. Surprisingly, Rac1 is not located at the binding site on the Sra1 subunit of the WRC previously identified by mutagenesis and biochemical data. Rather, it binds to a distinct, conserved site on the opposite end of Sra1. Biophysical and biochemical data on WRC mutants confirm that Rac1 binds to both sites, with the newly identified site having higher affinity and both sites required for WRC activation. Our data reveal that the WRC is activated by simultaneous engagement of two Rac1 molecules, suggesting a mechanism by which cells may sense the density of active Rac1 at membranes to precisely control actin assembly. PMID:28949297
Characteristics of high affinity and low affinity adenosine binding sites in human cerebral cortex
International Nuclear Information System (INIS)
John, D.; Fox, I.V.
1986-01-01
The binding characteristics of human brain cortical membrane fractions were evaluated to test the hypothesis that there are A 1 and A 2 adenosine binding sites. The ligands used were 2-chloro(8- 3 H) adenosine and N 6 -(adenine-2, 8- 3 H) cyclohexayladenosine. Binding of chloroadenosine to human brain cortical membranes was time dependent, reversible and concentration dependent. The kinetic constant determinations from binding studies of the adenosine receptor are presented. Utilizing tritium-cyclohexyladenosine as ligand the authors observed evidence for a high affinity binding site in human brain cortical membranes with a kd of 5 nM
International Nuclear Information System (INIS)
Bokut', S.B.; Parul', D.A.; Yachnik, N.N.; Milyutin, A.A.
2001-01-01
The present study focused on the localization at least one of the ANS binding sites in the major form of human hemoglobin HbA. High-resolution docking predict ANS binding to the hemoglobin central cavity. Steady-state fluorescence titration data obtained in the absence/presence of natural effector inositol hexaphosphate (IHP) allowed to conclude that IHP competitively inhibited ANS binding to HbA. Thus, we must conclude that one of the ANS binding sites is central cavity, which makes it possible to monitor changes at this region upon ligation/deligation, effector binding and changes in hemoglobin structure
Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle
Energy Technology Data Exchange (ETDEWEB)
Shima, K.; Kitayama, S.; Nakano, R.
1987-05-01
Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3 beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
New human erythrocyte protein with binding sites for both spectrin and calmodulin
International Nuclear Information System (INIS)
Gardner, K.; Bennett, V.
1986-01-01
A new cytoskeletal protein that binds calmodulin has been purified to greater than 95% homogeneity from human erythrocyte cytoskeletons. The protein is a heterodimer with subunits of 103,000 and 97,000 and M/sub r/ = 197,000 calculated from its Stokes radius of 6.9 nm and sedimentation coefficient of 6.8. A binding affinity of this protein for calmodulin has been estimated to be 230 nM by displacement of two different concentrations of 125 I-azidocalmodulin with increasing concentrations of unmodified calmodulin followed by Dixon plot analysis. This protein is present in red cells at approximately 30,000 copies per cell and contains a very tight binding site(s) on cytoskeletons. The protein can be only partially solubilized from isolated cytoskeletons in buffers containing high salt, but can be totally solubilized from red cell ghost membranes by extraction in low ionic strength buffers. Affinity purified IgG against this calmodulin-binding protein identifies crossreacting polypeptide(s) in brain, kidney, testes and retina. Visualization of the calmodulin-binding protein by negative staining, rotary shadowing and unidirectional shadowing indicate that it is a flattened circular molecule with molecular height of 5.4 nm and a diameter of 12.4 nm. Preliminary cosedimentation studies with purified spectrin and F-actin indicate that the site of interaction of this calmodulin-binding protein with the cytoskeleton resides on spectrin
Na-K pump site density and ouabain binding affinity in cultured chick heart cells
International Nuclear Information System (INIS)
Lobaugh, L.A.; Lieberman, M.
1987-01-01
The possible existence of multiple [ 3 H]ouabain binding sites and the relationship between ouabain binding and Na-K pump inhibition in cardiac muscle were studied using cultured embryonic chick heart cells. [ 3 H]ouabain bound to a single class of sites in 0.5 mM K (0.5 Ko) with an association rate constant (k+1) of 3.4 X 10(4) M-1.s-1 and a dissociation rate constant (k-1) of 0.0095 s. Maximal specific [ 3 H]ouabain binding RT to myocyte-enriched cultures is 11.7 pmol/mg protein and Kd is 0.43 microM in 0.5 Ko, whereas Kd,apparent is 6.6 microM in 5.4 Ko. The number of binding sites per myocyte was calculated by correcting for the contribution of fibroblasts in myocyte-enriched cultures using data from homogeneous fibroblast cultures (RT = 3.3 pmol/mg protein; Kd = 0.19 microM in 0.5 Ko). Equivalence of [ 3 H]ouabain binding sites and Na-K pumps was implied by agreement between maximal specific binding of [ 3 H]ouabain and 125 I-labeled monoclonal antibody directed against Na+-K+-ATPase (approximately 2 X 10(6) sites/cell). However, [ 3 H]ouabain binding occurred at lower concentrations than inhibition of ouabain-sensitive 42 K uptake in 0.5 Ko. Further studies in both 0.5 K and 5.4 Ko showed that ouabain caused cell Na content Nai to increase over the same range of concentrations that binding occurred, implying that increased Nai may stimulate unbound Na-K pumps and prevent a proportional decrease in 42 K uptake rate. The results show that Na-K pump inhibition occurs as a functional consequence of specific ouabain binding and indicate that the Na-K pump is the cardiac glycoside receptor in cultured heart cells
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Computational prediction of cAMP receptor protein (CRP binding sites in cyanobacterial genomes
Directory of Open Access Journals (Sweden)
Su Zhengchang
2009-01-01
Full Text Available Abstract Background Cyclic AMP receptor protein (CRP, also known as catabolite gene activator protein (CAP, is an important transcriptional regulator widely distributed in many bacteria. The biological processes under the regulation of CRP are highly diverse among different groups of bacterial species. Elucidation of CRP regulons in cyanobacteria will further our understanding of the physiology and ecology of this important group of microorganisms. Previously, CRP has been experimentally studied in only two cyanobacterial strains: Synechocystis sp. PCC 6803 and Anabaena sp. PCC 7120; therefore, a systematic genome-scale study of the potential CRP target genes and binding sites in cyanobacterial genomes is urgently needed. Results We have predicted and analyzed the CRP binding sites and regulons in 12 sequenced cyanobacterial genomes using a highly effective cis-regulatory binding site scanning algorithm. Our results show that cyanobacterial CRP binding sites are very similar to those in E. coli; however, the regulons are very different from that of E. coli. Furthermore, CRP regulons in different cyanobacterial species/ecotypes are also highly diversified, ranging from photosynthesis, carbon fixation and nitrogen assimilation, to chemotaxis and signal transduction. In addition, our prediction indicates that crp genes in modern cyanobacteria are likely inherited from a common ancestral gene in their last common ancestor, and have adapted various cellular functions in different environments, while some cyanobacteria lost their crp genes as well as CRP binding sites during the course of evolution. Conclusion The CRP regulons in cyanobacteria are highly diversified, probably as a result of divergent evolution to adapt to various ecological niches. Cyanobacterial CRPs may function as lineage-specific regulators participating in various cellular processes, and are important in some lineages. However, they are dispensable in some other lineages. The
International Nuclear Information System (INIS)
Sakakibara, H.; Shima, K.; Takamatsu, J.; Said, S.I.
1990-01-01
VIP binds to specific receptors on lymphocytes and mononuclear cells and exhibits antiinflammatory properties. Eosinophils (Eos) contribute to inflammatory reactions but the regulation of Eos function is incompletely understood. The authors examined the binding of monoradioiodinated VIP, [Tyr( 125 I) 10 ] VIP ( 125 I-VIP), to Eos in guinea pigs. The interaction of 125 i-VIP with Eos was rapid, reversible, saturable and linearly dependent on the number of cells. At equilibrium the binding was competitively inhibited by native peptide or by the related peptide helodermin. Scatchard analysis suggested the presence of a single class of VIP binding sites with a low affinity and a high capacity. In the presence of isobutyl-methylxanthine, VIP, PHI or helodermin did not stimulate cyclic AMP accumulation in intact Eos, while PGE 2 or 1-isoproterenol did. VIP also did not inhibit superoxide anion generation from Eos stimulated by phorbol myristate acetate. The authors conclude that: (1) VIP binds to low-affinity, specific sites on guinea pig peritoneal eosinophils; (2) this binding is not coupled to stimulation of adenylate cyclase; and (3) the possible function of these binding sites is at present unknown
Incorporating evolution of transcription factor binding sites into ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.
Cation binding at the node of Ranvier: I. Localization of binding sites during development.
Zagoren, J C; Raine, C S; Suzuki, K
1982-06-17
Cations are known to bind to the node of Ranvier and the paranodal regions of myelinated fibers. The integrity of these specialized structures is essential for normal conduction. Sites of cation binding can be microscopically identified by the electrondense histochemical reaction product formed by the precipitate of copper sulfate/potassium ferrocyanide. This technique was used to study the distribution of cation binding during normal development of myelinating fibers. Sciatic nerves of C57B1 mice, at 1, 3, 5, 6, 7, 8, 9, 13, 16, 18, 24 and 30 days of age, were prepared for electron microscopy following fixation in phosphate-buffered 2.5% glutaraldehyde and 1% osmic acid, microdissection and incubation in phosphate-buffered 0.1 M cupric sulfate followed by 0.1 M potassium ferrocyanide. Localization of reaction product was studied by light and electron microscopy. By light microscopy, no reaction product was observed prior to 9 days of age. At 13 days, a few nodes and paranodes exhibited reaction product. This increased in frequency and intensity up to 30 days when almost all nodes or paranodes exhibited reaction product. Ultrastructurally, diffuse reaction product was first observed at 3 days of age in the axoplasm of the node, in the paranodal extracellular space of the terminal loops, in the Schwann cell proper and in the terminal loops of Schwann cell cytoplasm. When myelinated axons fulfilled the criteria for mature nodes, reaction product was no longer observed in the Schwann cell cytoplasm, while the intensity of reaction product in the nodal axoplasm and paranodal extracellular space of the terminal loops increased. Reaction product in the latter site appeared to be interrupted by the transverse bands. These results suggest that cation binding accompanies nodal maturity and that the Schwann cell may play a role in production or storage of the cation binding substance during myelinogenesis and development.
Directory of Open Access Journals (Sweden)
Stormo Gary D
2005-07-01
Full Text Available Abstract Background Recognition codes for protein-DNA interactions typically assume that the interacting positions contribute additively to the binding energy. While this is known to not be precisely true, an additive model over the DNA positions can be a good approximation, at least for some proteins. Much less information is available about whether the protein positions contribute additively to the interaction. Results Using EGR zinc finger proteins, we measure the binding affinity of six different variants of the protein to each of six different variants of the consensus binding site. Both the protein and binding site variants include single and double mutations that allow us to assess how well additive models can account for the data. For each protein and DNA alone we find that additive models are good approximations, but over the combined set of data there are context effects that limit their accuracy. However, a small modification to the purely additive model, with only three additional parameters, improves the fit significantly. Conclusion The additive model holds very well for every DNA site and every protein included in this study, but clear context dependence in the interactions was detected. A simple modification to the independent model provides a better fit to the complete data.
DEFF Research Database (Denmark)
Svensson, Birte; Cockburn, Darrell
2013-01-01
is not universal and is in fact rare among some families of enzymes. In some cases an alternative to possessing a CBM is for the enzyme to bind to the substrate at a site on the catalytic domain, but away from the active site. Such a site is termed a surface (or secondary) binding site (SBS). SBSs have been...
Identification of metal ion binding sites based on amino acid sequences.
Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua
2017-01-01
The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.
Deconstructing the DGAT1 enzyme: membrane interactions at substrate binding sites.
Directory of Open Access Journals (Sweden)
Jose L S Lopes
Full Text Available Diacylglycerol acyltransferase 1 (DGAT1 is a key enzyme in the triacylglyceride synthesis pathway. Bovine DGAT1 is an endoplasmic reticulum membrane-bound protein associated with the regulation of fat content in milk and meat. The aim of this study was to evaluate the interaction of DGAT1 peptides corresponding to putative substrate binding sites with different types of model membranes. Whilst these peptides are predicted to be located in an extramembranous loop of the membrane-bound protein, their hydrophobic substrates are membrane-bound molecules. In this study, peptides corresponding to the binding sites of the two substrates involved in the reaction were examined in the presence of model membranes in order to probe potential interactions between them that might influence the subsequent binding of the substrates. Whilst the conformation of one of the peptides changed upon binding several types of micelles regardless of their surface charge, suggesting binding to hydrophobic domains, the other peptide bound strongly to negatively-charged model membranes. This binding was accompanied by a change in conformation, and produced leakage of the liposome-entrapped dye calcein. The different hydrophobic and electrostatic interactions observed suggest the peptides may be involved in the interactions of the enzyme with membrane surfaces, facilitating access of the catalytic histidine to the triacylglycerol substrates.
Binding sites for luminescent amyloid biomarkers from non-biased molecular dynamics simulations.
König, Carolin; Skånberg, Robin; Hotz, Ingrid; Ynnerman, Anders; Norman, Patrick; Linares, Mathieu
2018-03-25
A very stable binding site for the interaction between a pentameric oligothiophene and an amyloid-β(1-42) fibril has been identified by means of non-biased molecular dynamics simulations. In this site, the probe is locked in an all-trans conformation with a Coulombic binding energy of 1200 kJ mol -1 due to the interactions between the anionic carboxyl groups of the probe and the cationic ε-amino groups in the lysine side chain. Upon binding, the conformationally restricted probes show a pronounced increase in molecular planarity. This is in line with the observed changes in luminescence properties that serve as the foundation for their use as biomarkers.
The relationship between transcription initiation RNAs and CCCTC-binding factor (CTCF localization
Directory of Open Access Journals (Sweden)
Taft Ryan J
2011-08-01
Full Text Available Abstract Background Transcription initiation RNAs (tiRNAs are nuclear localized 18 nucleotide RNAs derived from sequences immediately downstream of RNA polymerase II (RNAPII transcription start sites. Previous reports have shown that tiRNAs are intimately correlated with gene expression, RNA polymerase II binding and behaviors, and epigenetic marks associated with transcription initiation, but not elongation. Results In the present work, we show that tiRNAs are commonly found at genomic CCCTC-binding factor (CTCF binding sites in human and mouse, and that CTCF sites that colocalize with RNAPII are highly enriched for tiRNAs. To directly investigate the relationship between tiRNAs and CTCF we examined tiRNAs originating near the intronic CTCF binding site in the human tumor suppressor gene, p21 (cyclin-dependent kinase inhibitor 1A gene, also known as CDKN1A. Inhibition of CTCF-proximal tiRNAs resulted in increased CTCF localization and increased p21 expression, while overexpression of CTCF-proximal tiRNA mimics decreased CTCF localization and p21 expression. We also found that tiRNA-regulated CTCF binding influences the levels of trimethylated H3K27 at the alternate upstream p21 promoter, and affects the levels of alternate p21 (p21alt transcripts. Extending these studies to another randomly selected locus with conserved CTCF binding we found that depletion of tiRNA alters nucleosome density proximal to sites of tiRNA biogenesis. Conclusions Taken together, these data suggest that tiRNAs modulate local epigenetic structure, which in turn regulates CTCF localization.
International Nuclear Information System (INIS)
Compton, D.R.; Bagley, R.B.; Katzen, J.S.; Martin, B.R.
1987-01-01
In vivo and in vitro binding studies, both in whole brain and in selected areas, indicate that non-identical (+)- and (-)-NANM sites exist in the mouse brain, and each exhibits a different regional distribution. The in vivo binding of (+)- 3 H-NANM was found to be saturable at pharmacologically relevant doses, and represents a relatively small (10 - 22%) portion of total brain (+)- 3 H-NANM concentrations. The in vivo binding of (+)- 3 H-NANM was selectively displaced by (+)-NANM and PCP, and more sensitive to haloperidol and (+)-ketocyclazocine than the (-)- 3 H-NANM site. The in vivo binding of (-)- 3 H-NANM was selectively displaced by (-)-NANM, and more sensitive to naloxone and (-) ketocyclazocine than the (+)- 3 H-NANM site, and insensitive to PCP. This study indicates that the investigation of NANM binding sites is possible using in vivo binding techniques, and that each isomer apparently binds, in the mouse brain, to a single class of distinct sites. 32 references, 4 figures, 2 tables
A systems biology approach to transcription factor binding site prediction.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2010-03-01
Full Text Available The elucidation of mammalian transcriptional regulatory networks holds great promise for both basic and translational research and remains one the greatest challenges to systems biology. Recent reverse engineering methods deduce regulatory interactions from large-scale mRNA expression profiles and cross-species conserved regulatory regions in DNA. Technical challenges faced by these methods include distinguishing between direct and indirect interactions, associating transcription regulators with predicted transcription factor binding sites (TFBSs, identifying non-linearly conserved binding sites across species, and providing realistic accuracy estimates.We address these challenges by closely integrating proven methods for regulatory network reverse engineering from mRNA expression data, linearly and non-linearly conserved regulatory region discovery, and TFBS evaluation and discovery. Using an extensive test set of high-likelihood interactions, which we collected in order to provide realistic prediction-accuracy estimates, we show that a careful integration of these methods leads to significant improvements in prediction accuracy. To verify our methods, we biochemically validated TFBS predictions made for both transcription factors (TFs and co-factors; we validated binding site predictions made using a known E2F1 DNA-binding motif on E2F1 predicted promoter targets, known E2F1 and JUND motifs on JUND predicted promoter targets, and a de novo discovered motif for BCL6 on BCL6 predicted promoter targets. Finally, to demonstrate accuracy of prediction using an external dataset, we showed that sites matching predicted motifs for ZNF263 are significantly enriched in recent ZNF263 ChIP-seq data.Using an integrative framework, we were able to address technical challenges faced by state of the art network reverse engineering methods, leading to significant improvement in direct-interaction detection and TFBS-discovery accuracy. We estimated the accuracy
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
Radiolabelling of phoneutria nigriventer spider toxin (Tx1): a tool to study its binding site
International Nuclear Information System (INIS)
Santos, Raquel Gouvea dos; Diniz, Carlos Roberto; Nascimento, Marta Cordeiro; Lima, Maria Elena de
1996-01-01
The neurotoxin Tx1, isolated from the venom of the South American spider Phoneutria nigriventer produces tail elevation and spastic paralysis of posterior limbs after intracerebral ventricular injection in mice. Tx1 also produces ileum contraction in bioassay. We have investigated the binding of radioiodinated-Tx1 ( 125 I-Tx1) on the preparation of myenteric plexus-longitudinal muscle membrane from guinea pig ileum (MPLM) as a tool to characterize the interaction of this neurotoxin with its site. The neurotoxin Tx1 was radioiodinated with Na 125 I by the lactoperoxidase method. 125 I-Tx1 specifically binds to a single class of noninteracting binding sites of high affinity (Kd= 3.5 x 10 -10 M) and low capacity (1.2 pmol/mg protein). The specific binding increased in parallel with the protein concentration. In competition experiments the ligands of ionic channels used (sodium, potassium and calcium) did not affect the binding of 125 I-Tx1 to MPLM neither did the cholinergic ligands (hemicholinium-3, hexamethonium, d-tubocurarine and atropine). Another neurotoxin (Tx2-6, one of the isoforms of Tx2 pool) decreased toxin with MPLM and showed that toxin has a specific and saturable binding site in guinea pig ileum and this binding site appears to be related to the Tx2 site. (author)
International Nuclear Information System (INIS)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-01-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for [3H]melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-[125I]iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-[125I]Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-[125I]iodomelatonin is rapid, stable, saturable, and reversible. Saturation studies demonstrated that 2-[125I]iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-[125I]iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive)
Directory of Open Access Journals (Sweden)
Tomasz Brzoska
Full Text Available The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP. The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation.
International Nuclear Information System (INIS)
O'Connor, L.H.; McEwen, B.S.
1986-01-01
t-Butylbicycloorthobenzoate (TBOB) has been shown to bind with high affinity to sites on or near the chloride ionophore in rat brain membrane preparations. The present study used in vitro quantitative autoradiography to localize the regional distribution of [ 3 H]TBOB binding sites in rat forebrain. Receptors were labelled with 10 nM [ 3 H]TBOB. Nonspecific binding was determined by adding 10 μM picrotoxin to the incubation. Autoradiograms were generated using LKB Ultrofilm and then quantitated using computer-assisted spot-densitometry. The highest specific binding was found in frontal cortex layer 4, islands of Calleja, and ventral palladium. High binding was also found in many regions including anterior hypothalamic n., ventromedial hypothalamic n., dentate gyrus, stratum oriens and stratum lacunosum moleculare of hippocampus, and substantia nigra. Nonspecific binding represented 5 to 15% of total binding and was uniformly low throughout all brain regions. Thus, this selective probe for GABA-regulated chloride ionophore binding sites should provide a useful tool for characterizing this system and its relationship to convulsant and depressant drug action
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Characterization of [125I]endothelin-1 binding sites in rat cardiac membrane fragments
International Nuclear Information System (INIS)
Gu, X.H.; Casley, D.J.; Nayler, W.G.
1989-01-01
Standard binding and displacement techniques were used to identify high-affinity binding sites for [ 125 I]-labeled endothelin-1 (ET-1) in membranes harvested from the hearts of adult female Sprague-Dawley rats. A single population of binding sites was identified, with a KD of 0.20 +/- 0.03 nM at 37 degrees C, and a Bmax of 93.5 +/- 6.4 fmol/mg protein. Bound [ 125 I]ET-1 was displaced by ET-1 (10(-13)-10(-8) M), with a Ki of 0.08 nM. Neither (-)Bay K 8644 (10(-11)-10(-5) M), prenylamine (10(-11)-10(-5) M), (+)-cis-diltiazem (10(-10)-10(-5) M), (-)D888 (10(-10)-10(-5) M), nicardipine (10(-10)-10(-5) M), lidoflazine (10(-11)-10(-5) M), flunarizine (10(-11)-10(-5) M), omega-conotoxin (10(-13)-10(-7) M), nor prazosin (10(-10)-10(-5) M) displaced the bound ligand. Binding occurred in the absence of Ca2+ and was absent in heat-denatured membranes. These results are interpreted to mean that [ 125 I]ET-1 binds to a single class of high-affinity binding sites that differ from those occupied by known regulators of voltage activated L- and N-type Ca2+ channels
SP-A binding sites on bovine alveolar macrophages.
Plaga, S; Plattner, H; Schlepper-Schaefer, J
1998-11-25
Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.
Number of active transcription factor binding sites is essential for the Hes7 oscillator
Directory of Open Access Journals (Sweden)
de Angelis Martin
2006-02-01
Full Text Available Abstract Background It is commonly accepted that embryonic segmentation of vertebrates is regulated by a segmentation clock, which is induced by the cycling genes Hes1 and Hes7. Their products form dimers that bind to the regulatory regions and thereby repress the transcription of their own encoding genes. An increase of the half-life of Hes7 protein causes irregular somite formation. This was shown in recent experiments by Hirata et al. In the same work, numerical simulations from a delay differential equations model, originally invented by Lewis, gave additional support. For a longer half-life of the Hes7 protein, these simulations exhibited strongly damped oscillations with, after few periods, severely attenuated the amplitudes. In these simulations, the Hill coefficient, a crucial model parameter, was set to 2 indicating that Hes7 has only one binding site in its promoter. On the other hand, Bessho et al. established three regulatory elements in the promoter region. Results We show that – with the same half life – the delay system is highly sensitive to changes in the Hill coefficient. A small increase changes the qualitative behaviour of the solutions drastically. There is sustained oscillation and hence the model can no longer explain the disruption of the segmentation clock. On the other hand, the Hill coefficient is correlated with the number of active binding sites, and with the way in which dimers bind to them. In this paper, we adopt response functions in order to estimate Hill coefficients for a variable number of active binding sites. It turns out that three active transcription factor binding sites increase the Hill coefficient by at least 20% as compared to one single active site. Conclusion Our findings lead to the following crucial dichotomy: either Hirata's model is correct for the Hes7 oscillator, in which case at most two binding sites are active in its promoter region; or at least three binding sites are active, in which
Tatsinkam, Arnold Junior; Mulloy, Barbara; Rider, Christopher C
2015-08-15
Gremlin is a member of the CAN (cerberus and DAN) family of secreted BMP (bone morphogenetic protein) antagonists and also an agonist of VEGF (vascular endothelial growth factor) receptor-2. It is critical in limb skeleton and kidney development and is re-expressed during tissue fibrosis. Gremlin binds strongly to heparin and heparan sulfate and, in the present study, we sought to investigate its heparin-binding site. In order to explore a putative non-contiguous binding site predicted by computational molecular modelling, we substituted a total of 11 key arginines and lysines located in three basic residue sequence clusters with homologous sequences from cerberus and DAN (differential screening selected gene abberative in neuroblastoma), CAN proteins which lack basic residues in these positions. A panel of six Myc-tagged gremlin mutants, MGR-1-MGR-6 (MGR, mutant gremlin), each containing different combinations of targeted substitutions, all showed markedly reduced affinity for heparin as demonstrated by their NaCl elution on heparin affinity chromatography, thus verifying our predictions. Both MGR-5 and MGR-6 retained BMP-4-binding activity comparable to that of wild-type gremlin. Low-molecular-mass heparin neither promoted nor inhibited BMP-4 binding. Finally, glutaraldehyde cross-linking demonstrated that gremlin forms non-covalent dimers, similar behaviour to that of DAN and also PRDC (protein related to cerberus and DAN), another CAN protein. The resulting dimer would possess two heparin-binding sites, each running along an exposed surface on the second β-strand finger loop of one of the monomers. © 2015 Authors; published by Portland Press Limited.
Directory of Open Access Journals (Sweden)
Deng W-M
2009-02-01
Full Text Available Abstract Background Dystroglycan (Dg is a transmembrane protein that is a part of the Dystrophin Glycoprotein Complex (DGC which connects the extracellular matrix to the actin cytoskeleton. The C-terminal end of Dg contains a number of putative SH3, SH2 and WW domain binding sites. The most C-terminal PPXY motif has been established as a binding site for Dystrophin (Dys WW-domain. However, our previous studies indicate that both Dystroglycan PPXY motives, WWbsI and WWbsII can bind Dystrophin protein in vitro. Results We now find that both WW binding sites are important for maintaining full Dg function in the establishment of oocyte polarity in Drosophila. If either WW binding site is mutated, the Dg protein can still be active. However, simultaneous mutations in both WW binding sites abolish the Dg activities in both overexpression and loss-of-function oocyte polarity assays in vivo. Additionally, sequence comparisons of WW binding sites in 12 species of Drosophila, as well as in humans, reveal a high level of conservation. This preservation throughout evolution supports the idea that both WW binding sites are functionally required. Conclusion Based on the obtained results we propose that the presence of the two WW binding sites in Dystroglycan secures the essential interaction between Dg and Dys and might further provide additional regulation for the cytoskeletal interactions of this complex.
Identification of nucleic acid binding sites on translin-associated factor X (TRAX protein.
Directory of Open Access Journals (Sweden)
Gagan Deep Gupta
Full Text Available Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity.
Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein
Gupta, Gagan Deep; Kumar, Vinay
2012-01-01
Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937
Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2017-09-01
Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Binding Sites for Amyloid-β Oligomers and Synaptic Toxicity
Smith, Levi M.; Strittmatter, Stephen M.
2017-01-01
In Alzheimer’s disease (AD), insoluble and fibrillary amyloid-β (Aβ) peptide accumulates in plaques. However, soluble Aβ oligomers are most potent in creating synaptic dysfunction and loss. Therefore, receptors for Aβ oligomers are hypothesized to be the first step in a neuronal cascade leading to dementia. A number of cell-surface proteins have been described as Aβ binding proteins, and one or more are likely to mediate Aβ oligomer toxicity in AD. Cellular prion protein (PrPC) is a high-affinity Aβ oligomer binding site, and a range of data delineates a signaling pathway leading from Aβ complexation with PrPC to neuronal impairment. Further study of Aβ binding proteins will define the molecular basis of this crucial step in AD pathogenesis. PMID:27940601
Binding sites for 3H-LTC4 in membranes from guinea pig ileal longitudinal muscle
International Nuclear Information System (INIS)
Nicosia, S.; Crowley, H.J.; Oliva, D.; Welton, A.F.
1984-01-01
Leutriene (LTC4) is one of the components of Slow Reacting Substance of Anaphylaxis (SRS-A) and is a potent constrictor of guinea pig ilea. The contraction is likely to be a receptor-mediated process. Here the authors report the existence of specific binding sites for 3 H-LTC4 in a crude membrane preparation from guinea pig ileal longitudinal muscle. At 4 degrees C in the presence of 20 mM Serine-borate, binding increases linearly with protein concentration, reaches equilibrium in 10 minutes, and is reversible upon addition of 3 x 10(-5) M unlabelled LTC4. The dissociation curve is consistent with the existence of more than one class of binding site. Ca++ and Mg++ greatly enhance the binding of 3 H-LTC4 at equilibrium. In the presence of 5 mM CaCl 2 and MgCl 2 not only LTC4 (IC50 10(-7)M), but also LTD4 and the SRS-A antagonist FPL 55712 can compete with 3 H-LTC4 for its binding sites. FPL 55712 only displaces 60-70% of the total amount bound, while LTC4 displaces 90-95%. These studies indicate that multiple classes of binding sites exist for 3 H-LTC4 in guinea pig ileal longitudinal muscle, and that at least part of these binding sites might be related to the ability of LTC4 to contract guinea pig ilea
The interaction of substituted benzamides with brain benzodiazepine binding sites in vitro.
Horton, R. W.; Lowther, S.; Chivers, J.; Jenner, P.; Marsden, C. D.; Testa, B.
1988-01-01
1. The interaction of substituted benzamides with brain benzodiazepine (BDZ) binding sites was examined by their ability to displace [3H]-flunitrazepam ([3H]-FNM) from specific binding sites in bovine cortical membranes in vitro. 2. Clebopride, Delagrange 2674, Delagrange 2335 and BRL 20627 displayed concentration-dependent displacement of [3H]-FNM with IC50 values of 73 nM, 132 nM, 7.7 microM and 5.9 microM, respectively. Other substituted benzamides including metoclopramide, sulpiride, tiap...
PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information
Wu, Hao; Ji, Hongkai
2014-01-01
ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116
Active site - a site of binding of affinity inhibitors in baker's yeast inorganic pyrophosphatase
International Nuclear Information System (INIS)
Svyato, I.E.; Sklyankina, V.A.; Avaeva, S.M.
1986-01-01
The interaction of the enzyme-substrate complex with methyl phosphate, O-phosphoethanolamine, O-phosphopropanolamine, N-acetylphosphoserine, and phosphoglyolic acid, as well as pyrophosphatase, modified by monoesters of phosphoric acid, with pyrophosphate and tripolyphosphate, was investigated. It was shown that the enzyme containing the substrate in the active site does not react with monophosphates, but modified pyrophosphatase entirely retains the ability to bind polyanions to the regulatory site. It is concluded that the inactivation of baker's yeast inorganic pyrophosphatase by monoesters of phosphoric acid, which are affinity inhibitors of it, is the result of modification of the active site of the enzyme
Training increases the concentration of [3H]ouabain-binding sites in rat skeletal muscle
DEFF Research Database (Denmark)
Kjeldsen, K; Richter, Erik; Galbo, H
1986-01-01
]ouabain-binding-site concentration in the diaphragm, but in the heart ventricles, the K+-dependent 3-O-methylfluorescein phosphatase activity increased by 20% (P less than 0.001). Muscle inactivity induced by denervation, plaster immobilisation or tenotomy reduced the [3H]ouabain-binding-site concentration by 20-30% (P less than 0...
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
(/sup 3/H)Spiperone binding sites in brain: autoradiographic localization of multiple receptors
Energy Technology Data Exchange (ETDEWEB)
Palacios, J M; Niehoff, D L; Kuhar, M J [Johns Hopkins Univ., Baltimore, MD (USA). School of Medicine
1981-01-01
(/sup 3/H)Spiperone ((/sup 3/H)SP) binding sites were localized by light microscopic autoradiography, after in vitro labelling. The kinetic and pharmacological characteristics of these binding sites were studied in slide-mounted sections of rat forebrain, and optimal labeling conditions were defined. Autoradiograms were obtained by apposing emulsion-coated coverslips to labeled sections. Differential drug sensitivity allowed the selective displacement of (/sup 3/H)SP from dopamine receptors by ADTN, from serotonin receptors by cinanserin, from both by haloperidol and from unique spiperone sites by unlabeled spiperone. The various sites presented a differential anatomical localization. For example, only dopaminergic sites were found in the glomerular layer of the olfactory bulb; only serotonergic sites were found in lamina IV of the neocortex, and a high concentration of unique spiperone sites were found in parts of the hippocampus.
