WorldWideScience

Sample records for bind mutant 5s

  1. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  2. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  3. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  4. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  5. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  6. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  7. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  8. An Inactive Geminin Mutant That Binds Cdt1

    Directory of Open Access Journals (Sweden)

    Marissa Suchyta

    2015-05-01

    Full Text Available The initiation of DNA replication is tightly regulated in order to ensure that the genome duplicates only once per cell cycle. In vertebrate cells, the unstable regulatory protein Geminin prevents a second round of DNA replication by inhibiting the essential replication factor Cdt1. Cdt1 recruits mini-chromosome maintenance complex (MCM2-7, the replication helicase, into the pre-replication complex (pre-RC at origins of DNA replication. The mechanism by which Geminin inhibits MCM2-7 loading by Cdt1 is incompletely understood. The conventional model is that Geminin sterically hinders a direct physical interaction between Cdt1 and MCM2-7. Here, we describe an inactive missense mutant of Geminin, GemininAWA, which binds to Cdt1 with normal affinity yet is completely inactive as a replication inhibitor even when added in vast excess. In fact, GemininAWA can compete with GemininWT for binding to Cdt1 and prevent it from inhibiting DNA replication. GemininAWA does not inhibit the loading of MCM2-7 onto DNA in vivo, and in the presence of GemininAWA, nuclear DNA is massively over-replicated within a single S phase. We conclude that Geminin does not inhibit MCM loading by simple steric interference with a Cdt1-MCM2-7 interaction but instead works by a non-steric mechanism, possibly by inhibiting the histone acetyltransferase HBO1.

  9. Ibrutinib targets mutant-EGFR kinase with a distinct binding conformation.

    Science.gov (United States)

    Wang, Aoli; Yan, Xiao-E; Wu, Hong; Wang, Wenchao; Hu, Chen; Chen, Cheng; Zhao, Zheng; Zhao, Peng; Li, Xixiang; Wang, Li; Wang, Beilei; Ye, Zi; Wang, Jinhua; Wang, Chu; Zhang, Wei; Gray, Nathanael S; Weisberg, Ellen L; Chen, Liang; Liu, Jing; Yun, Cai-Hong; Liu, Qingsong

    2016-10-25

    Ibrutinib, a clinically approved irreversible BTK kinase inhibitor for Mantle Cell Lymphoma (MCL) and Chronic Lymphocytic Leukemia (CLL) etc, has been reported to be potent against EGFR mutant kinase and currently being evaluated in clinic for Non Small Cell Lung Cancer (NSCLC). Through EGFR wt/mutant engineered isogenic BaF3 cell lines we confirmed the irreversible binding mode of Ibrutinib with EGFR wt/mutant kinase via Cys797. However, comparing to typical irreversible EGFR inhibitor, such as WZ4002, the washing-out experiments revealed a much less efficient covalent binding for Ibrutinib. The biochemical binding affinity examination in the EGFR L858R/T790M kinase revealed that, comparing to more efficient irreversible inhibitor WZ4002 (Kd: 0.074 μM), Ibrutinib exhibited less efficient binding (Kd: 0.18 μM). An X-ray crystal structure of EGFR (T790M) in complex with Ibrutinib exhibited a unique DFG-in/c-Helix-out inactive binding conformation, which partially explained the less efficiency of covalent binding and provided insight for further development of highly efficient irreversible binding inhibitor for the EGFR mutant kinase. These results also imply that, unlike the canonical irreversible inhibitor, sustained effective concentration might be required for Ibrutinib in order to achieve the maximal efficacy in the clinic application against EGFR driven NSCLC.

  10. DNA binding properties of dioxin receptors in wild-type and mutant mouse hepatoma cells

    International Nuclear Information System (INIS)

    Cuthill, S.; Poellinger, L.

    1988-01-01

    The current model of action of 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) entails stimulation of target gene transcription via the formation of dioxin-receptor complexes and subsequent accumulation of the complexes within the cell nucleus. Here, the authors have analyzed the DNA binding properties of the dioxin receptor in wild-type mouse hepatoma (Hepa 1c1c7) cells and a class of nonresponsive mutant cells which fail to accumulate dioxin-receptor complexes within the nucleus in vivo. In vitro, both the wild-type and mutant [ 3 H]dioxin-receptor complexes exhibited low affinity for DNA-cellulose (5-8% and around 4% retention, respectively) in the absence of prior biochemical manipulations. However, following chromatography on heparin-Sepharose, the wild-type but not the mutant dioxin receptor was transformed to a species with an increased affinity for DNA (40-50% retention on DNA-cellulose). The gross molecular structure of the mutant, non DNA binding dioxin receptor did not appear to be altered as compared to that of the wild-type receptor. These results imply that the primary deficiency in the mutant dioxin receptor form may reside at the DNA binding level and that, in analogy to steroid hormone receptors, DNA binding of the receptor may be an essential step in the regulation of target gene transcription by dioxin

  11. Differential binding of prohibitin-2 to estrogen receptor α and to drug-resistant ERα mutants

    Energy Technology Data Exchange (ETDEWEB)

    Chigira, Takeru, E-mail: 8120661875@mail.ecc.u-tokyo.ac.jp [Department of Chemistry and Biotechnology, School of Engineering, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639 (Japan); Nagatoishi, Satoru, E-mail: nagatoishi@bioeng.t.u-tokyo.ac.jp [Department of Bioengineering, School of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan); Tsumoto, Kouhei, E-mail: tsumoto@bioeng.t.u-tokyo.ac.jp [Department of Chemistry and Biotechnology, School of Engineering, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639 (Japan); Department of Bioengineering, School of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan)

    2015-08-07

    Endocrine resistance is one of the most challenging problems in estrogen receptor alpha (ERα)-positive breast cancer. The transcriptional activity of ERα is controlled by several coregulators, including prohibitin-2 (PHB2). Because of its ability to repress the transcriptional activity of activated ERα, PHB2 is a promising antiproliferative agent. In this study, were analyzed the interaction of PHB2 with ERα and three mutants (Y537S, D538G, and E380Q) that are frequently associated with a lack of sensitivity to hormonal treatments, to help advance novel drug discovery. PHB2 bound to ERα wild-type (WT), Y537S, and D538G, but did not bind to E380Q. The binding thermodynamics of Y537S and D538G to PHB2 were favorably altered entropically compared with those of WT to PHB2. Our results show that PHB2 binds to the ligand binding domain of ERα with a conformational change in the helix 12 of ERα. - Highlights: • Molten globule-likeness of an ERα repressor Prohibitin-2 (PHB2) is identified. • The thermodynamics is validated for the interaction between ERα and PHB2. • PHB2 binds to Y537S and D538G mutants of ERα commonly found in breast cancer. • ERα WT and mutants showed different thermodynamic parameters in the binding to PHB2. • ERα binds to PHB2 with conformational change involving packing of helix 12.

  12. AFM images of complexes between amylose and Aspergillus niger glucoamylase mutants, native and mutant starch binding domains: a model for the action of glucoamylase

    DEFF Research Database (Denmark)

    Morris, V. M.; Gunning, A. P.; Faults, C. B.

    2005-01-01

    Atomic force microscopy has been used to investigate the complexes formed between high molecular weight amylose chains and Aspergillus niger glucoamylase mutants (E400Q and W52F), wild-type A. niger starch binding domains (SBDS), and mutant SBDs (W563K and W590K) lacking either of the two starch...

  13. Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants

    Science.gov (United States)

    Einav, Tal; Duque, Julia; Phillips, Rob

    2018-02-01

    Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.

  14. Aggregation of ALS-linked FUS mutant sequesters RNA binding proteins and impairs RNA granules formation

    Energy Technology Data Exchange (ETDEWEB)

    Takanashi, Keisuke; Yamaguchi, Atsushi, E-mail: atsyama@restaff.chiba-u.jp

    2014-09-26

    Highlights: • Aggregation of ALS-linked FUS mutant sequesters ALS-associated RNA-binding proteins (FUS wt, hnRNP A1, and hnRNP A2). • Aggregation of ALS-linked FUS mutant sequesters SMN1 in the detergent-insoluble fraction. • Aggregation of ALS-linked FUS mutant reduced the number of speckles in the nucleus. • Overproduced ALS-linked FUS mutant reduced the number of processing-bodies (PBs). - Abstract: Protein aggregate/inclusion is one of hallmarks for neurodegenerative disorders including amyotrophic lateral sclerosis (ALS). FUS/TLS, one of causative genes for familial ALS, encodes a multifunctional DNA/RNA binding protein predominantly localized in the nucleus. C-terminal mutations in FUS/TLS cause the retention and the inclusion of FUS/TLS mutants in the cytoplasm. In the present study, we examined the effects of ALS-linked FUS mutants on ALS-associated RNA binding proteins and RNA granules. FUS C-terminal mutants were diffusely mislocalized in the cytoplasm as small granules in transiently transfected SH-SY5Y cells, whereas large aggregates were spontaneously formed in ∼10% of those cells. hnRNP A1, hnRNP A2, and SMN1 as well as FUS wild type were assembled into stress granules under stress conditions, and these were also recruited to FUS mutant-derived spontaneous aggregates in the cytoplasm. These aggregates stalled poly(A) mRNAs and sequestered SMN1 in the detergent insoluble fraction, which also reduced the number of nuclear oligo(dT)-positive foci (speckles) in FISH (fluorescence in situ hybridization) assay. In addition, the number of P-bodies was decreased in cells harboring cytoplasmic granules of FUS P525L. These findings raise the possibility that ALS-linked C-terminal FUS mutants could sequester a variety of RNA binding proteins and mRNAs in the cytoplasmic aggregates, which could disrupt various aspects of RNA equilibrium and biogenesis.

  15. A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A; Wagner, R

    1979-01-01

    An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

  16. Epilepsy, Behavioral Abnormalities, and Physiological Comorbidities in Syntaxin-Binding Protein 1 (STXBP1 Mutant Zebrafish.

    Directory of Open Access Journals (Sweden)

    Brian P Grone

    Full Text Available Mutations in the synaptic machinery gene syntaxin-binding protein 1, STXBP1 (also known as MUNC18-1, are linked to childhood epilepsies and other neurodevelopmental disorders. Zebrafish STXBP1 homologs (stxbp1a and stxbp1b have highly conserved sequence and are prominently expressed in the larval zebrafish brain. To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing "dark-flash" visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity. Our findings in these newly generated mutant lines of zebrafish suggest that zebrafish recapitulate clinical phenotypes associated with human syntaxin-binding protein 1 mutations.

  17. SERCA mutant E309Q binds two Ca ions but adopts a catalytically incompetent conformation

    DEFF Research Database (Denmark)

    Clausen, Johannes D.; Bublitz, Maike; Arnou, Bertrand

    2013-01-01

    The sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) couples ATP hydrolysis to transport of Ca2+. This directed energy transfer requires cross-talk between the two Ca2+ sites and the phosphorylation site over 50 Å distance. We have addressed the mechano-structural basis for this intramolecular...... a shift of transmembrane segment M1 into an ‘up and kinked position’. This transition is impaired in the E309Q mutant, most likely due to a lack of charge neutralization and altered hydrogen binding capacities at Ca2+ site II....

  18. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  19. Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences.

    Science.gov (United States)

    Tedesco, D; Fischer-Fantuzzi, L; Vesco, C

    1993-03-01

    Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.