Cell-type specificity of ChIP-predicted transcription factor binding sites
Directory of Open Access Journals (Sweden)
Håndstad Tony
2012-08-01
Full Text Available Abstract Background Context-dependent transcription factor (TF binding is one reason for differences in gene expression patterns between different cellular states. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identifies genome-wide TF binding sites for one particular context—the cells used in the experiment. But can such ChIP-seq data predict TF binding in other cellular contexts and is it possible to distinguish context-dependent from ubiquitous TF binding? Results We compared ChIP-seq data on TF binding for multiple TFs in two different cell types and found that on average only a third of ChIP-seq peak regions are common to both cell types. Expectedly, common peaks occur more frequently in certain genomic contexts, such as CpG-rich promoters, whereas chromatin differences characterize cell-type specific TF binding. We also find, however, that genotype differences between the cell types can explain differences in binding. Moreover, ChIP-seq signal intensity and peak clustering are the strongest predictors of common peaks. Compared with strong peaks located in regions containing peaks for multiple transcription factors, weak and isolated peaks are less common between the cell types and are less associated with data that indicate regulatory activity. Conclusions Together, the results suggest that experimental noise is prevalent among weak peaks, whereas strong and clustered peaks represent high-confidence binding events that often occur in other cellular contexts. Nevertheless, 30-40% of the strongest and most clustered peaks show context-dependent regulation. We show that by combining signal intensity with additional data—ranging from context independent information such as binding site conservation and position weight matrix scores to context dependent chromatin structure—we can predict whether a ChIP-seq peak is likely to be present in other cellular contexts.
Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A
2006-03-01
Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.
Washington, Shannan D; Musarrat, Farhana; Ertel, Monica K; Backes, Gregory L; Neumann, Donna M
2018-04-15
There are seven conserved CTCF binding domains in the herpes simplex virus 1 (HSV-1) genome. These binding sites individually flank the latency-associated transcript (LAT) and the immediate early (IE) gene regions, suggesting that CTCF insulators differentially control transcriptional domains in HSV-1 latency. In this work, we show that two CTCF binding motifs in HSV-1 display enhancer blocking in a cell-type-specific manner. We found that CTCF binding to the latent HSV-1 genome was LAT dependent and that the quantity of bound CTCF was site specific. Following reactivation, CTCF eviction was dynamic, suggesting that each CTCF site was independently regulated. We explored whether CTCF sites recruit the polycomb-repressive complex 2 (PRC2) to establish repressive domains through a CTCF-Suz12 interaction and found that Suz12 colocalized to the CTCF insulators flanking the ICP0 and ICP4 regions and, conversely, was removed at early times postreactivation. Collectively, these data support the idea that CTCF sites in HSV-1 are independently regulated and may contribute to lytic-latent HSV-1 control in a site-specific manner. IMPORTANCE The role of chromatin insulators in DNA viruses is an area of interest. It has been shown in several beta- and gammaherpesviruses that insulators likely control the lytic transcriptional profile through protein recruitment and through the formation of three-dimensional (3D) chromatin loops. The ability of insulators to regulate alphaherpesviruses has been understudied to date. The alphaherpesvirus HSV-1 has seven conserved insulator binding motifs that flank regions of the genome known to contribute to the establishment of latency. Our work presented here contributes to the understanding of how insulators control transcription of HSV-1. Copyright © 2018 American Society for Microbiology.
PATTERN BASED DETECTION OF POTENTIALLY DRUGGABLE BINDING SITES BY LIGAND SCREENING
Directory of Open Access Journals (Sweden)
Uttam Pal
2018-03-01
Full Text Available This article describes an innovative way of finding the potentially druggable sites on a target protein, which can be used for orthosteric and allosteric lead detection in a single virtual screening setup. Druggability estimation for an alternate binding site other than the canonical ligand-binding pocket of an enzyme is rewarding for several inherent benefits. Allostery is a direct and efficient way of regulating biomacromolecule function. The allosteric modulators can fine-tune protein mechanics. Besides, allosteric sites are evolutionarily less conserved/more diverse even in very similarly related proteins, thus, provides high degree of specificity in targeting a particular protein. Therefore, targeting of allosteric sites is gaining attention as an emerging strategy in rational drug design. However, the experimental approaches provide a limited degree of characterization of new allosteric sites. Computational approaches are useful to analyze and select potential allosteric sites for drug discovery. Here, the use of molecular docking, which has become an integral part of the drug discovery process, has been discussed to predict the druggability of novel allosteric sites as well as the active site on target proteins by ligand screening. Genetic algorithm was used for docking and the whole protein was placed in the search space. For each ligand in the library of small molecules, the genetic algorithm was run for multiple times to populate all the druggable sites in the target protein, which was then translated into two dimensional density maps or “patterns”. High density clusters were observed for lead like molecules in these pattern diagrams. Each cluster in such a pattern diagram indicated a plausible binding site and the density gave its druggability score in terms of weighted probabilities. The patterns were filtered to find the leads for each of the druggable sites on the target protein. Such a novel pattern based analysis of the
Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.
Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O
2010-08-01
Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.
Directory of Open Access Journals (Sweden)
Wang Pu
2010-10-01
Full Text Available Abstract The Epstein-Barr Virus (EBV Nuclear Antigen 1 (EBNA1 protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP, regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP combined with massively parallel deep-sequencing (ChIP-Seq was used to identify cellular sites bound by EBNA1. Sites identified by ChIP-Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A consensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, suggesting that some of these sites are indirectly bound by EBNA1. EBNA1 also bound close to the transcriptional start sites of a large number of cellular genes, including HDAC3, CDC7, and MAP3K1, which we show are positively regulated by EBNA1. EBNA1 binding sites were enriched in some repetitive elements, especially LINE 1 retrotransposons, and had weak correlations with histone modifications and ORC binding. We conclude that EBNA1 can interact with a large number of cellular genes and chromosomal loci in latently infected cells, but that these sites are likely to represent a complex ensemble of direct and indirect EBNA
Hassan, Faizule; Ni, Shuisong; Arnett, Tyler C; McKell, Melanie C; Kennedy, Michael A
2018-03-30
High mobility group AT-hook 1 (HMGA1) protein is an oncogenic architectural transcription factor that plays an essential role in early development, but it is also implicated in many human cancers. Elevated levels of HMGA1 in cancer cells cause misregulation of gene expression and are associated with increased cancer cell proliferation and increased chemotherapy resistance. We have devised a strategy of using engineered viruses to deliver decoy hyper binding sites for HMGA1 to the nucleus of cancer cells with the goal of sequestering excess HMGA1 at the decoy hyper binding sites due to binding competition. Sequestration of excess HMGA1 at the decoy binding sites is intended to reduce HMGA1 binding at the naturally occurring genomic HMGA1 binding sites, which should result in normalized gene expression and restored sensitivity to chemotherapy. As proof of principle, we engineered the replication defective adenovirus serotype 5 genome to contain hyper binding sites for HMGA1 composed of six copies of an individual HMGA1 binding site, referred to as HMGA-6. A 70%-80% reduction in cell viability and increased sensitivity to gemcitabine was observed in five different pancreatic and liver cancer cell lines 72 hr after infection with replication defective engineered adenovirus serotype 5 virus containing the HMGA-6 decoy hyper binding sites. The decoy hyper binding site strategy should be general for targeting overexpression of any double-stranded DNA-binding oncogenic transcription factor responsible for cancer cell proliferation.
Pomponi, Massimo; Bertonati, Claudia; Patamia, Maria; Marta, Maurizio; Derocher, Andrew E; Lydersen, Christian; Kovacs, Kit M; Wiig, Oystein; Bårdgard, Astrid J
2002-11-01
Polar bear (Ursus maritimus) hemoglobin (Hb) shows a low response to 2,3-diphosphoglycerate (2,3-DPG), compared to human Hb A0, even though these proteins have the same 2,3-DPG-binding site. In addition, polar bear Hb shows a high response to chloride and an alkaline Bohr effect (deltalog P50/deltapH) that is significantly greater than that of human Hb A0. The difference in sequence Pro (Hb A0)-->Gly (polar bear Hb) at position A2 in the A helix seems to be critical for reduced binding of 2,3-DPG. Our results also show that the A2 position may influence not only the flexibility of the A helix, but that differences in flexibility of the first turn of the A helix may affect the unloading of oxygen for the intrinsic ligand affinities of the alpha and beta chains. However, preferential binding to either chain can only take place if there is appreciable asymmetric binding of the phosphoric effector. Regarding this point, 31P NMR data suggest a loss of symmetry of the 2,3-DPG-binding site in the deoxyHb-2,3-DPG complex.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2016-05-28
The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.
BSSF: a fingerprint based ultrafast binding site similarity search and function analysis server
Directory of Open Access Journals (Sweden)
Jiang Hualiang
2010-01-01
Full Text Available Abstract Background Genome sequencing and post-genomics projects such as structural genomics are extending the frontier of the study of sequence-structure-function relationship of genes and their products. Although many sequence/structure-based methods have been devised with the aim of deciphering this delicate relationship, there still remain large gaps in this fundamental problem, which continuously drives researchers to develop novel methods to extract relevant information from sequences and structures and to infer the functions of newly identified genes by genomics technology. Results Here we present an ultrafast method, named BSSF(Binding Site Similarity & Function, which enables researchers to conduct similarity searches in a comprehensive three-dimensional binding site database extracted from PDB structures. This method utilizes a fingerprint representation of the binding site and a validated statistical Z-score function scheme to judge the similarity between the query and database items, even if their similarities are only constrained in a sub-pocket. This fingerprint based similarity measurement was also validated on a known binding site dataset by comparing with geometric hashing, which is a standard 3D similarity method. The comparison clearly demonstrated the utility of this ultrafast method. After conducting the database searching, the hit list is further analyzed to provide basic statistical information about the occurrences of Gene Ontology terms and Enzyme Commission numbers, which may benefit researchers by helping them to design further experiments to study the query proteins. Conclusions This ultrafast web-based system will not only help researchers interested in drug design and structural genomics to identify similar binding sites, but also assist them by providing further analysis of hit list from database searching.
Binding of the mannose-specific lectin, griffithsin, to HIV-1 gp120 exposes the CD4-binding site
CSIR Research Space (South Africa)
Alexandre, Kabamba B
2011-09-01
Full Text Available of the lectin griffithsin (GRFT) with HIV-1 gp120 and its effects on exposure of the CD4-binding site (CD4bs). We found that GRFT enhanced the binding of HIV-1 onto plates coated with anti-CD4bs antibodies b12, b6 or the CD4 receptor mimetic, CD4-IgG2...
International Nuclear Information System (INIS)
Mak, J.C.; Barnes, P.J.
1988-01-01
125 I-Human calcitonin gene-related peptide (hCGRP) binding sites were localized in human and guinea pig lungs by an autoradiographic method. Scatchard analysis of saturation experiments from slide-mounted sections of guinea pig lung displayed specific 125 I-hCGRP binding sites with a dissociation constant (Kd) of 0.72 +/- 0.05 nM (mean +/- S.E.M., n = 3) and a maximal number of binding sites (Bmax) of 133.4 +/- 5.6 fmol/mg protein. In both human and guinea pig lung, autoradiography revealed that CGRP binding sites were widely distributed, with particularly dense labeling over bronchial and pulmonary blood vessels of all sizes and alveolar walls. Airway smooth muscle and epithelium of large airways was sparsely labeled but no labeling was found over submucosal glands. This localization corresponds well to the reported pattern of CGRP-like immunoreactive innervation. The findings of localization of CGRP binding sites on bronchial and pulmonary blood vessels indicate that CGRP may be important in the regulation of airway and pulmonary blood flow
Effects of sodium on cell surface and intracellular 3H-naloxone binding sites
International Nuclear Information System (INIS)
Pollack, A.E.; Wooten, G.F.
1987-01-01
The binding of the opiate antagonist 3 H-naloxone was examined in rat whole brain homogenates and in crude subcellular fractions of these homogenates (nuclear, synaptosomal, and mitochondrial fractions) using buffers that approximated intra- (low sodium concentration) and extracellular (high sodium concentration) fluids. Saturation studies showed a two-fold decrease in the dissociation constant (Kd) in all subcellular fractions examined in extracellular buffer compared to intracellular buffer. In contrast, there was no significant effect of the buffers on the Bmax. Thus, 3 H-naloxone did not distinguish between binding sites present on cell surface and intracellular tissues in these two buffers. These results show that the sodium effect of opiate antagonist binding is probably not a function of altered selection of intra- and extracellular binding sites. 17 references, 2 tables
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Sugar-binding sites of the HA1 subcomponent of Clostridium botulinum type C progenitor toxin.
Nakamura, Toshio; Tonozuka, Takashi; Ide, Azusa; Yuzawa, Takayuki; Oguma, Keiji; Nishikawa, Atsushi
2008-02-22
Clostridium botulinum type C 16S progenitor toxin contains a hemagglutinin (HA) subcomponent, designated HA1, which appears to play an important role in the effective internalization of the toxin in gastrointestinal epithelial cells and in creating a broad specificity for the oligosaccharide structure that corresponds to various targets. In this study, using the recombinant protein fused to glutathione S-transferase, we investigated the binding specificity of the HA1 subcomponent to sugars and estimated the binding sites of HA1 based on X-ray crystallography and soaking experiments using various sugars. N-Acetylneuraminic acid, N-acetylgalactosamine, and galactose effectively inhibited the binding that occurs between glutathione S-transferase-HA1 and mucins, whereas N-acetylglucosamine and glucose did not inhibit it. The crystal structures of HA1 complex with N-acetylneuraminic acid, N-acetylgalactosamine, and galactose were also determined. There are two sugar-binding sites, sites I and II. Site I corresponds to the electron densities noted for all sugars and is located at the C-terminal beta-trefoil domain, while site II corresponds to the electron densities noted only for galactose. An aromatic amino acid residue, Trp176, at site I has a stacking interaction with the hexose ring of the sugars. On the other hand, there is no aromatic residue at site II; thus, the interaction with galactose seems to be poor. The double mutant W176A at site I and D271F at site II has no avidity for N-acetylneuraminic acid but has avidity for galactose. In this report, the binding specificity of botulinum C16S toxin HA1 to various sugars is demonstrated based on its structural features.
A model-based approach to identify binding sites in CLIP-Seq data.
Directory of Open Access Journals (Sweden)
Tao Wang
Full Text Available Cross-linking immunoprecipitation coupled with high-throughput sequencing (CLIP-Seq has made it possible to identify the targeting sites of RNA-binding proteins in various cell culture systems and tissue types on a genome-wide scale. Here we present a novel model-based approach (MiClip to identify high-confidence protein-RNA binding sites from CLIP-seq datasets. This approach assigns a probability score for each potential binding site to help prioritize subsequent validation experiments. The MiClip algorithm has been tested in both HITS-CLIP and PAR-CLIP datasets. In the HITS-CLIP dataset, the signal/noise ratios of miRNA seed motif enrichment produced by the MiClip approach are between 17% and 301% higher than those by the ad hoc method for the top 10 most enriched miRNAs. In the PAR-CLIP dataset, the MiClip approach can identify ∼50% more validated binding targets than the original ad hoc method and two recently published methods. To facilitate the application of the algorithm, we have released an R package, MiClip (http://cran.r-project.org/web/packages/MiClip/index.html, and a public web-based graphical user interface software (http://galaxy.qbrc.org/tool_runner?tool_id=mi_clip for customized analysis.
Inducible nucleosome depletion at OREBP-binding-sites by hypertonic stress.
Directory of Open Access Journals (Sweden)
Edith H Y Tong
Full Text Available BACKGROUND: Osmotic Response Element-Binding Protein (OREBP, also known as TonEBP or NFAT5, is a unique transcription factor. It is hitherto the only known mammalian transcription factor that regulates hypertonic stress-induced gene transcription. In addition, unlike other monomeric members of the NFAT family, OREBP exists as a homodimer and it is the only transcription factor known to bind naked DNA targets by complete encirclement in vitro. Nevertheless, how OREBP interacts with target DNA, also known as ORE/TonE, and how it elicits gene transcription in vivo, remains unknown. METHODOLOGY: Using hypertonic induction of the aldose reductase (AR gene activation as a model, we showed that OREs contained dynamic nucleosomes. Hypertonic stress induced a rapid and reversible loss of nucleosome(s around the OREs. The loss of nucleosome(s was found to be initiated by an OREBP-independent mechanism, but was significantly potentiated in the presence of OREBP. Furthermore, hypertonic induction of AR gene was associated with an OREBP-dependent hyperacetylation of histones that spanned the 5' upstream sequences and at least some exons of the gene. Nevertheless, nucleosome loss was not regulated by the acetylation status of histone. SIGNIFICANCE: Our findings offer novel insights into the mechanism of OREBP-dependent transcriptional regulation and provide a basis for understanding how histone eviction and transcription factor recruitment are coupled.
Directory of Open Access Journals (Sweden)
Gowda Veerabasappa T
2007-12-01
Full Text Available Abstract Background The snake venom group IIA secreted phospholipases A2 (SVPLA2, present in the Viperidae snake family exhibit a wide range of toxic and pharmacological effects. They exert their different functions by catalyzing the hydrolysis of phospholipids (PL at the membrane/water interface and by highly specific direct binding to: (i presynaptic membrane-bound or intracellular receptors; (ii natural PLA2-inhibitors from snake serum; and (iii coagulation factors present in human blood. Results Using surface plasmon resonance (SPR protein-protein interaction measurements and an in vitro biological test of inhibition of prothrombinase activity, we identify a number of Viperidae venom SVPLA2s that inhibit blood coagulation through direct binding to human blood coagulation factor Xa (FXa via a non-catalytic, PL-independent mechanism. We classify the SVPLA2s in four groups, depending on the strength of their binding. Molecular electrostatic potentials calculated at the surface of 3D homology-modeling models show a correlation with inhibition of prothrombinase activity. In addition, molecular docking simulations between SVPLA2 and FXa guided by the experimental data identify the potential FXa binding site on the SVPLA2s. This site is composed of the following regions: helices A and B, the Ca2+ loop, the helix C-β-wing loop, and the C-terminal fragment. Some of the SVPLA2 binding site residues belong also to the interfacial binding site (IBS. The interface in FXa involves both, the light and heavy chains. Conclusion We have experimentally identified several strong FXa-binding SVPLA2s that disrupt the function of the coagulation cascade by interacting with FXa by the non-catalytic PL-independent mechanism. By theoretical methods we mapped the interaction sites on both, the SVPLA2s and FXa. Our findings may lead to the design of novel, non-competitive FXa inhibitors.
National Research Council Canada - National Science Library
Wang, Yong-Dong
1999-01-01
.... The key approach is to prevent the binding of two transcription factors, ESX and AP-2, to the consensus DNA binding sites contained within the Her2/neu promoter resulting in inhibition of transcription factor function...
Specificity of cellular DNA-binding sites of microbial populations in a Florida reservoir
International Nuclear Information System (INIS)
Paul, J.H.; Pichard, S.L.
1989-01-01
The substrate specificity of the DNA-binding mechanism(s) of bacteria in a Florida reservoir was investigated in short- and long-term uptake studies with radiolabeled DNA and unlabeled competitors. Thymine oligonucleotides ranging in size from 2 base pairs to 19 to 24 base pairs inhibited DNA binding in 20-min incubations by 43 to 77%. Deoxynucleoside monophosphates, thymidine, and thymine had little effect on short-term DNA binding, although several of these compounds inhibited the uptake of the radiolabel from DNA in 4-h incubations. Inorganic phosphate and glucose-1-phosphate inhibited neither short- nor long-term binding of [ 3 H]- or [ 32 P]DNA, indicating that DNA was not utilized as a phosphorous source in this reservoir. RNA inhibited both short- and long-term radiolabeled DNA uptake as effectively as unlabeled DNA. Collectively these results indicate that aquatic bacteria possess a generalized nuclei acid uptake/binding mechanism specific for compounds containing phosphodiester bonds and capable of recognizing oligonucleotides as short as dinucleotides. This binding site is distinct from nucleoside-, nucleotide-, phosphomonoester-, and inorganic phosphate-binding sites. Such a nucleic acid-binding mechanism may have evolved for the utilization of extracellular DNA (and perhaps RNA), which is abundant in many marine and freshwater environments
Interaction of D-LSD with binding sites in brain: a study in vivo and in vitro
International Nuclear Information System (INIS)
Ebersole, B.L.J.
1985-01-01
The localization of [ 3 H]-d-lysergic acid diethylamide ([ 3 H]LSD) binding sites in the mouse brain was compared in vivo and in vitro. Radioautography of brain sections incubated with [ 3 H]LSD in vitro revealed substantial specific [ 3 H]LSD binding in cortical layers III-IV and areas CA1 and dentate gyrus in hippocampus. In contrast, in brain sections from animals that received [ 3 H]LSD in vivo, binding in hippocampus was scant and diffuse, although the pattern of labeling in cortex was similar to that seen in vitro. The low specific binding in hippocampus relative to cortex was confirmed by homogenate filtration studies of brain areas from mice that received injections of [ 3 H]LSD. Time-course studies established that peak specific binding at ten minutes was the same in cortex and hippocampus. At all times, binding in hippocampus was about one-third of that in cortex; in contrast, the concentration of free [ 3 H]LSD did not vary between regions. This finding was unexpected, because binding studies in vitro in membrane preparations indicated that the density and affinity of [ 3 H]LSD binding sites were similar in both brain regions. Saturation binding studies in vivo showed that the lower amount of [ 3 H]LSD binding in hippocampus was attributable to a lower density of sites labeled by [ 3 H]LSD. The pharmacological identify of [ 3 H]LSD binding sites in vivo may be relevant to the hallucinogenic properties of LSD and of other related hallucinogens
Rohacova, Jana; Sastre, German; Marin, M Luisa; Miranda, Miguel A
2011-09-08
Binding of natural bile acids to human serum albumin (HSA) is an important step in enterohepatic circulation and provides a measure of liver function. In this article, we report on the use of four dansyl (Dns) derivatives of cholic acid (ChA) to demonstrate a regiodifferentiation in their relative affinity for the two binding sites of HSA. Using both steady-state and time-resolved fluorescence, formation of Dns-ChA@HSA complexes was confirmed; the corresponding binding constants were determined, and their distribution between bulk solution and HSA microenvironment was estimated. By means of energy transfer from Trp to the Dns moiety, donor-acceptor distances were estimated (21-25 Å) and found to be compatible with both site 1 and site 2 occupancies. Nevertheless, titration using warfarin and ibuprofen as specific displacement probes clearly indicated that 3α- and 3β-Dns-ChA bind to HSA at site 2, whereas their C-7 regioisomers bind to HSA at site 1. Furthermore, the C-3-labeled compounds are displaced by lithocholic acid, whereas they are insensitive to ChA, confirming the assumption that the former binds to HSA at site 2. Thus, Dns labeling provides a useful tool to modulate the relative affinity of ChA to the major binding sites of HSA and, in combination with other fluorescent ChA analogs, to mimic the binding behavior of natural bile acids.
Characterisation of the human NMDA receptor subunit NR3A glycine binding site
DEFF Research Database (Denmark)
Nilsson, A; Duan, J; Mo-Boquist, L-L
2007-01-01
In this study, we characterise the binding site of the human N-methyl-d-aspartate (NMDA) receptor subunit NR3A. Saturation radioligand binding of the NMDA receptor agonists [(3)H]-glycine and [(3)H]-glutamate showed that only glycine binds to human NR3A (hNR3A) with high affinity (K(d)=535nM (277...
Directory of Open Access Journals (Sweden)
Marx Kenneth A
2006-03-01
Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also
Phosphorus Binding Sites in Proteins: Structural Preorganization and Coordination
DEFF Research Database (Denmark)
Gruber, Mathias Felix; Greisen, Per Junior; Junker, Märta Caroline
2014-01-01
to individual structures that bind to phosphate groups; here, we investigate a total of 8307 structures obtained from the RCSB Protein Data Bank (PDB). An analysis of the binding site amino acid propensities reveals very characteristic first shell residue distributions, which are found to be influenced...... by the characteristics of the phosphorus compound and by the presence of cobound cations. The second shell, which supports the coordinating residues in the first shell, is found to consist mainly of protein backbone groups. Our results show how the second shell residue distribution is dictated mainly by the first shell...
Interaction of Palmitic Acid with Metoprolol Succinate at the Binding Sites of Bovine Serum Albumin
Directory of Open Access Journals (Sweden)
Mashiur Rahman
2014-12-01
Full Text Available Purpose: The aim of this study was to characterize the binding profile as well as to notify the interaction of palmitic acid with metoprolol succinate at its binding site on albumin. Methods: The binding of metoprolol succinate to bovine serum albumin (BSA was studied by equilibrium dialysis method (ED at 27°C and pH 7.4, in order to have an insight in the binding chemistry of the drug to BSA in presence and absence of palmitic acid. The study was carried out using ranitidine as site-1 and diazepam as site-2 specific probe. Results: Different analysis of binding of metoprolol succinate to bovine serum albumin suggested two sets of association constants: high affinity association constant (k1 = 11.0 x 105 M-1 with low capacity (n1 = 2 and low affinity association (k2 = 4.0×105 M-1 constant with high capacity (n2 = 8 at pH 7.4 and 27°C. During concurrent administration of palmitic acid and metoprolol succinate in presence or absence of ranitidine or diazepam, it was found that palmitic acid displaced metoprolol succinate from its binding site on BSA resulting reduced binding of metoprolol succinate to BSA. The increment in free fraction of metoprolol succinate was from 26.27% to 55.08% upon the addition of increased concentration of palmitic acid at a concentration of 0×10-5 M to 16×10-5 M. In presence of ranitidine and diazepam, palmitic acid further increases the free fraction of metoprolol succinate from 33.05% to 66.95% and 40.68% to 72.88%, respectively. Conclusion: This data provided the evidence of interaction at higher concentration of palmitic acid at the binding sites on BSA, which might change the pharmacokinetic properties of metoprolol succinate.
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2011-06-01
Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.
Genome-wide identification of estrogen receptor alpha-binding sites in mouse liver
DEFF Research Database (Denmark)
Gao, Hui; Fält, Susann; Sandelin, Albin
2007-01-01
We report the genome-wide identification of estrogen receptor alpha (ERalpha)-binding regions in mouse liver using a combination of chromatin immunoprecipitation and tiled microarrays that cover all nonrepetitive sequences in the mouse genome. This analysis identified 5568 ERalpha-binding regions...... genes. The majority of ERalpha-binding regions lie in regions that are evolutionarily conserved between human and mouse. Motif-finding algorithms identified the estrogen response element, and variants thereof, together with binding sites for activator protein 1, basic-helix-loop-helix proteins, ETS...... signaling in mouse liver, by characterizing the first step in this signaling cascade, the binding of ERalpha to DNA in intact chromatin....
Energy Technology Data Exchange (ETDEWEB)
Shyy, Y.J.; Tian, G.; Tsai, M.D.
1987-10-06
Although the subtrate binding properties of adenylate kinase (AK) have been studied extensively by various biochemical and biophysical techniques, it remains controversial whether uncomplexed adenosine 5'-triphosphate (ATP) binds to the adenosine 5'-monophosphate (AMP) site of AK. The authors present two sets of experiments which argue against binding of ATP to the AMP site. (a) /sup 31/P nuclear magnetic resonance titration of ATP with AK indicated a 1:1 stoichiometry on the basis of changes in coupling constants and line widths. This ruled out binding of ATP to both sites. (b) ATP and MgATP were found to behave similarly by protecting AK from spontaneous inactivation while AMP showed only a small degree of protection. Such inactivation could also be protected or reversed by dithioerythritol and is most likely due to oxidation of sulfhydryl groups, one of which (cysteine-25) is located near the MgATP site. The results support binding of ATP to the MgATP site predominantly, instead of the AMP site, in the absence of Mg/sup 2 +/.
International Nuclear Information System (INIS)
Mong, S.; Wu, H.L.; Clark, M.A.; Stadel, J.M.; Gleason, J.G.; Crooke, S.T.
1984-01-01
A radioligand binding assay has been established to study leukotriene specific binding sites in the guinea pig and rabbit tissues. Using high specific activity [ 3 H]-leukotriene D4 [( 3 H]-LTD4), in the presence or absence of unlabeled LTD4, the diastereoisomer of LTD4 (5R,6S-LTD4), leukotriene E4 (LTE4) and the end-organ antagonist, FPL 55712, the authors have identified specific binding sites for [ 3 H]-LTD4 in the crude membrane fraction isolated from guinea pig lung. The time required for [ 3 H]-LTD4 binding to reach equilibrium was approximately 20 to 25 min at 37 degrees C in the presence of 10 mM Tris-HCl buffer (pH 7.5) containing 150 mM NaCl. The binding of [ 3 H]-LTD4 to the specific sites was saturable, reversible and stereospecific. The maximal number of binding sites (Bmax), derived from Scatchard analysis, was approximately 320 +/- 200 fmol per mg of crude membrane protein. The dissociation constants, derived from kinetic and saturation analyses, were 9.7 nM and 5 +/- 4 nM, respectively. The specific binding sites could not be detected in the crude membrane fraction prepared from guinea pig ileum, brain and liver, or rabbit lung, trachea, ileum and uterus. In radioligand competition experiments, LTD4, FPL 55712 and 5R,6S-LTD4 competed with [ 3 H]-LTD4. The metabolic inhibitors of arachidonic acid and SKF 88046, an antagonist of the indirectly-mediated actions of LTD4, did not significantly compete with [ 3 H]-LTD4 at the specific binding sites. These correlations indicated that these specific binding sites may be the putative leukotriene receptors in the guinea-pig lung
Neuropeptide Y binding sites in rat brain identified with purified neuropeptide Y-I125
International Nuclear Information System (INIS)
Walker, M.W.; Miller, R.J.
1986-01-01
Neuropeptide Y (NPY) is a widely distributed neuronally localized peptide with 36 amino acids, 5 of which are tyrosines. The authors wished to investigate the properties of specific receptors for NPY. They therefore labeled the tyrosines with I125 using chloramine T and then purified the peptide using HPLC. A single mono-iodinated species of NPY which yielded > 85% specific binding in rat forebrain synaptosomes was selected as the ligand for all subsequent experiments. A time course of binding showed that equilibrium conditions were reached in 60 minutes at 21 0 C. Scatchard plots revealed a single class of binding sites with a Kd and a Bmax of 3 x 10-10 M and 28 pmol/mg, respectively. Competition binding with unlabeled NPY showed 50% displacement of bound ligand at 1 x 10-10 M NPY. Competition binding with rat pancreatic polypeptide (RPP), a homologous peptide possessing little NPY-like activity, showed 50% displacement of bound ligand at 2 x 10 -7 M RPP. No binding was observed on F-11 or PC12 neuronal cell lines, or on HSWP fibroblast cells. They conclude that NPY-I125 purified to homogeneity with HPLC is a highly selective ligand for NPY receptor sites. They are currently investigating such sites in brain, gut, and other tissues
Where's water? The many binding sites of hydantoin.
Gruet, Sébastien; Pérez, Cristóbal; Steber, Amanda L; Schnell, Melanie
2018-02-21
Prebiotic hydantoin and its complexes with one and two water molecules are investigated using high-resolution broadband rotational spectroscopy in the 2-8 GHz frequency range. The hyperfine structure due to the nuclear quadrupole coupling of the two 14 N atoms is analysed for the monomer and the complexes. This characteristic hyperfine structure will support a definitive assignment from low frequency radioastronomy data. Experiments with H 2 18 O provide accurate experimental information on the preferred binding sites of water, which are compared with quantum-chemically calculated coordinates. In the 2-water complexes, the water molecules bind to hydantoin as a dimer instead of individually, indicating the strong water-water interactions. This information provides first insight on how hydantoin interacts with water on the molecular level.
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
International Nuclear Information System (INIS)
Gibson, T.R.; Wildey, G.M.; Manaker, S.; Glembotski, C.C.
1986-01-01
Atrial natriuretic peptides (ANP) have recently been identified in both heart and CNS. These peptides possess potent natriuretic, diuretic, and vasorelaxant activities, and are all apparently derived from a single prohormone. Specific ANP binding sites have been characterized in the adrenal zona glomerulosa and kidney cortex, and one study reported ANP binding sites in the CNS. However, a detailed examination of the localization of ANP binding sites throughout the brain has not been reported. In this study, quantitative autoradiography was employed to examine the distribution of ANP receptors in the rat CNS. The binding of (3- 125 I-iodotyrosyl28) rat ANP-28 to binding sites in the rat CNS was saturable, specific for ANP-related peptides, and displayed high affinity (Kd = 600 pM). When the relative concentrations of ANP binding sites were determined throughout the rat brain, the highest levels of ANP binding were localized to the circumventricular organs, including the area postrema and subfornical organ, and the olfactory apparatus. Moderate levels of ANP binding sites were present throughout the midbrain and brain stem, while low levels were found in the forebrain, diencephalon, basal ganglia, cortex, and cerebellum. The presence of ANP binding sites in the subfornical organ and the area postrema, regions considered to be outside the blood-brain barrier, suggests that peripheral ANP levels may regulate some aspects of CNS control of salt and water balance. The possible functions of ANP binding sites in other regions of the rat brain are not known, but, like many other peptides, ANP may act as a neurotransmitter or neuromodulator at these loci
Engineering of specific uranyl-coordination sites in the calcium-binding motif of Calmodulin
International Nuclear Information System (INIS)
Beccia, M.; Pardoux, R.; Sauge-Merle, S.; Bremond, N.; Lemaire, D.; Berthomieu, C.; Delangle, P.; Guilbaud, P.