  20. Effects of mutants in bHLH region on structure stability and protein-DNA binding energy in DECs.

    Science.gov (United States)

    Kong, Yi; Wang, Zhen; Jia, Yanfei; Li, Ping; Hao, Shuhua; Wang, Yunshan

    2017-07-01

    The human DEC subfamily contains two highly conserved members belonging to basic helix-loop-helix (bHLH) transcription factors. This conserved family is spread widely among various species with the function of regulating various crucial molecular signaling pathways. Due to the significance of DECs for important biological processes, their relationship with diseases and the lack of experimentally proven structures, we have implemented a comparative modeling for the bHLH region of DECs as homodimers with themselves and heterodimers with HES-1. Three mutants with predicted roles in reducing intramolecular binding (H57A, R65A, and LL7879AA in DEC1 and LL7071AA in DEC2) were investigated on DEC monomers. Molecular dynamics (MD) simulations were also employed to evaluate the behavior of the mutant molecules in aqueous solution. The monomer was divided into subregions for accurate investigation. The fluctuation in the basic region of mutants was higher than that of wild-type molecules. The binding energy value between protein and DNA obviously increased in the homodimer harboring R65A mutants, which led to more unstable status between protein and DNA. Thus, the mutant R65A interfered DNA-binding affinity. A study on the spatial structures of wild-type and mutant DECs may facilitate functional prediction for mutation effects and dynamic behavior under various conditions and may ultimately help in targeted drug design.

  1. An Mcm10 Mutant Defective in ssDNA Binding Shows Defects in DNA Replication Initiation.

    Science.gov (United States)

    Perez-Arnaiz, Patricia; Kaplan, Daniel L

    2016-11-20

    Mcm10 is an essential protein that functions to initiate DNA replication after the formation of the replication fork helicase. In this manuscript, we identified a budding yeast Mcm10 mutant (Mcm10-m2,3,4) that is defective in DNA binding in vitro. Moreover, this Mcm10-m2,3,4 mutant does not stimulate the phosphorylation of Mcm2 by Dbf4-dependent kinase (DDK) in vitro. When we expressed wild-type levels of mcm10-m2,3,4 in budding yeast cells, we observed a severe growth defect and a substantially decreased DNA replication. We also observed a substantially reduced replication protein A- chromatin immunoprecipitation signal at origins of replication, reduced levels of DDK-phosphorylated Mcm2, and diminished Go, Ichi, Ni, and San (GINS) association with Mcm2-7 in vivo. mcm5-bob1 bypasses the growth defect conferred by DDK-phosphodead Mcm2 in budding yeast. However, the growth defect observed by expressing mcm10-m2,3,4 is not bypassed by the mcm5-bob1 mutation. Furthermore, origin melting and GINS association with Mcm2-7 are substantially decreased for cells expressing mcm10-m2,3,4 in the mcm5-bob1 background. Thus, the origin melting and GINS-Mcm2-7 interaction defects we observed for mcm10-m2,3,4 are not explained by decreased Mcm2 phosphorylation by DDK, since the defects persist in an mcm5-bob1 background. These data suggest that DNA binding by Mcm10 is essential for the initiation of DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Binding of purified and radioiodinated capsular polysaccharides from Cryptococcus neoformans serotype A strains to capsule-free mutants

    International Nuclear Information System (INIS)

    Small, J.M.; Mitchell, T.G.

    1986-01-01

    Strains 6, 15, 98, 110, and 145 of Cryptococcus neoformans serotype A vary in capsule size, animal virulence, and susceptibility to in vitro phagocytosis. The isolated capsular polysaccharides (CPSs) differ in monosaccharide composition ratios and molecular size, as determined by gel filtration. The purpose of this investigation was to characterize the binding of CPSs to capsule-free mutants of C. neoformans and to examine CPSs from these strains for differences in their ability to bind, to determine whether such differences might explain the variation in the pathobiology of these strains. CPSs were partially periodate oxidized, tyraminated, iodinated with 125 I, and used in binding studies with two capsule-free mutants of C. neoformans, strain 602 and Cap59. Binding was specific for yeast species and for polysaccharide and was saturable, which is consistent with a receptor-mediated mechanism of attachment. Binding occurred rapidly and was only slowly reversible. Binding was also independent of pH from pH 5.5 to 8, of cation concentrations, and of competition by sugars up to 1.0 M concentrations. Only a portion of CPS was capable of binding, and strains varied in the extent to which their CPS bound. CPS-15-IV (peak IV was the major polysaccharide peak on DEAE-cellulose chromatography of CPS from strain 15) had the highest proportion of binding (40%), followed by CPS from strains 98, 6, 145, 110, and 15-III (peak III was an earlier eluting fraction of CPS from strain 15). The CPSs differed similarly in their ability to competitively inhibit binding. Treatment of CPS, but not yeast cells, with proteinase XIV abolished binding without altering the CPS gross structure. Treatment of yeast cells with proteases, heat, or formaldehyde did not alter binding, and both strain 602 and Cap59 bound CPS similarly. Binding to encapsulated yeast cells was minimal

  3. Structural analysis of site-directed mutants of cellular retinoic acid-binding protein II addresses the relationship between structural integrity and ligand binding

    International Nuclear Information System (INIS)

    Vaezeslami, Soheila; Jia, Xiaofei; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James H.

    2008-01-01

    A water network stabilizes the structure of cellular retionic acid binding protein II. The structural integrity of cellular retinoic acid-binding protein II (CRABPII) has been investigated using the crystal structures of CRABPII mutants. The overall fold was well maintained by these CRABPII mutants, each of which carried multiple different mutations. A water-mediated network is found to be present across the large binding cavity, extending from Arg111 deep inside the cavity to the α2 helix at its entrance. This chain of interactions acts as a ‘pillar’ that maintains the integrity of the protein. The disruption of the water network upon loss of Arg111 leads to decreased structural integrity of the protein. A water-mediated network can be re-established by introducing the hydrophilic Glu121 inside the cavity, which results in a rigid protein with the α2 helix adopting an altered conformation compared with wild-type CRABPII

  4. Defective FANCI binding by a fanconi anemia-related FANCD2 mutant.

    Directory of Open Access Journals (Sweden)

    Koichi Sato

    Full Text Available FANCD2 is a product of one of the genes associated with Fanconi anemia (FA, a rare recessive disease characterized by bone marrow failure, skeletal malformations, developmental defects, and cancer predisposition. FANCD2 forms a complex with FANCI (ID complex and is monoubiquitinated, which facilitates the downstream interstrand crosslink (ICL repair steps, such as ICL unhooking and nucleolytic end resection. In the present study, we focused on the chicken FANCD2 (cFANCD2 mutant harboring the Leu234 to Arg (L234R substitution. cFANCD2 L234R corresponds to the human FANCD2 L231R mutation identified in an FA patient. We found that cFANCD2 L234R did not complement the defective ICL repair in FANCD2-/- DT40 cells. Purified cFANCD2 L234R did not bind to chicken FANCI, and its monoubiquitination was significantly deficient, probably due to the abnormal ID complex formation. In addition, the histone chaperone activity of cFANCD2 L234R was also defective. These findings may explain some aspects of Fanconi anemia pathogenesis by a FANCD2 missense mutation.

  5. Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants

    Directory of Open Access Journals (Sweden)

    Xueyong Zhu

    2015-11-01

    Full Text Available Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA mutants from ferret-transmissible H5N1 viruses of A/Vietnam/1203/2004 and A/Indonesia/5/2005 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6-linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3-linked sialosides. Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogs reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.

  6. dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

    Science.gov (United States)

    Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

    2012-03-01

    The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    Science.gov (United States)

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  8. CtBP1/BARS Gly172 → Glu mutant structure: Impairing NAD(H)-binding and dimerization

    International Nuclear Information System (INIS)

    Nardini, Marco; Valente, Carmen; Ricagno, Stefano; Luini, Alberto; Corda, Daniela; Bolognesi, Martino

    2009-01-01

    C-terminal binding proteins (CtBPs) are multi-functional proteins involved in nuclear transcriptional co-repression, Golgi membrane fission, and synaptic ribbon formation. Binding of NAD(H) to CtBPs promotes dimerization. CtBP dimers act as a scaffold for multimeric protein complex formation, thus bridging transcriptional repressors and their targets in the nucleus. Based on size-exclusion chromatography experiments and on the crystal structure of the NAD(H)-free G172E CtBP mutant, we show here that absence of NAD(H) induces flexibility/backbone conformational changes at the dimerization interface and at the CtBP interdomain region. The results presented shed first light on the correlation between NAD(H)-binding and functional CtBP dimerization.

  9. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Deficiency of toxin-binding protein activity in mutants of sugarcane clone H54-775 as it relates to disease resistance

    International Nuclear Information System (INIS)

    Strobel, G.A.; Steiner, G.W.; Byther, R.

    1975-01-01

    Three mutants selected from a population of sugarcane clone H54-775 that had been irradiated with 3 kR γ-radiation all lacked toxin-binding protein activity. This activity previously had been shown to be essential for eye spot disease susceptibility and was demonstrated in the susceptible parent clone H54-775. In one mutant, the biochemical, immunochemical, and electrophoretic mobilities of the toxin-binding protein were all modified

  11. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft

    DEFF Research Database (Denmark)

    Kandra, L.; Abou Hachem, Maher; Gyemant, G.

    2006-01-01

    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....

  12. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  13. Chylomicronemia with a mutant GPIHBP1 (Q115P) that cannot bind lipoprotein lipase

    NARCIS (Netherlands)

    Beigneux, Anne P; Franssen, Remco; Bensadoun, André; Gin, Peter; Melford, Kristan; Peter, Jorge; Walzem, Rosemary L; Weinstein, Michael M; Davies, Brandon S J; Kuivenhoven, Jan A; Kastelein, John J P; Fong, Loren G; Dallinga-Thie, Geesje M; Young, Stephen G

    OBJECTIVE: GPIHBP1 is an endothelial cell protein that binds lipoprotein lipase (LPL) and chylomicrons. Because GPIHBP1 deficiency causes chylomicronemia in mice, we sought to determine whether some cases of chylomicronemia in humans could be attributable to defective GPIHBP1 proteins. METHODS AND

  14. Binding of cetuximab to the EGFRvIII deletion mutant and its biological consequences in malignant glioma cells

    International Nuclear Information System (INIS)

    Jutten, Barry; Dubois, Ludwig; Li Younan; Aerts, Hugo; Wouters, Bradly G.; Lambin, Philippe; Theys, Jan; Lammering, Guido

    2009-01-01

    Background and purpose: Despite the clinical use of cetuximab, a chimeric antibody against EGFR, little is known regarding its interaction with EGFRvIII, a frequently expressed deletion mutant of EGFR. Therefore, we investigated the interaction and the functional consequences of cetuximab treatment on glioma cells stably expressing EGFRvIII. Materials and methods: The human glioma cell line U373 genetically modified to express EGFRvIII was used to measure the binding of cetuximab and its internalization using flow cytometry and confocal microscopy. Proliferation and cell survival were analyzed by cell growth and clonogenic survival assays. Results: Cetuximab is able to bind to EGFRvIII and causes an internalization of the receptor and decreases its expression levels. Furthermore, in contrast to EGF, cetuximab was able to activate EGFRvIII which was evidenced by multiple phosphorylation sites and its downstream signaling targets. Despite this activation, the growth rate and the radiosensitivity of the EGFRvIII-expressing glioma cells were not modulated. Conclusions: Cetuximab binds to EGFRvIII and leads to the initial activation, internalization and subsequent downregulation of EGFRvIII, but it does not seem to modulate the proliferation or radiosensitivity of EGFRvIII-expressing glioma cells. Thus, approaches to treat EGFRvIII-expressing glioma cells should be evaluated more carefully.

  15. Substrate binding activates the designed triple mutant of the colicin E7 metallonuclease

    Czech Academy of Sciences Publication Activity Database

    Németh, E.; Körtvélyesi, T.; Kožíšek, Milan; Thulstrup, P. W.; Christensen, H. E. M.; Asaka, M. N.; Nagata, K.; Gyurcsik, B.