2014-01-01
Complete text of publication follows: Characterization of heavy metals interactions with proteins is fundamental for understanding the molecular factors and mechanisms governing ions toxicity and speciation in cells. This line of research will also help in developing new molecules able to selectively and efficiently bind toxic metal ions, which could find application for bio-detection or bioremediation purposes. We have used the regulatory calcium-binding protein Calmodulin (CaM) from A. thaliana as a structural model and, starting from it, we have designed various mutants by site-directed mutagenesis. We have analysed thermodynamics of uranyl ion binding to both sites I and II of CaM N-terminal domain and we have identified structural factors governing this interaction. Selectivity for uranyl ion has been tested by studying reactions of the investigated peptides with Ca 2+ , in the same conditions used for UO 2 2+ . Spectro-fluorimetric titrations and FTIR analysis have shown that the affinity for uranyl increases by phosphorylation of a threonine in site I, especially approaching the physiological pH, where the phospho-threonine side chain is deprotonated. Based on structural models obtained by Molecular Dynamics, we tested the effect of a two residues deletion on site I properties. We obtained an almost two orders of magnitude increase in affinity for uranyl, with a sub-nanomolar dissociation constant for the uranyl complex with the non phosphorylated peptide, and an improved uranyl/calcium selectivity. Allosteric effects depending on Ca 2+ and UO 2 2+ binding have been investigated by comparing thermodynamic parameters obtained for mutants having both sites I and II able to chelate metal ions with those of mutants consisting of just one active site
Studies on the digitalis binding site in Na, K-ATPase
International Nuclear Information System (INIS)
Ahmed, K.; McParland, R.; Becker, R.; From, A.; Schimerlik, M.; Fullerton, D.S.
1986-01-01
Na, K-ATPase is believed to be the receptor for digitalis glycosides. The authors have previously documented that C17 side group of the cardenolide molecule is crucial to α subunit receptor binding. They have attempted to identify the structure of this binding site by labelling the enzyme with a 3 H-labelled photoactive probe localized in the C17 side group of the genin molecule. 3 H-α-subunit was purified and subjected to tryptic digestion. The digest was fractionated by gel filtration on Sephadex G-100. Fractions containing 3 H-labelled peptide were pooled and rechromatographed. The central peak fractions of 3 H-peptide were pooled, analyzed by SDS-PAGE, and subjected to amino acid sequence analysis. The tryptic peptide containing the 3 H-probe showed considerable sequence heterogeneity. Comparison of the sequence data with the published cDNA-based α-subunit sequence revealed that this peptide material was indeed a mixture of two tryptic peptides of nearly identical size containing the sequences from residue 68 through residue 146, and residues 263 through 342. The latter peptide contains the sequence ... glu tyr thr try leu glu ... speculated by Shull et al. as a possible ouabain binding site
Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.
2011-01-01
In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.
2012-01-01
The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950
Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.
Directory of Open Access Journals (Sweden)
Nandhitha Subramanian
Full Text Available The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.
Mcm1p binding sites in ARG1 positively regulate Gcn4p binding and SWI/SNF recruitment
Yoon, Sungpil; Hinnebusch, Alan G.
2009-01-01
Transcription of the arginine biosynthetic gene ARG1 is activated by Gcn4p, a transcription factor induced by starvation for any amino acid. Previously we showed that Gcn4p binding stimulates the recruitment of Mcm1p and co-activator SWI/SNF to ARG1 in cells via Gcn4p induction through amino acid starvation. Here we report that Gcn4p binding is reduced by point mutations of the Mcm1p binding site and increased by overexpression of Mcm1p. This result suggests that Mcm1p plays a positive role i...
Locations of the three primary binding sites for long-chain fatty acids on bovine serum albumin
International Nuclear Information System (INIS)
Hamilton, J.A.; Era, S.; Bhamidipati, S.P.; Reed, R.G.
1991-01-01
Binding of 13 C-enriched oleic acid to bovine serum albumin and to three large proteolytic fragments of albumin - two complementary fragments corresponding to the two halved of albumin and one fragment corresponding to the carboxyl-terminal domain - yielded unique patterns of NMR resonances (chemical shifts and relative intensities) that were used to identify the locations of binding of the first 5 mol of oleic acid to the multidomain albumin molecule. The first 3 mol of oleic acid added to intact albumin generated three distinct NMR resonances as a result of simultaneous binding of oleic acid to three heterogeneous sites (primary sites). This distribution suggests albumin to be a less symmetrical binding molecule than theoretical models predict. This work also demonstrates the power of NMR for the study of microenvironments of individual fatty acid binding sites in specific domain
Energy Technology Data Exchange (ETDEWEB)
Wood, M.S.; Traynor, J.R.
1989-07-01
The binding of the unselective opioid antagonist (/sup 3/H)diprenorphine to homogenates prepared from rat brain and from guinea-pig brain and cerebellum has been studied in HEPES buffer containing 10 mM Mg2+ ions. Sequential displacement of bound (/sup 3/H)diprenorphine by ligands with selectivity for mu-, delta-, and kappa-opioid receptors uncovers the multiple components of binding. In the presence of cold ligands that occupy all mu-, delta-, and kappa-sites, opioid binding still remains. This binding represents 20% of total specific sites and is displaced by naloxone. The nature of these undefined opioid binding sites is discussed.
Directory of Open Access Journals (Sweden)
Soazig Le Lay
Full Text Available Caveolin-1 (Cav1, a structural protein required for the formation of invaginated membrane domains known as caveolae, has been implicated in cholesterol trafficking and homeostasis. Here we investigated the contribution of Cav1 to apolipoprotein A-I (apoA-I cell surface binding and intracellular processing using mouse embryonic fibroblasts (MEFs derived from wild type (WT or Cav1-deficient (Cav1(-/- animals. We found that cells expressing Cav1 have 2.6-fold more apoA-I binding sites than Cav1(-/- cells although these additional binding sites are not associated with detergent-free lipid rafts. Further, Cav1-mediated binding targets apoA-I for internalization and degradation and these processes are not correlated to cholesterol efflux. Despite lower apoA-I binding, cholesterol efflux from Cav1(-/- MEFs is 1.7-fold higher than from WT MEFs. Stimulation of ABCA1 expression with an LXR agonist enhances cholesterol efflux from both WT and Cav1(-/- cells without increasing apoA-I surface binding or affecting apoA-I processing. Our results indicate that there are at least two independent lipid binding sites for apoA-I; Cav1-mediated apoA-I surface binding and uptake is not linked to cholesterol efflux, indicating that membrane domains other than caveolae regulate ABCA1-mediated cholesterol efflux.
Comparison of Transcription Factor Binding Site Models
Bhuyan, Sharifulislam
2012-05-01
Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.
In vivo labelling in several rat tissues of 'peripheral type' benzodiazepine binding sites
Energy Technology Data Exchange (ETDEWEB)
Benavides, J.; Guilloux, F.; Rufat, P.; Uzan, A.; Renault, C.; Dubroeucq, M.C.; Gueremy, C.; Le Fur, G. (Pharmuka Laboratoires, 92 - Gennevilliers (France))
1984-03-16
'Peripheral type' benzodiazepine binding sites in several rat tissues were labelled by intravenous injection of (/sup 3/H)PK 11195 and (/sup 3/H)RO5-4864. Binding was saturable in all tissues studied and regional distribution paralleled the in vitro binding. A similar potency order of displacing compounds was found in vivo and in vitro PK 11195 > PK 11211 > RO5-4864 > diazepam > dipyridamole > clonazepam. These results demonstrate the feasibility of using this technique to examine the effects of pharmacological manipulation on the binding sites in their native state. However, some properties (broader maximum during time course, higher percentage of particulate binding in the brain and independence of temperature) make (/sup 3/H)PK 11195 the most suitable ligand for this kind of studies.
Liu, Sheng; Zibetti, Cristina; Wan, Jun; Wang, Guohua; Blackshaw, Seth; Qian, Jiang
2017-07-27
Computational prediction of transcription factor (TF) binding sites in different cell types is challenging. Recent technology development allows us to determine the genome-wide chromatin accessibility in various cellular and developmental contexts. The chromatin accessibility profiles provide useful information in prediction of TF binding events in various physiological conditions. Furthermore, ChIP-Seq analysis was used to determine genome-wide binding sites for a range of different TFs in multiple cell types. Integration of these two types of genomic information can improve the prediction of TF binding events. We assessed to what extent a model built upon on other TFs and/or other cell types could be used to predict the binding sites of TFs of interest. A random forest model was built using a set of cell type-independent features such as specific sequences recognized by the TFs and evolutionary conservation, as well as cell type-specific features derived from chromatin accessibility data. Our analysis suggested that the models learned from other TFs and/or cell lines performed almost as well as the model learned from the target TF in the cell type of interest. Interestingly, models based on multiple TFs performed better than single-TF models. Finally, we proposed a universal model, BPAC, which was generated using ChIP-Seq data from multiple TFs in various cell types. Integrating chromatin accessibility information with sequence information improves prediction of TF binding.The prediction of TF binding is transferable across TFs and/or cell lines suggesting there are a set of universal "rules". A computational tool was developed to predict TF binding sites based on the universal "rules".
Directory of Open Access Journals (Sweden)
Shubhadip Das
Full Text Available The protein γ-tubulin plays an important role in centrosomal clustering and this makes it an attractive therapeutic target for treating cancers. Griseofulvin, an antifungal drug, has recently been used to inhibit proliferation of various types of cancer cells. It can also affect the microtubule dynamics by targeting the γ-tubulin protein. So far, the binding pockets of γ-tubulin protein are not properly identified and the exact mechanism by which the drug binds to it is an area of intense speculation and research. The aim of the present study is to investigate the binding mechanism and binding affinity of griseofulvin on γ-tubulin protein using classical molecular dynamics simulations. Since the drug griseofulvin is sparingly soluble in water, here we also present a promising approach for formulating and achieving delivery of hydrophobic griseofulvin drug via hydrotrope sodium cumene sulfonate (SCS cluster. We observe that the binding pockets of γ-tubulin protein are mainly formed by the H8, H9 helices and S7, S8, S14 strands and the hydrophobic interactions between the drug and γ-tubulin protein drive the binding process. The release of the drug griseofulvin from the SCS cluster is confirmed by the coordination number analysis. We also find hydrotrope-induced alteration of the binding sites of γ-tubulin protein and the weakening of the drug-protein interactions.
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
DEFF Research Database (Denmark)
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed...
Li, Shunyi; Yang, Wei; Maniccia, Anna W; Barrow, Doyle; Tjong, Harianto; Zhou, Huan-Xiang; Yang, Jenny J
2008-10-01
Ca2+, as a messenger of signal transduction, regulates numerous target molecules via Ca2+-induced conformational changes. Investigation into the determinants for Ca2+-induced conformational change is often impeded by cooperativity between multiple metal-binding sites or protein oligomerization in naturally occurring proteins. To dissect the relative contributions of key determinants for Ca2+-dependent conformational changes, we report the design of a single-site Ca2+-binding protein (CD2.trigger) created by altering charged residues at an electrostatically sensitive location on the surface of the host protein rat Cluster of Differentiation 2 (CD2).CD2.trigger binds to Tb3+ and Ca2+ with dissociation constants of 0.3 +/- 0.1 and 90 +/- 25 microM, respectively. This protein is largely unfolded in the absence of metal ions at physiological pH, but Tb3+ or Ca2+ binding results in folding of the native-like conformation. Neutralization of the charged coordination residues, either by mutation or protonation, similarly induces folding of the protein. The control of a major conformational change by a single Ca2+ ion, achieved on a protein designed without reliance on sequence similarity to known Ca2+-dependent proteins and coupled metal-binding sites, represents an important step in the design of trigger proteins.
Directory of Open Access Journals (Sweden)
Jean-Marc Taymans
Full Text Available Leucine rich repeat kinase 2 (LRRK2 is a Parkinson's disease (PD gene that encodes a large multidomain protein including both a GTPase and a kinase domain. GTPases often regulate kinases within signal transduction cascades, where GTPases act as molecular switches cycling between a GTP bound "on" state and a GDP bound "off" state. It has been proposed that LRRK2 kinase activity may be increased upon GTP binding at the LRRK2 Ras of complex proteins (ROC GTPase domain. Here we extensively test this hypothesis by measuring LRRK2 phosphorylation activity under influence of GDP, GTP or non-hydrolyzable GTP analogues GTPγS or GMPPCP. We show that autophosphorylation and lrrktide phosphorylation activity of recombinant LRRK2 protein is unaltered by guanine nucleotides, when co-incubated with LRRK2 during phosphorylation reactions. Also phosphorylation activity of LRRK2 is unchanged when the LRRK2 guanine nucleotide binding pocket is previously saturated with various nucleotides, in contrast to the greatly reduced activity measured for the guanine nucleotide binding site mutant T1348N. Interestingly, when nucleotides were incubated with cell lysates prior to purification of LRRK2, kinase activity was slightly enhanced by GTPγS or GMPPCP compared to GDP, pointing to an upstream guanine nucleotide binding protein that may activate LRRK2 in a GTP-dependent manner. Using metabolic labeling, we also found that cellular phosphorylation of LRRK2 was not significantly modulated by nucleotides, although labeling is significantly reduced by guanine nucleotide binding site mutants. We conclude that while kinase activity of LRRK2 requires an intact ROC-GTPase domain, it is independent of GDP or GTP binding to ROC.
Discovery and mapping of an intracellular antagonist binding site at the chemokine receptor CCR2
DEFF Research Database (Denmark)
Zweemer, Annelien J M; Bunnik, Julia; Veenhuizen, Margo
2014-01-01
be divided into two groups with most likely two topographically distinct binding sites. The aim of the current study was to identify the binding site of one such group of ligands, exemplified by three allosteric antagonists, CCR2-RA-[R], JNJ-27141491, and SD-24. We first used a chimeric CCR2/CCR5 receptor...
The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.
Wang, Jinling; de Montellano, Paul R Ortiz
2003-05-30
Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.
Visualization of specific binding sites of benzodiazepine in human brain
International Nuclear Information System (INIS)
Shinotoh, H.; Yamasaki, T.; Inoue, O.; Itoh, T.; Suzuki, K.; Hashimoto, K.; Tateno, Y.; Ikehira, H.
1986-01-01
Using 11C-labeled Ro15-1788 and positron emission tomography, studies of benzodiazepine binding sites in the human brain were performed on four normal volunteers. Rapid and high accumulation of 11C activity was observed in the brain after i.v. injection of [11C]Ro15-1788, the maximum of which was within 12 min. Initial distribution of 11C activity in the brain was similar to the distribution of the normal cerebral blood flow. Ten minutes after injection, however, a high uptake of 11C activity was observed in the cerebral cortex and moderate uptake was seen in the cerebellar cortex, the basal ganglia, and the thalamus. The accumulation of 11C activity was low in the brain stem. This distribution of 11C activity was approximately parallel to the known distribution of benzodiazepine receptors. Saturation experiments were performed on four volunteers with oral administration of 0.3-1.8 mg/kg of cold Ro15-1788 prior to injection. Initial distribution of 11C activity following injection peaked within 2 min and then the accumulation of 11C activity decreased rapidly and remarkably throughout the brain. The results indicated that [11C] Ro15-1788 associates and dissociates to specific and nonspecific binding sites rapidly and has a high ratio of specific receptor binding to nonspecific binding in vivo. Carbon-11 Ro15-1788 is a suitable radioligand for the study of benzodiazepine receptors in vivo in humans
International Nuclear Information System (INIS)
Nemeroff, C.B.; Knight, D.L.; Krishnan, R.R.; Slotkin, T.A.; Bissette, G.; Melville, M.L.; Blazer, D.G.
1988-01-01
The number (Bmax) and affinity (Kd) of platelet-tritiated imipramine binding sites was determined in young and middle-aged controls 50 years of age and younger (n = 25), elderly normal controls over 60 years of age (n = 18), patients who fulfilled DSM-III criteria for major depression who were under 50 years of age (n = 29), patients who fulfilled DSM-III criteria for major depression who were 60 years of age and older (n = 19), and patients who fulfilled both DSM-III criteria for primary degenerative dementia and National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association criteria for probable Alzheimer's disease (n = 13). Both groups of depressed patients (under 50 and over 60 years of age) exhibited significant reductions (decreases 42%) in the number of platelet-tritiated imipramine binding sites with no change in affinity, when compared with their age-matched controls. There was little overlap in Bmax values between the elderly depressed patients and their controls. The patients with probable Alzheimer's disease showed no alteration in platelet-tritiated imipramine binding. There was no statistically significant relationship between postdexamethasone plasma cortisol concentrations and tritiated imipramine binding. These results indicate that platelet-tritiated imipramine binding may have potential utility as a diagnostic adjunct in geriatric depression, and moreover that the reduction in the number of platelet-tritiated imipramine binding sites is not due to hypercortisolemia
Kulakovskiy, Ivan V.
2011-08-18
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.
International Nuclear Information System (INIS)
Kilbourn, Michael R.
1997-01-01
The recovery of in vivo binding sites for (±)-α-[ 11 C]methoxytetrabenazine, a radioligand for the monoamine vesicular transporter (VMAT2), was determined in mouse brain at various times following a pharmacological dose of tetrabenazine. Concentrations of in vivo radioligand binding sites progressively increased and had reached control values by 8.5 h, and this recovery was consistent with the pharmacokinetics of the competing drug tetrabenazine and its active metabolite, dihydrotetrabenazine. This study demonstrates a simple experimental protocol of using a single dose of a reversible competing drug and time-dependent measurements of in vivo binding of a radioligand. This protocol is suitable for testing the sensitivity of an in vivo radiotracer for measurement of varying concentrations of in vivo binding sites
Dangerous connections : on binding site models of infectious disease dynamics
Leung, Ka Yin; Diekmann, Odo
2017-01-01
We formulate models for the spread of infection on networks that are amenable to analysis in the large population limit. We distinguish three different levels: (1) binding sites, (2) individuals, and (3) the population. In the tradition of physiologically structured population models, the
Ratheal, Ian M; Virgin, Gail K; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-10-26
The Na/K pump is a P-type ATPase that exchanges three intracellular Na(+) ions for two extracellular K(+) ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na(+) or K(+); site III binds only Na(+)) are poorly understood. We studied cation selectivity by outward-facing sites (high K(+) affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium(+), methylguanidinium(+), and aminoguanidinium(+) produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K(+), and (ii) induction of pump-mediated, guanidinium-derivative-carried inward current at negative potentials without Na(+) and K(+). In contrast, formamidinium(+) and acetamidinium(+) induced K(+)-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K(+) congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li(+) induced Na(+)-like VDI, whereas all metals tested except Na(+) induced K(+)-like outward currents. Pump-mediated K(+)-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium(+) derivatives suggest that Na(+) binds to site III in a hydrated form and that the inward current observed without external Na(+) and K(+) represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites.
Composite Structural Motifs of Binding Sites for Delineating Biological Functions of Proteins
Kinjo, Akira R.; Nakamura, Haruki
2012-01-01
Most biological processes are described as a series of interactions between proteins and other molecules, and interactions are in turn described in terms of atomic structures. To annotate protein functions as sets of interaction states at atomic resolution, and thereby to better understand the relation between protein interactions and biological functions, we conducted exhaustive all-against-all atomic structure comparisons of all known binding sites for ligands including small molecules, proteins and nucleic acids, and identified recurring elementary motifs. By integrating the elementary motifs associated with each subunit, we defined composite motifs that represent context-dependent combinations of elementary motifs. It is demonstrated that function similarity can be better inferred from composite motif similarity compared to the similarity of protein sequences or of individual binding sites. By integrating the composite motifs associated with each protein function, we define meta-composite motifs each of which is regarded as a time-independent diagrammatic representation of a biological process. It is shown that meta-composite motifs provide richer annotations of biological processes than sequence clusters. The present results serve as a basis for bridging atomic structures to higher-order biological phenomena by classification and integration of binding site structures. PMID:22347478
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Alcohol-Binding Sites in Distinct Brain Proteins: The Quest for Atomic Level Resolution
Howard, Rebecca J.; Slesinger, Paul A.; Davies, Daryl L.; Das, Joydip; Trudell, James R.; Harris, R. Adron
2011-01-01
Defining the sites of action of ethanol on brain proteins is a major prerequisite to understanding the molecular pharmacology of this drug. The main barrier to reaching an atomic-level understanding of alcohol action is the low potency of alcohols, ethanol in particular, which is a reflection of transient, low-affinity interactions with their targets. These mechanisms are difficult or impossible to study with traditional techniques such as radioligand binding or spectroscopy. However, there has been considerable recent progress in combining X-ray crystallography, structural modeling, and site-directed mutagenesis to define the sites and mechanisms of action of ethanol and related alcohols on key brain proteins. We review such insights for several diverse classes of proteins including inwardly rectifying potassium, transient receptor potential, and neurotransmit-ter-gated ion channels, as well as protein kinase C epsilon. Some common themes are beginning to emerge from these proteins, including hydrogen bonding of the hydroxyl group and van der Waals interactions of the methylene groups of ethanol with specific amino acid residues. The resulting binding energy is proposed to facilitate or stabilize low-energy state transitions in the bound proteins, allowing ethanol to act as a “molecular lubricant” for protein function. We discuss evidence for characteristic, discrete alcohol-binding sites on protein targets, as well as evidence that binding to some proteins is better characterized by an interaction region that can accommodate multiple molecules of ethanol. PMID:21676006
Fabrication of supramolecular frameworks by tuning the binding site ...
Indian Academy of Sciences (India)
Administrator
Fabrication of supramolecular frameworks by tuning the binding site of a tripodal ligand with d. 10 metal ions 803. Table 1. Crystal data and structure refinement parameters for 1 and 2. 1 .... e-mail: deposit@ccdc.cam.ac.uk web: http://www. ccdc. cam.ac.uk/deposit]. Supplementary figures and tables can be found in website ...
Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J
1993-11-01
Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth factors stimulate the phosphorylation of Nck and its association with autophosphorylated growth factor receptors. A panel of platelet-derived growth factor (PDGF) receptor mutations at tyrosine residues has been used to identify the Nck binding site. Here we show that mutation at Tyr-751 of the PDGF beta-receptor eliminates Nck binding both in vitro and in living cells. Moreover, the Y751F PDGF receptor mutant failed to mediate PDGF-stimulated phosphorylation of Nck in intact cells. A phosphorylated Tyr-751 is also required for binding of phosphatidylinositol-3 kinase to the PDGF receptor. Hence, the SH2 domains of p85 and Nck share a binding site in the PDGF receptor. Competition experiments with different phosphopeptides derived from the PDGF receptor suggest that binding of Nck and p85 is influenced by different residues around Tyr-751. Thus, a single tyrosine autophosphorylation site is able to link the PDGF receptor to two distinct SH2 domain-containing signaling molecules.
Identification of steroid-binding and phosphorylated sites within the glucocorticoid receptor
International Nuclear Information System (INIS)
Smith, L.I.
1989-01-01
The primary goal of these studies was to localize the steroid-binding and phosphorylated sites of the glucocorticoid receptor. The synthetic steroid, dexamethasone 21-mesylate (DM) forms a covalent thioether bond via the sulfhydryl group of a cysteine residue in the receptor. To determine the covalent site of attachment of this ligand, receptors in WEHI-7 mouse thymoma cells were labeled with [ 3 H]DM and purified with a monoclonal antibody. The receptor was completely digested with trypsin and a single peptide covalently labeled with steroid identified by reversed-phase HPLC. This peptide was analyzed by automated Edman degradation to determine the location of the steroid-labeled residue. A similar analysis was performed on an overlapping peptide produced by Staphylococcus aureus protease digestion. Analysis of tryptic peptides from receptors labeled with both [ 3 H]DM and L-[ 35 S]methionine indicated that this peptide contained methionine. These analyses, coupled with the published amino acid sequence of the receptor, identified Cysteine-644 in the steroid-binding domain of the mouse glucocorticoid receptor as the residue involved in covalent steroid-binding. A synthetic peptide representing amino acids 640-650 of the mouse receptor was prepared and analyzed to confirm the identification. These biochemical studies represent a direct demonstration of an amino acid important in receptor function. It has been proposed that the receptor functions through a phosphorylation-dephosphorylation cycle to explain the dependence of hormone binding capacity upon cellular ATP. The glucocorticoid receptor has been shown to be a phosphoprotein. As an initial step to identifying a role of phosphorylation in receptor action, phosphorylated sites within the functional domains of the protein were identified
Autologous peptides constitutively occupy the antigen binding site on Ia
DEFF Research Database (Denmark)
Buus, S; Sette, A; Colon, S M
1988-01-01
Low molecular weight material associated with affinity-purified class II major histocompatibility complex (MHC) molecules of mouse (Ia) had the expected properties of peptides bound to the antigen binding site of Ia. Thus, the low molecular weight material derived from the I-Ad isotype...
Ontogeny of basic fibroblast growth factor binding sites in mouse ocular tissues
International Nuclear Information System (INIS)
Fayein, N.A.; Courtois, Y.; Jeanny, J.C.
1990-01-01
Basic fibroblast growth factor (bFGF) binding to ocular tissues has been studied by autoradiographical and biochemical approaches directly performed on sections during mouse embryonic and postnatal development. Frozen sections of embryos (9 to 18 days), newborns, and adults (1 day to 6 months) were incubated with iodinated bFGF. One specific FGF binding site (KD = 2.5 nM) is colocalized with heparan sulfate proteoglycans of the basement membranes and is heparitinase sensitive. It first appears at Day 9 around the neural tube, the optic vesicles, and below the head ectoderm and by Day 14 of embryonic development is found in all basement membranes of the eye. At Day 16, very intensely labeled patches appear, corresponding to mast cells which have been characterized by metachromatic staining of their heparin-rich granulations with toluidine blue. In addition to the latter binding, we have also observed a general diffuse distribution of silver grains on all tissues and preferentially in the ecto- and neuroectodermic tissues. From Days 17-18, there is heterogeneous labeling inside the retina, localized in the pigmented epithelium and in three different layers colocalized with the inner and outer plexiform layers and with the inner segments of the photoreceptors. This binding is heparitinase resistant but N-glycanase sensitive and may represent a second specific binding site corresponding to cellular FGF receptors (KD = 280 pM). Both types of binding patterns observed suggest a significant role for bFGF in eye development and physiology
Three-dimensional binding sites volume assessment during cardiac pacing lead extraction
Directory of Open Access Journals (Sweden)
Bich Lien Nguyen
2015-07-01
Conclusions: Real-time 3D binding sites assessment is feasible and improves transvenous lead extraction outcomes. Its role as a complementary information requires extensive validation, and might be beneficial for a tailored strategy.
Tentative identification of the second substrate binding site in Arabidopsis phytochelatin synthase.
Directory of Open Access Journals (Sweden)
Ju-Chen Chia
Full Text Available Phytochelatin synthase (PCS uses the substrates glutathione (GSH, γGlu-Cys-Gly and a cadmium (Cd-bound GSH (Cd∙GS2 to produce the shortest phytochelatin product (PC2, (γGlu-Cys2-Gly through a ping-pong mechanism. The binding of the 2 substrates to the active site, particularly the second substrate binding site, is not well-understood. In this study, we generated a structural model of the catalytic domain of Arabidopsis AtPCS1 (residues 12-218 by using the crystal structure of the γGlu-Cys acyl-enzyme complex of the PCS of the cyanobacterium Nostoc (NsPCS as a template. The modeled AtPCS1 revealed a cavity in proximity to the first substrate binding site, consisting of 3 loops containing several conserved amino acids including Arg152, Lys185, and Tyr55. Substitutions of these amino acids (R152K, K185R, or double mutation resulted in the abrogation of enzyme activity, indicating that the arrangement of these 2 positive charges is crucial for the binding of the second substrate. Recombinant AtPCS1s with mutations at Tyr55 showed lower catalytic activities because of reduced affinity (3-fold for Y55W for the Cd∙GS2, further suggesting the role of the cation-π interaction in recognition of the second substrate. Our study results indicate the mechanism for second substrate recognition in PCS. The integrated catalytic mechanism of PCS is further discussed.
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Handing, Katarzyna B.; Shabalin, Ivan G.; Szlachta, Karol; Majorek, Karolina A.; Minor, Wladek
2016-01-01
Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1 ?. Cetirizine is bound in two sites ? a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizi...
Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S
2017-06-02
Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Rannversson, Hafsteinn; Andersen, Jacob; Bang-Andersen, Benny
2017-01-01
amber codon suppression in hSERT to encode the photo-cross-linking unnatural amino acid p-azido-l-phenylalanine into the suggested high- and low-affinity binding sites. We then employ UV-induced cross-linking with azF to map the binding site of escitalopram and paroxetine, two prototypical selective...... serotonin reuptake inhibitors (SSRIs). We find that the two antidepressant drugs exclusively cross-link to azF incorporated at the high-affinity binding site of hSERT, while cross-linking is not observed at the low-affinity binding site. Combined with previous homology models and recent structural data on h...
International Nuclear Information System (INIS)
Pike, V.W.; Osman, S.; Shah, F.; Turton, D.R.; Waters, S.L.; Crouzel, C.; Nutt, D.J.
1993-01-01
The status of the radiochemical development and biological evaluation of radioligands for PET studies of central benzodiazepine (BZ) receptors and the so-called peripheral benzodiazepine binding sites, here discriminated and referred to as PK binding sites, is reviewed against current pharmacological knowledge, indicating those agents with present value and those with future potential. Practical recommendations are given for the preparation of two useful radioligands for PET studies, [N-methyl- 11 C]flumazenil for central BZ receptors, and [N-methyl- 11 C]PK 11195 for PK binding sites. Quality assurance and plasma metabolite analysis are also reviewed for these radioligands and practical recommendations are given on methodology for their performance. (Author)
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Juracek, Kyle E.
2011-01-01
Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean
International Nuclear Information System (INIS)
Nelson, D.A.; Mencke, A.J.; Chambers, S.A.; Oosterhof, D.K.; Rill, R.L.
1982-01-01
Micrococcal nuclease cleaves within nucleosomes at sites spaced about 10.4 base pairs (bp) apart. Cleavages at sites equivalent to 30-35 bp from the ends of 146-bp cores cause spontaneous loss of an H2a-H2b pair associated with 30-40 bp length DNA. Cleavages at certain other sites do not affect the nucleosome integrity unless a solvent perturbant such as urea is added. Chromatin moderately digested with micrococcal nuclease, when fractionated by sedimentation or electrophoresis in the presence of 3 M urea, yielded four previously unobserved subnucleosomes with the following histone/DNA compositions: (H3) 2 (H4) 2 (H2a)(H2b)/95-115 bp; (H3)(H4)/70-80 bp DNA; (H2a)(H2b)/50-60 bp DNA; and (H1)/60-70 bp DNA. All but the latter subnucleosome were also obtained upon DNase I digestion of purified nucleosome cores labeled on the 5' ends with 32 P. Only subnucleosomes that retained H2a and H2b also retained labeled ends. These results show that H2a and H2b are paired on the terminal 30-40 bp of core DNA, as suggested from analyses of histone-DNA cross-link products by Mirzabekov and coworkers. Considerations of the orgins and compositions of subnucleosomes and of cross-linking data suggest an expanded model for the locations of histone binding sites along nucleosome core DNA. The principal features of this model are (i) strong electrostatic binding sites of H2a and H2b occur at positions approximately 20-30 bp from the core ends, (ii) strong electrostatic binding sites of H3 and H4 occur primarily on the central 40 bp of core DNA, (iii) strong nonelectrostatic, urea-sensitive binding sites of H3 and H4 occur at positions approximately 30-50 bp from the core ends, and (iv) urea-sensitive binding sites of H2a or H2b may occur on the terminal 10-20 bp of core DNA
Peptide microarrays to probe for competition for binding sites in a protein interaction network
Sinzinger, M.D.S.; Ruttekolk, I.R.R.; Gloerich, J.; Wessels, H.; Chung, Y.D.; Adjobo-Hermans, M.J.W.; Brock, R.E.
2013-01-01
Cellular protein interaction networks are a result of the binding preferences of a particular protein and the entirety of interactors that mutually compete for binding sites. Therefore, the reconstruction of interaction networks by the accumulation of interaction networks for individual proteins
International Nuclear Information System (INIS)
Yagaloff, K.A.; Hartig, P.R.
1985-01-01
125 I-Lysergic acid diethylamide ( 125 I-LSD) binds with high affinity to serotonergic sites on rat choroid plexus. These sites were localized to choroid plexus epithelial cells by use of a novel high resolution stripping film technique for light microscopic autoradiography. In membrane preparations from rat choroid plexus, the serotonergic site density was 3100 fmol/mg of protein, which is 10-fold higher than the density of any other serotonergic site in brain homogenates. The choroid plexus site exhibits a novel pharmacology that does not match the properties of 5-hydroxytryptamine-1a (5-HT1a), 5-HT1b, or 5-HT2 serotonergic sites. 125 I-LSD binding to the choroid plexus site is potently inhibited by mianserin, serotonin, and (+)-LSD. Other serotonergic, dopaminergic, and adrenergic agonists and antagonists exhibit moderate to weak affinities for this site. The rat choroid plexus 125 I-LSD binding site appears to represent a new type of serotonergic site which is located on non-neuronal cells in this tissue
International Nuclear Information System (INIS)
Fuchs, G.; Mobassaleh, M.; Donohue-Rolfe, A.; Montgomery, R.K.; Grand, R.J.; Keusch, G.T.