    2014-01-01

    Roč. 19, č. 8 (2014), s. 1295-1303 ISSN 0949-8257 Grant - others:OPPC(XE) CZ.2.16/3.1.00/24016; Seventh Framework Programme of the European Union(XE) FP7-312284 Institutional support: RVO:61388963 Keywords : binding affinity * calorimetry * zinc nuclease * substrate induced folding * protein engineering Subject RIV: CE - Biochemistry Impact factor: 2.538, year: 2014

  16. Binding of mutant and wild type p53 proteins to supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Pivoňková, Hana; Walter, K.; Warnecke, Gabriele; Živanovic, Marko; Krstic, Dušan; Paleček, Emil; Deppert, W.; Fojta, Miroslav

    2005-01-01

    Roč. 3, č. 1 (2005), S4-S5 ISSN 1214-021X. [Cells VI - Biological Days /18./. 24.10.2005-26.10.2005, České Budějovice] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GA301/05/0416 Institutional research plan: CEZ:AV0Z50040507 Keywords : wtp53 * hot spot mutp53 * SCS binding Subject RIV: BO - Biophysics

  17. Transcriptional switching by the MerR protein: Activation and repression mutants implicate distinct DNA and mercury(II) binding domains

    International Nuclear Information System (INIS)

    Shewchuk, L.M.; Helmann, J.D.; Ross, W.; Park, S.J.; Summers, A.O.; Walsh, C.T.

    1989-01-01

    Bacterial resistance to mercuric compounds is controlled by the MerR metalloregulatory protein. The MerR protein functions as both a transcriptional repressor and a mercuric ion dependent transcriptional activator. Chemical mutagenesis of the cloned merR structural gene has led to the identification of mutant proteins that are specifically deficient in transcriptional repression, activation, or both. Five mutant proteins have been overproduced, purified to homogeneity, and assayed for ability to dimerize, bind mer operator DNA, and bind mercuric ion. A mutation in the recognition helix of a proposed helix-turn-helix DNA binding motif (E22K) yields protein deficient in both activation and repression in vivo (a - r - ) and deficient in operator binding in vitro. In contrast, mutations in three of the four MerR cysteine residues are repression competent but activation deficient (a - r + ) in vivo. In vitro, the purified cysteine mutant proteins bind to the mer operator site with near wild-type affinity but are variable deficient in binding the in vivo inducer mercury(II) ion. A subset of the isolated proteins also appears compromised in their ability to form dimers at low protein concentrations. These data support a model in which DNA-bound MerR dimer binds one mercuric ion and transmits this occupancy information to a protein region involved in transcriptional activation

  18. Dynamic fluorescence spectroscopy on single tryptophan mutants of EIImtl in detergent micelles : Effects of substrate binding and phosphorylation on the fluorescence and anisotropy decay

    NARCIS (Netherlands)

    Swaving Dijkstra, Dolf; Broos, J.; Visser, Antonie J.W.G.; van Hoek, A.; Robillard, George

    1997-01-01

    The effects of substrate and substrate analogue binding and phosphorylation on the conformational dynamics of the mannitol permease of Escherichia coli were investigated, using time-resolved fluorescence spectroscopy on mutants containing five single tryptophans situated in the membrane-embedded C

  19. Spontaneous nisin-resistant Listeria monocytogenes mutants with increased expression of a putative penicillin-binding protein and their sensitivity to various antibiotics

    DEFF Research Database (Denmark)

    Gravesen, Anne; Sorensen, K.; Aarestrup, Frank Møller

    2001-01-01

    -molecular-weight penicillin-binding proteins (PBPs), a histidine protein kinase, a protein of unknown function, and ClpB (putative functions from homology), The three former proteins had increased expression in a total of six out of 10 independent mutants originating from five different wildtype strains, indicating...

  20. Dynamics of translocation and substrate binding in individual complexes formed with active site mutants of {phi}29 DNA polymerase.

    Science.gov (United States)

    Dahl, Joseph M; Wang, Hongyun; Lázaro, José M; Salas, Margarita; Lieberman, Kate R

    2014-03-07

    The Φ29 DNA polymerase (DNAP) is a processive B-family replicative DNAP. Fluctuations between the pre-translocation and post-translocation states can be quantified from ionic current traces, when individual Φ29 DNAP-DNA complexes are held atop a nanopore in an electric field. Based upon crystal structures of the Φ29 DNAP-DNA binary complex and the Φ29 DNAP-DNA-dNTP ternary complex, residues Tyr-226 and Tyr-390 in the polymerase active site were implicated in the structural basis of translocation. Here, we have examined the dynamics of translocation and substrate binding in complexes formed with the Y226F and Y390F mutants. The Y226F mutation diminished the forward and reverse rates of translocation, increased the affinity for dNTP in the post-translocation state by decreasing the dNTP dissociation rate, and increased the affinity for pyrophosphate in the pre-translocation state. The Y390F mutation significantly decreased the affinity for dNTP in the post-translocation state by decreasing the association rate ∼2-fold and increasing the dissociation rate ∼10-fold, implicating this as a mechanism by which this mutation impedes DNA synthesis. The Y390F dissociation rate increase is suppressed when complexes are examined in the presence of Mn(2+) rather than Mg(2+). The same effects of the Y226F or Y390F mutations were observed in the background of the D12A/D66A mutations, located in the exonuclease active site, ∼30 Å from the polymerase active site. Although translocation rates were unaffected in the D12A/D66A mutant, these exonuclease site mutations caused a decrease in the dNTP dissociation rate, suggesting that they perturb Φ29 DNAP interdomain architecture.

  1. Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

    International Nuclear Information System (INIS)

    Wang Qishan; Bag, Jnanankur

    2008-01-01

    Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO 4 , and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40, and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein

  2. Apolar Distal Pocket Mutants of Yeast Cytochrome c Peroxidase: Hydrogen Peroxide Reactivity and Cyanide Binding of the TriAla, TriVal, and TriLeu Variants

    Science.gov (United States)

    Bidwai, Anil K.; Meyen, Cassandra; Kilheeney, Heather; Wroblewski, Damian; Vitello, Lidia B.; Erman, James E.

    2012-01-01

    Three yeast cytochrome c peroxidase (CcP) variants with apolar distal heme pockets have been constructed. The CcP variants have Arg48, Trp51, and His52 mutated to either all alanines, CcP(triAla), all valines, CcP(triVal), or all leucines, CcP(triLeu). The triple mutants have detectable enzymatic activity at pH 6 but the activity is less than 0.02% that of wild-type CcP. The activity loss is primarily due to the decreased rate of reaction between the triple mutants and H2O2 compared to wild-type CcP. Spectroscopic properties and cyanide binding characteristics of the triple mutants have been investigated over the pH stability region of CcP, pH 4 to 8. The absorption spectra indicate that the CcP triple mutants have hemes that are predominantly five-coordinate, high-spin at pH 5 and six-coordinate, low-spin at pH 8. Cyanide binding to the triple mutants is biphasic indicating that the triple mutants have two slowly-exchanging conformational states with different cyanide affinities. The binding affinity for cyanide is reduced at least two orders of magnitude in the triple mutants compared to wild-type CcP and the rate of cyanide binding is reduced by four to five orders of magnitude. Correlation of the reaction rates of CcP and 12 distal pocket mutants with H2O2 and HCN suggests that both reactions require ionization of the reactants within the distal heme pocket allowing the anion to bind the heme iron. Distal pocket features that promote substrate ionization (basic residues involved in base-catalyzed substrate ionization or polar residues that can stabilize substrate anions) increase the overall rate of reaction with H2O2 and HCN while features that inhibit substrate ionization slow the reactions. PMID:23022490

  3. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  4. A KAS2 cDNA complements the phenotypes of the Arabidopsis fab1 mutant that differs in a single residue bordering the substrate binding pocket

    DEFF Research Database (Denmark)

    Carlsson, A.S.; LaBrie, S.T.; Kinney, A.J.

    2002-01-01

    The fab1 mutant of Arabidopsis is partially deficient in activity of ß-ketoacyl-[acyl carrier protein] synthase II (KAS II). This defect results in increased levels of 16 : 0 fatty acid and is associated with damage and death of the mutants at low temperature. Transformation of fab1 plants with a c......DNA from Brassica napus encoding a KAS II enzyme resulted in complementation of both mutant phenotypes. The dual complementation by expression of the single gene proves that low-temperature damage is a consequence of altered membrane unsaturation. The fab1 mutation is a single nucleotide change...... chain to bend. For functional analysis the equivalent Leu207Phe mutation was introduced into the fabB gene encoding the E. coli KAS I enzyme. Compared to wild-type, the Leu207Phe protein showed a 10-fold decrease in binding affinity for the fatty acid substrate, exhibited a modified behavior during size...

  5. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with SV40 T-antigen mutants defective in RB and P53 binding domains

    International Nuclear Information System (INIS)

    LingNah Su; Little, J.B.

    1992-01-01

    A series of human diploid fibroblast cell clones were developed by DNA transfection with either wild-type SV40 T-antigen (SV40T) or T-antigen mutants defective in its various functional domains. Cell clones expressing the wild-type SV40 T were significantly radioresistant as compared with clones transfected with the neo gene only (D o 192 ± 13 vs 127 ± 19). This radioresistance persisted in post-crisis, immortalized cell lines. A series of mutants with point or deletion mutations within each functionally active domain of SV40 T were also examined for their ability to alter radiosensitivity and induce morphological transformation. Cell clones transfected with T-antigen mutants defective in nuclear localization or origin binding showed increased radioresistance similar to clones transfected with wild-type T-antigen, and expressed morphological changes characteristic of SV40 T-transfected cells. (author)

  6. Arg156 in the AP2-domain exhibits the highest binding activity among the 20 individuals to the GCC box in BnaERF-B3-hy15, a mutant ERF transcription factor from Brassica napus

    Directory of Open Access Journals (Sweden)

    Jing Zhuang

    2016-10-01

    Full Text Available To develop mutants of the ERF factor with more binding activities to the GCC box, we performed in vitro directed evolution by using DNA shuffling and screened mutants through yeast one-hybrid assay. Here, a series of mutants were obtained and used to reveal key amino acids that induce changes in the DNA binding activity of the BnaERF-B3 protein. With the BnaERF-B3-hy15 as the template, we produced 12 mutants which host individual mutation of potential key residues. We found that amino acid 156 is the key site, and the other 18 mutants host the 18 corresponding individual amino acid residues at site 156. Among the 20 individuals comprising WT (Gly156, Mu3 (Arg156, and 18 mutants with other 18 amino acid residues, Arg156 in the AP2-domain is the amino acid residue with the highest binding activity to the GCC box. The structure of the α-helix in the AP2-domain affects the binding activity. Other residues within AP2-domain modulated binding activity of ERF protein, suggesting that these positions are important for binding activity. Comparison of the mutant and wild-type transcription factors revealed the relationship of protein function and sequence modification. Our result provides a potential useful resource for understanding the trans-activation of ERF proteins.

  7. Biofilm formation and binding specificities of CFA/I, CFA/II and CS2 adhesions of enterotoxigenic Escherichia coli and Cfae-R181A mutant.

    Science.gov (United States)

    Liaqat, Iram; Sakellaris, Harry

    2012-07-01

    Enterotoxigenic Escherichia coli (ETEC) strains are leading causes of childhood diarrhea in developing countries. Adhesion is the first step in pathogenesis of ETEC infections and ETEC pili designated colonization factor antigens (CFAs) are believed to be important in the biofim formation, colonization and host cell adhesions. As a first step, we have determined the biofilm capability of ETEC expressing various types of pili (CFA/I, CfaE-R181A mutant/CfaE tip mutant, CFA/II and CS2). Further, enzyme-linked immunosorbent assay (ELISA) assay were developed to compare the binding specificity of CFA/I, CFA/II (CS1 - CS3) and CS2 of ETEC, using extracted pili and piliated bacteria. CFA/II strain (E24377a) as well as extracted pili exhibited significantly higher binding both in biofilm and ELISA assays compared to non piliated wild type E24377a, CFA/I and CS2 strains. This indicates that co-expression of two or more CS2 in same strain is more efficient in increasing adherence. Significant decrease in binding specificity of DH5αF'lacI (q)/∆cotD (CS2) strain and MC4100/pEU2124 (CfaE-R181A) mutant strain indicated the important contribution of tip proteins in adherence assays. However, CS2 tip mutant strain (DH5αF'lacI (q)/pEU5881) showed that this specific residue may not be important as adhesions in these strains. In summary, our data suggest that pili, their minor subunits are important for biofilm formation and adherence mechanisms. Overall, the functional reactivity of strains co expressing various antigens, particularly minor subunit antigen observed in this study suggest that fewer antibodies may be required to elicit immunity to ETEC expressing a wider array of related pili.

  8. Analysis of Metal-Binding Features of the Wild Type and Two Domain-Truncated Mutant Variants of Littorina littorea Metallothionein Reveals Its Cd-Specific Character

    Directory of Open Access Journals (Sweden)

    Òscar Palacios

    2017-07-01

    Full Text Available After the resolution of the 3D structure of the Cd9-aggregate of the Littorina littorea metallothionein (MT, we report here a detailed analysis of the metal binding capabilities of the wild type MT, LlwtMT, and of two truncated mutants lacking either the N-terminal domain, Lltr2MT, or both the N-terminal domain, plus four extra flanking residues (SSVF, Lltr1MT. The recombinant synthesis and in vitro studies of these three proteins revealed that LlwtMT forms unique M9-LlwtMT complexes with Zn(II and Cd(II, while yielding a complex mixture of heteronuclear Zn,Cu-LlwtMT species with Cu(I. As expected, the truncated mutants gave rise to unique M6-LltrMT complexes and Zn,Cu-LltrMT mixtures of lower stoichiometry with respect to LlwtMT, with the SSVF fragment having an influence on their metal binding performance. Our results also revealed a major specificity, and therefore a better metal-coordinating performance of the three proteins for Cd(II than for Zn(II, although the analysis of the Zn(II/Cd(II displacement reaction clearly demonstrates a lack of any type of cooperativity in Cd(II binding. Contrarily, the analysis of their Cu(I binding abilities revealed that every LlMT domain is prone to build Cu4-aggregates, the whole MT working by modules analogously to, as previously described, certain fungal MTs, like those of C. neoformans and T. mesenterica. It is concluded that the Littorina littorea MT is a Cd-specific protein that (beyond its extended binding capacity through an additional Cd-binding domain confers to Littorina littorea a particular adaptive advantage in its changeable marine habitat.

  9. Crystallographic Analysis Reveals a Novel Second Binding Site for Trimethoprim in Active Site Double Mutants of Human Dihydrofolate Reductase†,‡

    Science.gov (United States)

    Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.

    2011-01-01

    In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339

  10. Ectopic expression of a polyalanine expansion mutant of poly(A)-binding protein N1 in muscle cells in culture inhibits myogenesis

    International Nuclear Information System (INIS)

    Wang Qishan; Bag, Jnanankur

    2006-01-01

    Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset dominant genetic disease caused by the expansion of a GCG trinucleotide repeat that encodes the polyalanine tract at the N-terminus of the nuclear poly(A)-binding protein (PABPN1). Presence of intranuclear inclusions (INIs) containing PABPN1 aggregates in the skeletal muscles is the hallmark of OPMD. Here, we show that ectopic expression of the mutant PABPN1 produced INIs in a muscle cell culture model and reduced expression of several muscle-specific proteins including α-actin, slow troponin C, muscle creatine kinase, and two myogenic transcription factors, myogenin and MyoD. However, the levels of two upstream regulators of the MyoD gene, the Myf-5 and Pax3/7, were not affected, but both proteins co-localized with the PABPN1 aggregates in the mutant PABPN1 overexpressing cells. In these cells, although myogenin and MyoD levels were reduced, these two transcription factors did not co-localize with the mutant PABPN1 aggregates. Therefore, sequestration of Myf5 and Pax3/7 by the mutant PABPN1 aggregates was a specific effect on these factors. Our results suggest that trapping of these two important myogenic determinants may interfere with an early step in myogenesis

  11. Mutants of the major ryegrass pollen allergen, Lol p 5, with reduced IgE-binding capacity: candidates for grass pollen-specific immunotherapy.

    Science.gov (United States)

    Swoboda, Ines; De Weerd, Nicole; Bhalla, Prem L; Niederberger, Verena; Sperr, W R; Valent, Peter; Kahlert, Helga; Fiebig, Helmut; Verdino, Petra; Keller, Walter; Ebner, Christof; Spitzauer, Susanne; Valenta, Rudolf; Singh, Mohan B

    2002-01-01

    More than 400 million individuals are sensitized to grass pollen allergens. Group 5 allergens represent the most potent grass pollen allergens recognized by more than 80 % of grass pollen allergic patients. The aim of our study was to reduce the allergenic activity of group 5 allergens for specific immunotherapy of grass pollen allergy. Based on B- and T-cell epitope mapping studies and on sequence comparison of group 5 allergens from different grasses, point mutations were introduced by site-directed mutagenesis in highly conserved sequence domains of Lol p 5, the group 5 allergen from ryegrass. We obtained Lol p 5 mutants with low IgE-binding capacity and reduced allergenic activity as determined by basophil histamine release and by skin prick testing in allergic patients. Circular dichroism analysis showed that these mutants exhibited an overall structural fold similar to the recombinant Lol p 5 wild-type allergen. In addition, Lol p 5 mutants retained the ability to induce proliferation of group 5 allergen-specific T cell lines and clones. Our results demonstrate that a few point mutations in the Lol p 5 sequence yield mutants with reduced allergenic activity that represent potential vaccine candidates for immunotherapy of grass pollen allergy.

  12. An allosteric binding site at the human serotonin transporter mediates the inhibition of escitalopram by R-citalopram: kinetic binding studies with the ALI/VFL-SI/TT mutant.

    Science.gov (United States)

    Zhong, Huailing; Hansen, Kasper B; Boyle, Noel J; Han, Kiho; Muske, Galina; Huang, Xinyan; Egebjerg, Jan; Sánchez, Connie

    2009-10-25

    The human serotonin transporter (hSERT) has primary and allosteric binding sites for escitalopram and R-citalopram. Previous studies have established that the interaction of these two compounds at a low affinity allosteric binding site of hSERT can affect the dissociation of [(3)H]escitalopram from hSERT. The allosteric binding site involves a series of residues in the 10th, 11th, and 12th trans-membrane domains of hSERT. The low affinity allosteric activities of escitalopram and R-citalopram are essentially eliminated in a mutant hSERT with changes in some of these residues, namely A505V, L506F, I507L, S574T, I575T, as measured in dissociation binding studies. We confirm that in association binding experiments, R-citalopram at clinically relevant concentrations reduces the association rate of [(3)H]escitalopram as a ligand to wild type hSERT. We demonstrate that the ability of R-citalopram to reduce the association rate of escitalopram is also abolished in the mutant hSERT (A505V, L506F, I507L, S574T, I575T), along with the expected disruption the low affinity allosteric function on dissociation binding. This suggests that the allosteric binding site mediates both the low affinity and higher affinity interactions between R-citalopram, escitalopram, and hSERT. Our data add an additional structural basis for the different efficacies of escitalopram compared to racemic citalopram reported in animal studies and clinical trials, and substantiate the hypothesis that hSERT has complex allosteric mechanisms underlying the unexplained in vivo activities of its inhibitors.

  13. Crl binds to domain 2 of σ(S) and confers a competitive advantage on a natural rpoS mutant of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Monteil, Véronique; Kolb, Annie; Mayer, Claudine; Hoos, Sylviane; England, Patrick; Norel, Françoise

    2010-12-01

    The RpoS sigma factor (σ(S)) is the master regulator of the bacterial response to a variety of stresses. Mutants in rpoS arise in bacterial populations in the absence of stress, probably as a consequence of a subtle balance between self-preservation and nutritional competence. We characterized here one natural rpoS mutant of Salmonella enterica serovar Typhi (Ty19). We show that the rpoS allele of Ty19 (rpoS(Ty19)) led to the synthesis of a σ(S)(Ty19) protein carrying a single glycine-to-valine substitution at position 282 in σ(S) domain 4, which was much more dependent than the wild-type σ(S) protein on activation by Crl, a chaperone-like protein that increases the affinity of σ(S) for the RNA polymerase core enzyme (E). We used the bacterial adenylate cyclase two-hybrid system to demonstrate that Crl bound to residues 72 to 167 of σ(S) domain 2 and that G282V substitution did not directly affect Crl binding. However, this substitution drastically reduced the ability of σ(S)(Ty19) to bind E in a surface plasmon resonance assay, a defect partially rescued by Crl. The modeled structure of the Eσ(S) holoenzyme suggested that substitution G282V could directly disrupt a favorable interaction between σ(S) and E. The rpoS(Ty19) allele conferred a competitive fitness when the bacterial population was wild type for crl but was outcompeted in Δcrl populations. Thus, these results indicate that the competitive advantage of the rpoS(Ty19) mutant is dependent on Crl and suggest that crl plays a role in the appearance of rpoS mutants in bacterial populations.

  14. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  15. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  16. Phosphorus Partitioning of Soybean Lines Containing Different Mutant Alleles of Two Soybean Seed-Specific Adenosine Triphosphate-Binding Cassette Phytic Acid Transporter Paralogs

    Directory of Open Access Journals (Sweden)

    Jason D. Gillman

    2013-03-01

    Full Text Available Seed phytate is a repository of P and minerals in soybean [ (L. Merr.] seeds that limits P and mineral bioavailability for monogastric animals (e.g., humans, swine [], and poultry [especially chicken, ] due to insufficient digestive tract phytase activity. We previously identified epistatic recessive mutations affecting two paralogous adenosine triphosphate-binding cassette phytic acid transporter genes (one a nonsense mutation in and the other a missense mutation in as the molecular genetic basis in the ethyl methanesulfonate (EMS-induced mutant low phytate soybean line M153. An additional mutant low phytate line, M766, contained one single nucleotide polymorphism within the ninth intron of the locus as well as a nonsense mutation in . The objectives of this research were to clarify the genetics underlying the low phytate phenotype in line M766 and to determine P partitioning in new combinations of mutant alleles from M766 and M153. Inheritance of nonsense alleles affecting both ( genes (one from M153 and one from M766 led to the production of viable seeds that contained transgressive reductions in total seed phytate and significantly higher levels of inorganic phosphate than has been reported for nontransgenic soybean material and will allow efficient molecular selection of soybeans with even greater reductions of phytate for improved quality soybean meal.

  17. An attenuated Shigella mutant lacking the RNA-binding protein Hfq provides cross-protection against Shigella strains of broad serotype.

    Science.gov (United States)

    Mitobe, Jiro; Sinha, Ritam; Mitra, Soma; Nag, Dhrubajyoti; Saito, Noriko; Shimuta, Ken; Koizumi, Nobuo; Koley, Hemanta

    2017-07-01

    Few live attenuated vaccines protect against multiple serotypes of bacterial pathogen because host serotype-specific immune responses are limited to the serotype present in the vaccine strain. Here, immunization with a mutant of Shigella flexneri 2a protected guinea pigs against subsequent infection by S. dysenteriae type 1 and S. sonnei strains. This deletion mutant lacked the RNA-binding protein Hfq leading to increased expression of the type III secretion system via loss of regulation, resulting in attenuation of cell viability through repression of stress response sigma factors. Such increased antigen production and simultaneous attenuation were expected to elicit protective immunity against Shigella strains of heterologous serotypes. Thus, the vaccine potential of this mutant was tested in two guinea pig models of shigellosis. Animals vaccinated in the left eye showed fewer symptoms upon subsequent challenge via the right eye, and even survived subsequent intestinal challenge. In addition, oral vaccination effectively induced production of immunoglobulins without severe side effects, again protecting all animals against subsequent intestinal challenge with S. dysenteriae type 1 or S. sonnei strains. Antibodies against common virulence proteins and the O-antigen of S. flexneri 2a were detected by immunofluorescence microscopy. Reaction of antibodies with various strains, including enteroinvasive Escherichia coli, suggested that common virulence proteins induced protective immunity against a range of serotypes. Therefore, vaccination is expected to cover not only the most prevalent serotypes of S. sonnei and S. flexneri 2a, but also various Shigella strains, including S. dysenteriae type 1, which produces Shiga toxin.