1986-01-01
This study examined the binding of purified 125 I-labeled shigella toxin to rabbit jejunal microvillus membranes (MVMs). Toxin binding was concentration dependent, saturable, reversible, and specifically inhibited by unlabeled toxin. The calculated number of toxin molecules bound at 4 0 C was 7.9 X 10(10) (3 X 10(10) to 2 X 10(11))/micrograms of MVM protein or 1.2 X 10(6) per enterocyte. Scatchard analysis showed the binding site to be of a single class with an equilibrium association constant, K, of 4.7 X 10(9) M-1 at 4 0 C. Binding was inversely related to the temperature of incubation. A total of 80% of the labeled toxin binding at 4 0 C dissociated from MVM when the temperature was raised to 37 0 C, but reassociated when the temperature was again brought to 4 0 C. There was no structural or functional change of MVM due to toxin as monitored by electron microscopy or assay of MVM sucrase activity. These studies demonstrate a specific binding site for shigella toxin on rabbit MVMs. The physiological relevance of this receptor remains to be determined
Energy Technology Data Exchange (ETDEWEB)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase in receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.
Multi-binding site model-based curve-fitting program for the computation of RIA data
International Nuclear Information System (INIS)
Malan, P.G.; Ekins, R.P.; Cox, M.G.; Long, E.M.R.
1977-01-01
In this paper, a comparison will be made of model-based and empirical curve-fitting procedures. The implementation of a multiple binding-site curve-fitting model which will successfully fit a wide range of assay data, and which can be run on a mini-computer is described. The latter sophisticated model also provides estimates of binding site concentrations and the values of the respective equilibrium constants present: the latter have been used for refining assay conditions using computer optimisation techniques. (orig./AJ) [de
Energy Technology Data Exchange (ETDEWEB)
Matthew, E.; Parfitt, A.G.; Sugden, D.; Engelhardt, D.L.; Zimmerman, E.A.; Klein, D.C.
1984-02-01
Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects of diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.
International Nuclear Information System (INIS)
Cosman, M; Zeller, L; Lightstone, F C; Krishnan, V V; Balhorn, R
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design of chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that
Directory of Open Access Journals (Sweden)
Londiwe Siphephise Mgcina
2015-05-01
Full Text Available Lipopolysaccharide (LPS from Gram-negative bacteria is recognized as a microbe-associated molecular pattern (MAMP and not only induces an innate immune response in plants, but also stimulates the development of characteristic defense responses. However, identification and characterization of a cell surface LPS-receptor/binding site, as described in mammals, remains elusive in plants. As an amphiphilic, macromolecular lipoglycan, intact LPS potentially contains three MAMP-active regions, represented by the O-polysaccharide chain, the core and the lipid A. Binding site studies with intact labelled LPS were conducted in Arabidopsis thaliana protoplasts and quantified using flow cytometry fluorescence changes. Qdots, which allow non-covalent, hydrophobic labelling were used as a novel strategy in this study and compared to covalent, hydrophilic labelling with Alexa 488. Affinity for LPS-binding sites was clearly demonstrated by concentration-, temperature- and time-dependent increases in protoplast fluorescence following treatment with the labelled LPS. Moreover, this induced fluorescence increase was convincingly reduced following pre-treatment with excess unlabeled LPS, thereby indicating reversibility of LPS binding. Inhibition of the binding process is also reported using endo- and exocytosis inhibitors. Here, we present evidence for the anticipated presence of LPS-specific binding sites in Arabidopsis protoplasts, and furthermore propose Qdots as a more sensitive LPS-labelling strategy in comparison to the conventional Alexa 488 hydrazide label for binding studies.
Exploration of N-arylpiperazine Binding Sites of D2 Dopaminergic Receptor.
Soskic, Vukic; Sukalovic, Vladimir; Kostic-Rajacic, Sladjana
2015-01-01
The crystal structures of the D3 dopamine receptor and several other G-protein coupled receptors (GPCRs) were published in recent times. Those 3D structures are used by us and other scientists as a template for the homology modeling and ligand docking analysis of related GPCRs. Our main scientific interest lies in the field of pharmacologically active N-arylpiperazines that exhibit antipsychotic and/or antidepressant properties, and as such are dopaminergic and serotonergic receptor ligands. In this short review article we are presenting synthesis and biological data on the new N-arylpipereazine as well our results on molecular modeling of the interactions of those N-arylpiperazines with the model of D2 dopamine receptors. To obtain that model the crystal structure of the D3 dopamine receptor was used. Our results show that the N-arylpiperazines binding site consists of two pockets: one is the orthosteric binding site where the N-arylpiperazine part of the ligand is docked and the second is a non-canonical accessory binding site for N-arylpipereazine that is formed by a second extracellular loop (ecl2) of the receptor. Until now, the structure of this receptor region was unresolved in crystal structure analyses of the D3 dopamine receptor. To get a more complete picture of the ligand - receptor interaction, DFT quantum mechanical calculations on N-arylpiperazine were performed and the obtained models were used to examine those interactions.
International Nuclear Information System (INIS)
Alderson, R.; Pastan, I.; Cheng, S.
1985-01-01
The binding of [ 125 I]T3 to sites on human placenta plasma membranes was characterized, and the binding site was solubilized after affinity labeling with N-bromoacetyl-[ 125 I]T3 (BrAc[ 125 I]T3). Two classes of T3-binding sites were detected. One class has a high affinity (K /sub d/ = 2.0nM) and a low capacity (approximately 320 fmol/mg protein); the other has a low affinity (K /sub k/ = 18.5 microM) and a high capacity (approximately 2.2 pmol/mg protein). The binding sites were found to be specific for T3 in that other thyroid hormone analogs (D-T3, rT3, D-T4, and L-T4) were less effective or ineffective in displacing the bound [ 125 I]T3. The affinity labeling ligand BrAc[ 125 I]T3 was found to specifically label a protein with an apparent mol wt of 65,000, as determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The BrAc[ 125 I]T3-labeled protein was solubilized with 2 mM 3-[( 3-cholamidopropyl)dimethylammonio]1-propane sulfonate. The apparent mol wt of the labeled protein was between 140,000 and 150,000 by Sephadex-G-200 gel filtration. These data demonstrate that a high affinity binding site specific for T3 is present on plasma membranes from human placenta and that the binding site is a protein, most likely a dimer, with a native mol wt between 140,000 and 150,000
Directory of Open Access Journals (Sweden)
Kristopher J. L. Irizarry
2016-01-01
Full Text Available Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1 that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons.
A Unified Model of the GABA(A) Receptor Comprising Agonist and Benzodiazepine Binding Sites
DEFF Research Database (Denmark)
Kongsbak, Kristine Grønning; Bergmann, Rikke; Sørensen, Pernille Louise
2013-01-01
We present a full-length a1b2c2 GABA receptor model optimized for agonists and benzodiazepine (BZD) allosteric modulators. We propose binding hypotheses for the agonists GABA, muscimol and THIP and for the allosteric modulator diazepam (DZP). The receptor model is primarily based on the glutamate......-gated chloride channel (GluCl) from C. elegans and includes additional structural information from the prokaryotic ligand-gated ion channel ELIC in a few regions. Available mutational data of the binding sites are well explained by the model and the proposed ligand binding poses. We suggest a GABA binding mode...... of the agonists in the orthosteric site. The carbonyl group of DZP is predicted to interact with two threonines a1T206 and c2T142, similar to the acidic moiety of GABA. The chlorine atom of DZP is placed near the important a1H101 and the N-methyl group near a1Y159, a1T206, and a1Y209. We present a binding mode...
Human platelet ( sup 125 I)R-DOI binding sites. Characterization by in vitro autoradiography
Energy Technology Data Exchange (ETDEWEB)
Himeno, A.; Saavedra, J.M. (National Institute of Mental Health, Bethesda, MD (USA))
1990-02-01
We quantified binding sites for 2,5-dimethoxy-4-iodo-phenylisopropylamine (DOI), a 5-HT2 agonist and hallucinogen, in human platelets. We incubated sections from human platelet pellets with ({sup 125}I)R-DOI with or without 1 mumol/L ketanserin, followed by autoradiography and computerized microdensitometry. We corrected the values of binding density by the protein content of each section with a densitometric protein assay. The present method revealed a single class of high affinity binding sites for ({sup 125}I)R-DOI, with a Kd of 6.4 +/- 0.7 nmol/L and a Bmax of 100 +/- 10 fmol/mg protein. Kd and Bmax for ({sup 125}I)R-DOI determined by the classical membrane binding assay, were 2.7 +/- 0.4 nmol/L and 100 +/- 10 fmol/mg protein, respectively. The present method is precise, very sensitive, and allows the characterization of ({sup 125}I)R-DOI binding in sections obtained from as little as 3 ml of blood. Standardization is possible after correction by the protein content of each individual section.
Maurer, Manuela; de Beer, Stephanie B A; Oostenbrink, Chris
2016-04-15
The periplasmic oligopeptide binding protein A (OppA) represents a well-known example of water-mediated protein-ligand interactions. Here, we perform free-energy calculations for three different ligands binding to OppA, using a thermodynamic integration approach. The tripeptide ligands share a high structural similarity (all have the sequence KXK), but their experimentally-determined binding free energies differ remarkably. Thermodynamic cycles were constructed for the ligands, and simulations conducted in the bound and (freely solvated) unbound states. In the unbound state, it was observed that the difference in conformational freedom between alanine and glycine leads to a surprisingly slow convergence, despite their chemical similarity. This could be overcome by increasing the softness parameter during alchemical transformations. Discrepancies remained in the bound state however, when comparing independent simulations of the three ligands. These difficulties could be traced to a slow relaxation of the water network within the active site. Fluctuations in the number of water molecules residing in the binding cavity occur mostly on a timescale larger than the simulation time along the alchemical path. After extensive simulations, relative binding free energies that were converged to within thermal noise could be obtained, which agree well with available experimental data.
Carotenoid-binding sites of the major light-harvesting complex II of higher plants
Croce, Roberta; Weiss, Saskia; Bassi, Roberto
1999-01-01
Recombinant light-harvesting complex II (LHCII) proteins with modified carotenoid composition have been obtained by in vitro reconstitution of the Lhcb1 protein overexpressed in bacteria. The monomeric protein possesses three xanthophyll-binding sites. The L1 and L2 sites, localized by electron
International Nuclear Information System (INIS)
Ledoux, D.; Mereau, A.; Dauchel, M.C.; Barritault, D.; Courty, J.
1989-01-01
In order to localize a rich source of basic FGF receptor, we examined the distribution of basic FGF binding sites in brain, stomach, lung, spleen, kidney, liver and intestine membrane preparations from adult guinea pig. Comparative binding studies using iodinated basic FGF showed that a specific binding was detected in all the membrane preparations tested. Scatchard plots from iodinated basic FGF competition experiment with native basic FGF in various membrane preparations, suggested the presence of one class of binding sites in some tissues such as liver, kidney, spleen, lung, stomach, and intestine with an apparent dissociation constant (appKD) value ranging from 4 to 7.5 nM and the existence of a second class of higher affinity sites in brain membranes with appKD value of 15 pM. Characterization of these basic FGF high affinity interaction sites was performed using a cross-linking reagent. These results show for the first time that specific interaction sites for basic FGF are widely distributed, suggesting that this growth factor might play a role in the physiological functions of a number of adult organs
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Osteopontin: A uranium phosphorylated binding-site characterization
International Nuclear Information System (INIS)
Safi, Samir; Jeanson, Aurelie; Roques, Jerome; Simoni, Eric; Creff, Gaelle; Qi, Lei; Basset, Christian; Vidaud, Claude; Solari, Pier Lorenzo; Den Auwer, Christophe
2013-01-01
Herein, we describe the structural investigation of one possible uranyl binding site inside a non structured protein. This approach couples spectroscopy, thermodynamics, and theoretical calculations (DFT) and studies the interaction of uranyl ions with a phospho-peptide, thus mimicking a possible osteopontin (OPN) hydroxyapatite growth-inhibition site. Although thermodynamical aspects were investigated by using time-resolved laser fluorescence spectroscopy (TRLFS) and isothermal titration calorimetry (ITC), structural characterization was performed by extended X-ray absorption fine structure (EXAFS) at the U L(III)-edge combined with attenuated total reflection Fourier transform infrared (ATR-FTIR) spectroscopy. From the vibrational and fluorescence spectra, several structural models of a UO 2 2+ /peptide complex were developed and subsequently refined by using theoretical calculations to fit the experimental EXAFS obtained. The structural effect of the pH value was also considered under acidic to moderately acidic conditions (pH 1.5-5.5). Most importantly, the uranyl/peptide coordination environment was similar to that of the native protein. (authors)
Energy Technology Data Exchange (ETDEWEB)
Zhu, Genhai; Jensen, R.G. (Univ. of Arizona, Tucson (USA))
1990-05-01
The properties of the tight and specific binding of 2-C-carboxy-D-arabinitol 1,5-bisphosphate (CABP), which occurs only to reaction sites of ribulose 1,5-bisphosphate carboxylase (Rubisco) that are activated by CO{sub 2} and Mg{sup 2+}, were studied. With fully active purified spinach (Spinacia oleracea) Rubisco the rate of tight binding of ({sup 14}C)CABP fit a multiple exponential rate equation with half of the sites binding with a rate constant of 40 per minute and the second half of the sites binding at 3.2 per minute. This suggests that after CABP binds to one site of a dimer of Rubisco large subunits, binding to the second site is considerably slower, indicating negative cooperativity as previously reported. The rate of CABP binding to partially activated Rubisco was complete within 2 to 5 minutes, with slower binding to inactive sites as they formed the carbamate and bound Mg{sup 2+}. Addition of ({sup 14}C)CABP and EDTA stopped binding of Mg{sup 2+} and allowed tight binding of the radiolabel only to sites which were CO{sub 2}/Mg{sup 2+}-activated at that moment. The rate of CO{sub 2} fixation was proportional to the CO{sub 2}/Mg{sup 2+}-activated sites. During light-dependent CO{sub 2} fixation with isolated spinach chloroplasts, the amount of carbamylation was proportional to Rubisco activity either initially upon lysis of the plastids or following total activation with Mg{sup 2+} and CO{sub 2}. Lysis of chloroplasts in media with ({sup 14}C)CABP plus EDTA estimated those carbamylated sites having Mg{sup 2+}. The loss of Rubisco activation during illumination was partially due to the lack of Mg{sup 2+} to stabilize the carbamylated sites.
Further investigations on the inorganic phosphate binding site of beef heart mitochondrial F1-ATPase
International Nuclear Information System (INIS)
Pougeois, R.; Lauquin, G.J.
1985-01-01
The possibility that 4-azido-2-nitrophenyl phosphate (ANPP), a photoreactive derivative of inorganic phosphate (P /sub i/ ), could mimic ATP was investigated. ANPP was hydrolyzed in the dark by sarcoplasmic reticulum Ca 2+ -ATPase in the presence of Ca 2+ but not in the presence of ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid. ANPP was not hydrolyzed by purified mitochondrial F1-ATPase; however, ADP and ATP protected F1-ATPase against ANPP photoinactivation. On the other hand, the trinitrophenyl nucleotide analogues (TNP-ADP, TNP-ATP, and TNP-AMP-PNP), which bind specifically at the two catalytic sites of F1-ATPase, abolished P /sub i/ binding on F1-ATPase; they do not protect F1-ATPase against ANPP photoinactivation. Furthermore, ANPP-photoinactivated F1-ATPase binds the TNP analogues in the same way as the native enzyme. The Pi binding site of F1-ATPase, which is shown to be photolabeled by ANPP, does not appear to be at the gamma-phosphate position of the catalytic sites
Manzanares, José A; Rimpelä, Anna-Kaisa; Urtti, Arto
2016-04-04
Melanin has a high binding affinity for a wide range of drugs. The determination of the melanin binding capacity and its binding affinity are important, e.g., in the determination of the ocular drug distribution, the prediction of drug effects in the eye, and the trans-scleral drug delivery. The binding parameters estimated from a given data set vary significantly when using different isotherms or different nonlinear fitting methods. In this work, the commonly used bi-Langmuir isotherm, which assumes two classes of independent sites, is confronted with the Sips isotherm. Direct, log-log, and Scatchard plots are used, and the interpretation of the binding curves in the latter is critically analyzed. In addition to the goodness of fit, the emphasis is placed on the physical meaning of the binding parameters. The bi-Langmuir model imposes a bimodal distribution of binding energies for the sites on the melanin granules, but the actual distribution is most likely continuous and unimodal, as assumed by the Sips isotherm. Hence, the latter describes more accurately the distribution of binding energies and also the experimental results of melanin binding to drugs and metal ions. Simulations are used to show that the existence of two classes of sites cannot be confirmed on the sole basis of the shape of the binding curve in the Scatchard plot, and that serious doubts may appear on the meaning of the binding parameters of the bi-Langmuir model. Experimental results of melanin binding to chloroquine and metoprolol are used to illustrate the importance of the choice of the binding isotherm and of the method used to evaluate the binding parameters.
Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M
2017-07-24
Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
Long, Katherine S.
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu H. E-mail: V.H.Nguyen@ansto.gov.au; Mardon, Karine; Kassiou, Michael; Christie, MacDonald J
1999-02-01
ABSTRACT. N-(4-phenylbutyl)-3-hydroxy-4-azahexacyclo[5.4.1.0{sup 2,6}.0{sup 3,10}.0{sup 5,9}.0{sup 8}= {sup ,11}]dodecane (ANSTO-14) showed the highest activity for the {sigma}{sub 1} site ( K{sub i}=9.4 nM) and 19-fold {sigma}{sub 1}/{sigma}{sub 2} selectivity. The present study showed that [{sup 3}H]ANSTO-14 binds to a single high-affinity site in guinea pig brain membranes with an equilibrium K{sub d} of 8.0 {+-} 0.3 nM, in good agreement with the kinetic studies ( K{sub d}=13.3{+-}5.4 nM, n=4), and a B{sub max} of 3,199 {+-} 105 fmol/mg protein ( n=4). The in vivo biodistribution of [{sup 3}H]ANSTO-14 showed a high uptake in the diencephalon. Pretreatment of rats with {sigma} ligands including (+)-pentazocine ({sigma}{sub 1}), ANSTO-14 ({sigma}{sub 1}), and DTG ({sigma}{sub 1} and {sigma}{sub 2}) did not significantly reduce radiotracer uptake in the brain, but did in the spleen. A labelled metabolite was found in the liver and brain. Due to its insensitivity to {sigma} ligands, the accumulation of [{sup 3}H]ANSTO-14 in the brain indicates high nonspecific binding. Therefore, [{sup 3}H]ANSTO-14 is a suitable ligand for labelling {sigma}{sub 1} sites in vitro but is not suitable for brain imaging of {sigma} binding sites in vivo.
Directory of Open Access Journals (Sweden)
Wilson Zoe A
2010-02-01
Full Text Available Abstract Background ChIP-Seq, which combines chromatin immunoprecipitation (ChIP with high-throughput massively parallel sequencing, is increasingly being used for identification of protein-DNA interactions in vivo in the genome. However, to maximize the effectiveness of data analysis of such sequences requires the development of new algorithms that are able to accurately predict DNA-protein binding sites. Results Here, we present SIPeS (Site Identification from Paired-end Sequencing, a novel algorithm for precise identification of binding sites from short reads generated by paired-end solexa ChIP-Seq technology. In this paper we used ChIP-Seq data from the Arabidopsis basic helix-loop-helix transcription factor ABORTED MICROSPORES (AMS, which is expressed within the anther during pollen development, the results show that SIPeS has better resolution for binding site identification compared to two existing ChIP-Seq peak detection algorithms, Cisgenome and MACS. Conclusions When compared to Cisgenome and MACS, SIPeS shows better resolution for binding site discovery. Moreover, SIPeS is designed to calculate the mappable genome length accurately with the fragment length based on the paired-end reads. Dynamic baselines are also employed to effectively discriminate closely adjacent binding sites, for effective binding sites discovery, which is of particular value when working with high-density genomes.
Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John
2017-09-08
Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.
International Nuclear Information System (INIS)
Burcher, E.; Bornstein, J.C.
1988-01-01
Whole mounts of guinea pig ileum submucosa were incubated with radiolabeled tachykinins, and binding sites were visualized using autoradiography. Very dense specific binding for [ 125 I]-Bolton-Hunter substance P (BHSP) was observed over ganglia of the submucous plexus, with weaker binding over internodal strands. Dense specific binding was also seen over occasional strands of circular muscle, with weak binding over clumps of mucosa. Although very weak binding was seen over some large blood vessels, no binding was associated with smaller blood vessels. Localization of binding was absent in whole-mounts coincubated with 1 microM substance P, used to define nonspecific binding. Localization of BHSP-specific binding was also abolished in whole-mounts coincubated with 1 nM substance P, but not with 1 nM neurokinin B, suggesting that binding was probably to an NK-1 tachykinin receptor. In whole-mounts incubated in [ 125 I]-iodohistidyl neurokinin A (INKA) or [ 125 I]-Bolton-Hunter neurokinin B (BHNKB), no specific binding over ganglia was observed. These binding sites for BHSP are probably identical with the neuronal substance P receptors mediating mucosal ion transport
Directory of Open Access Journals (Sweden)
Yaron Orenstein
Full Text Available The new technology of protein binding microarrays (PBMs allows simultaneous measurement of the binding intensities of a transcription factor to tens of thousands of synthetic double-stranded DNA probes, covering all possible 10-mers. A key computational challenge is inferring the binding motif from these data. We present a systematic comparison of four methods developed specifically for reconstructing a binding site motif represented as a positional weight matrix from PBM data. The reconstructed motifs were evaluated in terms of three criteria: concordance with reference motifs from the literature and ability to predict in vivo and in vitro bindings. The evaluation encompassed over 200 transcription factors and some 300 assays. The results show a tradeoff between how the methods perform according to the different criteria, and a dichotomy of method types. Algorithms that construct motifs with low information content predict PBM probe ranking more faithfully, while methods that produce highly informative motifs match reference motifs better. Interestingly, in predicting high-affinity binding, all methods give far poorer results for in vivo assays compared to in vitro assays.
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Musgrave, I.F.; Kotsopoulos, D.; Hughes, R.A.
1998-01-01
Full text: The structure of I 1 -imidazoline binding sites is still unknown and we have proposed that they represent ion channels (i). In these experiments we characterised the effects of the known ion channel modulators methyltriphenylphosphonium (MTPP), 4-aminopyridine (4-AP) and tetraethyl ammonium (TEA) on [ 3 H] clonidine binding in bovine adrenal medullary membranes as these membranes have a relatively well defined I 1 -imidazoline binding site (Molderings et al, 1993). Membranes from bovine adrenal medulla's were prepared by a minor modification of the method of Rapier et al. [ 3 H] Clonidine binding was performed by the method of Ernsberger et al (3), with [ 3 H] clonidine (62 Ci/mmol) used at a final concentration of 5 nM. [ 3 H] Clonidine binding was displaced from bovine adrenal medullary membranes by adrenergic drugs with the order of potency being oxymetazoline > clonidine > moxonidine = idazoxan >> yonimbine. This order of potency is consistent with previous studies of I 1 -imidazoline binding sites (4). Non-linear curve fitting to this data was consistent with a single site model. Both TEA and 4-AP displaced [ H] clonidine with similar potency to its effect on ion channels, TEA having a EC>> of 54 ± 0.3 μM (n=3). The displacement of [ 3 H] clonidine produced by both TEA and 4-AP also fitted to a single site model. Displacement of [ 3 H] clonidine by MTPP fitted a two site model (p 1 -imidazoline binding sites defined with [ 3 H] clonidine may represent ion channels. We have used this data to perform molecular modelling and have determined a common conformation of I 1 -prefering ligands which will aid in the development of I 1 -selective ligands in the future. Copyright (1998) Australian Neuroscience Society
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-01-01
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes...
International Nuclear Information System (INIS)
Rebelo, Tânia S.C.R.; Santos, C.; Costa-Rodrigues, J.; Fernandes, M.H.; Noronha, João P.; Sales, M. Goreti F.
2014-01-01
Graphical abstract: EF13-201, Novel Prostate Specific Antigen plastic antibody designed with charged binding sites for an improved protein binding and its application in a biosensor of potentiometric transduction. - Abstract: This work shows that the synthesis of protein plastic antibodies tailored with selected charged monomers around the binding site enhances protein binding. These charged receptor sites are placed over a neutral polymeric matrix, thus inducing a suitable orientation the protein reception to its site. This is confirmed by preparing control materials with neutral monomers and also with non-imprinted template. This concept has been applied here to Prostate Specific Antigen (PSA), the protein of choice for screening prostate cancer throughout the population, with serum levels >10 ng/mL pointing out a high probability of associated cancer. Protein Imprinted Materials with charged binding sites (C/PIM) have been produced by surface imprinting over graphene layers to which the protein was first covalently attached. Vinylbenzyl(trimethylammonium chloride) and vinyl benzoate were introduced as charged monomers labelling the binding site and were allowed to self-organize around the protein. The subsequent polymerization was made by radical polymerization of vinylbenzene. Neutral PIM (N/PIM) prepared without oriented charges and non imprinted materials (NIM) obtained without template were used as controls. These materials were used to develop simple and inexpensive potentiometric sensor for PSA. They were included as ionophores in plasticized PVC membranes, and tested over electrodes of solid or liquid conductive contacts, made of conductive carbon over a syringe or of inner reference solution over micropipette tips. The electrodes with charged monomers showed a more stable and sensitive response, with an average slope of -44.2 mV/decade and a detection limit of 5.8 × 10 −11 mol/L (2 ng/mL). The corresponding non-imprinted sensors showed lower
Vandenbon, Alexis; Kumagai, Yutaro; Teraguchi, Shunsuke; Amada, Karlou Mar; Akira, Shizuo; Standley, Daron M
2013-01-21
Identification of cis- and trans-acting factors regulating gene expression remains an important problem in biology. Bioinformatics analyses of regulatory regions are hampered by several difficulties. One is that binding sites for regulatory proteins are often not significantly over-represented in the set of DNA sequences of interest, because of high levels of false positive predictions, and because of positional restrictions on functional binding sites with regard to the transcription start site. We have developed a novel method for the detection of regulatory motifs based on their local over-representation in sets of regulatory regions. The method makes use of a Parzen window-based approach for scoring local enrichment, and during evaluation of significance it takes into account GC content of sequences. We show that the accuracy of our method compares favourably to that of other methods, and that our method is capable of detecting not only generally over-represented regulatory motifs, but also locally over-represented motifs that are often missed by standard motif detection approaches. Using a number of examples we illustrate the validity of our approach and suggest applications, such as the analysis of weaker binding sites. Our approach can be used to suggest testable hypotheses for wet-lab experiments. It has potential for future analyses, such as the prediction of weaker binding sites. An online application of our approach, called LocaMo Finder (Local Motif Finder), is available at http://sysimm.ifrec.osaka-u.ac.jp/tfbs/locamo/.
Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†
Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald
2009-01-01
A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129
Energy Technology Data Exchange (ETDEWEB)
Hsu, Hao-Chi [Cryo-EM Structural; Tong, Simon [Department of Chemistry, Stony Brook University, Stony Brook, New York 11794, United States; Zhou, Yuchen [Department of Applied Mathematics; Elmes, Matthew W. [Department of Biochemistry and; Yan, Su [Department of Chemistry, Stony Brook University, Stony Brook, New York 11794, United States; Kaczocha, Martin [Department of Biochemistry and; Department of Anesthesiology, Stony Brook University, Stony; Deutsch, Dale G. [Department of Biochemistry and; Institute of Chemical Biology and; Rizzo, Robert C. [Department of Applied Mathematics; Institute of Chemical Biology and; Laufer; Ojima, Iwao [Department of Chemistry, Stony Brook University, Stony Brook, New York 11794, United States; Institute of Chemical Biology and; Li, Huilin [Cryo-EM Structural; Institute of Chemical Biology and
2017-06-28
Human FABP5 and FABP7 are intracellular endocannabinoid transporters. SBFI-26 is an α-truxillic acid 1-naphthyl monoester that competitively inhibits the activities of FABP5 and FABP7 and produces antinociceptive and anti-inflammatory effects in mice. The synthesis of SBFI-26 yields several stereoisomers, and it is not known how the inhibitor binds the transporters. Here we report co-crystal structures of SBFI-26 in complex with human FABP5 and FABP7 at 2.2 and 1.9 Å resolution, respectively. We found that only (S)-SBFI-26 was present in the crystal structures. The inhibitor largely mimics the fatty acid binding pattern, but it also has several unique interactions. Notably, the FABP7 complex corroborates key aspects of the ligand binding pose at the canonical site previously predicted by virtual screening. In FABP5, SBFI-26 was unexpectedly found to bind at the substrate entry portal region in addition to binding at the canonical ligand-binding pocket. Our structural and binding energy analyses indicate that both R and S forms appear to bind the transporter equally well. We suggest that the S enantiomer observed in the crystal structures may be a result of the crystallization process selectively incorporating the (S)-SBFI-26–FABP complexes into the growing lattice, or that the S enantiomer may bind to the portal site more rapidly than to the canonical site, leading to an increased local concentration of the S enantiomer for binding to the canonical site. Our work reveals two binding poses of SBFI-26 in its target transporters. This knowledge will guide the development of more potent FABP inhibitors based upon the SBFI-26 scaffold.
Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong
2017-01-24
Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains
DEFF Research Database (Denmark)
Peng, Nan; Xia, Qiu; Chen, Zhengjun
2009-01-01
S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki
2017-11-01
Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.
Integrin activation dynamics between the RGD-binding site and the headpiece hinge.
Puklin-Faucher, Eileen; Vogel, Viola
2009-12-25
Integrins form mechanical links between the extracellular matrix and the cytoskeleton. Although integrin activation is known to be regulated by an allosteric conformational change, which can be induced from the extracellular or intracellular end of the molecule, little is known regarding the sequence of structural events by which signals propagate between distant sites. Here, we reveal with molecular dynamics simulations of the FnIII(10)-bound alpha(V)beta(3) integrin headpiece how the binding pocket and interdomain betaA/hybrid domain hinge on the distal end of the betaA domain are allosterically linked via a hydrophobic T-junction between the middle of the alpha1 helix and top of the alpha7 helix. The key results of this study are: 1) that this T-junction is induced by ligand binding and hinge opening, and thus displays bidirectionality; 2) that formation of this junction can be accelerated by ligand-mediated force; and 3) how formation of this junction is inhibited by Ca(2+) in place of Mg(2+) at the site adjacent to the metal ion-dependent adhesion site ("ADMIDAS"). Together with recent experimental evidence that integrin complexes can form catch bonds (i.e. become strengthened under force), as well as earlier evidence that Ca(2+) at the ADMIDAS results in lower binding affinity, these simulations provide a common structural model for the dynamic process by which integrins become activated.
Validation of binding of SE-75 labeled sucralfate to sites of gastrointestinal ulceration
Energy Technology Data Exchange (ETDEWEB)
Maurer, A.H.; Knight, L.C.; Kollman, M.; Krevsky, B.; Pleet, D.; D' Ercole, F.; Siegel, J.A.; Fisher, R.S.; Malmud, L.S.
1985-05-01
This study was performed to determine if and for how long sucralfate (SU) binds selectively to sites of gastro-intestinal (GI) ulceration. Se-Su was prepared by sulfating sucrose with tracer Se-75 and precipitating it as the basic Al salt. All patients (pts) had endoscopy to confirm the presence of either: esophagitis (n=5), gastritis (GA) (n=5), gastric ulcers (GU) (n=5), duodenal ulcers (DU) (n=5), or no ulceration (NU) (n=5). Following an overnight fast the pts swallowed 1 gm with 100 ..mu..Ci of Se-SU and were imaged continuously over 24 hours or until no activity remained in the upper GI tract. Pts with GU visually demonstrated focal SU binding at the ulcers for an average of 3.9 +- 1.1 hrs. with a mean GET of 68 +- 25 min. Mean GET for pts with DU was prolonged, 171 +- 63 min, however focal binding at duodenal ulcers was not seen. All pts with GA had diffuse retention of SU in the stomach with a mean GET of 118 +- 34 min. Focal binding of SU at all sites of esophagitis was seen with a T-1/2 of 65 +- 32 min at the ulcerations. In conclusion these data support the theory that the mechanism of ulcer healing with SU is related to its ability to adhere to the ulcer site forming a protective barrier. In addition Se-SU is a potential ulcer imaging agent which can be used to noninvasively assess healing.
Validation of binding of SE-75 labeled sucralfate to sites of gastrointestinal ulceration
International Nuclear Information System (INIS)
Maurer, A.H.; Knight, L.C.; Kollman, M.; Krevsky, B.; Pleet, D.; D'Ercole, F.; Siegel, J.A.; Fisher, R.S.; Malmud, L.S.
1985-01-01
This study was performed to determine if and for how long sucralfate (SU) binds selectively to sites of gastro-intestinal (GI) ulceration. Se-Su was prepared by sulfating sucrose with tracer Se-75 and precipitating it as the basic Al salt. All patients (pts) had endoscopy to confirm the presence of either: esophagitis (n=5), gastritis (GA) (n=5), gastric ulcers (GU) (n=5), duodenal ulcers (DU) (n=5), or no ulceration (NU) (n=5). Following an overnight fast the pts swallowed 1 gm with 100 μCi of Se-SU and were imaged continuously over 24 hours or until no activity remained in the upper GI tract. Pts with GU visually demonstrated focal SU binding at the ulcers for an average of 3.9 +- 1.1 hrs. with a mean GET of 68 +- 25 min. Mean GET for pts with DU was prolonged, 171 +- 63 min, however focal binding at duodenal ulcers was not seen. All pts with GA had diffuse retention of SU in the stomach with a mean GET of 118 +- 34 min. Focal binding of SU at all sites of esophagitis was seen with a T-1/2 of 65 +- 32 min at the ulcerations. In conclusion these data support the theory that the mechanism of ulcer healing with SU is related to its ability to adhere to the ulcer site forming a protective barrier. In addition Se-SU is a potential ulcer imaging agent which can be used to noninvasively assess healing
Localization of 125I-insulin binding sites in the rat hypothalamus by quantitative autoradiography
International Nuclear Information System (INIS)
Corp, E.S.; Woods, S.C.; Figlewicz, D.P.; Porte, D. Jr.; Baskin, D.G.; Dorsa, D.M.