  18. Four novel FBN1 mutations: Significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Dietz, H.C.; McIntosh, I.; Pyeritz, R.E.; Francomano, C.A. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)); Sakai, L.Y.; Corson, G.M.; Chalberg, S.C. (Oregon Health Sciences Univ., Portland (United States))

    1993-08-01

    Defects of fibrillin (FBN1), a glycoprotein component of the extracellular microfibril, cause Marfan syndrome. This disorder is characterized by marked inter- and intrafamilial variation in phenotypic severity. To understand the molecular basis for this clinical observation, the authors have screened the fibrillin gene (FBN1) on chromosome 15, including the newly cloned 5[prime] coding sequence, for disease-producing alterations in a panel of patients with a wide range of manifestations and clinical severity. All the missense mutations identified to date, including two novel mutations discussed here, are associated with classic and moderate to severe disease and occur at residues with putative significance for calcium binding to epidermal growth factor (EGF)-like domains. In contrast, two new mutations that create premature signals for termination of translation of mRNA and are associated with reduction in the amount of mutant allele transcript produce a range of phenotypic severity. The patient with the lowest amount of mutant transcript has the mildest disease. These data support a role for altered calcium binding to EGF-like domains in the pathogenesis of Marfan syndrome and suggest a dominant negative mechanism for the pathogenesis of this disorder. 26 refs., 6 figs., 1 tab.

  19. Identification of a 34 kDa protein altered in the LF-1 mutant as the herbicide-binding D1 protein of photosystem II

    International Nuclear Information System (INIS)

    Metz, J.; Pakrasi, H.; Seibert, M.; Arntzen, C.

    1986-01-01

    The LF-1 mutant of Scenedesmus has a complete block on the oxidizing side of its PSII reaction center. However, the reaction center as well as the reducing side of PSII is fully functional in this mutant. Compared to the wildtype (WT) the only detected protein difference in the PSII complex of LF-1 is the change in mobility of a 34 kDa protein to 36 kDa. This protein has been implicated to have a major role in Mn-binding and water-oxidation. The authors have recently shown that photoaffinity labeling of thylakoids with azido-[ 14 C]-atrazine tags the 34 kDa protein in WT and the 36 kDa protein in LF-1. It has been shown that the azido-atrazine labeled protein, called D1, functions in herbicide binding and Q/sub A/ to Q/sub B/ electron transfer on the reducing side of PSII. Polyclonal antibodies directed against the D1 protein of Amaranthus hybridus (Ohad, et al., EMBOJ 1985) were found to recognize the Scenedesmus 34 kDa (WT) and 36 kDa (LF-1) proteins. The implied dual function for the D1 protein on the reducing as well as the oxidizing side of PSII reaction center will be discussed

  20. Hyperactivity of the Arabidopsis cryptochrome (cry1) L407F mutant is caused by a structural alteration close to the cry1 ATP-binding site.

    Science.gov (United States)

    Orth, Christian; Niemann, Nils; Hennig, Lars; Essen, Lars-Oliver; Batschauer, Alfred

    2017-08-04

    Plant cryptochromes (cry) act as UV-A/blue light receptors. The prototype, Arabidopsis thaliana cry1, regulates several light responses during the life cycle, including de-etiolation, and is also involved in regulating flowering time. The cry1 photocycle is initiated by light absorption by its FAD chromophore, which is most likely fully oxidized (FAD ox ) in the dark state and photoreduced to the neutral flavin semiquinone (FADH°) in its lit state. Cryptochromes lack the DNA-repair activity of the closely related DNA photolyases, but they retain the ability to bind nucleotides such as ATP. The previously characterized L407F mutant allele of Arabidopsis cry1 is biologically hyperactive and seems to mimic the ATP-bound state of cry1, but the reason for this phenotypic change is unclear. Here, we show that cry1 L407F can still bind ATP, has less pronounced photoreduction and formation of FADH° than wild-type cry1, and has a dark reversion rate 1.7 times lower than that of the wild type. The hyperactivity of cry1 L407F is not related to a higher FADH° occupancy of the photoreceptor but is caused by a structural alteration close to the ATP-binding site. Moreover, we show that ATP binds to cry1 in both the dark and the lit states. This binding was not affected by cry1's C-terminal extension, which is important for signal transduction. Finally, we show that a recently discovered chemical inhibitor of cry1, 3-bromo-7-nitroindazole, competes for ATP binding and thereby diminishes FADH° formation, which demonstrates that both processes are important for cry1 function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

    Science.gov (United States)

    Hagemann, H; Marcillat, O; Buchet, R; Vial, C

    2000-08-08

    Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

  2. Characterization of a Mutant Diphtheria Toxin that is Defective in Binding to Cell Membrane Receptors on Vero Cells

    Science.gov (United States)

    1982-08-13

    pinocytlc activity was demonstrated by the Increase in lysosomal vesicles ( acid phosphatase -positive vesicles) (4, 13). Poly-L-ornithine increased... wheat germ agglutinin and the protection was reversed by a-methly- mannoslde and N-acetylglucosamlne, respectively. These studies suggested that the...on the cell surface were involved in the initial binding of toxin to cell surface receptors. Concanavalin A and wheat germ agglutinin Inhibited the

  3. An attenuated Shigella mutant lacking the RNA-binding protein Hfq provides cross-protection against Shigella strains of broad serotype.

    Directory of Open Access Journals (Sweden)

    Jiro Mitobe

    2017-07-01

    Full Text Available Few live attenuated vaccines protect against multiple serotypes of bacterial pathogen because host serotype-specific immune responses are limited to the serotype present in the vaccine strain. Here, immunization with a mutant of Shigella flexneri 2a protected guinea pigs against subsequent infection by S. dysenteriae type 1 and S. sonnei strains. This deletion mutant lacked the RNA-binding protein Hfq leading to increased expression of the type III secretion system via loss of regulation, resulting in attenuation of cell viability through repression of stress response sigma factors. Such increased antigen production and simultaneous attenuation were expected to elicit protective immunity against Shigella strains of heterologous serotypes. Thus, the vaccine potential of this mutant was tested in two guinea pig models of shigellosis. Animals vaccinated in the left eye showed fewer symptoms upon subsequent challenge via the right eye, and even survived subsequent intestinal challenge. In addition, oral vaccination effectively induced production of immunoglobulins without severe side effects, again protecting all animals against subsequent intestinal challenge with S. dysenteriae type 1 or S. sonnei strains. Antibodies against common virulence proteins and the O-antigen of S. flexneri 2a were detected by immunofluorescence microscopy. Reaction of antibodies with various strains, including enteroinvasive Escherichia coli, suggested that common virulence proteins induced protective immunity against a range of serotypes. Therefore, vaccination is expected to cover not only the most prevalent serotypes of S. sonnei and S. flexneri 2a, but also various Shigella strains, including S. dysenteriae type 1, which produces Shiga toxin.

  4. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Science.gov (United States)

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  5. Rescue of Na+ and H+ binding in Na+,K+-ATPase M8 aspartate mutants by secondary mutation

    DEFF Research Database (Denmark)

    Holm, Rikke; Einholm, Anja P.; Andersen, Jens Peter

    A mutation replacing the aspartate in transmembrane segment M8 in the a3-isoform of Na,K-ATPase with asparagine has been found in patients with rapid-onset dystonia parkinsonism or alternating hemiplegia of childhood. This aspartate may be a critical Na+ coordinating residue, but the crystal......-isoforms of Na,K-ATPase, and much smaller effects were seen for other mutations to the M8 aspartate, which were less disruptive of Na+ binding than mutations to other residues related to Na+ site III. The D928 (rat a1 numbering) mutations strongly diminished the cooperativity of Na+ binding. Moreover the p......H optimum of Na,K-ATPase activity was left-shifted, again with D928N being most disruptive. The reduced affinity for activating Na+ and for inhibitory protons, caused by D928N and D928A mutations, could be rescued by introduction of an additional mutation of a glutamate located far away from D928....

  6. Lipid binding defects and perturbed synaptogenic activity of a Collybistin R290H mutant that causes epilepsy and intellectual disability.

    Science.gov (United States)

    Papadopoulos, Theofilos; Schemm, Rudolf; Grubmüller, Helmut; Brose, Nils

    2015-03-27

    Signaling at nerve cell synapses is a key determinant of proper brain function, and synaptic defects--or synaptopathies--are at the basis of many neurological and psychiatric disorders. In key areas of the mammalian brain, such as the hippocampus or the basolateral amygdala, the clustering of the scaffolding protein Gephyrin and of γ-aminobutyric acid type A receptors at inhibitory neuronal synapses is critically dependent upon the brain-specific guanine nucleotide exchange factor Collybistin (Cb). Accordingly, it was discovered recently that an R290H missense mutation in the diffuse B-cell lymphoma homology domain of Cb, which carries the guanine nucleotide exchange factor activity, leads to epilepsy and intellectual disability in human patients. In the present study, we determined the mechanism by which the Cb(R290H) mutation perturbs inhibitory synapse formation and causes brain dysfunction. Based on a combination of biochemical, cell biological, and molecular dynamics simulation approaches, we demonstrate that the R290H mutation alters the strength of intramolecular interactions between the diffuse B-cell lymphoma homology domain and the pleckstrin homology domain of Cb. This defect reduces the phosphatidylinositol 3-phosphate binding affinity of Cb, which limits its normal synaptogenic activity. Our data indicate that impairment of the membrane lipid binding activity of Cb and a consequent defect in inhibitory synapse maturation represent a likely molecular pathomechanism of epilepsy and mental retardation in humans. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Modification of radiation effects on E. coli B/r and a radiosensitive mutant Bsub(s-1) by membrane-binding drugs

    International Nuclear Information System (INIS)

    Yonei, S.

    1979-01-01

    In this study, the effects of chlorpromazine, procaine and quinidine on the X-radiation effects on Escherichia coli B/r and its radiosensitive mutant Bsub(s-1) (which is genetically unable to repair radiation damage to DNA) were examined. At chlorpromazine concentrations > = 25 mM, there was loss of colony-forming ability in both strains. Chlorpromazine (0.1 mM) markedly sensitized E. coli B/r under hypoxic conditions of irradiation but not under oxic conditions. There was no significant radiosensitization by chlorpromazine (0.1-1.0mM) in E. coli Bsub(s-1) under either oxic or hypoxic conditions. Similar results were obtained when procaine and quinidine were used as 'membrane-binding radiosensitizers'. Thus these results suggested that radiosensitization by such drugs in E. coli B/r was the result of inhibition of post-irradiation DNA repair in cells. It was concluded that the inhibition of DNA repair could be a secondary consequence of cell membrane alterations or damage caused by the membrane-binding of these drugs. (UK)

  8. The capacity of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette transporters to form biofilms and comparison with the wild type

    Directory of Open Access Journals (Sweden)

    Marina Ceruso

    2014-02-01

    Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.

  9. Ophthalmic acid accumulation in an Escherichia coli mutant lacking the conserved pyridoxal 5'-phosphate-binding protein YggS.

    Science.gov (United States)

    Ito, Tomokazu; Yamauchi, Ayako; Hemmi, Hisashi; Yoshimura, Tohru

    2016-12-01

    Escherichia coli YggS is a highly conserved pyridoxal 5'-phosphate (PLP)-binding protein whose biochemical function is currently unknown. A previous study with a yggS-deficient E. coli strain (ΔyggS) demonstrated that YggS controls l-Ile- and l-Val-metabolism by modulating 2-ketobutyrate (2-KB), l-2-aminobutyrate (l-2-AB), and/or coenzyme A (CoA) availability in a PLP-dependent fashion. In this study, we found that ΔyggS accumulates an unknown metabolite as judged by amino acid analyses. LC/MS and MS/MS analyses of the compound with propyl chloroformate derivatization, and co-chromatography analysis identified this compound as γ-l-glutamyl-l-2-aminobutyryl-glycine (ophthalmic acid), a glutathione (GSH) analogue in which the l-Cys moiety is replaced by l-2-AB. We also determine the metabolic consequence of the yggS mutation. Absence of YggS initially increases l-2-AB availability, and then causes ophthalmic acid accumulation and CoA limitation in the cell. The expression of a γ-glutamylcysteine synthetase and a glutathione synthetase in a ΔyggS background causes high-level accumulation of ophthalmic acid in the cells (∼1.2 nmol/mg cells) in a minimal synthetic medium. This opens the possibility of a first fermentative production of ophthalmic acid. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  11. Client Proteins and Small Molecule Inhibitors Display Distinct Binding Preferences for Constitutive and Stress-Induced HSP90 Isoforms and Their Conformationally Restricted Mutants.

    Directory of Open Access Journals (Sweden)

    Thomas L Prince

    Full Text Available The two cytosolic/nuclear isoforms of the molecular chaperone HSP90, stress-inducible HSP90α and constitutively expressed HSP90β, fold, assemble and maintain the three-dimensional structure of numerous client proteins. Because many HSP90 clients are important in cancer, several HSP90 inhibitors have been evaluated in the clinic. However, little is known concerning possible unique isoform or conformational preferences of either individual HSP90 clients or inhibitors. In this report, we compare the relative interaction strength of both HSP90α and HSP90β with the transcription factors HSF1 and HIF1α, the kinases ERBB2 and MET, the E3-ubiquitin ligases KEAP1 and RHOBTB2, and the HSP90 inhibitors geldanamycin and ganetespib. We observed unexpected differences in relative client and drug preferences for the two HSP90 isoforms, with HSP90α binding each client protein with greater apparent affinity compared to HSP90β, while HSP90β bound each inhibitor with greater relative interaction strength compared to HSP90α. Stable HSP90 interaction was associated with reduced client activity. Using a defined set of HSP90 conformational mutants, we found that some clients interact strongly with a single, ATP-stabilized HSP90 conformation, only transiently populated during the dynamic HSP90 chaperone cycle, while other clients interact equally with multiple HSP90 conformations. These data suggest different functional requirements among HSP90 clientele that, for some clients, are likely to be ATP-independent. Lastly, the two inhibitors examined, although sharing the same binding site, were differentially able to access distinct HSP90 conformational states.

  12. Structural and Biochemical Characterization of a Copper-Binding Mutant of the Organomercurial Lyase MerB: Insight into the Key Role of the Active Site Aspartic Acid in Hg-Carbon Bond Cleavage and Metal Binding Specificity.

    Science.gov (United States)

    Wahba, Haytham M; Lecoq, Lauriane; Stevenson, Michael; Mansour, Ahmed; Cappadocia, Laurent; Lafrance-Vanasse, Julien; Wilkinson, Kevin J; Sygusch, Jurgen; Wilcox, Dean E; Omichinski, James G

    2016-02-23

    In bacterial resistance to mercury, the organomercurial lyase (MerB) plays a key role in the detoxification pathway through its ability to cleave Hg-carbon bonds. Two cysteines (C96 and C159; Escherichia coli MerB numbering) and an aspartic acid (D99) have been identified as the key catalytic residues, and these three residues are conserved in all but four known MerB variants, where the aspartic acid is replaced with a serine. To understand the role of the active site serine, we characterized the structure and metal binding properties of an E. coli MerB mutant with a serine substituted for D99 (MerB D99S) as well as one of the native MerB variants containing a serine residue in the active site (Bacillus megaterium MerB2). Surprisingly, the MerB D99S protein copurified with a bound metal that was determined to be Cu(II) from UV-vis absorption, inductively coupled plasma mass spectrometry, nuclear magnetic resonance, and electron paramagnetic resonance studies. X-ray structural studies revealed that the Cu(II) is bound to the active site cysteine residues of MerB D99S, but that it is displaced following the addition of either an organomercurial substrate or an ionic mercury product. In contrast, the B. megaterium MerB2 protein does not copurify with copper, but the structure of the B. megaterium MerB2-Hg complex is highly similar to the structure of the MerB D99S-Hg complexes. These results demonstrate that the active site aspartic acid is crucial for both the enzymatic activity and metal binding specificity of MerB proteins and suggest a possible functional relationship between MerB and its only known structural homologue, the copper-binding protein NosL.

  13. Involvement of the Eukaryote-Like Kinase-Phosphatase System and a Protein That Interacts with Penicillin-Binding Protein 5 in Emergence of Cephalosporin Resistance in Cephalosporin-Sensitive Class A Penicillin-Binding Protein Mutants in Enterococcus faecium

    Directory of Open Access Journals (Sweden)

    Charlene Desbonnet

    2016-04-01

    Full Text Available The intrinsic resistance of Enterococcus faecium to ceftriaxone and cefepime (here referred to as “cephalosporins” is reliant on the presence of class A penicillin-binding proteins (Pbps PbpF and PonA. Mutants lacking these Pbps exhibit cephalosporin susceptibility that is reversible by exposure to penicillin and by selection on cephalosporin-containing medium. We selected two cephalosporin-resistant mutants (Cro1 and Cro2 of class A Pbp-deficient E. faecium CV598. Genome analysis revealed changes in the serine-threonine kinase Stk in Cro1 and a truncation in the associated phosphatase StpA in Cro2 whose respective involvements in resistance were confirmed in separate complementation experiments. In an additional effort to identify proteins linked to cephalosporin resistance, we performed tandem affinity purification using Pbp5 as bait in penicillin-exposed E. faecium; these experiments yielded a protein designated Pbp5-associated protein (P5AP. Transcription of the P5AP gene was increased after exposure to penicillin in wild-type strains and in Cro2 and suppressed in Cro2 complemented with the wild-type stpA. Transformation of class A Pbp-deficient strains with the plasmid-carried P5AP gene conferred cephalosporin resistance. These data suggest that Pbp5-associated cephalosporin resistance in E. faecium devoid of typical class A Pbps is related to the presence of P5AP, whose expression is influenced by the activity of the serine-threonine phosphatase/kinase system.

  14. Structural and functional consequences of binding site mutations in transferrin: crystal structures of the Asp63Glu and Arg124Ala mutants of the N-lobe of human transferrin.

    Science.gov (United States)

    Baker, Heather M; He, Qing-Yu; Briggs, Sara K; Mason, Anne B; Baker, Edward N

    2003-06-17

    Human transferrin is a serum protein whose function is to bind Fe(3+) with very high affinity and transport it to cells, for delivery by receptor-mediated endocytosis. Structurally, the transferrin molecule is folded into two globular lobes, representing its N-terminal and C-terminal halves, with each lobe possessing a high-affinity iron binding site, in a cleft between two domains. Central to function is a highly conserved set of iron ligands, including an aspartate residue (Asp63 in the N-lobe) that also hydrogen bonds between the two domains and an arginine residue (Arg124 in the N-lobe) that binds an iron-bound carbonate ion. To further probe the roles of these residues, we have determined the crystal structures of the D63E and R124A mutants of the N-terminal half-molecule of human transferrin. The structure of the D63E mutant, determined at 1.9 A resolution (R = 0.245, R(free) = 0.261), showed that the carboxyl group still binds to iron despite the larger size of the Glu side chain, with some slight rearrangement of the first turn of alpha-helix residues 63-72, to which it is attached. The structure of the R124A mutant, determined at 2.4 A resolution (R = 0.219, R(free) = 0.288), shows that the loss of the arginine side chain results in a 0.3 A displacement of the carbonate ion, and an accompanying movement of the iron atom. In both mutants, the iron coordination is changed slightly, the principal change being in each case a lengthening of the Fe-N(His249) bond. Both mutants also release iron more readily than the wild type, kinetically and in terms of acid lability of iron binding. We attribute this to more facile protonation of the synergistically bound carbonate ion, in the case of R124A, and to strain resulting from the accommodation of the larger Glu side chain, in the case of D63E. In both cases, the weakened Fe-N(His) bond may also contribute, consistent with protonation of the His ligand being an early intermediate step in iron release, following the

  15. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  16. Characterization of the Escherichia coli prsA1-encoded mutant phosphoribosylpyrophosphate synthetase identifies a divalent cation-nucleotide binding site

    DEFF Research Database (Denmark)

    Bower, Stanley G.; Harlow, Kenneth W.; Switzer, Robert L.

    1989-01-01

    : DLHAXQIQGFFDI/VPI/VD. There was little alteration in the Km for ribose 5-phosphate. The Km for ATP of the mutant enzyme was increased 27-fold when Mg2+ was the activating cation but only 5-fold when Mn2+ was used. Maximal velocities of the wild type and mutant enzymes were the same. The mutant enzyme has a 6......-fold lower affinity for Ca2+, as judged by the ability of Ca2+ to inhibit the reaction in the presence of 10 mM Mg2+. Wild type PRPP synthetase is subject to product inhibition by AMP, but AMP inhibition of the prsA1 mutant enzyme could not be detected. It has been previously proposed that a divalent...

  17. In Silico Molecular Modeling and Docking Studies on Novel Mutants (E229V, H225P and D230C) of the Nucleotide-Binding Domain of Homo sapiens Hsp70.

    Science.gov (United States)

    Elengoe, Asita; Hamdan, Salehhuddin

    2017-12-01

    In this study, we explored the possibility of determining the synergistic interactions between nucleotide-binding domain (NBD) of Homo sapiens heat-shock 70 kDa protein (Hsp70) and E1A 32 kDa of adenovirus serotype 5 motif (PNLVP) in the efficiency of killing of tumor cells in cancer treatment. At present, the protein interaction between NBD and PNLVP motif is still unknown, but believed to enhance the rate of virus replication in tumor cells. Three mutant models (E229V, H225P and D230C) were built and simulated, and their interactions with PNLVP motif were studied. The PNLVP motif showed the binding energy and intermolecular energy values with the novel E229V mutant at -7.32 and -11.2 kcal/mol. The E229V mutant had the highest number of hydrogen bonds (7). Based on the root mean square deviation, root mean square fluctuation, hydrogen bonds, salt bridge, secondary structure, surface-accessible solvent area, potential energy and distance matrices analyses, it was proved that the E229V had the strongest and most stable interaction with the PNLVP motif among all the four protein-ligand complex structures. The knowledge of this protein-ligand complex model would help in designing Hsp70 structure-based drug for cancer therapy.

  18. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

    Science.gov (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

    2008-09-01

    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  19. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  20. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. 5S-menetelmän pilotointi

    OpenAIRE

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  2. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  3. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  4. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  5. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    International Nuclear Information System (INIS)

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  6. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  7. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  8. Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

    Science.gov (United States)

    Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

    2014-01-01

    Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

  9. An insulin receptor mutant (Asp707 → Ala), involved in leprechaunism, is processed and transported to the cell surface but unable to bind insulin

    NARCIS (Netherlands)

    L.M. 't Hart (Leen); D. Lindhout (Dick); G.C.M. van der Zon (Gerard); H. Kayserilli (Hülya); M.Y. Apak (Memnune); W.J. Kleijer (Wim); E.R. van der Vorm (Eric); J.A. Maassen (Johannes)

    1996-01-01

    textabstractWe have identified a homozygous mutation near the carboxyl terminus of the insulin receptor (IR) α subunit from a leprechaun patient, changing Asp707 into Ala. Fibroblasts from this patient had no high affinity insulin binding sites. To examine the effect of the mutation on IR

  10. Insights into the "pair of sugar tongs" surface binding site in barley alpha-amylase isozymes and crystallization of appropriate sugar tongs mutants

    DEFF Research Database (Denmark)

    Tranier, S.; Deville, K.; Robert, X.