1986-01-01
In vitro autoradiography and computer video densitometry were used to localize and quantify binding of 125 I-insulin in the hypothalamus of the rat brain. Highest specific binding was found in the arculate, dorsomedial, suprachiasmatic, paraventricular and periventricular regions. Significantly lower binding was present in the ventromedial nucleus and median eminence. The results are consistent with the hypothesis that insulin modulates the neural regulation of feeding by acting at sites in the hypothalamus. (author)
Low nucleosome occupancy is encoded around functional human transcription factor binding sites
Directory of Open Access Journals (Sweden)
Daenen Floris
2008-07-01
Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Competitive binding of Chlorin p6 and Dansyl-L-Proline to Sudlow's site II of human serum albumin
Patel, Sunita; Sharma, Kaushal Kishor; Datta, Anindya
2015-03-01
The binding of chlorin p6, a model photosensitizer for photodynamic therapy (PDT), to the Sudlow's site II of Human Serum Albumin (HSA) has been monitored by different spectroscopic methods. Displacement of Dansyl-L-Proline (DP) from its conjugate with HSA is manifested in the spectral shift and decrease in its fluorescence intensity as well as the emergence of component with lifetime of 2-3 ns, which is characteristic of free DP. As DP is known to bind specifically to the Sudlow's site II of human serum albumin, its displacement by chlorin p6 indicates the residence of the photosensitizer in the same site, in addition to Sudlow's site I. The binding constants for Sudlow's site II, determined by the stopped-flow technique, are found to be two orders of magnitude smaller than that for Sudlow's site I.
Energy Technology Data Exchange (ETDEWEB)
Kazmi, S.M.I.; Mishra, R.K.
1986-06-13
Human neuroblastoma SH-SY5Y cells exhibited a heterogeneous population of ..mu.. and delta types of opioid binding sites. These specific binding sites displayed the characteristic saturability, stereospecificity and reversibility, expected of a receptor. Scatchard analysis of (/sup 3/H)-D-Ala/sup 2/-D-Leu/sup 5/-enkephalin (DADLE) in the presence of 10/sup -5/M D-Pro/sup 4/-morphiceptin (to block the ..mu.. receptors) and the competitive displacement by various highly selective ligands yielded the binding parameters of delta sites which closely resemble those of the delta receptors in brain and mouse neuroblastoma clones. Similarly, the high affinity binding of (/sup 3/H)-dihydromorphine, together with the higher potency of morphine analogues to displace (/sup 3/H)-naloxone binding established the presence of ..mu.. sites. Guanine nucleotides and NaCl significantly inhibited the association and increased the dissociation of (/sup 3/H)-DADLE binding.
Distribution of epidermal growth factor binding sites in the adult rat anterior pituitary gland
International Nuclear Information System (INIS)
Chabot, J.G.; Walker, P.; Pelletier, G.
1986-01-01
The distribution of epidermal growth (EGF) binding sites was studied in the pituitary gland using light and electron microscope autoradiography which was performed at different time intervals (2 to 60 min) after intravenous (IV) injection of [ 125 I]EGF into adult rats. At the light microscopic level, the labeling was found over cells of the anterior pituitary gland. The time-course study performed by light microscope autoradiography showed that the maximal values were reached at the 2 min time interval. At this time interval, most silver grains were found at the periphery of the target cells. After, the number of silver grains decreased progressively and the localization of silver grains in the cytoplasm indicated the internalization of [ 125 I]EGF. Electron microscope autoradiography showed that labeling was mostly restricted to mammotrophs and somatotrophs. Control experiments indicated that the autoradiographic labeling was due specific interaction of [ 125 I]EGF with its binding site. These results indicate that EGF binding sites are present in at least two anterior pituitary cell types and suggest that EGF can exert a physiological role in the pituitary gland
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M
2015-10-01
Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.
Na,K-ATPase binding sites in human erythrocytes in cirrhosis of the liver
International Nuclear Information System (INIS)
Schober, O.; Oetting, G.; Bossaller, C.
1985-01-01
The number of red blood cell ouabain binding sites, total-body potassium (TBK), serum potassium, exchangeable sodium, and serum sodium was studied in 24 patients with cirrhosis of the liver. The number of red cell ouabain binding sites, measured by equilibrium binding of 3 H-ouabain, showed a significant increase in the number of Na,K pumps in patients with cirrhosis of the liver (447+-99) as compared with a control group (281+-50, n=36). TBK was measured by counting the endogenous K-40 in a whole-body counter. TBK was 76+-10% in cirrhosis. This significant reduction in TBK was accompanied by normal serum potassium levels, and slightly decreased serum sodium levels in cirrhosis, however exchangeable sodium (Na-24) was increased in cirrhosis of the liver (55+-13 mmol/kg) compared with controls (40+-7 mmol/kg). These results support the suggestion that changes of sodium-potassium concentration at the cell membrane may regulate the synthesis of Na,K-pump molecules. (orig.) [de
Molecular Modeling of the M3 Acetylcholine Muscarinic Receptor and Its Binding Site
Directory of Open Access Journals (Sweden)
Marlet Martinez-Archundia
2012-01-01
Full Text Available The present study reports the results of a combined computational and site mutagenesis study designed to provide new insights into the orthosteric binding site of the human M3 muscarinic acetylcholine receptor. For this purpose a three-dimensional structure of the receptor at atomic resolution was built by homology modeling, using the crystallographic structure of bovine rhodopsin as a template. Then, the antagonist N-methylscopolamine was docked in the model and subsequently embedded in a lipid bilayer for its refinement using molecular dynamics simulations. Two different lipid bilayer compositions were studied: one component palmitoyl-oleyl phosphatidylcholine (POPC and two-component palmitoyl-oleyl phosphatidylcholine/palmitoyl-oleyl phosphatidylserine (POPC-POPS. Analysis of the results suggested that residues F222 and T235 may contribute to the ligand-receptor recognition. Accordingly, alanine mutants at positions 222 and 235 were constructed, expressed, and their binding properties determined. The results confirmed the role of these residues in modulating the binding affinity of the ligand.
André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J
1999-11-01
Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential
DNA-binding proteins regulating pIP501 transfer and replication
Directory of Open Access Journals (Sweden)
Elisabeth Grohmann
2016-08-01
Full Text Available pIP501 is a Gram-positive broad-host-range model plasmid intensively used for studying plasmid replication and conjugative transfer. It is a multiple antibiotic resistance plasmid frequently found in clinical Enterococcus faecalis and Enterococcus faecium isolates. Replication of pIP501 proceeds unidirectionally by a theta mechanism. The minimal replicon of pIP501 is composed of the repR gene encoding the essential rate-limiting replication initiator protein RepR and the origin of replication, oriR, located downstream of repR. RepR is similar to RepE of related streptococcal plasmid pAMβ1, which has been shown to possess RNase activity cleaving free RNA molecules in close proximity of the initiation site of DNA synthesis. Replication of pIP501 is controlled by the concerted action of a small protein, CopR, and an antisense RNA, RNAIII. CopR has a dual role: It acts as transcriptional repressor at the repR promoter and prevents convergent transcription of RNAIII and repR mRNA (RNAII, thereby indirectly increasing RNAIII synthesis. CopR binds asymmetrically as a dimer at two consecutive binding sites upstream of and overlapping with the repR promoter. RNAIII induces transcriptional attenuation within the leader region of the repR mRNA (RNAII. Deletion of either control component causes a 10- to 20-fold increase of plasmid copy number, while simultaneous deletions have no additional effect. Conjugative transfer of pIP501 depends on a type IV secretion system (T4SS encoded in a single operon. Its transfer host-range is considerably broad, as it has been transferred to virtually all Gram-positive bacteria including filamentous streptomycetes and even the Gram-negative Escherichia coli. Expression of the 15 genes encoding the T4SS is tightly controlled by binding of the relaxase TraA, the transfer initiator protein, to the operon promoter, which overlaps with the origin of transfer (oriT. The T4SS operon encodes the DNA-binding proteins TraJ (VirD4
Autoradiographic localization of (125I-Tyr4)bombesin-binding sites in rat brain
International Nuclear Information System (INIS)
Zarbin, M.A.; Kuhar, M.J.; O'Donohue, T.L.; Wolf, S.S.; Moody, T.W.
1985-01-01
The binding of ( 125 I-Tyr 4 )bombesin to rat brain slices was investigated. Radiolabeled (Tyr 4 )bombesin bound with high affinity (K/sub d/ . 4 nM) to a single class of sites (B/sub max/ . 130 fmol/mg of protein); the ratio of specific to nonspecific binding was 6/1. Also, pharmacology studies indicated that the C-terminal of bombesin was important for the high affinity binding activity. Autoradiographic studies indicated that the ( 125 I-Tyr4)bombesin-binding sites were discretely distributed in certain gray but not white matter regions of rat brain. Highest grain densities were present in the olfactory bulb and tubercle, nucleus accumbens, suprachiasmatic and periventricular nuclei of the hypothalamus, central medial thalamic nucleus, medial amygdaloid nucleus, hippocampus, dentate gyrus, subiculum, nucleus of the solitary tract, and substantia gelatinosa. Moderate grain densities were present in the parietal cortex, deep layers of the neocortex, rhinal cortex, caudate putamen, stria terminalis, locus ceruleus, parabrachial nucleus, and facial nucleus. Low grain densities were present in the globus pallidus, lateral thalamus, and midbrain. Negligible grain densities were present in the cerebellum, corpus callosum, and all regions treated with 1 microM unlabeled bombesin. The discrete regional distribution of binding suggests that endogenous bombesin-like peptides may function as important regulatory agents in certain brain loci
Qiu, L.Y.; Swarts, H.G.P.; Tonk, E.C.; Willems, P.H.G.M.; Koenderink, J.B.; Pont, J.J.H.H.M. de
2006-01-01
P-type ATPases of the IIC subfamily exhibit large differences in sensitivity toward ouabain. This allows a strategy in which ouabain-insensitive members of this subfamily are used as template for mutational elucidation of the ouabain-binding site. With this strategy, we recently identified seven
International Nuclear Information System (INIS)
Chalmers, D.T.; Dewar, D.; Graham, D.I.; Brooks, D.N.; McCulloch, J.
1990-01-01
Involvement of cortical glutamatergic mechanisms in senile dementia of the Alzheimer type (SDAT) has been investigated with quantitative ligand-binding autoradiography. The distribution and density of Na(+)-dependent glutamate uptake sites and glutamate receptor subtypes--kainate, quisqualate, and N-methyl-D-aspartate--were measured in adjacent sections of frontal cortex obtained postmortem from six patients with SDAT and six age-matched controls. The number of senile plaques was determined in the same brain region. Binding of D-[3H]aspartate to Na(+)-dependent uptake sites was reduced by approximately 40% throughout SDAT frontal cortex relative to controls, indicating a general loss of glutamatergic presynaptic terminals. [3H]Kainate receptor binding was significantly increased by approximately 70% in deep layers of SDAT frontal cortex compared with controls, whereas this binding was unaltered in superficial laminae. There was a positive correlation (r = 0.914) between kainate binding and senile plaque number in deep cortical layers. Quisqualate receptors, as assessed by 2-amino-3-hydroxy-5-[3H]methylisoxazole-4-propionic acid binding, were unaltered in SDAT frontal cortex compared with controls. There was a small reduction (25%) in N-methyl-D-aspartate-sensitive [3H]glutamate binding only in superficial cortical layers of SDAT brains relative to control subjects. [3H]Glutamate binding in SDAT subjects was unrelated to senile plaque number in superficial cortical layers (r = 0.104). These results indicate that in the presence of cortical glutamatergic terminal loss in SDAT plastic alterations occur in some glutamate receptor subtypes but not in others
Energy Technology Data Exchange (ETDEWEB)
Smith, S.R.; Bencze, K.Z.; Russ, K.A.; Wasiukanis, K.; Benore-Parsons, M.; Stemmler, T.L.
2009-05-26
Riboflavin Binding Protein (RBP) binds copper in a 1:1 molar ratio, forming a distinct well-ordered type II site. The nature of this site has been examined using X-ray absorption and pulsed electron paramagnetic resonance (EPR) spectroscopies, revealing a four coordinate oxygen/nitrogen rich environment. On the basis of analysis of the Cambridge Structural Database, the average protein bound copper-ligand bond length of 1.96 {angstrom}, obtained by extended x-ray absorption fine structure (EXAFS), is consistent with four coordinate Cu(I) and Cu(II) models that utilize mixed oxygen and nitrogen ligand distributions. These data suggest a Cu-O{sub 3}N coordination state for copper bound to RBP. While pulsed EPR studies including hyperfine sublevel correlation spectroscopy and electron nuclear double resonance show clear spectroscopic evidence for a histidine bound to the copper, inclusion of a histidine in the EXAFS simulation did not lead to any significant improvement in the fit.
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
International Nuclear Information System (INIS)
Sun Zhong-Hua; Jiang Fan
2010-01-01
In this paper a new continuous variable called core-ratio is defined to describe the probability for a residue to be in a binding site, thereby replacing the previous binary description of the interface residue using 0 and 1. So we can use the support vector machine regression method to fit the core-ratio value and predict the protein binding sites. We also design a new group of physical and chemical descriptors to characterize the binding sites. The new descriptors are more effective, with an averaging procedure used. Our test shows that much better prediction results can be obtained by the support vector regression (SVR) method than by the support vector classification method. (rapid communication)
Directory of Open Access Journals (Sweden)
Barna Dey
2009-05-01
Full Text Available The human immunodeficiency virus type 1 (HIV-1 exterior envelope glycoprotein, gp120, possesses conserved binding sites for interaction with the primary virus receptor, CD4, and also for the co-receptor, generally CCR5. Although gp120 is a major target for virus-specific neutralizing antibodies, the gp120 variable elements and its malleable nature contribute to evasion of effective host-neutralizing antibodies. To understand the conformational character and immunogenicity of the gp120 receptor binding sites as potential vaccine targets, we introduced structure-based modifications to stabilize gp120 core proteins (deleted of the gp120 major variable regions into the conformation recognized by both receptors. Thermodynamic analysis of the re-engineered core with selected ligands revealed significant stabilization of the receptor-binding regions. Stabilization of the co-receptor-binding region was associated with a marked increase in on-rate of ligand binding to this site as determined by surface plasmon resonance. Rabbit immunization studies showed that the conformational stabilization of core proteins, along with increased ligand affinity, was associated with strikingly enhanced humoral immune responses against the co-receptor-binding site. These results demonstrate that structure-based approaches can be exploited to stabilize a conformational site in a large functional protein to enhance immunogenic responses specific for that region.
Tong, Jiefei; Elowe, Sabine; Nash, Piers; Pawson, Tony
2003-02-21
Signaling by the Eph family of receptor tyrosine kinases (RTKs) is complex, because they can interact with a variety of intracellular targets, and can potentially induce distinct responses in different cell types. In NG108 neuronal cells, activated EphB2 recruits p120RasGAP, in a fashion that is associated with down-regulation of the Ras-Erk mitogen-activated kinase (MAPK) pathway and neurite retraction. To pursue the role of the Ras-MAPK pathway in EphB2-mediated growth cone collapse, and to explore the biochemical and biological functions of Eph receptors, we sought to re-engineer the signaling properties of EphB2 by manipulating its regulatory motifs and SH2 binding sites. An EphB2 mutant that retained juxtamembrane (JM) RasGAP binding sites but incorporated a Grb2 binding motif at an alternate RasGAP binding site within the kinase domain had little effect on basal Erk MAPK activation. In contrast, elimination of all RasGAP binding sites, accompanied by the addition of a Grb2 binding site within the kinase domain, led to an increase in phospho-Erk levels in NG108 cells following ephrin-B1 stimulation. Functional assays indicated a correlation between neurite retraction and the ability of the EphB2 mutants to down-regulate Ras-Erk MAPK signaling. These data suggest that EphB2 can be designed to repress, stabilize, or activate the Ras-Erk MAPK pathway by the manipulation of RasGAP and Grb2 SH2 domain binding sites and support the notion that Erk MAPK regulation plays a significant role in axon guidance. The behavior of EphB2 variants with mutations in the JM region and kinase domains suggests an intricate pattern of regulation and target recognition by Eph receptors.
The serotonin transporter in rhesus monkey brain: comparison of DASB and citalopram binding sites
International Nuclear Information System (INIS)
Zeng Zhizhen; Chen, T.-B.; Miller, Patricia J.; Dean, Dennis; Tang, Y.S.; Sur, Cyrille; Williams, David L.
2006-01-01
We have characterized the interaction of the serotonin transporter ligand [ 3 H]-N,N-dimethyl-2-(2-amino-4-cyanophenylthio)-benzylamine (DASB) with rhesus monkey brain in vitro using tissue homogenate binding and autoradiographic mapping. [ 3 H]-DASB, a tritiated version of the widely used [ 11 C] positron emission tomography tracer, was found to selectively bind to a single population of sites with high affinity (K d =0.20±0.04 nM). The serotonin transporter density (B max ) obtained for rhesus frontal cortex was found to be 66±8 fmol/mg protein using [ 3 H]-DASB, similar to the B max value obtained using the reference radioligand [ 3 H]-citalopram, a well-characterized and highly selective serotonin reuptake inhibitor (83±22 fmol/mg protein). Specific binding sites of both [ 3 H]-DASB and [ 3 H]-citalopram were similarly and nonuniformly distributed throughout the rhesus central nervous system, in a pattern consistent with serotonin transporter localization reported for human brain. Regional serotonin transporter densities, estimated from optical densities of the autoradiographic images, were well correlated between the two radioligands. Finally, DASB and fluoxetine showed dose-dependent full inhibition of [ 3 H]-citalopram binding in a competition autoradiographic study, with K i values in close agreement with those obtained from rhesus brain homogenates. This side-by-side comparison of [ 3 H]-DASB and [ 3 H]-citalopram binding sites in rhesus tissue homogenates and in adjacent rhesus brain slices provides additional support for the use of [ 11 C]-DASB to assess the availability and distribution of serotonin transporters in nonhuman primates
Cytochrome c1 exhibits two binding sites for cytochrome c in plants.
Moreno-Beltrán, Blas; Díaz-Quintana, Antonio; González-Arzola, Katiuska; Velázquez-Campoy, Adrián; De la Rosa, Miguel A; Díaz-Moreno, Irene
2014-10-01
In plants, channeling of cytochrome c molecules between complexes III and IV has been purported to shuttle electrons within the supercomplexes instead of carrying electrons by random diffusion across the intermembrane bulk phase. However, the mode plant cytochrome c behaves inside a supercomplex such as the respirasome, formed by complexes I, III and IV, remains obscure from a structural point of view. Here, we report ab-initio Brownian dynamics calculations and nuclear magnetic resonance-driven docking computations showing two binding sites for plant cytochrome c at the head soluble domain of plant cytochrome c1, namely a non-productive (or distal) site with a long heme-to-heme distance and a functional (or proximal) site with the two heme groups close enough as to allow electron transfer. As inferred from isothermal titration calorimetry experiments, the two binding sites exhibit different equilibrium dissociation constants, for both reduced and oxidized species, that are all within the micromolar range, thus revealing the transient nature of such a respiratory complex. Although the docking of cytochrome c at the distal site occurs at the interface between cytochrome c1 and the Rieske subunit, it is fully compatible with the complex III structure. In our model, the extra distal site in complex III could indeed facilitate the functional cytochrome c channeling towards complex IV by building a "floating boat bridge" of cytochrome c molecules (between complexes III and IV) in plant respirasome. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Lewis-Ballester, Ariel; Pham, Khoa N.; Batabyal, Dipanwita; Karkashon, Shay; Bonanno, Jeffrey B.; Poulos, Thomas L.; Yeh, Syun-Ru (Einstein); (UCI)
2017-11-22
Human indoleamine 2,3-dioxygenase 1 (hIDO1) is an attractive cancer immunotherapeutic target owing to its role in promoting tumoral immune escape. However, drug development has been hindered by limited structural information. Here, we report the crystal structures of hIDO1 in complex with its substrate, Trp, an inhibitor, epacadostat, and/or an effector, indole ethanol (IDE). The data reveal structural features of the active site (Sa) critical for substrate activation; in addition, they disclose a new inhibitor-binding mode and a distinct small molecule binding site (Si). Structure-guided mutation of a critical residue, F270, to glycine perturbs the Si site, allowing structural determination of an inhibitory complex, where both the Sa and Si sites are occupied by Trp. The Si site offers a novel target site for allosteric inhibitors and a molecular explanation for the previously baffling substrate-inhibition behavior of the enzyme. Taken together, the data open exciting new avenues for structure-based drug design.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.
Directory of Open Access Journals (Sweden)
Nina Winter
Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.
Integrin Activation Dynamics between the RGD-binding Site and the Headpiece Hinge*
Puklin-Faucher, Eileen; Vogel, Viola
2009-01-01
Integrins form mechanical links between the extracellular matrix and the cytoskeleton. Although integrin activation is known to be regulated by an allosteric conformational change, which can be induced from the extracellular or intracellular end of the molecule, little is known regarding the sequence of structural events by which signals propagate between distant sites. Here, we reveal with molecular dynamics simulations of the FnIII10-bound αVβ3 integrin headpiece how the binding pocket and interdomain βA/hybrid domain hinge on the distal end of the βA domain are allosterically linked via a hydrophobic T-junction between the middle of the α1 helix and top of the α7 helix. The key results of this study are: 1) that this T-junction is induced by ligand binding and hinge opening, and thus displays bidirectionality; 2) that formation of this junction can be accelerated by ligand-mediated force; and 3) how formation of this junction is inhibited by Ca2+ in place of Mg2+ at the site adjacent to the metal ion-dependent adhesion site (“ADMIDAS”). Together with recent experimental evidence that integrin complexes can form catch bonds (i.e. become strengthened under force), as well as earlier evidence that Ca2+ at the ADMIDAS results in lower binding affinity, these simulations provide a common structural model for the dynamic process by which integrins become activated. PMID:19762919
CONREAL web server: identification and visualization of conserved transcription factor binding sites
Berezikov, E.; Guryev, V.; Cuppen, E.
2005-01-01
The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are
Directory of Open Access Journals (Sweden)
Anil Raj
Full Text Available Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.
Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew
2015-01-01
Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.
Zhong, Huailing; Hansen, Kasper B; Boyle, Noel J; Han, Kiho; Muske, Galina; Huang, Xinyan; Egebjerg, Jan; Sánchez, Connie
2009-10-25
The human serotonin transporter (hSERT) has primary and allosteric binding sites for escitalopram and R-citalopram. Previous studies have established that the interaction of these two compounds at a low affinity allosteric binding site of hSERT can affect the dissociation of [(3)H]escitalopram from hSERT. The allosteric binding site involves a series of residues in the 10th, 11th, and 12th trans-membrane domains of hSERT. The low affinity allosteric activities of escitalopram and R-citalopram are essentially eliminated in a mutant hSERT with changes in some of these residues, namely A505V, L506F, I507L, S574T, I575T, as measured in dissociation binding studies. We confirm that in association binding experiments, R-citalopram at clinically relevant concentrations reduces the association rate of [(3)H]escitalopram as a ligand to wild type hSERT. We demonstrate that the ability of R-citalopram to reduce the association rate of escitalopram is also abolished in the mutant hSERT (A505V, L506F, I507L, S574T, I575T), along with the expected disruption the low affinity allosteric function on dissociation binding. This suggests that the allosteric binding site mediates both the low affinity and higher affinity interactions between R-citalopram, escitalopram, and hSERT. Our data add an additional structural basis for the different efficacies of escitalopram compared to racemic citalopram reported in animal studies and clinical trials, and substantiate the hypothesis that hSERT has complex allosteric mechanisms underlying the unexplained in vivo activities of its inhibitors.
Substrate binding in the active site of cytochrome P450cam
Swart, M.; Groenhof, A.R.; Ehlers, A.W.; Lammertsma, K.
2005-01-01
We have studied the binding of camphor in the active site of cytochrome P450cam with density functional theory (DFT) calculations. A strong hydrogen bond (>6 kcal/mol) to a tyrosine residue (Tyr96) is observed, that may account for the high specificity of the reaction taking place. The DFT
International Nuclear Information System (INIS)
Miles, L.A.; Plow, E.F.
1986-01-01
An antibody population that reacted with the high-affinity lysine binding site of human plasminogen was elicited by immunizing rabbits with an elastase degradation product containing kringles 1-3 (EDP I). This antibody was immunopurified by affinity chromatography on plasminogen-Sepharose and elution with 0.2 M 6-aminohexanoic acid. The eluted antibodies bound [ 125 I]EDP I, [ 125 I]Glu-plasminogen, and [ 125 I]Lys-plasminogen in radioimmunoassays, and binding of each ligand was at least 99% inhibited by 0.2 M 6-aminohexanoic acid. The concentrations for 50% inhibition of [ 125 I]EDP I binding by tranexamic acid, 6-aminohexanoic acid, and lysine were 2.6, 46, and l730 μM, respectively. Similar values were obtained with plasminogen and suggested that an unoccupied high-affinity lysine binding site was required for antibody recognition. The antiserum reacted exclusively with plasminogen derivatives containing the EDP I region and did not react with those lacking an EDP I region, or with tissue plasminogen activator or prothrombin, which also contains kringles. By immunoblotting analyses, a chymotryptic degradation product of M/sub r/ 20,000 was derived from EDP I that retained reactivity with the antibody. α 2 -Antiplasmin inhibited the binding of radiolabeled EDP I, Glu-plasminogen, or Lys-plasminogen by the antiserum, suggesting that the recognized site is involved in the noncovalent interaction of the inhibitor with plasminogen. The binding of [ 125 I]EDP I to fibrin was also inhibited by the antiserum. The observations provide independent evidence for the role of the high-affinity lysine binding site in the functional interactions of plasminogen with its primary substrate and inhibitor
Distribution of cyclophilin B-binding sites in the subsets of human peripheral blood lymphocytes.
Denys, A; Allain, F; Foxwell, B; Spik, G
1997-08-01
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway and released in biological fluids. We have recently demonstrated that both free CyPB and CyPB-CsA complex specifically bind to peripheral blood T lymphocytes and are internalized. These results suggest that CyPB might promote the targeting of the drug into sensitive cells. Peripheral blood lymphocytes are subdivided in several populations according to their biological functions and sensitivity to CsA. We have investigated the binding of CyPB to these different subsets using a CyPB derivatized by fluorescein through its single cysteine which retains its binding properties. We have confirmed that only T cells were involved in the interaction with CyPB. The ligand binding was found to be heterogeneously distributed on the different T-cell subsets and surface-bound CyPB was mainly associated with the CD4-positive cells. No significant difference was noted between the CD45RA and CD45RO subsets, demonstrating that CyPB-binding sites were equally distributed between native and memory T cells. CD3 stimulation of T lymphocytes led to a decrease in the CyPB-binding capacity, that may be explained by a down-regulation of the CyPB-receptor expression upon T-cell activation. Finally, we demonstrated that CyPB-receptor-positive cells, isolated on CyPB sulphydryl-coupled affinity matrices, are more sensitive to CyPB-complexed CsA than mixed peripheral blood lymphocytes, suggesting that CyPB potentiates CsA activity through the binding of the complex. Taken together, our results demonstrate that CyPB-binding sites are mainly associated with resting cells of the helper T lymphocyte, and that CyPB might modulate the distribution of CsA through the drug targeting to sensitive cells.
International Nuclear Information System (INIS)
Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.
2005-01-01
Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Functional analysis of a potential regulatory K+-binding site in the Na+, K+-ATPase
DEFF Research Database (Denmark)
Schack, Vivien Rodacker; Vilsen, Bente
The Na+, K+-ATPase functions by actively transporting 3 Na+ ions out of and 2 K+ ions into the cell, thereby creating ion gradients crucial for many physiological processes. Recently, a combined structural and functional study of the closely related Ca2+-ATPase indicated the presence...... of a regulatory K+-binding site in the P-domain of the enzyme, identifying E732 as being of particular importance (Sorensen, Clausen et al. 2004). In addition, P709 is thought to play a significant role in the structural organization of this site. Both E732 and P709 are highly conserved among P-type ATPases (E732...... is present as either glutamic acid or aspartic acid), which supports their importance and additionally raises the question whether this site may play a general role among P-type ATPases. In Na+, K+-ATPase, K+ functions directly as a substrate for membrane binding sites, however, an additional regulatory...
DEFF Research Database (Denmark)
Møller, Charlotte; Sprenger, Richard R.; Stürup, Stefan
2011-01-01
Using insulin as a model protein for binding of oxaliplatin to proteins, various mass spectrometric approaches and techniques were compared. Several different platinum adducts were observed, e.g. addition of one or two diaminocyclohexane platinum(II) (Pt(dach)) molecules. By top-down analysis...... and fragmentation of the intact insulin-oxaliplatin adduct using nano-electrospray ionisation quadrupole time-of-flight mass spectrometry (nESI-Q-ToF-MS), the major binding site was assigned to histidine5 on the insulin B chain. In order to simplify the interpretation of the mass spectrum, the disulphide bridges...... were reduced. This led to the additional identification of cysteine6 on the A chain as a binding site along with histidine5 on the B chain. Digestion of insulin-oxaliplatin with endoproteinase Glu-C (GluC) followed by reduction led to the formation of five peptides with Pt(dach) attached...
The serotonin transporter in rhesus monkey brain: comparison of DASB and citalopram binding sites
Energy Technology Data Exchange (ETDEWEB)
Zeng Zhizhen [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States)]. E-mail: zhizhen_zeng@merck.com; Chen, T.-B. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Miller, Patricia J. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Dean, Dennis [Labeled Compound Synthesis Group, Drug Metabolism, Merck Research Laboratories, Rahway, NJ 07065-0900 (United States); Tang, Y.S. [Labeled Compound Synthesis Group, Drug Metabolism, Merck Research Laboratories, Rahway, NJ 07065-0900 (United States); Sur, Cyrille [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Williams, David L. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States)
2006-05-15
We have characterized the interaction of the serotonin transporter ligand [{sup 3}H]-N,N-dimethyl-2-(2-amino-4-cyanophenylthio)-benzylamine (DASB) with rhesus monkey brain in vitro using tissue homogenate binding and autoradiographic mapping. [{sup 3}H]-DASB, a tritiated version of the widely used [{sup 11}C] positron emission tomography tracer, was found to selectively bind to a single population of sites with high affinity (K {sub d}=0.20{+-}0.04 nM). The serotonin transporter density (B {sub max}) obtained for rhesus frontal cortex was found to be 66{+-}8 fmol/mg protein using [{sup 3}H]-DASB, similar to the B {sub max} value obtained using the reference radioligand [{sup 3}H]-citalopram, a well-characterized and highly selective serotonin reuptake inhibitor (83{+-}22 fmol/mg protein). Specific binding sites of both [{sup 3}H]-DASB and [{sup 3}H]-citalopram were similarly and nonuniformly distributed throughout the rhesus central nervous system, in a pattern consistent with serotonin transporter localization reported for human brain. Regional serotonin transporter densities, estimated from optical densities of the autoradiographic images, were well correlated between the two radioligands. Finally, DASB and fluoxetine showed dose-dependent full inhibition of [{sup 3}H]-citalopram binding in a competition autoradiographic study, with K {sub i} values in close agreement with those obtained from rhesus brain homogenates. This side-by-side comparison of [{sup 3}H]-DASB and [{sup 3}H]-citalopram binding sites in rhesus tissue homogenates and in adjacent rhesus brain slices provides additional support for the use of [{sup 11}C]-DASB to assess the availability and distribution of serotonin transporters in nonhuman primates.
International Nuclear Information System (INIS)
Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio
2005-01-01
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Hunt, A F; Reed, M I
1990-07-01
The binding mechanisms and binding sites involved in the tannic acid and chromic chloride-induced binding of protein to red cells were investigated using the binding of IgA paraprotein to red cells as model systems. Inhibition studies of these model systems using amino acid homopolymers and compounds (common as red cell membrane constituents) suggest that the mechanisms involved are similar to those proposed for the conversion of hide or skin collagen to leather, as in commercial tanning. These studies also suggest that tannic acid-induced binding of IgA paraprotein to red cells involves the amino acid residues of L-arginine, L-lysine, L-histidine, and L-proline analogous to tanning with phenolic plant extracts. The amino acid residues of L-aspartate, L-glutamate and L-asparagine are involved in a similar manner in chronic chloride-induced binding of protein to red cells.
International Nuclear Information System (INIS)
Leff, S.E.; Creese, I.