    2005-01-01

    of an additional surface binding site called a "pair of sugar tongs" due to the sugar capturing by Tyr380 which is situated in domain C of AMYL For the first time, a biological role for the domain C was suggested as well as a hypothetical explanation of enzymatic differences between the two barley a......-amylase isozymes. However, no sugar was bound at the "sugar tongs" site in the AMY2/acarbose complex. Comparative studies of this domain on the basis of sequence, secondary structure and spatial organization allow to propose factors needed for such a site. One of the most obvious is the replacement of Ser378(AMY1......, surface plasmon resonance sugar binding experiments have proven unambiguously that this residue cannot totally explain the lack of the "pair of sugar tongs" and other tracks must be studied as, for example, the differences in orientation of Asp381 and the critical role of His395, both good candidates...

  11. Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant

    Energy Technology Data Exchange (ETDEWEB)

    Atwell, Shane; Brouillette, Christie G.; Conners, Kris; Emtage, Spencer; Gheyi, Tarun; Guggino, William B.; Hendle, Jorg; Hunt, John F.; Lewis, Hal A.; Lu, Frances; Protasevich, Irina I.; Rodgers, Logan A.; Romero, Rich; Wasserman, Stephen R.; Weber, Patricia C.; Wetmore, Diana; Zhang, Feiyu F.; Zhao, Xun (Cystic); (UAB); (JHU); (Columbia); (Lilly)

    2010-04-26

    Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646({Delta}405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-{angstrom} resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The {Delta}F508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

  12. Ophthalmic acid accumulation in an Escherichia coli mutant lacking the conserved pyridoxal 5′-phosphate-binding protein YggS

    OpenAIRE

    Ito, Tomokazu; Yamauchi, Ayako; Hemmi, Hisashi; Yoshimura, Tohru

    2016-01-01

    Escherichia coli YggS is a highly conserved pyridoxal 5′-phosphate (PLP)-binding protein whose biochemical function is currently unknown. A previous study with a yggS-deficient E. coli strain (ΔyggS) demonstrated that YggS controls l-Ile- and l-Val-metabolism by modulating 2-ketobutyrate (2-KB), l-2-aminobutyrate (l-2-AB), and/or coenzyme A (CoA) availability in a PLP-dependent fashion. In this study, we found that ΔyggS accumulates an unknown metabolite as judged by amino acid analyses. LC/M...

  13. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  14. Binding of bufuralol, dextromethorphan, and 3,4-methylenedioxymethylamphetamine to wild-type and F120A mutant cytochrome P450 2D6 studied by resonance Raman spectroscopy

    International Nuclear Information System (INIS)

    Bonifacio, Alois; Keizers, Peter H.J.; Commandeur, Jan N.M.; Vermeulen, Nico P.E.; Robert, Bruno; Gooijer, Cees; Zwan, Gert van der

    2006-01-01

    Cytochrome P450 2D6 (CYP2D6) is one of the most important drug-metabolizing enzymes in humans. Resonance Raman data, reported for First time for CYP2D6, show that the CYP2D6 heme is found to be in a six-coordinated low-spin state in the absence of substrates, and it is perturbed to different extents by bufuralol, dextromethorphan, and 3,4-methylenedioxymethylamphetamine (MDMA). Dextromethorphan and MDMA induce in CYP2D6 a significant amount of five-coordinated high-spin heme species and reduce the polarity of its heme-pocket, whereas bufuralol does not. Spectra of the F120A mutant CYP2D6 suggest that Phe 12 is involved in substrate-binding of dextromethorphan and MDMA, being responsible for the spectral differences observed between these two compounds and bufuralol. These differences could be explained postulating a different substrate mobility for each compound in the CYP2D6 active site, consistently with the role previously suggested for Phe 12 in binding dextromethorphan and MDMA

  15. Binding events of (S )-N -(3-oxo-octanoyl)-homoserine lactone with agrobacterium tumefaciens mutant cells studied by saturation transfer difference NMR

    Energy Technology Data Exchange (ETDEWEB)

    Cabeca, Luis Fernando; Pomini, Armando Mateus; Cruz, Pedro Luiz R.; Marsaioli, Anita J. [University of Campinas (UNICAMP), SP (Brazil). Chemistry Inst.

    2011-07-01

    Quorum-sensing is a widely studied communication phenomenon in bacteria, which involves the production and detection of signaling substances in relation with cell density and colony behavior. Herein, the membrane binding interactions of the signal (S)-N-(3-oxo-octanoyl)-HSL with A. tumefaciens NTL4(pZLR4) cells were studied using saturation transfer difference NMR spectroscopy (STD-NMR). The substance epitope map was obtained showing that the hydrophobic acyl chain is the most important interacting site for the signal and the cell membrane. Results were interpreted upon comparisons with a simpler system, using liposomes as membrane models. Some insights on the use of b-cyclodextrin as acyl-HSL carrier were also provided. (author)

  16. Amyotrophic lateral sclerosis mutant vesicle-associated membrane protein-associated protein-B transgenic mice develop TAR-DNA-binding protein-43 pathology.

    LENUS (Irish Health Repository)

    Tudor, E L

    2010-05-19

    Cytoplasmic ubiquitin-positive inclusions containing TAR-DNA-binding protein-43 (TDP-43) within motor neurons are the hallmark pathology of sporadic amyotrophic lateral sclerosis (ALS). TDP-43 is a nuclear protein and the mechanisms by which it becomes mislocalized and aggregated in ALS are not properly understood. A mutation in the vesicle-associated membrane protein-associated protein-B (VAPB) involving a proline to serine substitution at position 56 (VAPBP56S) is the cause of familial ALS type-8. To gain insight into the molecular mechanisms by which VAPBP56S induces disease, we created transgenic mice that express either wild-type VAPB (VAPBwt) or VAPBP56S in the nervous system. Analyses of both sets of mice revealed no overt motor phenotype nor alterations in survival. However, VAPBP56S but not VAPBwt transgenic mice develop cytoplasmic TDP-43 accumulations within spinal cord motor neurons that were first detected at 18 months of age. Our results suggest a link between abnormal VAPBP56S function and TDP-43 mislocalization.

  17. Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Moore, P.B.

    1987-01-01

    The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

  18. Deletion mutants of the Escherichia coli K-12 mannitol permease: dissection of transport-phosphorylation, phospho-exchange, and mannitol-binding activities.

    Science.gov (United States)

    Grisafi, P L; Scholle, A; Sugiyama, J; Briggs, C; Jacobson, G R; Lengeler, J W

    1989-05-01

    We have constructed a series of deletion mutations of the cloned Escherichia coli K-12 mtlA gene, which encodes the mannitol-specific enzyme II of the phosphoenolpyruvate (PEP)-dependent carbohydrate phosphotransferase system. This membrane-bound permease consists of 637 amino acid residues and is responsible for the concomitant transport and phosphorylation of D-mannitol in E. coli. Deletions into the 3' end of mtlA were constructed by exonuclease III digestion. Restriction mapping of the resultant plasmids identified several classes of deletions that lacked approximately 5% to more than 75% of the gene. Immunoblotting experiments revealed that many of these plasmids expressed proteins within the size range predicted by the restriction analyses, and all of these proteins were membrane localized, which demonstrated that none of the C-terminal half of the permease is required for membrane insertion. Functional analyses of the deletion proteins, expressed in an E. coli strain deleted for the chromosomal copy of mtlA, showed that all but one of the strains containing confirmed deletions were inactive in transport and PEP-dependent phosphorylation of mannitol, but deletions removing up to at least 117 amino acid residues from the C terminus of the permease were still active in catalyzing phospho exchange between mannitol 1-phosphate and mannitol. A deletion protein that lacked 240 residues from the C terminus of the permease was inactive in phospho exchange but still bound mannitol with high affinity. These experiments localize sites important for transport and PEP-dependent phosphorylation to the extreme C terminus of the mannitol permease, sites important for phospho exchange to between residues 377 and 519, and sites necessary for mannitol binding to the N-terminal 60% of the molecule. The results are discussed with respect to the fact that the mannitol permease consists of structurally independent N- and C-terminal domains.

  19. Brief Report: Blockade of TANK-Binding Kinase 1/IKKɛ Inhibits Mutant Stimulator of Interferon Genes (STING)-Mediated Inflammatory Responses in Human Peripheral Blood Mononuclear Cells.

    Science.gov (United States)

    Frémond, Marie-Louise; Uggenti, Carolina; Van Eyck, Lien; Melki, Isabelle; Bondet, Vincent; Kitabayashi, Naoki; Hertel, Christina; Hayday, Adrian; Neven, Bénédicte; Rose, Yoann; Duffy, Darragh; Crow, Yanick J; Rodero, Mathieu P

    2017-07-01

    Gain-of-function mutations in TMEM173, encoding the stimulator of interferon (IFN) genes (STING) protein, underlie a novel type I interferonopathy that is minimally responsive to conventional immunosuppressive therapies and associated with high frequency of childhood morbidity and mortality. STING gain-of-function causes constitutive oversecretion of IFN. This study was undertaken to determine the effects of a TANK-binding kinase 1 (TBK-1)/IKKɛ inhibitor (BX795) on secretion and signaling of IFN in primary peripheral blood mononuclear cells (PBMCs) from patients with mutations in STING. PBMCs from 4 patients with STING-associated disease were treated with BX795. The effect of BX795 on IFN pathways was assessed by Western blotting and an IFNβ reporter assay, as well as by quantification of IFNα in cell lysates, staining for STAT-1 phosphorylation, and measurement of IFN-stimulated gene (ISG) messenger RNA (mRNA) expression. Treatment of PBMCs with BX795 inhibited the phosphorylation of IFN regulatory factor 3 and IFNβ promoter activity induced in HEK 293T cells by cyclic GMP-AMP or by genetic activation of STING. In vitro exposure to BX795 inhibited IFNα production in PBMCs of patients with STING-associated disease without affecting cell survival. In addition, BX795 decreased STAT-1 phosphorylation and ISG mRNA expression independent of IFNα blockade. These findings demonstrate the effect of BX795 on reducing type I IFN production and IFN signaling in cells from patients with gain-of-function mutations in STING. A combined inhibition of TBK-1 and IKKɛ therefore holds potential for the treatment of patients carrying STING mutations, and may also be relevant in other type I interferonopathies. © 2017, American College of Rheumatology.

  20. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    Science.gov (United States)

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  1. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  2. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  3. Synthesis of iron oxide nanoparticles in Listeria innocua Dps (DNA-binding protein from starved cells): a study with the wild-type protein and a catalytic centre mutant.

    Science.gov (United States)

    Ceci, Pierpaolo; Chiancone, Emilia; Kasyutich, Oksana; Bellapadrona, Giuliano; Castelli, Lisa; Fittipaldi, Maria; Gatteschi, Dante; Innocenti, Claudia; Sangregorio, Claudio

    2010-01-11

    A comparative analysis of the magnetic properties of iron oxide nanoparticles grown in the cavity of the DNA-binding protein from starved cells of the bacterium Listeria innocua, LiDps, and of its triple-mutant lacking the catalytic ferroxidase centre, LiDps-tm, is presented. TEM images and static and dynamic magnetic and electron magnetic resonance (EMR) measurements reveal that, under the applied preparation conditions, namely alkaline pH, high temperature (65 degrees C), exclusion of oxygen, and the presence of hydrogen peroxide, maghemite and/or magnetite nanoparticles with an average diameter of about 3 nm are mineralised inside the cavities of both LiDps and LiDps-tm. The magnetic nanoparticles (MNPs) thus formed show similar magnetic properties, with superparamagnetic behaviour above 4.5 K and a large magnetic anisotropy. Interestingly, in the EMR spectra an absorption at half-field is observed, which can be considered as a manifestation of the quantum behaviour of the MNPs. These results indicate that Dps proteins can be advantageously used for the production of nanomagnets at the interface between molecular clusters and traditional MNPs and that the presence of the ferroxidase centre, though increasing the efficiency of nanoparticle formation, does not affect the nature and fine structure of the MNPs. Importantly, the self-organisation of MNP-containing Dps on HRTEM grids suggests that Dps-enclosed MNPs can be deposited on surfaces in an ordered fashion.