1985-01-01
The interactions of dopaminergic agonists and antagonists with 3 H-agonist labeled D3 dopaminergic binding sites of rat striatum have been characterized by radioligand-binding techniques. When the binding of [ 3 H]dopamine and [ 3 H]apomorphine to D2 dopamine receptors is blocked by the inclusion of D2 selective concentrations of unlabeled spiroperidol or domperidone, these ligands appear to label selectively the previously termed D3 binding site. Antagonist/[ 3 H]dopamine competition curves are of uniformly steep slope (nH . 1.0), suggesting the presence of a single D3 binding site. The relative potencies of antagonists to inhibit D3 specific [ 3 H]dopamine binding are significantly correlated with their potencies to block D1 dopamine receptors as measured by the inhibition of both dopamine-stimulated adenylate cyclase and [ 3 H]flupentixol-binding activities. The affinities of agonists to inhibit D3 specific [ 3 H]dopamine binding are also correlated with estimates of these agonists affinities for the high affinity binding component of agonist/[ 3 H]flupentixol competition curves. Both D3 specific [ 3 H] dopamine binding and the high affinity agonist-binding component of dopamine/[ 3 H]flupentixol competition curves show a similar sensitivity to guanine nucleotides. Taken together, these data strongly suggest that the D3 binding site is related to a high affinity agonist-binding state of the D1 dopamine receptor
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Binding-site analysis of opioid receptors using monoclonal anti-idiotypic antibodies
International Nuclear Information System (INIS)
Conroy, W.G.
1988-01-01
Structural relatedness between the variable region of anti-ligand antibodies and opioid binding sites allowed the generation of anti-idiotypic antibodies which recognized opioid receptors. The IgG 3 k antibodies which bound to opioid receptors were obtained when an anti-morphine antiserum was the idiotype. Both antibodies bound to opioid receptors, but only one of these blocked the binding of [ 3 H]naloxone. The antibody which did not inhibit the binding of [ 3 H]naloxone was itself displaced from the receptor by opioid ligands. The unique binding properties displayed by this antibody indicated that anti-idiotypic antibodies are not always a perfect image of the original ligand, and therefore may be more useful than typical ligands as probes for the receptor. An auto-anti-idiotypic technique was successfully used to obtain anti-opioid receptor antibodies. Another IgG 3 k antibody that blocked the binding of [ 3 H]naloxone to rat brain opioid receptors was obtained when a mouse was immunized with naloxone conjugated to bovine serum albumin. These data confirmed that an idiotype-anti-idiotype network which can generate an anti-receptor antibody normally functions when an opioid ligand is introduced into an animal in an immunogenic form
Directory of Open Access Journals (Sweden)
Simon Oakley
Full Text Available Barbiturates potentiate GABA actions at the GABA(A receptor and act as central nervous system depressants that can induce effects ranging from sedation to general anesthesia. No structural information has been available about how barbiturates are recognized by their protein targets. For this reason, we tested whether these drugs were able to bind specifically to horse spleen apoferritin, a model protein that has previously been shown to bind many anesthetic agents with affinities that are closely correlated with anesthetic potency. Thiopental, pentobarbital, and phenobarbital were all found to bind to apoferritin with affinities ranging from 10-500 µM, approximately matching the concentrations required to produce anesthetic and GABAergic responses. X-ray crystal structures were determined for the complexes of apoferritin with thiopental and pentobarbital at resolutions of 1.9 and 2.0 Å, respectively. These structures reveal that the barbiturates bind to a cavity in the apoferritin shell that also binds haloalkanes, halogenated ethers, and propofol. Unlike these other general anesthetics, however, which rely entirely upon van der Waals interactions and the hydrophobic effect for recognition, the barbiturates are recognized in the apoferritin site using a mixture of both polar and nonpolar interactions. These results suggest that any protein binding site that is able to recognize and respond to the chemically and structurally diverse set of compounds used as general anesthetics is likely to include a versatile mixture of both polar and hydrophobic elements.
International Nuclear Information System (INIS)
Besson, J.; Dussaillant, M.; Marie, J.C.; Rostene, W.; Rosselin, G.
1984-01-01
This paper describes the autoradiographic distribution of VIP binding sites in the rat central nervous system using monoiodinated 125I-labeled VIP. High densities of VIP binding sites are observed in the granular layer of the dorsal dentate gyrus of the hippocampus, the basolateral amygdaloid nucleus, the dorsolateral and median geniculate nuclei of the thalamus as well as in the ventral part of the hypothalamic dorsomedial nucleus
Bakker, A.H.F.; Weening-Verhoeff, E.J.D.; Verheijen, J.H.
1995-01-01
To describe the role of the lysyl binding site in the interaction of tissue-type plasminogen activator (t-PA, FGK1K2P) with a forming fibrin clot, we performed binding experiments with domain deletion mutants GK1K2P, K2P, and the corresponding point mutants lacking the lysyl binding site in the
International Nuclear Information System (INIS)
Shahlaei, Mohsen; Rahimi, Behnoosh; Ashrafi-Kooshk, Mohammad Reza; Sadrjavadi, Komail; Khodarahmi, Reza
2015-01-01
Human serum albumin (HSA)-drug binding affinity is one of the major factors that determine the pharmacokinetics, halftime and bioavailability of drugs in various tissues. In the present study, the interaction of olanzapine (OLZ), a thienobenzodiazepine drug, administered for the treatment of schizophrenia and bipolar disorder, with HSA has been studied using spectroscopic methods such as ultraviolet absorbance, fluorescence and FTIR combined with computational procedures. Analyzing of the Stern–Volmer quenching data showed only one primary binding site on HSA with a binding constant of 4.12×10 4 M −1 at 298 K. Thermodynamic analyses showed enthalpy change (ΔH°) and entropy change (ΔS°) were 28.03±3.42 kJ mol −1 and −25.52±11.52 J mol −1 K −1 , respectively. Molecular docking results suggested the hydrophobic residues such as Val 216 , Leu 327 , Ala 350 and polar residues such as Glu 354 play an important role in the drug binding. Decrement in α-helix content of the protein upon OLZ binding was also confirmed by evidences provided by molecular dynamics simulation as well as FTIR spectroscopy. - Highlights: • Leu 327 , Ala 350 as well as hydrophilic residues of HSA play an important role in the binding reaction. • The drug has only one primary binding site on HSA with a binding constant of 4.12×10 4 M −1 at 298 K. • The drug binds near to site I
DEFF Research Database (Denmark)
Pooley, John R.; Flynn, Ben P.; Grøntved, Lars
2017-01-01
linked to structural and organizational roles, an absence of major tethering partners for GRs, and little or no evidence for binding at negative glucocorticoid response elements. A basic helix-loop-helix motif closely resembling a NeuroD1 or Olig2 binding site was found underlying a subset of GR binding......Glucocorticoids regulate hippocampal function in part by modulating gene expression through the glucocorticoid receptor (GR). GR binding is highly cell type specific, directed to accessible chromatin regions established during tissue differentiation. Distinct classes of GR binding sites...
Energy Technology Data Exchange (ETDEWEB)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.
2004-08-06
The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.
Directory of Open Access Journals (Sweden)
Yunpeng Yang
2017-01-01
Full Text Available Catabolite control protein A (CcpA is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR and carbon catabolite activation (CCA, two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt consensus site that is called a catabolite response element (cre within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named crevar, has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA. It was found that the length of the intervening spacer of crevar can affect CcpA binding affinity, and moreover, the core palindromic sequence of crevar is the key structure for regulation. Such a variable architecture of crevar shows potential importance for CcpA’s diverse and fine regulation. A total of 103 potential crevar sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs, and 30 sites were confirmed to be bound by CcpA. These 30 crevar sites are associated with 27 genes involved in many important pathways. Also of significance, the crevar sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria.
LTRs of Endogenous Retroviruses as a Source of Tbx6 Binding Sites.
Yasuhiko, Yukuto; Hirabayashi, Yoko; Ono, Ryuichi
2017-01-01
Retrotransposons are abundant in mammalian genomes and can modulate the gene expression of surrounding genes by disrupting endogenous binding sites for transcription factors (TFs) or providing novel TFs binding sites within retrotransposon sequences. Here, we show that a (C/T)CACACCT sequence motif in ORR1A, ORR1B, ORR1C, and ORR1D, Long Terminal Repeats (LTRs) of MaLR endogenous retrovirus (ERV), is the direct target of Tbx6, an evolutionary conserved family of T-box TFs. Moreover, by comparing gene expression between control mice (Tbx6 +/-) and Tbx6-deficient mice (Tbx6 -/-), we demonstrate that at least four genes, Twist2, Pitx2, Oscp1 , and Nfxl1 , are down-regulated with Tbx6 deficiency. These results suggest that ORR1A, ORR1B, ORR1C and ORR1D may contribute to the evolution of mammalian embryogenesis.
DEFF Research Database (Denmark)
Cockburn, Darrell; Wilkens, Casper; Ruzanski, Christian
2014-01-01
Surface binding sites (SBSs) interact with carbohydrates outside of the enzyme active site. They are frequently situated on catalytic domains and are distinct from carbohydrate binding modules (CBMs). SBSs are found in a variety of enzymes and often seen in crystal structures. Notably about half ...
International Nuclear Information System (INIS)
Krizsan, D.; Varga, E.; Benyhe, S.; Szucs, M.; Borsodi, A.; Hosztafi, S.
1991-01-01
C-6 derivatives-hydrazones, phenylhydrazones, dinitrophenylhydrazones, oximes and semicarbazones - of morphinane-6-ones were synthesized and their binding characteristics were studied on rat brain membranes. The dihydromorphinone and oxymorphone derivatives compete for the ( 3 H)naloxone binding sites with high affinity, while the dihydrocodeinone and oxycodone derivatives are less potent. The affinity of the new compounds is decreased for the delta sites as compared to the parent ligands. The ligands bearing bulky substituents also bind with low affinity to the kappa sites. The modification decreased the Na + -index of compounds indicating their mixed agonist-antagonist character. The dihydromorphinone derivatives are all capable to block irreversibly the high affinity binding site of ( 3 H)naloxone, whereas the dihydrocodeinone derivatives block irreversibly the low affinity site. A possible mechanism for the inhibition is suggested
International Nuclear Information System (INIS)
Savage, D.D.; McNamara, J.O.
1982-01-01
Amygdala-kindled seizures reduced significantly the total number of [ 3 H]quinuclidinyl benzilate binding sites in both dentate and hippocampal gyri compared to electrode implanted unstimulated controls. Both high and low affinity carbachol displaceable binding site populations were significantly reduced in hippocampal gyrus. By contrast, a selective decline of low affinity sites was found in dentate gyrus membranes. The selectivity of the decline in dentate but not hippocampus gyrus underscores the specificity of this molecular response to amygdala-kindled seizures. We suggest that these receptor alterations underlie adaptive mechanisms which antagonize kindled epileptogenesis
International Nuclear Information System (INIS)
Siuciak, J.A.; Krause, D.N.; Dubocovich, M.L.
1991-01-01
The authors have localized and characterized 2-125I-iodomelatonin binding sites in the chicken brain using in vitro quantitative autoradiography. Binding sites were widely distributed throughout the chicken brain, predominantly in regions associated with the visual system. The specific binding of 2-125I-iodomelatonin to discrete chicken brain areas was found to be saturable, reversible, and of high affinity. The specific binding of 2-125I-iodomelatonin (75 pm) was quantitated for 40 identifiable brain regions. Eight brain regions were chosen for binding characterization and pharmacological analysis: optic tectum, Edinger-Westphal nucleus, oculomotor nucleus, nucleus rotundus, ventral supraoptic decussation, ventrolateral geniculate nucleus, neostriatum, and ectostriatum. These regions showed no rostral-caudal gradient in 2-125I-iodomelatonin specific binding, and saturation analysis revealed a single class of high-affinity sites with KD values in the range of 33-48 pM and receptor site density (Bmax) ranging from 31 to 58 fmol/mg protein. Competition experiments carried out with various indoles revealed a similar order of pharmacological affinities in these areas: melatonin greater than 6-chloromelatonin greater than methoxyluzindole greater than N-acetylserotonin greater than luzindole much greater than 5-HT greater than 5-methoxytryptamine. The affinity constants determined by quantitative autoradiography for these compounds to compete for 2-125I-iodomelatonin binding in the optic tectum correlated well with the affinities in chicken brain membranes at 25 degrees C (r = 0.966; slope = 0.845; n = 7) and 0 degree C (r = 0.946; slope = 0.379; n = 7), chicken retinal membranes (r = 0.973; slope = 0.759; n = 7), and the potency or affinity of these compounds to affect the calcium-dependent release of 3H-dopamine from the rabbit retina (r = 0.902; slope = 0.506; n = 6)
Directory of Open Access Journals (Sweden)
Kareem Mohideen-Abdul
2017-06-01
Full Text Available Most nuclear receptors (NRs bind DNA as dimers, either as hetero- or as homodimers on DNA sequences organized as two half-sites with specific orientation and spacing. The dimerization of NRs on their cognate response elements (REs involves specific protein–DNA and protein–protein interactions. The estrogen-related receptor (ERR belongs to the steroid hormone nuclear receptor (SHR family and shares strong similarity in its DNA-binding domain (DBD with that of the estrogen receptor (ER. In vitro, ERR binds with high affinity inverted repeat REs with a 3-bps spacing (IR3, but in vivo, it preferentially binds to single half-site REs extended at the 5′-end by 3 bp [estrogen-related response element (ERREs], thus explaining why ERR was often inferred as a purely monomeric receptor. Since its C-terminal ligand-binding domain is known to homodimerize with a strong dimer interface, we investigated the binding behavior of the isolated DBDs to different REs using electrophoretic migration, multi-angle static laser light scattering (MALLS, non-denaturing mass spectrometry, and nuclear magnetic resonance. In contrast to ER DBD, ERR DBD binds as a monomer to EREs (IR3, such as the tff1 ERE-IR3, but we identified a DNA sequence composed of an extended half-site embedded within an IR3 element (embedded ERRE/IR3, where stable dimer binding is observed. Using a series of chimera and mutant DNA sequences of ERREs and IR3 REs, we have found the key determinants for the binding of ERR DBD as a dimer. Our results suggest that the sequence-directed DNA shape is more important than the exact nucleotide sequence for the binding of ERR DBD to DNA as a dimer. Our work underlines the importance of the shape-driven DNA readout mechanisms based on minor groove recognition and electrostatic potential. These conclusions may apply not only to ERR but also to other members of the SHR family, such as androgen or glucocorticoid, for which a strong well-conserved half-site
Vogensen, Stine B.; Marek, Aleš; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frølund, Bente; Pedersen, Martin H.F.; Clausen, Rasmus P.
2013-01-01
3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screening of 1 against different CNS targets establishes a high selectivity and we demonstrate in vivo brain penetration. In vitro characterization of [3H]-1 binding shows high specificity to the high-affinity GHB binding sites. PMID:24053696
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
Mi, Ran; Hu, Yan-Jun; Fan, Xiao-Yang; Ouyang, Yu; Bai, Ai-Min
2014-01-03
This paper exploring the site-selective binding of jatrorrhizine to human serum albumin (HSA) under physiological conditions (pH=7.4). The investigation was carried out using fluorescence spectroscopy, UV-vis spectroscopy, and molecular modeling. The results of fluorescence quenching and UV-vis absorption spectra experiments indicated the formation of the complex of HSA-jatrorrhizine. Binding parameters calculating from Stern-Volmer method and Scatchard method were calculated at 298, 304 and 310 K, with the corresponding thermodynamic parameters ΔG, ΔH and ΔS as well. Binding parameters calculating from Stern-Volmer method and Scatchard method showed that jatrorrhizine bind to HSA with the binding affinities of the order 10(4) L mol(-1). The thermodynamic parameters studies revealed that the binding was characterized by negative enthalpy and positive entropy changes and the electrostatic interactions play a major role for jatrorrhizine-HSA association. Site marker competitive displacement experiments and molecular modeling calculation demonstrating that jatrorrhizine is mainly located within the hydrophobic pocket of the subdomain IIIA of HSA. Furthermore, the synchronous fluorescence spectra suggested that the association between jatrorrhizine and HSA changed molecular conformation of HSA. Copyright © 2013. Published by Elsevier B.V.
Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E
2017-10-01
Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.
Energy Technology Data Exchange (ETDEWEB)
Bijari, Nooshin [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Shokoohinia, Yalda [Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Ashrafi-Kooshk, Mohammad Reza; Ranjbar, Samira; Parvaneh, Shahram [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Moieni-Arya, Maryam [Student Research Committee, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Khodarahmi, Reza, E-mail: rkhodarahmi@mbrc.ac.ir [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of)
2013-11-15
The studies on the interaction between human serum albumin (HSA) and drugs have been an interesting research field in life science, chemistry and clinical medicine. Osthole possesses a variety of pharmacological activities including anti-tumor, anti-inflammation, anti-seizure, anti-hyperlipidemic and anti-osteoporosis effects. The interaction of osthole with HSA and its binding site in HSA by spectroscopic methods is the subject of this work. By monitoring the intrinsic fluorescence of the single Trp{sub 214} residue and performing site markers displacement measurements, the specific binding of osthole in the vicinity of Sudlow's site I of HSA has been clarified. The changes in the secondary structure of HSA after its complexation with ligand were studied with CD spectroscopy, which indicate that osthole induced only a slight decrease in the helix structural content of the protein. In addition, the mean distance between osthole and HSA fluorophores is estimated to be 4.96 nm using Föster's equation on the basis of the fluorescence energy transfer. Furthermore, the synchronous fluorescence spectra show that the microenvironment of the tryptophan residues does not have obvious changes. Osthole can quench the intrinsic fluorescence of HSA by dynamic quenching, and analysis of the thermodynamic parameters of binding showed that hydrophobic interactions play an important role in the stabilizing of the complex. Increase of protein surface hydrophobicity (PSH) was also observed upon the osthole binding. -- Highlights: • Hydrophobic interactions play an important role in osthole–HSA interaction. • Sudlow's I site is possible binding site of osthole. • Osthole inhibits esterase activity of HSA. • Osthole binding induces no gross protein structural changes.
Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.
2018-01-01
Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412
Binding of MCM-interacting proteins to ATP-binding site in MCM6
Directory of Open Access Journals (Sweden)
Hosoi A
2016-03-01
Full Text Available Atsutoshi Hosoi, Taku Sakairi, Yukio Ishimi Graduate School of Science and Engineering, Ibaraki University, Mito, Ibaraki, Japan Abstract: The function of MCM2–7 complex that is a DNA helicase in DNA replication may be regulated by various MCM-interacting proteins, including CDC45, RPA, TIM, TIPIN, Claspin, MCM10, and MCM-BP. It has been shown by immunoprecipitation that human MCM6 interacts with all these proteins in coexpressed insect cells. To determine the region in MCM6 to interact with these proteins, we prepared various truncated forms of MCM6 and examined the interaction of these MCM6 fragments with the MCM-interacting proteins. All these proteins bound to C-terminal half of MCM6, and CDC45, RPA2, TIM, TIPIN, MCM-BP, and MCM10 bound to the fragments containing ATP-binding motifs. CDC45 and RPA2 bound to the smallest fragment containing Walker motif A. Only MCM-BP is bound to the N-terminal half of MCM6. Site-directed mutagenesis study suggests that hydrophobic interaction is involved in the interaction of MCM6 with CDC45 and TIM. These results suggest a possibility that MCM-interacting proteins regulate MCM2–7 function by modulating the ATP-binding ability of the MCM2–7. Keywords: DNA helicase, DNA replication, checkpoint, MCM2–7 proteins
Common structural features of cholesterol binding sites in crystallized soluble proteins.
Bukiya, Anna N; Dopico, Alejandro M
2017-06-01
Cholesterol-protein interactions are essential for the architectural organization of cell membranes and for lipid metabolism. While cholesterol-sensing motifs in transmembrane proteins have been identified, little is known about cholesterol recognition by soluble proteins. We reviewed the structural characteristics of binding sites for cholesterol and cholesterol sulfate from crystallographic structures available in the Protein Data Bank. This analysis unveiled key features of cholesterol-binding sites that are present in either all or the majority of sites: i ) the cholesterol molecule is generally positioned between protein domains that have an organized secondary structure; ii ) the cholesterol hydroxyl/sulfo group is often partnered by Asn, Gln, and/or Tyr, while the hydrophobic part of cholesterol interacts with Leu, Ile, Val, and/or Phe; iii ) cholesterol hydrogen-bonding partners are often found on α-helices, while amino acids that interact with cholesterol's hydrophobic core have a slight preference for β-strands and secondary structure-lacking protein areas; iv ) the steroid's C21 and C26 constitute the "hot spots" most often seen for steroid-protein hydrophobic interactions; v ) common "cold spots" are C8-C10, C13, and C17, at which contacts with the proteins were not detected. Several common features we identified for soluble protein-steroid interaction appear evolutionarily conserved. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Energy Technology Data Exchange (ETDEWEB)
Shahlaei, Mohsen, E-mail: mohsenshahlaei@yahoo.com [Nano drug delivery research Center, Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Department of Medicinal Chemistry, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Rahimi, Behnoosh [Department of Medicinal Chemistry, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Student research committee, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Ashrafi-Kooshk, Mohammad Reza [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Sadrjavadi, Komail [Department of Medicinal Chemistry, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Khodarahmi, Reza, E-mail: rkhodarahmi@mbrc.ac.ir [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of)
2015-02-15
Human serum albumin (HSA)-drug binding affinity is one of the major factors that determine the pharmacokinetics, halftime and bioavailability of drugs in various tissues. In the present study, the interaction of olanzapine (OLZ), a thienobenzodiazepine drug, administered for the treatment of schizophrenia and bipolar disorder, with HSA has been studied using spectroscopic methods such as ultraviolet absorbance, fluorescence and FTIR combined with computational procedures. Analyzing of the Stern–Volmer quenching data showed only one primary binding site on HSA with a binding constant of 4.12×10{sup 4} M{sup −1} at 298 K. Thermodynamic analyses showed enthalpy change (ΔH°) and entropy change (ΔS°) were 28.03±3.42 kJ mol{sup −1} and −25.52±11.52 J mol{sup −1} K{sup −1}, respectively. Molecular docking results suggested the hydrophobic residues such as Val{sub 216}, Leu{sub 327}, Ala{sub 350} and polar residues such as Glu{sub 354} play an important role in the drug binding. Decrement in α-helix content of the protein upon OLZ binding was also confirmed by evidences provided by molecular dynamics simulation as well as FTIR spectroscopy. - Highlights: • Leu{sub 327}, Ala{sub 350} as well as hydrophilic residues of HSA play an important role in the binding reaction. • The drug has only one primary binding site on HSA with a binding constant of 4.12×10{sup 4} M{sup −1} at 298 K. • The drug binds near to site I.
Sugihara, J; Imamura, T; Nagafuchi, S; Bonaventura, J; Bonaventura, C; Cashon, R
1985-01-01
We encountered an abnormal hemoglobin (Rahere), with a threonine residue replacing the beta 82 (EF6) lysine residue at the binding site of 2,3-diphosphoglycerate, which was responsible for overt erythrocytosis in two individuals of a Japanese family. Hemoglobin Rahere shows a lower oxygen affinity on the binding of 2,3-diphosphoglycerate or chloride ions than hemoglobin A. Although a decrease in the positive charge density at the binding sites of 2,3-diphosphoglycerate in hemoglobin Rahere ap...
Effects of cytosine methylation on transcription factor binding sites
Medvedeva, Yulia A
2014-03-26
Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.
DEFF Research Database (Denmark)
Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J
1988-01-01
Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...
Energy Technology Data Exchange (ETDEWEB)
Dessi, F; Represa, A; Ben-Ari, Y [Institut National de la Sante et de la Recherche Medicale (INSERM), 75 - Paris (France)
1991-01-01
In the rat, neonatal irradiation produces a destruction of denate granule cells and prevents the development of the mossy fibre-CA3 pyramidal cell synapse. The developmental increase of high affinity kainate binding sites in the stratum lucidum was reduced on the irradiated side as compared with the control side. This suggests that a proportion of high affinity kainate binding sites is associated with mossy fibres. In contrast, the development profile of N-methyl-D-aspartate binding sites, which are associated with associational and commissural synapses in CA3, was not affected by irradiation. The role that afferent fibres may play in the development of pyramidal cells is discussed in connection with the modulatory effects of glutamate receptors on the development of neurons. (author).
Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M
2000-04-01
Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding.
Global identification of hnRNP A1 binding sites for SSO-based splicing modulation
DEFF Research Database (Denmark)
Bruun, Gitte H; Doktor, Thomas K; Borch-Jensen, Jonas
2016-01-01
for this deregulation by blocking other SREs with splice-switching oligonucleotides (SSOs). However, the location and sequence of most SREs are not well known. RESULTS: Here, we used individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) to establish an in vivo binding map for the key splicing...... regulatory factor hnRNP A1 and to generate an hnRNP A1 consensus binding motif. We find that hnRNP A1 binding in proximal introns may be important for repressing exons. We show that inclusion of the alternative cassette exon 3 in SKA2 can be significantly increased by SSO-based treatment which blocks an i...... downstream of the 5' splice site can be blocked by SSOs to activate the exon. CONCLUSIONS: The hnRNP A1 binding map can be used to identify potential targets for SSO-based therapy. Moreover, together with the hnRNP A1 consensus binding motif, the binding map may be used to predict whether disease...
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Energy Technology Data Exchange (ETDEWEB)
B Akabayov; C Richardson
2011-12-31
Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstrate that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.
Okuwaki, Mitsuru; Abe, Mayumi; Hisaoka, Miharu; Nagata, Kyosuke
2016-11-01
Linker histones play important roles in the genomic organization of mammalian cells. Of the linker histone variants, H1.X shows the most dynamic behavior in the nucleus. Recent research has suggested that the linker histone variants H1.X and H1.0 have different chromosomal binding site preferences. However, it remains unclear how the dynamics and binding site preferences of linker histones are determined. Here, we biochemically demonstrated that the DNA/nucleosome and histone chaperone binding activities of H1.X are significantly lower than those of other linker histones. This explains why H1.X moves more rapidly than other linker histones in vivo Domain swapping between H1.0 and H1.X suggests that the globular domain (GD) and C-terminal domain (CTD) of H1.X independently contribute to the dynamic behavior of H1.X. Our results also suggest that the N-terminal domain (NTD), GD, and CTD cooperatively determine the preferential binding sites, and the contribution of each domain for this determination is different depending on the target genes. We also found that linker histones accumulate in the nucleoli when the nucleosome binding activities of the GDs are weak. Our results contribute to understanding the molecular mechanisms of dynamic behaviors, binding site selection, and localization of linker histones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
International Nuclear Information System (INIS)
Morrow, A.L.; Norman, A.B.; Battaglia, G.; Loy, R.; Creese, I.
1985-01-01
Lesions of the serotonergic afferents to the hippocampus, by fimbrial transection or by 5,7-dihydroxytryptamine treatment, produce an increase in the Bmax of ( 3 H)WB4101 to its nanomolar affinity binding site, with no effect on its picomolar affinity binding site or on ( 3 H)prazosin binding. The nanomolar site is serotonergic as the serotonergic agonists, serotonin and 8-hydroxy-dipropylaminotetraline (8-OH-DPAT) have nanomolar affinity for ( 3 H)WB4101 binding when studied in the presence of a prazosin mask (30nM) of the alpha-1 component of ( 3 H)WB4101 binding. The serotonin receptor antagonists metergoline, lysergic acid diethylamide and lisuride also have high nanomolar affinities while ketanserin, yohimbine, prazosin and noradrenergic agonists have affinities in the micromolar range. Fimbrial transection or 5,7-dihydroxytryptamine injections produced 32% and 44% increases in the Bmax of ( 3 H)WB4101 binding in the presence of a prazosin mask. Serotonin competition for ( 3 H)WB4101 binding was identical in control and experimental tissues from each lesion experiment. Although specific binding of ( 3 H)WB4101 was increased, there was no change in the affinities or the percentages of the two binding components for serotonin competition with ( 3 H)WB4101. These data suggest that removal of the serotonergic input to the hippocampus produces an increase in the Bmax of serotonin receptor binding sites labeled by ( 3 H)WB4101. 33 references, 3 figures, 3 tables
Crystal structure and DNA binding of the homeodomain of the stem cell transcription factor Nanog.
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C; Kolatkar, Prasanna R
2008-02-22
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
Crystal Structure and DNA Binding of the Homeodomain of the Stem Cell Transcription Factor Nanog
Energy Technology Data Exchange (ETDEWEB)
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C.; Kolatkar, Prasanna R. (GI-Singapore); (Scripps)
2010-02-08
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
Multiple ETS family proteins regulate PF4 gene expression by binding to the same ETS binding site.
Directory of Open Access Journals (Sweden)
Yoshiaki Okada
Full Text Available In previous studies on the mechanism underlying megakaryocyte-specific gene expression, several ETS motifs were found in each megakaryocyte-specific gene promoter. Although these studies suggested that several ETS family proteins regulate megakaryocyte-specific gene expression, only a few ETS family proteins have been identified. Platelet factor 4 (PF4 is a megakaryocyte-specific gene and its promoter includes multiple ETS motifs. We had previously shown that ETS-1 binds to an ETS motif in the PF4 promoter. However, the functions of the other ETS motifs are still unclear. The goal of this study was to investigate a novel functional ETS motif in the PF4 promoter and identify proteins binding to the motif. In electrophoretic mobility shift assays and a chromatin immunoprecipitation assay, FLI-1, ELF-1, and GABP bound to the -51 ETS site. Expression of FLI-1, ELF-1, and GABP activated the PF4 promoter in HepG2 cells. Mutation of a -51 ETS site attenuated FLI-1-, ELF-1-, and GABP-mediated transactivation of the promoter. siRNA analysis demonstrated that FLI-1, ELF-1, and GABP regulate PF4 gene expression in HEL cells. Among these three proteins, only FLI-1 synergistically activated the promoter with GATA-1. In addition, only FLI-1 expression was increased during megakaryocytic differentiation. Finally, the importance of the -51 ETS site for the activation of the PF4 promoter during physiological megakaryocytic differentiation was confirmed by a novel reporter gene assay using in vitro ES cell differentiation system. Together, these data suggest that FLI-1, ELF-1, and GABP regulate PF4 gene expression through the -51 ETS site in megakaryocytes and implicate the differentiation stage-specific regulation of PF4 gene expression by multiple ETS factors.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...
Directory of Open Access Journals (Sweden)
Victor S. Blancato
2016-02-01
Full Text Available The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC, indicated that CitO has a high affinity for citrate (KD= 1.2±0.2 µM, while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation.
International Nuclear Information System (INIS)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M.
1989-01-01
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of 125 I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity
Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.
2011-01-01
Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...
pMD-Membrane: A Method for Ligand Binding Site Identification in Membrane-Bound Proteins.
Directory of Open Access Journals (Sweden)
Priyanka Prakash
2015-10-01
Full Text Available Probe-based or mixed solvent molecular dynamics simulation is a useful approach for the identification and characterization of druggable sites in drug targets. However, thus far the method has been applied only to soluble proteins. A major reason for this is the potential effect of the probe molecules on membrane structure. We have developed a technique to overcome this limitation that entails modification of force field parameters to reduce a few pairwise non-bonded interactions between selected atoms of the probe molecules and bilayer lipids. We used the resulting technique, termed pMD-membrane, to identify allosteric ligand binding sites on the G12D and G13D oncogenic mutants of the K-Ras protein bound to a negatively charged lipid bilayer. In addition, we show that differences in probe occupancy can be used to quantify changes in the accessibility of druggable sites due to conformational changes induced by membrane binding or mutation.
Molecular modeling studies of novel retro-binding tripeptide active-site inhibitors of thrombin.
Lau, W F; Tabernero, L; Sack, J S; Iwanowicz, E J
1995-08-01
A novel series of retro-binding tripeptide thrombin active-site inhibitors was recently developed (Iwanowicz, E. I. et al. J. Med. Chem. 1994, 37, 2111(1)). It was hypothesized that the binding mode for these inhibitors is similar to that of the first three N-terminal residues of hirudin. This binding hypothesis was subsequently verified when the crystal structure of a member of this series, BMS-183,507 (N-[N-[N-[4-(Aminoiminomethyl)amino[-1-oxobutyl]-L- phenylalanyl]-L-allo-threonyl]-L-phenylalanine, methyl ester), was determined (Taberno, L.J. Mol. Biol. 1995, 246, 14). The methodology for developing the binding models of these inhibitors, the structure-activity relationships (SAR) and modeling studies that led to the elucidation of the proposed binding mode is described. The crystal structure of BMS-183,507/human alpha-thrombin is compared with the crystal structure of hirudin/human alpha-thrombin (Rydel, T.J. et al. Science 1990, 249,227; Rydel, T.J. et al. J. Mol Biol. 1991, 221, 583; Grutter, M.G. et al. EMBO J. 1990, 9, 2361) and with the computational binding model of BMS-183,507.
International Nuclear Information System (INIS)
Liu, Zhongchuan; Xie, Tian; Zhong, Qiuping; Wang, Ganggang
2016-01-01
The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature of CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhongchuan; Xie, Tian [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China); Zhong, Qiuping [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China); University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of (China); Wang, Ganggang, E-mail: wanggg@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China)
2016-03-24
The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature of CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.
Bao, Haibo; Liu, Yang; Zhang, Yixi; Liu, Zewen
2017-08-01
Due to great diversity of nicotinic acetylcholine receptor (nAChR) subtypes in insects, one β subunit may be contained in numerous nAChR subtypes. In the locust Locusta migratoria, a model insect species with agricultural importance, the third β subunits (Locβ3) was identified in this study, which reveals at least three β subunits in this insect species. Imidacloprid was found to bind nAChRs in L. migratoria central nervous system at two sites with different affinities, with K d values of 0.16 and 10.31nM. The specific antisera (L1-1, L2-1 and L3-1) were raised against fusion proteins at the large cytoplasmic loop of Locβ1, Locβ2 and Locβ3 respectively. Specific immunodepletion of Locβ1 with antiserum L1-1 resulted in the selective loss of the low affinity binding site for imidacloprid, whereas the immunodepletion of Locβ3 with L3-1 caused the selective loss of the high affinity site. Dual immunodepletion with L1-1 and L3-1 could completely abolish imidacloprid binding. In contrast, the immunodepletion of Locβ2 had no significant effect on the specific [ 3 H]imidacloprid binding. Taken together, these data indicated that Locβ1 and Locβ3 were respectively contained in the low- and high-affinity binding sites for imidacloprid in L. migratoria, which is different to the previous finding in Nilaparvata lugens that Nlβ1 was in two binding sites for imidacloprid. The involvement of two β subunits separately in two binding sites may decrease the risk of imidacloprid resistance due to putative point mutations in β subunits in L. migratoria. Copyright © 2017 Elsevier B.V. All rights reserved.
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
DEFF Research Database (Denmark)
Long, Katherine S.; Vester, Birte
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...
Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.
2017-09-06
Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the
Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.
Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F
2005-11-01
Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-09-08
Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.
Ceruloplasmin revisited: structural and functional roles of various metal cation-binding sites
International Nuclear Information System (INIS)
Bento, Isabel; Peixoto, Cristina; Zaitsev, Vjacheslav N.; Lindley, Peter F.
2007-01-01
The three-dimensional molecular structure of human serum ceruloplasmin has been reinvestigated using X-ray synchrotron data collected at 100 K from a crystal frozen to liquid-nitrogen temperature. The three-dimensional molecular structure of human serum ceruloplasmin has been reinvestigated using X-ray synchrotron data collected at 100 K from a crystal frozen to liquid-nitrogen temperature. The resulting model, with an increase in resolution from 3.1 to 2.8 Å, gives an overall improvement of the molecular structure, in particular the side chains. In addition, it enables the clear definition of previously unidentified Ca 2+ -binding and Na + -binding sites. The Ca 2+ cation is located in domain 1 in a configuration very similar to that found in the activated bovine factor Va. The Na + sites appear to play a structural role in providing rigidity to the three protuberances on the top surface of the molecule. These features probably help to steer substrates towards the mononuclear copper sites prior to their oxidation and to restrict the size of the approaching substrate. The trinuclear copper centre appears to differ from the room-temperature structure in that a dioxygen moiety is bound in a similar way to that found in the endospore coat protein CotA from Bacillus subtilis
Energy Technology Data Exchange (ETDEWEB)
Savage, D.D.; McNamara, J.O.
1982-09-01
Amygdala-kindled seizures reduced significantly the total number of (/sup 3/H)quinuclidinyl benzilate binding sites in both dentate and hippocampal gyri compared to electrode implanted unstimulated controls. Both high and low affinity carbachol displaceable binding site populations were significantly reduced in hippocampal gyrus. By contrast, a selective decline of low affinity sites was found in dentate gyrus membranes. The selectivity of the decline in dentate but not hippocampus gyrus underscores the specificity of this molecular response to amygdala-kindled seizures. We suggest that these receptor alterations underlie adaptive mechanisms which antagonize kindled epileptogenesis.
Directory of Open Access Journals (Sweden)
Kinyui Alice Lo
Full Text Available The growing epidemic of obesity and metabolic diseases calls for a better understanding of adipocyte biology. The regulation of transcription in adipocytes is particularly important, as it is a target for several therapeutic approaches. Transcriptional outcomes are influenced by both histone modifications and transcription factor binding. Although the epigenetic states and binding sites of several important transcription factors have been profiled in the mouse 3T3-L1 cell line, such data are lacking in human adipocytes. In this study, we identified H3K56 acetylation sites in human adipocytes derived from mesenchymal stem cells. H3K56 is acetylated by CBP and p300, and deacetylated by SIRT1, all are proteins with important roles in diabetes and insulin signaling. We found that while almost half of the genome shows signs of H3K56 acetylation, the highest level of H3K56 acetylation is associated with transcription factors and proteins in the adipokine signaling and Type II Diabetes pathways. In order to discover the transcription factors that recruit acetyltransferases and deacetylases to sites of H3K56 acetylation, we analyzed DNA sequences near H3K56 acetylated regions and found that the E2F recognition sequence was enriched. Using chromatin immunoprecipitation followed by high-throughput sequencing, we confirmed that genes bound by E2F4, as well as those by HSF-1 and C/EBPα, have higher than expected levels of H3K56 acetylation, and that the transcription factor binding sites and acetylation sites are often adjacent but rarely overlap. We also discovered a significant difference between bound targets of C/EBPα in 3T3-L1 and human adipocytes, highlighting the need to construct species-specific epigenetic and transcription factor binding site maps. This is the first genome-wide profile of H3K56 acetylation, E2F4, C/EBPα and HSF-1 binding in human adipocytes, and will serve as an important resource for better understanding adipocyte
Directory of Open Access Journals (Sweden)
Cheng Zheng
Full Text Available Zinc-binding proteins are the most abundant metalloproteins in the Protein Data Bank where the zinc ions usually have catalytic, regulatory or structural roles critical for the function of the protein. Accurate prediction of zinc-binding sites is not only useful for the inference of protein function but also important for the prediction of 3D structure. Here, we present a new integrative framework that combines multiple sequence and structural properties and graph-theoretic network features, followed by an efficient feature selection to improve prediction of zinc-binding sites. We investigate what information can be retrieved from the sequence, structure and network levels that is relevant to zinc-binding site prediction. We perform a two-step feature selection using random forest to remove redundant features and quantify the relative importance of the retrieved features. Benchmarking on a high-quality structural dataset containing 1,103 protein chains and 484 zinc-binding residues, our method achieved >80% recall at a precision of 75% for the zinc-binding residues Cys, His, Glu and Asp on 5-fold cross-validation tests, which is a 10%-28% higher recall at the 75% equal precision compared to SitePredict and zincfinder at residue level using the same dataset. The independent test also indicates that our method has achieved recall of 0.790 and 0.759 at residue and protein levels, respectively, which is a performance better than the other two methods. Moreover, AUC (the Area Under the Curve and AURPC (the Area Under the Recall-Precision Curve by our method are also respectively better than those of the other two methods. Our method can not only be applied to large-scale identification of zinc-binding sites when structural information of the target is available, but also give valuable insights into important features arising from different levels that collectively characterize the zinc-binding sites. The scripts and datasets are available at http://protein.cau.edu.cn/zincidentifier/.
International Nuclear Information System (INIS)
Awad, M.; Gavish, M.
1988-01-01
The present study demonstrates a differential effect of various detergent treatments on [ 3 H]Ro 5-4864 and [ 3 H]PK 11195 binding to peripheral benzodiazepine binding sites (PBS). Triton X-100 caused a decrease of about 70% in [ 3 H]Ro 5-4864 binding to membranes from various peripheral tissues of rat, but had only a negligible effect on [ 3 H]PK 11195 binding. A similar effect of Triton X-100 was observed on guinea pig and rabbit kidney membranes. The decrease in [ 3 H]Ro 5-4864 binding after treatment with Triton X-100 was apparently due to a decrease in the density of PBS, since the affinity remained unaltered. The detergents 3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate (CHAPS), Tween 20, deoxycholic acid, or digitonin (0.0125%) caused only a minor change in [ 3 H]Ro 5-4864 and [ 3 H]PK 11195 binding to rat kidney membranes; but when concentrations were substantially increased (0.1%), all detergents caused a decrease of at least 50% in [ 3 H]Ro 5-4864 binding, while [ 3 H]PK 11195 binding to rat kidney membranes remained unaffected by the first three detergents, with only a minor decrease (15%) after treatment with digitonin
Jian, Jhih-Wei; Elumalai, Pavadai; Pitti, Thejkiran; Wu, Chih Yuan; Tsai, Keng-Chang; Chang, Jeng-Yih; Peng, Hung-Pin; Yang, An-Suei
2016-01-01
Predicting ligand binding sites (LBSs) on protein structures, which are obtained either from experimental or computational methods, is a useful first step in functional annotation or structure-based drug design for the protein structures. In this work, the structure-based machine learning algorithm ISMBLab-LIG was developed to predict LBSs on protein surfaces with input attributes derived from the three-dimensional probability density maps of interacting atoms, which were reconstructed on the query protein surfaces and were relatively insensitive to local conformational variations of the tentative ligand binding sites. The prediction accuracy of the ISMBLab-LIG predictors is comparable to that of the best LBS predictors benchmarked on several well-established testing datasets. More importantly, the ISMBLab-LIG algorithm has substantial tolerance to the prediction uncertainties of computationally derived protein structure models. As such, the method is particularly useful for predicting LBSs not only on experimental protein structures without known LBS templates in the database but also on computationally predicted model protein structures with structural uncertainties in the tentative ligand binding sites. PMID:27513851
Energy Technology Data Exchange (ETDEWEB)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish; (UAB)
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips to the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate
Directory of Open Access Journals (Sweden)
Chattopadhyay Debasish
2009-02-01
Full Text Available Abstract Background The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips to the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. Results We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2Å resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Occupancy classification of position weight matrix-inferred transcription factor binding sites.
Directory of Open Access Journals (Sweden)
Hollis Wright
Full Text Available BACKGROUND: Computational prediction of Transcription Factor Binding Sites (TFBS from sequence data alone is difficult and error-prone. Machine learning techniques utilizing additional environmental information about a predicted binding site (such as distances from the site to particular chromatin features to determine its occupancy/functionality class show promise as methods to achieve more accurate prediction of true TFBS in silico. We evaluate the Bayesian Network (BN and Support Vector Machine (SVM machine learning techniques on four distinct TFBS data sets and analyze their performance. We describe the features that are most useful for classification and contrast and compare these feature sets between the factors. RESULTS: Our results demonstrate good performance of classifiers both on TFBS for transcription factors used for initial training and for TFBS for other factors in cross-classification experiments. We find that distances to chromatin modifications (specifically, histone modification islands as well as distances between such modifications to be effective predictors of TFBS occupancy, though the impact of individual predictors is largely TF specific. In our experiments, Bayesian network classifiers outperform SVM classifiers. CONCLUSIONS: Our results demonstrate good performance of machine learning techniques on the problem of occupancy classification, and demonstrate that effective classification can be achieved using distances to chromatin features. We additionally demonstrate that cross-classification of TFBS is possible, suggesting the possibility of constructing a generalizable occupancy classifier capable of handling TFBS for many different transcription factors.
Selectivity of the surface binding site (SBS) on barley starch synthase I
DEFF Research Database (Denmark)
Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica
2014-01-01
Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...
Douglas, Max E.
2016-01-01
Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337
Douglas, Max E; Diffley, John F X
2016-03-11
Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Battisti, W.P.; Artymyshyn, R.P.; Murray, M.
1989-01-01
The plasticity of the beta 1- and beta 2-adrenergic receptor subtypes was examined in the interpeduncular nucleus (IPN) of the adult rat. The beta-adrenergic receptor antagonist 125I-pindolol (125I-PIN) was used in conjunction with the selective subtype antagonists ICI 118,551 and ICI 89,406 to determine the subnuclear distribution of beta 1- and beta 2-adrenergic receptors in this nucleus and to correlate the receptor distribution with the distribution of both noradrenergic afferents from the locus coeruleus (LC) and non-noradrenergic afferents from the fasiculus retroflexus (FR). The density of these binding sites was examined following lesions that decreased (LC lesions) or increased (FR lesions) the density of the noradrenergic projection in the IPN. Quantitative radioautography indicated that beta 1-labeled binding sites account for the larger percentage of binding sites in the IPN. The beta 1-binding sites are densest in those subnuclei that receive a noradrenergic projection from the LC: the central, rostral, and intermediate subnuclei. beta 1-binding sites are algo homogeneously distributed throughout the lateral subnuclei, where there is no detectable noradrenergic innervation. beta 2-binding sites have a more restricted distribution. They are concentrated in the ventral half of the lateral subnuclei, where they account for 70% of total 125I-PIN binding sites. beta 2-binding sites are also present along the ventral border of the IPN. Some of this labeling extends into the central and intermediate subnuclei. Bilateral lesions of the LC, which selectively remove noradrenergic innervation to the IPN, result in an increase in the beta 1-binding sites. Bilateral lesions of the FR, which remove the major cholinergic and peptidergic input from the IPN, elicit an increase in noradrenergic projections and a decrease in beta 1-binding sites
The fitness landscapes of cis-acting binding sites in different promoter and environmental contexts.
Directory of Open Access Journals (Sweden)
Ryan K Shultzaberger
2010-07-01
Full Text Available The biophysical nature of the interaction between a transcription factor and its target sequences in vitro is sufficiently well understood to allow for the effects of DNA sequence alterations on affinity to be predicted. But even in relatively simple in vivo systems, the complexities of promoter organization and activity have made it difficult to predict how altering specific interactions between a transcription factor and DNA will affect promoter output. To better understand this, we measured the relative fitness of nearly all Escherichia coli sigma(70 -35 binding sites in different promoter and environmental contexts by competing four randomized -35 promoter libraries controlling the expression of the tetracycline resistance gene (tetagainst each other in increasing concentrations of drug. We sequenced populations after competition to determine the relative enrichment of each -35 sequence. We observed a consistent relationship between the frequency of recovery of each -35 binding site and its predicted affinity for sigma(70 that varied depending on the sequence context of the promoter and drug concentration. Overall the relative fitness of each promoter could be predicted by a simple thermodynamic model of transcriptional regulation, in which the rate of transcriptional initiation (and hence fitness is dependent upon the overall stability of the initiation complex, which in turn is dependent upon the energetic contributions of all sites within the complex. As implied by this model, a decrease in the free energy of association at one site could be compensated for by an increase in the binding energy at another to produce a similar output. Furthermore, these data show that a large and continuous range of transcriptional outputs can be accessed by merely changing the -35, suggesting that evolved or engineered mutations at this site could allow for subtle and precise control over gene expression.
Functional impact of HIV coreceptor-binding site mutations
International Nuclear Information System (INIS)
Biscone, Mark J.; Miamidian, John L.; Muchiri, John M.; Baik, Sarah S.W.; Lee, Fang-Hua; Doms, Robert W.; Reeves, Jacqueline D.
2006-01-01
The bridging sheet region of the gp120 subunit of the HIV-1 Env protein interacts with the major virus coreceptors, CCR5 and CXCR4. We examined the impact of mutations in and adjacent to the bridging sheet region of an X4 tropic HIV-1 on membrane fusion and entry inhibitor susceptibility. When the V3-loop of this Env was changed so that CCR5 was used, the effects of these same mutations on CCR5 use were assayed as well. We found that coreceptor-binding site mutations had greater effects on CXCR4-mediated fusion and infection than when CCR5 was used as a coreceptor, perhaps related to differences in coreceptor affinity. The mutations also reduced use of the alternative coreceptors CCR3 and CCR8 to varying degrees, indicating that the bridging sheet region is important for the efficient utilization of both major and minor HIV coreceptors. As seen before with a primary R5 virus strain, bridging sheet mutations increased susceptibility to the CCR5 inhibitor TAK-779, which correlated with CCR5 binding efficiency. Bridging sheet mutations also conferred increased susceptibility to the CXCR4 ligand AMD-3100 in the context of the X4 tropic Env. However, these mutations had little effect on the rate of membrane fusion and little effect on susceptibility to enfuvirtide, a membrane fusion inhibitor whose activity is dependent in part on the rate of Env-mediated membrane fusion. Thus, mutations that reduce coreceptor binding and enhance susceptibility to coreceptor inhibitors can affect fusion and enfuvirtide susceptibility in an Env context-dependent manner
Energy Technology Data Exchange (ETDEWEB)
Gutkind, J.S.; Kurihara, M.; Castren, E.; Saavedra, J.M.
1988-09-01
Quantitative autoradiographic methods were utilized to characterize specific, high-affinity vasoactive intestinal peptide binding sites (Kd = 310 +/- 60 pmol/L; Bmax = 93 +/- 11 fmol/mg protein) in frozen sections obtained from a mononuclear cell pellet derived from 20 ml of human blood. The method is at least one order of magnitude more sensitive than conventional membrane binding techniques, and it has the potential for wide applications in studies of neuropeptide, biogenic amine, and drug binding in clinical samples.
International Nuclear Information System (INIS)
Gutkind, J.S.; Kurihara, M.; Castren, E.; Saavedra, J.M.
1988-01-01
Quantitative autoradiographic methods were utilized to characterize specific, high-affinity vasoactive intestinal peptide binding sites (Kd = 310 +/- 60 pmol/L; Bmax = 93 +/- 11 fmol/mg protein) in frozen sections obtained from a mononuclear cell pellet derived from 20 ml of human blood. The method is at least one order of magnitude more sensitive than conventional membrane binding techniques, and it has the potential for wide applications in studies of neuropeptide, biogenic amine, and drug binding in clinical samples
International Nuclear Information System (INIS)
Ronjat, M.; Lacapere, J.J.; Dufour, J.P.; Dupont, Y.
1987-01-01
The plasma membrane of yeasts contains an H+-ATPase similar to the other cation transport ATPases of eukaryotic organisms. This enzyme has been purified and shows H+ transport in reconstituted vesicles. In the presence of Mg2+, formycin triphosphate (FTP) is hydrolyzed by the H+-ATPase and supports H+ transport. When combined with terbium ion, FTP (Tb-FTP) and ATP (Tb-ATP) are no longer hydrolyzed. Competition between Mg-ATP and Tb-FTP for ATP hydrolysis indicates that terbium-associated nucleotides bind to the catalytic site of the H+-ATPase. The fluorescent properties of the Tb-FTP complex were used to study the active site of the H+-ATPase. Fluorescence of Tb-FTP is greatly enhanced upon binding into the nucleotide site of H+-ATPase with a dissociation constant of 1 microM. Tb-ATP, Tb-ADP, and Tb-ITP are competitive inhibitors of Tb-FTP binding with Ki = 4.5, 5.0, and 6.0 microM, respectively. Binding of Tb-FTP is observed only in the presence of an excess of Tb3+ with an activation constant Ka = 25 microM for Tb3+. Analysis of the data reveals that the sites for Tb-FTP and Tb3+ binding are independent entities. In standard conditions these sites would be occupied by Mg-ATP and Mg2+, respectively. These findings suggest an important regulatory role of divalent cations on the activity of H+-ATPase. Replacement of H 2 O by D 2 O in the medium suggests the existence of two types of nucleotide binding sites differing by the hydration state of the Tb3+ ion in the bound Tb-FTP complex
International Nuclear Information System (INIS)
Akiyama, K.; Sato, M.; Otsuki, S.
1982-01-01
The specific 3 H-spiperone binding to membrane homogenates of the striatum, mesolimbic area, and frontal cortex was examined in two groups of rats pretreated once daily with saline or 4 mg/kg of methamphetamine (MAP) for 14 days. At 7 days following cessation of chronic pretreatment, all rats received an injection of 4 mg/kg of MAP and were decapitated 1 hr after the injection. In the chronic saline-pretreatment group, the single administration of MAP induced significant changes in the number (Bmax) of specific 3 H-spiperone binding sites (a decrease in the striatum and an increase in the mesolimbic area and frontal cortex), but no significant changes in the affinity (KD) in any brain area. The chronic MAP pretreatment markedly augmented the changes in Bmax in the striatum and mesolimbic area. The increase in specific 3 H-spiperone binding sites in the mesolimbic area is discussed in relation to MAP-induced behavioral hypersensitivity
Directory of Open Access Journals (Sweden)
Mattias N E Forsell
2008-10-01
Full Text Available The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3. Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4 rabbits with envelope glycoprotein (Env trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.
Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T
2008-10-03
The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.
Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.
2015-01-01
SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000
Galloux, Marie; Tarus, Bogdan; Blazevic, Ilfad; Fix, Jenna; Duquerroy, Stéphane; Eléouët, Jean-François
2012-08-01
The human respiratory syncytial virus (HRSV) genome is composed of a negative-sense single-stranded RNA that is tightly associated with the nucleoprotein (N). This ribonucleoprotein (RNP) complex is the template for replication and transcription by the viral RNA-dependent RNA polymerase. RNP recognition by the viral polymerase involves a specific interaction between the C-terminal domain of the phosphoprotein (P) (P(CTD)) and N. However, the P binding region on N remains to be identified. In this study, glutathione S-transferase (GST) pulldown assays were used to identify the N-terminal core domain of HRSV N (N(NTD)) as a P binding domain. A biochemical characterization of the P(CTD) and molecular modeling of the N(NTD) allowed us to define four potential candidate pockets on N (pocket I [PI] to PIV) as hydrophobic sites surrounded by positively charged regions, which could constitute sites complementary to the P(CTD) interaction domain. The role of selected amino acids in the recognition of the N-RNA complex by P was first screened for by site-directed mutagenesis using a polymerase activity assay, based on an HRSV minigenome containing a luciferase reporter gene. When changed to Ala, most of the residues of PI were found to be critical for viral RNA synthesis, with the R132A mutant having the strongest effect. These mutations also reduced or abolished in vitro and in vivo P-N interactions, as determined by GST pulldown and immunoprecipitation experiments. The pocket formed by these residues is critical for P binding to the N-RNA complex, is specific for pneumovirus N proteins, and is clearly distinct from the P binding sites identified so far for other nonsegmented negative-strand viruses.
Kaiso Directs the Transcriptional Corepressor MTG16 to the Kaiso Binding Site in Target Promoters
Barrett, Caitlyn W.; Smith, J. Joshua; Lu, Lauren C.; Markham, Nicholas; Stengel, Kristy R.; Short, Sarah P.; Zhang, Baolin; Hunt, Aubrey A.; Fingleton, Barbara M.; Carnahan, Robert H.; Engel, Michael E.; Chen, Xi; Beauchamp, R. Daniel; Wilson, Keith T.; Hiebert, Scott W.; Reynolds, Albert B.; Williams, Christopher S.
2012-01-01
Myeloid translocation genes (MTGs) are transcriptional corepressors originally identified in acute myelogenous leukemia that have recently been linked to epithelial malignancy with non-synonymous mutations identified in both MTG8 and MTG16 in colon, breast, and lung carcinoma in addition to functioning as negative regulators of WNT and Notch signaling. A yeast two-hybrid approach was used to discover novel MTG binding partners. This screen identified the Zinc fingers, C2H2 and BTB domain containing (ZBTB) family members ZBTB4 and ZBTB38 as MTG16 interacting proteins. ZBTB4 is downregulated in breast cancer and modulates p53 responses. Because ZBTB33 (Kaiso), like MTG16, modulates Wnt signaling at the level of TCF4, and its deletion suppresses intestinal tumorigenesis in the ApcMin mouse, we determined that Kaiso also interacted with MTG16 to modulate transcription. The zinc finger domains of Kaiso as well as ZBTB4 and ZBTB38 bound MTG16 and the association with Kaiso was confirmed using co-immunoprecipitation. MTG family members were required to efficiently repress both a heterologous reporter construct containing Kaiso binding sites (4×KBS) and the known Kaiso target, Matrix metalloproteinase-7 (MMP-7/Matrilysin). Moreover, chromatin immunoprecipitation studies placed MTG16 in a complex occupying the Kaiso binding site on the MMP-7 promoter. The presence of MTG16 in this complex, and its contributions to transcriptional repression both required Kaiso binding to its binding site on DNA, establishing MTG16-Kaiso binding as functionally relevant in Kaiso-dependent transcriptional repression. Examination of a large multi-stage CRC expression array dataset revealed patterns of Kaiso, MTG16, and MMP-7 expression supporting the hypothesis that loss of either Kaiso or MTG16 can de-regulate a target promoter such as that of MMP-7. These findings provide new insights into the mechanisms of transcriptional control by ZBTB family members and broaden the scope of co
Lack of specific (3H) prazosin binding sites in dog and rabbit cerebral arteries
International Nuclear Information System (INIS)
Ferron, P.M.; Banner, W. Jr.; Duckles, S.P.
1984-01-01
In order to explore the characteristics of alpha adrenergic receptors on cerebrovascular smooth muscle, specific binding sites for the alpha 1 adrenergic ligand, ( 3 H) prazosin, were studied in blood vessel homogenates. No specific ( 3 H) prazosin binding was found in either rabbit or dog cerebral arteries, but specific binding was demonstrated in the rabbit saphenous and ear arteries. In the ear artery 3 H-prazosin binding was saturable with a K/sub d/ of 0.51 +/- 0.20 nM and a Bmax of 89 +/- 29 fmoles/mg protein. To confirm the adequacy of our membrane preparation, homogenates of both dog and rabbit cerebral arteries showed saturable specific binding with two different ligands: one for muscarinic receptors, [ 3 H](-) quinuclidinyl benzilate (QNB) and one for alpha 2 adrenergic receptors, ( 3 H) yohimbine. The results of these studies demonstrate a lack of alpha 1 adrenergic receptors on cerebral blood vessels, confirming functional studies showing only a weak contractile response to norepinephrine. 29 references, 3 figures, 2 tables
G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.
Lee, Hui Sun; Im, Wonpil
2017-01-01
Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.
Two classes of ouabain binding sites in ferret heart and two forms of Na+-K+-ATPase
Energy Technology Data Exchange (ETDEWEB)
Ng, Y.C.; Akera, T.
1987-05-01
In partially purified Na+-K+-adenosinetriphosphatase (ATPase) obtained from ferret heart, ouabain produced a monophasic inhibition curve; however, the curve spanned over 5 logarithmic units, indicating the presence of more than one classes of enzyme. (/sup 3/H)ouabain binding studies revealed high-and low-affinity binding sites in approximately equal abundance, with apparent dissociation constants of 10 and 230 nM, respectively. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of phosphoenzyme formed from (gamma-/sup 32/P)ATP showed two distinct K+-sensitive bands of approximately 100,000 molecular weight. Phosphoenzyme formation from the high-molecular-weight alpha(+) form was selectively inhibited by N-ethylmaleimide. Ouabain caused a 50% inhibition of phosphorylation of the alpha(+) form at 40 nM and the lower-molecular-weight alpha form at 300 nM. In papillary muscle preparations, 1-30 nM ouabain produced a modest positive inotropic effect that reached an apparent plateau at 30 nM. Further increases in ouabain concentrations, however, produced additional and prominent inotropic effects at 0.1-10 microM. These results indicate for the first time in cardiac muscle that the high- and low-affinity ouabain binding sites are associated with the alpha(+) and alpha forms of the Na+-K+-ATPase, respectively, and that binding of ouabain to either of these sites causes enzyme inhibition and the positive inotropic effect.
Energy Technology Data Exchange (ETDEWEB)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M. (Centre de Biochimie, Nice (France))
1989-07-05
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of {sup 125}I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity.
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Energy Technology Data Exchange (ETDEWEB)
Kousba, Ahmed A.; Sultatos, L G.; Poet, Torka S.; Timchalk, Chuck
2004-08-02
The primary mechanism of action for organophosphorus (OP) insecticides involves the inhibition of acetylcholinesterase (AChE) by oxygenated metabolites (oxons). This inhibition has been attributed to the phosphorylation of the serine hydroxyl group located in the active site of the AChE molecule. The rate of phosphorylation is described by the bimolecular inhibitory rate constant (ki), which has been utilized for quantification of OP inhibitory capacity. It has been previously proposed that a peripheral binding site exists on the AChE molecule, which when occupied, reduces the capacity of additional oxon molecules to phosphorylate the active site. The objective of the current study was to evaluate the interaction of chlorpyrifos oxon (CPO) and paraoxon (PO) with rat brain AChE using a modified Ellman assay in conjunction with a pharmacodynamic model to further assess the dynamics of AChE inhibition and the potential role of a peripheral binding site. The ki for AChE inhibition determined at oxon concentrations of 5 x 10{sup -4} 100 nM were 0.212 and 0.0216 nM-1h-1 for CPO and PO, respectively. The spontaneous reactivation rates of the inhibited AChE for CPO and PO were 0.087 and 0.078 h-1, respectively. In contrast, the ki estimated at a low oxon concentration (1 pM) were {approx} 1,000 and 10,000 -fold higher than those determined at high CPO and PO concentrations, respectively. At these low concentrations, the ki estimates were approximately similar for both CPO and PO (180 and 250 nM-1h-1, respectively). This implies that at low exposure concentrations, both oxons exhibited similar inhibitory potency in contrast to the marked difference exhibited at higher concentrations, which is consistent with the presence of a peripheral binding site on the AChE enzyme. These results support the potential importance of a secondary binding site associated with AChE kinetics, particularly at low environmentally relevant concentrations.
Binding site for the adenosyl group of coenzyme B12 in diol dehydrase
International Nuclear Information System (INIS)
Toraya, T.
1985-01-01
The binding of cob(II)alamin (CblII) and 5'-deoxyadenosine to diol dehydrase was studied spectroscopically and with [U- 14 C]5'-deoxyadenosine. CblII was bound to this enzyme forming a tight 1:1 complex which was resistant to oxidation by O 2 even in the presence of CN-. An irreversible 1:1:1 ternary complex was formed between enzyme, CblII, and 5'-deoxyadenosine, when the enzyme was incubated first with the nucleoside and then with CblII. When this order of addition of the constituents was reversed, no 5'-deoxyadenosine was bound to the enzyme-CblII complex. Hydroxocobalamin could also bind to the enzyme together with the nucleoside, while other cob(III)alamins bearing a bulkier Co beta ligand displaced the nucleoside upon binding to the enzyme. The binding of [U- 14 C]5'-deoxyadenosine was strongly inhibited by unlabeled 5'-deoxy-ara-adenosine, 4',5'-anhydroadenosine, adenosine, adenine, and 5',8-cyclic adenosine, in this order, but not by 5'-deoxyuridine. These results constitute direct evidence for the presence of the binding site for the adenosyl group of adenosylcobalamin, which is spatially limited to and highly specific for adenine nucleosides. The binding of 5'-deoxyadenosine to the apoenzyme was reversible
Synthesis of Zn-MOF incorporating titanium-hydrides as active sites binding H{sub 2} molecules
Energy Technology Data Exchange (ETDEWEB)
Kim, Jongsik, E-mail: jkim40@nd.edu [Department of Chemical and Biomolecular Engineering, University of Notre Dame, 182, Fitzpatrick Hall, Notre Dame, IN 46556 (United States); Ok Kim, Dong; Wook Kim, Dong; Sagong, Kil [Hanwha Chemical Research & Development Center, 6, Shinseong-dong, Yuseong-gu, Daejeon 305-804 (Korea, Republic of)
2015-10-15
This paper describes the synthetic effort for a Zn-MOF imparting Ti-H as a preferential binding site potentially capturing H{sub 2} molecules via Kubas-type interaction. The formation mechanism of Ti-H innate to the final material was potentially demonstrated to follow a radical dissociation rather than a β-hydrogen elimination and a C-H reductive elimination. - Graphical abstract: This study details the synthesis and the formation mechanism of Zn-MOF adsorbent site-isolating TiH{sub 3} that can potentially capture H{sub 2} molecules via Kubas-binding mechanism. - Highlights: • OH-functionalized Zn-MOF was employed as a reactive template to site-isolate TiH{sub 3}. • This MOF was post-synthetically modified using a tetracyclohexyl titanium (IV). • This intermediate was hydrogenolyzed to change ligand from cyclohexyl to hydride. • Formation mechanism of TiH{sub 3} was investigated via two control GC–MS experiments. • Final Zn-MOF potentially site-isolating TiH{sub 3} species was used as a H{sub 2} adsorbent.
International Nuclear Information System (INIS)
Knight, G.B.; Gudas, J.M.; Pardee, A.B.
1987-01-01
Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene
Directory of Open Access Journals (Sweden)
Dan M Park
Full Text Available Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ(70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis.
Rui, Huan; Artigas, Pablo; Roux, Benoît
2016-08-04
The Na(+)/K(+)-pump maintains the physiological K(+) and Na(+) electrochemical gradients across the cell membrane. It operates via an 'alternating-access' mechanism, making iterative transitions between inward-facing (E1) and outward-facing (E2) conformations. Although the general features of the transport cycle are known, the detailed physicochemical factors governing the binding site selectivity remain mysterious. Free energy molecular dynamics simulations show that the ion binding sites switch their binding specificity in E1 and E2. This is accompanied by small structural arrangements and changes in protonation states of the coordinating residues. Additional computations on structural models of the intermediate states along the conformational transition pathway reveal that the free energy barrier toward the occlusion step is considerably increased when the wrong type of ion is loaded into the binding pocket, prohibiting the pump cycle from proceeding forward. This self-correcting mechanism strengthens the overall transport selectivity and protects the stoichiometry of the pump cycle.
Fago, Angela; Malte, Hans; Storz, Jay F.; Gorr, Thomas A.
2013-01-01
In contrast to other vertebrate hemoglobins (Hbs) whose high intrinsic O2 affinities are reduced by red cell allosteric effectors (mainly protons, CO2, organic phosphates, and chloride ions), crocodilian Hbs exhibit low sensitivity to organic phosphates and high sensitivity to bicarbonate (HCO3−), which is believed to augment Hb-O2 unloading during diving and postprandial alkaline tides when blood HCO3− levels and metabolic rates increase. Examination of α- and β-globin amino acid sequences of dwarf caiman (Paleosuchus palpebrosus) revealed a unique combination of substitutions at key effector binding sites compared with other vertebrate and crocodilian Hbs: β82Lys→Gln, β143His→Val, and β146His→Tyr. These substitutions delete positive charges and, along with other distinctive changes in residue charge and polarity, may be expected to disrupt allosteric regulation of Hb-O2 affinity. Strikingly, however, P. palpebrosus Hb shows a strong Bohr effect, and marked deoxygenation-linked binding of organic phosphates (ATP and DPG) and CO2 as carbamate (contrasting with HCO3− binding in other crocodilians). Unlike other Hbs, it polymerizes to large complexes in the oxygenated state. The highly unusual properties of P. palpebrosus Hb align with a high content of His residues (potential sites for oxygenation-linked proton binding) and distinctive surface Cys residues that may form intermolecular disulfide bridges upon polymerization. On the basis of its singular properties, P. palpebrosus Hb provides a unique opportunity for studies on structure-function coupling and the evolution of compensatory mechanisms for maintaining tissue O2 delivery in Hbs that lack conventional effector-binding residues. PMID:23720132
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
Energy Technology Data Exchange (ETDEWEB)
Wang, Qing; He, Jiawei; Wu, Di; Wang, Jing; Yan, Jin; Li, Hui, E-mail: lihuilab@sina.com
2015-08-15
α-Cyperone, as the main constituent of Cyperus rotundus, is a sesquiterpene ketone. In this work, LigandFit and CDOCKER docking programs of Discovery Studio 3.1 were used to preliminarily estimate and further confirm the binding sites of α-cyperone. LigandFit results showed that α-cyperone is mainly bound in subdomain IIA. This finding was further confirmed by CDOCKER results. Site marker competitive experimental results also suggested that α-cyperone contains the same binding site as warfarin. Software simulation results further revealed that α-cyperone is mainly bound in subdomain IIA. Site marker competitive experiment results are consistent with simulation results. 3D fluorescence and CD spectroscopy results indicated that the native conformation of HSA molecule is affected by the presence of α-cyperone. - Highlights: • This work carried out by adopting molecular docking and spectroscopic studies. • Discovery studio 3.1 was used for estimating the binding sites. • The insertion of α-cyperone molecule caused the microenvironment of HSA changed. • The native conformation of HSA was changed during binding with α-cyperone.
International Nuclear Information System (INIS)
Wang, Qing; He, Jiawei; Wu, Di; Wang, Jing; Yan, Jin; Li, Hui
2015-01-01
α-Cyperone, as the main constituent of Cyperus rotundus, is a sesquiterpene ketone. In this work, LigandFit and CDOCKER docking programs of Discovery Studio 3.1 were used to preliminarily estimate and further confirm the binding sites of α-cyperone. LigandFit results showed that α-cyperone is mainly bound in subdomain IIA. This finding was further confirmed by CDOCKER results. Site marker competitive experimental results also suggested that α-cyperone contains the same binding site as warfarin. Software simulation results further revealed that α-cyperone is mainly bound in subdomain IIA. Site marker competitive experiment results are consistent with simulation results. 3D fluorescence and CD spectroscopy results indicated that the native conformation of HSA molecule is affected by the presence of α-cyperone. - Highlights: • This work carried out by adopting molecular docking and spectroscopic studies. • Discovery studio 3.1 was used for estimating the binding sites. • The insertion of α-cyperone molecule caused the microenvironment of HSA changed. • The native conformation of HSA was changed during binding with α-cyperone
LIGSITEcsc: predicting ligand binding sites using the Connolly surface and degree of conservation
Directory of Open Access Journals (Sweden)
Schroeder Michael
2006-09-01
Full Text Available Abstract Background Identifying pockets on protein surfaces is of great importance for many structure-based drug design applications and protein-ligand docking algorithms. Over the last ten years, many geometric methods for the prediction of ligand-binding sites have been developed. Results We present LIGSITEcsc, an extension and implementation of the LIGSITE algorithm. LIGSITEcsc is based on the notion of surface-solvent-surface events and the degree of conservation of the involved surface residues. We compare our algorithm to four other approaches, LIGSITE, CAST, PASS, and SURFNET, and evaluate all on a dataset of 48 unbound/bound structures and 210 bound-structures. LIGSITEcsc performs slightly better than the other tools and achieves a success rate of 71% and 75%, respectively. Conclusion The use of the Connolly surface leads to slight improvements, the prediction re-ranking by conservation to significant improvements of the binding site predictions. A web server for LIGSITEcsc and its source code is available at scoppi.biotec.tu-dresden.de/pocket.
High density of benzodiazepine binding sites in the substantia innominata of the rat
International Nuclear Information System (INIS)
Sarter, M.; Schneider, H.H.
1988-01-01
In order to study the neuronal basis of the pharmacological interactions between benzodiazepine receptor ligands and cortical cholinergic turnover, we examined the regional distribution of specific benzodiazepine binding sites using in vitro autoradiography. In the basal forebrain, the substantia innominata contained a high density of [ 3 H]lormetazepam (LMZ) binding sites (Bmax = 277 fmol/mg tissue; Kd = 0.55 nM). The label could be displaced by diazepam (IC50 = 100 nM), the benzodiazepine receptor antagonist beta-carboline ZK 93426 (45 nM) and the partial inverse agonist beta-carboline FG 7142 (540 nM). It is hypothesized that the amnesic effects of benzodiazepine receptor agonists are exerted through benzodiazepine receptors which are situated on cholinergic neurons in the substantia innominata and are involved in a tonic inhibition of cortical acetylcholine release. The benzodiazepine receptor antagonist ZK 93426 may exert its nootropic effects via benzodiazepine receptors in the substantia innominata and, consequently, by disinhibiting cortical acetylcholine release
The role of upstream sequences in selecting the reading frame on tmRNA
Directory of Open Access Journals (Sweden)
Dewey Jonathan D
2008-06-01
Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.
Guo, Wei-Li; Huang, De-Shuang
2017-08-22
Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.
Laursen, Mette; Yatime, Laure; Nissen, Poul; Fedosova, Natalya U
2013-07-02
The Na(+),K(+)-ATPase maintains electrochemical gradients for Na(+) and K(+) that are critical for animal cells. Cardiotonic steroids (CTSs), widely used in the clinic and recently assigned a role as endogenous regulators of intracellular processes, are highly specific inhibitors of the Na(+),K(+)-ATPase. Here we describe a crystal structure of the phosphorylated pig kidney Na(+),K(+)-ATPase in complex with the CTS representative ouabain, extending to 3.4 Å resolution. The structure provides key details on CTS binding, revealing an extensive hydrogen bonding network formed by the β-surface of the steroid core of ouabain and the side chains of αM1, αM2, and αM6. Furthermore, the structure reveals that cation transport site II is occupied by Mg(2+), and crystallographic studies indicate that Rb(+) and Mn(2+), but not Na(+), bind to this site. Comparison with the low-affinity [K2]E2-MgF(x)-ouabain structure [Ogawa et al. (2009) Proc Natl Acad Sci USA 106(33):13742-13747) shows that the CTS binding pocket of [Mg]E2P allows deep ouabain binding with possible long-range interactions between its polarized five-membered lactone ring and the Mg(2+). K(+) binding at the same site unwinds a turn of αM4, dragging residues Ile318-Val325 toward the cation site and thereby hindering deep ouabain binding. Thus, the structural data establish a basis for the interpretation of the biochemical evidence pointing at direct K(+)-Mg(2+) competition and explain the well-known antagonistic effect of K(+) on CTS binding.
International Nuclear Information System (INIS)
Yoshida, M.; Allison, W.S.
1986-01-01
Two classes of ADP binding sites at 20 degrees C have been characterized in the F1-ATPase from the thermophilic bacterium, PS3 (TF1). One class is comprised of three sites which saturate with [ 3 H]ADP in less than 10 s with a Kd of 10 microM which, once filled, exchange rapidly with medium ADP. The binding of ADP to these sites is dependent on Mg2+. [ 3 H]ADP bound to these sites is removed by repeated gel filtrations on centrifuge columns equilibrated with ADP free medium. The other class is comprised of a single site which saturates with [ 3 H]ADP in 30 min with a Kd of 30 microM. [ 3 H]ADP bound to this site does not exchange with medium ADP nor does it dissociate on gel filtration through centrifuge columns equilibrated with ADP free medium. Binding of [ 3 H]ADP to this site is weaker in the presence of Mg2+ where the Kd for ADP is about 100 microM. [ 3 H]ADP dissociated from this site when ATP plus Mg2+ was added to the complex while it remained bound in the presence of ATP alone or in the presence of ADP, Pi, or ADP plus Pi with or without added Mg2+. Significant amounts of ADP in the 1:1 TF1.ADP complex were converted to ATP in the presence of Pi, Mg2+, and 50% dimethyl sulfoxide. Enzyme-bound ATP synthesis was abolished by chemical modification of a specific glutamic acid residue by dicyclohexylcarbodiimide, but not by modification of a specific tyrosine residue with 7-chloro-4-nitrobenzofurazan. Difference circular dichroism spectra revealed that the three Mg2+ -dependent, high affinity ADP binding sites that were not stable to gel filtration were on the alpha subunits and that the single ADP binding site that was stable to gel filtration was on one of the three beta subunits
Sugihara, J; Imamura, T; Nagafuchi, S; Bonaventura, J; Bonaventura, C; Cashon, R
1985-09-01
We encountered an abnormal hemoglobin (Rahere), with a threonine residue replacing the beta 82 (EF6) lysine residue at the binding site of 2,3-diphosphoglycerate, which was responsible for overt erythrocytosis in two individuals of a Japanese family. Hemoglobin Rahere shows a lower oxygen affinity on the binding of 2,3-diphosphoglycerate or chloride ions than hemoglobin A. Although a decrease in the positive charge density at the binding sites of 2,3-diphosphoglycerate in hemoglobin Rahere apparently shifts the allosteric equilibrium toward the low affinity state, it greatly diminishes the cofactor effects by anions. The oxygen affinity of the patient's erythrocytes is substantially lowered by the presence of bezafibrate, which combines with sites different from those of 2,3-diphosphoglycerate in either hemoglobin Rahere or hemoglobin A.
Delineation of the peptide binding site of the human galanin receptor.
Kask, K; Berthold, M; Kahl, U; Nordvall, G; Bartfai, T
1996-01-01
Galanin, a neuroendocrine peptide of 29 amino acids, binds to Gi/Go-coupled receptors to trigger cellular responses. To determine which amino acids of the recently cloned seven-transmembrane domain-type human galanin receptor are involved in the high-affinity binding of the endogenous peptide ligand, we performed a mutagenesis study. Mutation of the His264 or His267 of transmembrane domain VI to alanine, or of Phe282 of transmembrane domain VII to glycine, results in an apparent loss of galanin binding. The substitution of Glu271 to serine in the extracellular loop III of the receptor causes a 12-fold loss in affinity for galanin. We combined the mutagenesis results with data on the pharmacophores (Trp2, Tyr9) of galanin and with molecular modelling of the receptor using bacteriorhodopsin as a model. Based on these studies, we propose a binding site model for the endogenous peptide ligand in the galanin receptor where the N-terminus of galanin hydrogen bonds with Glu271 of the receptor, Trp2 of galanin interacts with the Zn2+ sensitive pair of His264 and His267 of transmembrane domain VI, and Tyr9 of galanin interacts with Phe282 of transmembrane domain VII, while the C-terminus of galanin is pointing towards the N-terminus of th Images PMID:8617199
Blindauer, Claudia A; Khazaipoul, Siavash; Yu, Ruitao; Stewart, Alan J
2016-01-01
Human serum albumin (HSA) is the major protein in blood plasma and is responsible for circulatory transport of a range of small molecules including fatty acids, metal ions and drugs. We previously identified the major plasma Zn2+ transport site on HSA and revealed that fatty-acid binding (at a distinct site called the FA2 site) and Zn2+ binding are interdependent via an allosteric mechanism. Since binding affinities of long-chain fatty acids exceed those of plasma Zn2+, this means that under certain circumstances the binding of fatty acid molecules to HSA is likely to diminish HSA Zn2+-binding, and hence affects the control of circulatory and cellular Zn2+ dynamics. This relationship between circulatory fatty acid and Zn2+ dynamics is likely to have important physiological and pathological implications, especially since it has been recognised that Zn2+ acts as a signalling agent in many cell types. Fatty acid levels in the blood are dynamic, but most importantly, chronic elevation of plasma fatty acid levels is associated with some metabolic disorders and disease states - including myocardial infarction and other cardiovascular diseases. In this article, we briefly review the metal-binding properties of albumin and highlight the importance of their interplay with fatty acid binding. We also consider the impact of this dynamic link upon levels and speciation of plasma Zn2+, its effect upon cellular Zn2+ homeostasis and its relevance to cardiovascular and circulatory processes in health and disease.
Energy Technology Data Exchange (ETDEWEB)
Bartlett, S.E.; Smith, M.T. (Department of Pharmacy, The University of Queensland (Australia)); Dood, P.R. (Clinical Research Centre, Royal Brisbane Hospital Foundation, Brisbane (Australia))
1994-07-01
Morphine in high doses and its major metabolite, morphine-3-glucuronide, cause CNS excitation following intrathecal and intracerebroventricular administration by an unknown mechanism. This study investigated whether morphine and morphine-3-glucuronide interact at major excitatory (glutamate), major inhibitory (GABA or glycine), or opioid binding sites. Homogenate binding assays were performed using specific radioligands. At opioid receptors, morphine-3-glucuronide and morphine caused an equipotent sodium shift, consistent with morphine-3-glucuronide behaving as an agonist. This suggests that morphine-3-glucuronide-mediated excitation is not caused by an interaction at opioid receptors. Morphine-3-glucuronide and morphine caused a weak inhibition of the binding of [sup 3]H-MK801 (non-competitive antagonist) and [sup 125]I-ifenprodil (polyamine site antagonist), but at unphysiologically high concentrations. This suggests that CNS excitation would not result from an interaction of morphine-3-glucuronide and high-dose morphine with these sites on the NMDA receptor. Morphine-3-glucuronide and morphine inhibited the binding of [sup 3]H-muscimol (GABA receptor agonist), [sup 3]H-diazepam and [sup 3]H-flunitraxepam (benzodiazepine agonists) binding very weakly, suggesting the excitatory effects of morphine-3-glucuronide and high-dose morphine are not elicited through GABA[sub A] receptors. Morphine-3-glucuronide and high-dose morphine did not prevent re-uptake of glutamate into presynaptic nerve terminals. In addition, morphine-3-glucuronide and morphine did not inhibit the binding of [sup 3]H-strychnine (glycine receptor antagonist) to synaptic membranes prepared from bovine spinal cord. It is concluded that excitation caused by high-dose morphine and morphine-3-glucuronide is not mediated by an interaction with postsynaptic amino acid receptors. (au) (30 refs.).
Arslan, Baran; Colpan, Mert; Gray, Kevin T; Abu-Lail, Nehal I; Kostyukova, Alla S
2018-01-15
Tropomodulin family of proteins includes several isoforms of tropomodulins (Tmod) and leiomodins (Lmod). These proteins can sequester actin monomers or nucleate actin polymerization. Although it is known that their actin-binding properties are isoform-dependent, knowledge on how they vary in strengths of interactions with G-actin is missing. While it is confirmed in many studies that Tmods have two actin-binding sites, information on number and location of actin-binding sites in Lmod2 is controversial. We used atomic force microscopy to study interactions between G-actin and proteins of the tropomodulin family. Unbinding forces between G-actin and Tmod1, Tmod2, Tmod3, or Lmod2 were quantified. Our results indicated that Tmod1 and Tmod3 had unimodal force distributions, Tmod2 had a bimodal distribution and Lmod2 had a trimodal distribution. The number of force distributions correlates with the proteins' abilities to sequester actin or to nucleate actin polymerization. We assigned specific unbinding forces to the individual actin-binding sites of Tmod2 and Lmod2 using mutations that destroy actin-binding sites of Tmod2 and truncated Lmod2. Our results confirm the existence of the N-terminal actin-binding site in Lmod2. Altogether, our data demonstrate how the differences between the number and the strength of actin-binding sites of Tmod or Lmod translate to their functional abilities. Copyright © 2017 Elsevier Inc. All rights reserved.
Investigation of the metal binding site in methionine aminopeptidase by density functional theory
DEFF Research Database (Denmark)
Jørgensen, Anne Techau; Norrby, Per-Ola; Liljefors, Tommy
2002-01-01
All methionine aminopeptidases exhibit the same conserved metal binding site. The structure of this site with either Co2+ ions or Zn2+ ions was investigated using density functional theory. The calculations showed that the structure of the site was not influenced by the identity of the metal ions....... This was the case for both of the systems studied; one based on the X-ray structure of the human methionine aminopeptidase type 2 (hMetAP-2) and the other based on the X-ray structure of the E. coli methionine aminopeptidase type 1 (eMetAP-1). Another important structural issue is the identity of the bridging...
Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K
2012-11-01
Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.
Su, Min-Gang; Weng, Julia Tzu-Ya; Hsu, Justin Bo-Kai; Huang, Kai-Yao; Chi, Yu-Hsiang; Lee, Tzong-Yi
2017-12-21
Protein post-translational modification (PTM) plays an essential role in various cellular processes that modulates the physical and chemical properties, folding, conformation, stability and activity of proteins, thereby modifying the functions of proteins. The improved throughput of mass spectrometry (MS) or MS/MS technology has not only brought about a surge in proteome-scale studies, but also contributed to a fruitful list of identified PTMs. However, with the increase in the number of identified PTMs, perhaps the more crucial question is what kind of biological mechanisms these PTMs are involved in. This is particularly important in light of the fact that most protein-based pharmaceuticals deliver their therapeutic effects through some form of PTM. Yet, our understanding is still limited with respect to the local effects and frequency of PTM sites near pharmaceutical binding sites and the interfaces of protein-protein interaction (PPI). Understanding PTM's function is critical to our ability to manipulate the biological mechanisms of protein. In this study, to understand the regulation of protein functions by PTMs, we mapped 25,835 PTM sites to proteins with available three-dimensional (3D) structural information in the Protein Data Bank (PDB), including 1785 modified PTM sites on the 3D structure. Based on the acquired structural PTM sites, we proposed to use five properties for the structural characterization of PTM substrate sites: the spatial composition of amino acids, residues and side-chain orientations surrounding the PTM substrate sites, as well as the secondary structure, division of acidity and alkaline residues, and solvent-accessible surface area. We further mapped the structural PTM sites to the structures of drug binding and PPI sites, identifying a total of 1917 PTM sites that may affect PPI and 3951 PTM sites associated with drug-target binding. An integrated analytical platform (CruxPTM), with a variety of methods and online molecular docking
Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan
2018-05-22
Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.
International Nuclear Information System (INIS)
Hall, H.; Wedel, I.
1985-01-01
The effects of long-term treatment of rats with alaproclate and amiflamine on the number and kinetics of 5-HT 1 and 5-HT 2 binding sites were investigated using in vitro receptor binding techniques. Some other studies have reported down-regulatory effects of alaproclate and amiflamine on 5-HT 2 binding sites in certain regions of the rat forebrain, but no such effects could be detected in the present study. Induction of a high-affinity binding site for 3 H-5-HT after long-term antidepressant treatment, as has been reported elsewhere, was not obtained in the present study. The results are compared to the effects obtained by treatment of rats with para-chloroamphetamine (PCA), which depletes the presynaptic neurons of monoamines. These different types of treatment do not cause any change in the binding properties of the specific 5-HT binding sites. It is thus concluded that such manipulations of the presynaptic 5-HT neurons do not affect the postsynaptic 5-HT 1 and 5-HT 2 binding sites. (Author)
The distribution of iron between the metal-binding sites of transferrin human serum.
Williams, J; Moreton, K
1980-02-01
The Makey & Seal [(1976) Biochim. Biophys. Acta 453, 250--256] method of polyacrylamide-gel electrophoresis in buffer containing 6 M-urea was used to determine the distribution of iron between the N-terminal and C-terminal iron-binding sites of transferrin in human serum. In fresh serum the two sites are unequally occupied; there is preferential occupation of the N-terminal site. On incubation of the serum at 37 degrees C the preference of iron for the N-terminal site becomes more marked. On storage of serum at -15 degrees C the iron distribution changes so that there is a marked preference for the C-terminal site. Dialysis of serum against buffer at pH 7.4 also causes iron to be bound much more strongly by the C-terminal than by the N-terminal site. The original preference for the N-terminal site can be resroted to the dialysed serum by addition of the diffusible fraction.
Atrial natriuretic factor binding sites in experimental congestive heart failure
International Nuclear Information System (INIS)
Bianchi, C.; Thibault, G.; Wrobel-Konrad, E.; De Lean, A.; Genest, J.; Cantin, M.
1989-01-01
A quantitative in vitro autoradiographic study was performed on the aorta, renal glomeruli, and adrenal cortex of cardiomyopathic hamsters in various stages of heart failure and correlated, in some instances, with in vivo autoradiography. The results indicate virtually no correlation between the degree of congestive heart failure and the density of 125I-labeled atrial natriuretic factor [(Ser99, Tyr126)ANF] binding sites (Bmax) in the tissues examined. Whereas the Bmax was increased in the thoracic aorta in moderate and severe heart failure, there were no significant changes in the zona glomerulosa. The renal glomeruli Bmax was lower in mild and moderate heart failure compared with control and severe heart failure. The proportion of ANF B- and C-receptors was also evaluated in sections of the aorta, adrenal, and kidney of control and cardiomyopathic hamsters with severe heart failure. (Arg102, Cys121)ANF [des-(Gln113, Ser114, Gly115, Leu116, Gly117) NH2] (C-ANF) at 10(-6) M displaced approximately 505 of (Ser99, Tyr126)125I-ANF bound in the aorta and renal glomeruli and approximately 20% in the adrenal zona glomerulosa in both series of animals. These results suggest that ANF may exert a buffering effect on the vasoconstriction of heart failure and to a certain extent may inhibit aldosterone secretion. The impairment of renal sodium excretion does not appear to be related to glomerular ANF binding sites at any stage of the disease
Target molecular weights for red cell band 3 stilbene and mercurial binding sites
International Nuclear Information System (INIS)
Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.
1986-01-01
Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
International Nuclear Information System (INIS)
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-01-01
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable
The binding site for neohesperidin dihydrochalcone at the human sweet taste receptor
Directory of Open Access Journals (Sweden)
Kratochwil Nicole A
2007-10-01
Full Text Available Abstract Background Differences in sweet taste perception among species depend on structural variations of the sweet taste receptor. The commercially used isovanillyl sweetener neohesperidin dihydrochalcone activates the human but not the rat sweet receptor TAS1R2+TAS1R3. Analysis of interspecies combinations and chimeras of rat and human TAS1R2+TAS1R3 suggested that the heptahelical domain of human TAS1R3 is crucial for the activation of the sweet receptor by neohesperidin dihydrochalcone. Results By mutational analysis combined with functional studies and molecular modeling we identified a set of different amino acid residues within the heptahelical domain of human TAS1R3 that forms the neohesperidin dihydrochalcone binding pocket. Sixteen amino acid residues in the transmembrane domains 2 to 7 and one in the extracellular loop 2 of hTAS1R3 influenced the receptor's response to neohesperidin dihydrochalcone. Some of these seventeen residues are also part of the binding sites for the sweetener cyclamate or the sweet taste inhibitor lactisole. In line with this observation, lactisole inhibited activation of the sweet receptor by neohesperidin dihydrochalcone and cyclamate competitively, whereas receptor activation by aspartame, a sweetener known to bind to the N-terminal domain of TAS1R2, was allosterically inhibited. Seven of the amino acid positions crucial for activation of hTAS1R2+hTAS1R3 by neohesperidin dihydrochalcone are thought to play a role in the binding of allosteric modulators of other class C GPCRs, further supporting our model of the neohesperidin dihydrochalcone pharmacophore. Conclusion From our data we conclude that we identified the neohesperidin dihydrochalcone binding site at the human sweet taste receptor, which overlaps with those for the sweetener cyclamate and the sweet taste inhibitor lactisole. This readily delivers a molecular explanation of our finding that lactisole is a competitive inhibitor of the receptor
Enantioselective kappa opioid binding sites on the macrophage cell line, P388d sub 1
Energy Technology Data Exchange (ETDEWEB)
Carr, D.J.J.; Blalock, J.E. (Univ. of Alabama, Birmingham (USA)); DeCosta, B.R.; Jacobson, A.E.; Rice, K.C. (NIDDK, NIH, Bethesda, MD (USA))
1991-01-01
A kappa opioid binding site has been characterized on the macrophage cell line, P388d{sub 1}, using the kappa selective affinity ligand, ({sup 3H}(1S,2S)-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-phrrolidinyl) cyclohexyl) benzeneacetamide ((-)BD166). The kappa site has a relative molecular mass (Mr) of 38,000 under nonreducing conditions and 42,000 under reducing conditions. Moreover, it exhibits enantioselectivity in that 1S,2S-(-)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((-)-U-50,488) blocks ({sup 3}H)95{alpha},7{alpha},8{beta})-(-)-N-methyl-N-(7-(1- pyrrolidinyl)-1-oxaspiro-(4,5)-dec-8-yl)benzeneacetamide (U-69,593) binding to P388d{sub 1} cells with an IC{sub 50} = 7.0 nM whereas 1R,2R-(+)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((+)U-50,488) blocks ({sup 3}H)U-69,593 binding to P388d{sub 1} cells with an IC{sub 50} = 700 nM.
The N-terminal tropomyosin- and actin-binding sites are important for leiomodin 2's function.
Ly, Thu; Moroz, Natalia; Pappas, Christopher T; Novak, Stefanie M; Tolkatchev, Dmitri; Wooldridge, Dayton; Mayfield, Rachel M; Helms, Gregory; Gregorio, Carol C; Kostyukova, Alla S
2016-08-15
Leiomodin is a potent actin nucleator related to tropomodulin, a capping protein localized at the pointed end of the thin filaments. Mutations in leiomodin-3 are associated with lethal nemaline myopathy in humans, and leiomodin-2-knockout mice present with dilated cardiomyopathy. The arrangement of the N-terminal actin- and tropomyosin-binding sites in leiomodin is contradictory and functionally not well understood. Using one-dimensional nuclear magnetic resonance and the pointed-end actin polymerization assay, we find that leiomodin-2, a major cardiac isoform, has an N-terminal actin-binding site located within residues 43-90. Moreover, for the first time, we obtain evidence that there are additional interactions with actin within residues 124-201. Here we establish that leiomodin interacts with only one tropomyosin molecule, and this is the only site of interaction between leiomodin and tropomyosin. Introduction of mutations in both actin- and tropomyosin-binding sites of leiomodin affected its localization at the pointed ends of the thin filaments in cardiomyocytes. On the basis of our new findings, we propose a model in which leiomodin regulates actin poly-merization dynamics in myocytes by acting as a leaky cap at thin filament pointed ends. © 2016 Ly, Moroz, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Naturally occurring deletions of hunchback binding sites in the even-skipped stripe 3+7 enhancer.
Directory of Open Access Journals (Sweden)
Arnar Palsson
Full Text Available Changes in regulatory DNA contribute to phenotypic differences within and between taxa. Comparative studies show that many transcription factor binding sites (TFBS are conserved between species whereas functional studies reveal that some mutations segregating within species alter TFBS function. Consistently, in this analysis of 13 regulatory elements in Drosophila melanogaster populations, single base and insertion/deletion polymorphism are rare in characterized regulatory elements. Experimentally defined TFBS are nearly devoid of segregating mutations and, as has been shown before, are quite conserved. For instance 8 of 11 Hunchback binding sites in the stripe 3+7 enhancer of even-skipped are conserved between D. melanogaster and Drosophila virilis. Oddly, we found a 72 bp deletion that removes one of these binding sites (Hb8, segregating within D. melanogaster. Furthermore, a 45 bp deletion polymorphism in the spacer between the stripe 3+7 and stripe 2 enhancers, removes another predicted Hunchback site. These two deletions are separated by ∼250 bp, sit on distinct haplotypes, and segregate at appreciable frequency. The Hb8Δ is at 5 to 35% frequency in the new world, but also shows cosmopolitan distribution. There is depletion of sequence variation on the Hb8Δ-carrying haplotype. Quantitative genetic tests indicate that Hb8Δ affects developmental time, but not viability of offspring. The Eve expression pattern differs between inbred lines, but the stripe 3 and 7 boundaries seem unaffected by Hb8Δ. The data reveal segregating variation in regulatory elements, which may reflect evolutionary turnover of characterized TFBS due to drift or co-evolution.
Naturally occurring deletions of hunchback binding sites in the even-skipped stripe 3+7 enhancer.
Palsson, Arnar; Wesolowska, Natalia; Reynisdóttir, Sigrún; Ludwig, Michael Z; Kreitman, Martin
2014-01-01
Changes in regulatory DNA contribute to phenotypic differences within and between taxa. Comparative studies show that many transcription factor binding sites (TFBS) are conserved between species whereas functional studies reveal that some mutations segregating within species alter TFBS function. Consistently, in this analysis of 13 regulatory elements in Drosophila melanogaster populations, single base and insertion/deletion polymorphism are rare in characterized regulatory elements. Experimentally defined TFBS are nearly devoid of segregating mutations and, as has been shown before, are quite conserved. For instance 8 of 11 Hunchback binding sites in the stripe 3+7 enhancer of even-skipped are conserved between D. melanogaster and Drosophila virilis. Oddly, we found a 72 bp deletion that removes one of these binding sites (Hb8), segregating within D. melanogaster. Furthermore, a 45 bp deletion polymorphism in the spacer between the stripe 3+7 and stripe 2 enhancers, removes another predicted Hunchback site. These two deletions are separated by ∼250 bp, sit on distinct haplotypes, and segregate at appreciable frequency. The Hb8Δ is at 5 to 35% frequency in the new world, but also shows cosmopolitan distribution. There is depletion of sequence variation on the Hb8Δ-carrying haplotype. Quantitative genetic tests indicate that Hb8Δ affects developmental time, but not viability of offspring. The Eve expression pattern differs between inbred lines, but the stripe 3 and 7 boundaries seem unaffected by Hb8Δ. The data reveal segregating variation in regulatory elements, which may reflect evolutionary turnover of characterized TFBS due to drift or co-evolution.
Energy Technology Data Exchange (ETDEWEB)
Zheng, Wei [Department of Medicinal Chemistry, School of Pharmacy, Fudan University, 826 Zhangheng Road, Shanghai 200032 (China); NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032 (China); Li, Juan [Department of Pharmacology, Institute of Medical Sciences, Shanghai Jiaotong University School of Medicine, 280 South Chongqing Road, Shanghai 200025 (China); Qiu, Zhuibai [Department of Medicinal Chemistry, School of Pharmacy, Fudan University, 826 Zhangheng Road, Shanghai 200032 (China); Xia, Zheng [Department of Pharmacology, Institute of Medical Sciences, Shanghai Jiaotong University School of Medicine, 280 South Chongqing Road, Shanghai 200025 (China); Li, Wei [Department of Medicinal Chemistry, School of Pharmacy, Fudan University, 826 Zhangheng Road, Shanghai 200032 (China); Yu, Lining; Chen, Hailin; Chen, Jianxing [NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032 (China); Chen, Yan; Hu, Zhuqin; Zhou, Wei; Shao, Biyun; Cui, Yongyao [Department of Pharmacology, Institute of Medical Sciences, Shanghai Jiaotong University School of Medicine, 280 South Chongqing Road, Shanghai 200025 (China); Xie, Qiong, E-mail: xiejoanxq@gmail.com [Department of Medicinal Chemistry, School of Pharmacy, Fudan University, 826 Zhangheng Road, Shanghai 200032 (China); Chen, Hongzhuan, E-mail: yaoli@shsmu.edu.cn [Department of Pharmacology, Institute of Medical Sciences, Shanghai Jiaotong University School of Medicine, 280 South Chongqing Road, Shanghai 200025 (China)
2012-10-01
The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC{sub 50} values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC{sub 50} values of 49.1 μM (for ZLA) and 55.3 μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.
International Nuclear Information System (INIS)
Zheng, Wei; Li, Juan; Qiu, Zhuibai; Xia, Zheng; Li, Wei; Yu, Lining; Chen, Hailin; Chen, Jianxing; Chen, Yan; Hu, Zhuqin; Zhou, Wei; Shao, Biyun; Cui, Yongyao; Xie, Qiong; Chen, Hongzhuan
2012-01-01
The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC 50 values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC 50 values of 49.1 μM (for ZLA) and 55.3 μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.
Sael, Lee; Kihara, Daisuke
2012-04-01
Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. Copyright © 2011 Wiley Periodicals, Inc.
Kadamur, Ganesh
2016-01-01
Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. PMID:27002154
GPU-Based Point Cloud Superpositioning for Structural Comparisons of Protein Binding Sites.
Leinweber, Matthias; Fober, Thomas; Freisleben, Bernd
2018-01-01
In this paper, we present a novel approach to solve the labeled point cloud superpositioning problem for performing structural comparisons of protein binding sites. The solution is based on a parallel evolution strategy that operates on large populations and runs on GPU hardware. The proposed evolution strategy reduces the likelihood of getting stuck in a local optimum of the multimodal real-valued optimization problem represented by labeled point cloud superpositioning. The performance of the GPU-based parallel evolution strategy is compared to a previously proposed CPU-based sequential approach for labeled point cloud superpositioning, indicating that the GPU-based parallel evolution strategy leads to qualitatively better results and significantly shorter runtimes, with speed improvements of up to a factor of 1,500 for large populations. Binary classification tests based on the ATP, NADH, and FAD protein subsets of CavBase, a database containing putative binding sites, show average classification rate improvements from about 92 percent (CPU) to 96 percent (GPU). Further experiments indicate that the proposed GPU-based labeled point cloud superpositioning approach can be superior to traditional protein comparison approaches based on sequence alignments.