  4. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  5. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  6. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  7. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  8. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  9. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  10. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  11. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  12. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Poliovirus Mutants Resistant to Neutralization with Soluble Cell Receptors

    Science.gov (United States)

    Kaplan, Gerardo; Peters, David; Racaniello, Vincent R.

    1990-12-01

    Poliovirus mutants resistant to neutralization with soluble cellular receptor were isolated. Replication of soluble receptor-resistant (srr) mutants was blocked by a monoclonal antibody directed against the HeLa cell receptor for poliovirus, indicating that the mutants use this receptor to enter cells. The srr mutants showed reduced binding to HeLa cells and cell membranes. However, the reduced binding phenotype did not have a major impact on viral replication, as judged by plaque size and one-step growth curves. These results suggest that the use of soluble receptors as antiviral agents could lead to the selection of neutralization-resistant mutants that are able to bind cell surface receptors, replicate, and cause disease.

  16. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  17. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  18. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  19. Strong decays and dipion transitions of Y(5S)

    International Nuclear Information System (INIS)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  20. Assessment of application of 5S practices in ceramic industry

    Directory of Open Access Journals (Sweden)

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  1. 5S-toimintamallin kehittäminen nostintuotannossa

    OpenAIRE

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  2. Radiative transitions from Υ(5S) to molecular bottomonium

    International Nuclear Information System (INIS)

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  3. Defining the requirements for the pathogenic interaction between mutant calreticulin and MPL in MPN.

    Science.gov (United States)

    Elf, Shannon; Abdelfattah, Nouran S; Baral, April J; Beeson, Danielle; Rivera, Jeanne F; Ko, Amy; Florescu, Natalie; Birrane, Gabriel; Chen, Edwin; Mullally, Ann

    2018-02-15

    Mutations in calreticulin ( CALR ) are phenotypic drivers in the pathogenesis of myeloproliferative neoplasms. Mechanistic studies have demonstrated that mutant CALR binds to the thrombopoietin receptor MPL, and that the positive electrostatic charge of the mutant CALR C terminus is required for mutant CALR-mediated activation of JAK-STAT signaling. Here we demonstrate that although binding between mutant CALR and MPL is required for mutant CALR to transform hematopoietic cells; binding alone is insufficient for cytokine independent growth. We further show that the threshold of positive charge in the mutant CALR C terminus influences both binding of mutant CALR to MPL and activation of MPL signaling. We find that mutant CALR binds to the extracellular domain of MPL and that 3 tyrosine residues within the intracellular domain of MPL are required to activate signaling. With respect to mutant CALR function, we show that its lectin-dependent function is required for binding to MPL and for cytokine independent growth, whereas its chaperone and polypeptide-binding functionalities are dispensable. Together, our findings provide additional insights into the mechanism of the pathogenic mutant CALR-MPL interaction in myeloproliferative neoplasms. © 2018 by The American Society of Hematology.

  4. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  5. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  6. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  7. Promising rice mutants

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1988-01-01

    Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs

  8. Mutant heterosis in rice

    International Nuclear Information System (INIS)

    1987-01-01

    In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent

  9. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  10. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    Energy Technology Data Exchange (ETDEWEB)

    Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: w.n.hunter@dundee.ac.uk [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: w.n.hunter@dundee.ac.uk [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)

    2015-07-28

    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.

  11. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    International Nuclear Information System (INIS)

    Baum, Bernhard; Lecker, Laura S. M.; Zoltner, Martin; Jaenicke, Elmar; Schnell, Robert; Hunter, William N.; Brenk, Ruth

    2015-01-01

    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials

  12. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. Mutants of common bean alpha-amylase inhibitor-2 as an approach to investigate binding specificity to alpha-amylases Mutantes do inibidor-2 de alfa-amilase do feijão-comum para investigação da especificidade de ligação a alfa-amilases

    Directory of Open Access Journals (Sweden)

    Maria Cristina Mattar da Silva

    2004-03-01

    Full Text Available Despite the presence of a family of defense proteins, Phaseolus vulgaris can be attacked by bruchid insects resulting in serious damage to stored grains. The two distinct active forms of a-amylase inhibitors, a-AI1 and a-AI2, in P. vulgaris show different specificity toward a-amylases. Zabrotes subfasciatus a-amylase is inhibited by a-AI2 but not by a-AI1. In contrast, porcine a-amylase is inhibited by a-AI1 but not by a-AI2. The objective of this work was to understand the molecular basis of the specificity of two inhibitors in P. vulgaris (a-AI1 and a-AI2 in relation to a-amylases. Mutants of a-AI2 were made and expressed in tobacco plants. The results showed that all the a-AI2 mutant inhibitors lost their activity against the insect a-amylases but none exhibited activity toward the mammalian a-amylase. The replacement of His33 of a-AI2 with the a-AI1-like sequence Ser-Tyr-Asn abolished inhibition of Z. subfasciatus a-amylase. From structural modeling, the conclusion is that the size and complexity of the amylase-inhibitor interface explain why mutation of the N-terminal loop and resultant abolition of Z. subfasciatus a-amylase inhibition are not accompanied by gain of inhibitory activity against porcine a-amylase.Apesar de possuir uma família de proteínas de defesa, o feijão-comum (Phaseolus vulgaris L. pode ser atacado por insetos bruquídeos causando sérios danos aos grãos armazenados. O P. vulgaris possui duas formas ativas de inibidores de a-amilases, denominadas a-AI1 e a-AI2, que apresentam diferentes especificidades em relação às a-amilases. A a-amilase de Zabrotes subfasciatus é inibida por a-AI2 mas não por a-AI1. Em contraste, a a-amilase pancreática de porco é inibida por a-AI1 mas não é por a-AI2. O objetivo deste trabalho foi entender as bases moleculares da especificidade desses inibidores em relação às a-amilases. Para tanto, foram construídos mutantes do a-AI2, os quais foram expressados em plantas de fumo

  14. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  15. Productive mutants of niger

    International Nuclear Information System (INIS)

    Misra, R.C.

    2001-01-01

    Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

  16. Structural, stability, dynamic and binding properties of the ALS-causing T46I mutant of the hVAPB MSP domain as revealed by NMR and MD simulations.

    Directory of Open Access Journals (Sweden)

    Shixiong Lua

    Full Text Available T46I is the second mutation on the hVAPB MSP domain which was recently identified from non-Brazilian kindred to cause a familial amyotrophic lateral sclerosis (ALS. Here using CD, NMR and molecular dynamics (MD simulations, we characterized the structure, stability, dynamics and binding capacity of the T46I-MSP domain. The results reveal: 1 unlike P56S which we previously showed to completely eliminate the native MSP structure, T46I leads to no significant disruption of the native secondary and tertiary structures, as evidenced from its far-UV CD spectrum, as well as Cα and Cβ NMR chemical shifts. 2 Nevertheless, T46I does result in a reduced thermodynamic stability and loss of the cooperative urea-unfolding transition. As such, the T46I-MSP domain is more prone to aggregation than WT at high protein concentrations and temperatures in vitro, which may become more severe in the crowded cellular environments. 3 T46I only causes a 3-fold affinity reduction to the Nir2 peptide, but a significant elimination of its binding to EphA4. 4 EphA4 and Nir2 peptide appear to have overlapped binding interfaces on the MSP domain, which strongly implies that two signaling networks may have a functional interplay in vivo. 5 As explored by both H/D exchange and MD simulations, the MSP domain is very dynamic, with most loop residues and many residues on secondary structures highly fluctuated or/and exposed to bulk solvent. Although T46I does not alter overall dynamics, it does trigger increased dynamics of several local regions of the MSP domain which are implicated in binding to EphA4 and Nir2 peptide. Our study provides the structural and dynamic understanding of the T46I-causing ALS; and strongly highlights the possibility that the interplay of two signaling networks mediated by the FFAT-containing proteins and Eph receptors may play a key role in ALS pathogenesis.

  17. Human liver cell trafficking mutants: characterization and whole exome sequencing.

    Directory of Open Access Journals (Sweden)

    Fei Yuan

    Full Text Available The HuH7 liver cell mutant Trf1 is defective in membrane trafficking and is complemented by the casein kinase 2α subunit CK2α''. Here we identify characteristic morphologies, trafficking and mutational changes in six additional HuH7 mutants Trf2-Trf7. Trf1 cells were previously shown to be severely defective in gap junction functions. Using a Lucifer yellow transfer assay, remarkable attenuation of gap junction communication was revealed in each of the mutants Trf2-Trf7. Electron microscopy and light microscopy of thiamine pyrophosphatase showed that several mutants exhibited fragmented Golgi apparatus cisternae compared to parental HuH7 cells. Intracellular trafficking was investigated using assays of transferrin endocytosis and recycling and VSV G secretion. Surface binding of transferrin was reduced in all six Trf2-Trf7 mutants, which generally correlated with the degree of reduced expression of the transferrin receptor at the cell surface. The mutants displayed the same transferrin influx rates as HuH7, and for efflux rate, only Trf6 differed, having a slower transferrin efflux rate than HuH7. The kinetics of VSV G transport along the exocytic pathway were altered in Trf2 and Trf5 mutants. Genetic changes unique to particular Trf mutants were identified by exome sequencing, and one was investigated in depth. The novel mutation Ile34Phe in the GTPase RAB22A was identified in Trf4. RNA interference knockdown of RAB22A or overexpression of RAB22AI34F in HuH7 cells caused phenotypic changes characteristic of the Trf4 mutant. In addition, the Ile34Phe mutation reduced both guanine nucleotide binding and hydrolysis activities of RAB22A. Thus, the RAB22A Ile34Phe mutation appears to contribute to the Trf4 mutant phenotype.

  18. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  19. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  20. Allosteric Mutant IDH1 Inhibitors Reveal Mechanisms for IDH1 Mutant and Isoform Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xiaoling; Baird, Daniel; Bowen, Kimberly; Capka, Vladimir; Chen, Jinyun; Chenail, Gregg; Cho, YoungShin; Dooley, Julia; Farsidjani, Ali; Fortin, Pascal; Kohls, Darcy; Kulathila, Raviraj; Lin, Fallon; McKay, Daniel; Rodrigues, Lindsey; Sage, David; Touré, B. Barry; van der Plas, Simon; Wright, Kirk; Xu, Ming; Yin, Hong; Levell, Julian; Pagliarini, Raymond A. (Novartis)

    2017-03-01

    Oncogenic IDH1 and IDH2 mutations contribute to cancer via production of R-2-hydroxyglutarate (2-HG). Here, we characterize two structurally distinct mutant- and isoform-selective IDH1 inhibitors that inhibit 2-HG production. Both bind to an allosteric pocket on IDH1, yet shape it differently, highlighting the plasticity of this site. Oncogenic IDH1R132H mutation destabilizes an IDH1 “regulatory segment,” which otherwise restricts compound access to the allosteric pocket. Regulatory segment destabilization in wild-type IDH1 promotes inhibitor binding, suggesting that destabilization is critical for mutant selectivity. We also report crystal structures of oncogenic IDH2 mutant isoforms, highlighting the fact that the analogous segment of IDH2 is not similarly destabilized. This intrinsic stability of IDH2 may contribute to observed inhibitor IDH1 isoform selectivity. Moreover, discrete residues in the IDH1 allosteric pocket that differ from IDH2 may also guide IDH1 isoform selectivity. These data provide a deeper understanding of how IDH1 inhibitors achieve mutant and isoform selectivity.

  1. Connexin mutants and cataracts

    Directory of Open Access Journals (Sweden)

    Eric C Beyer

    2013-04-01

    Full Text Available The lens is a multicellular, but avascular tissue that must stay transparent to allow normal transmission of light and focusing of it on the retina. Damage to lens cells and/or proteins can cause cataracts, opacities that disrupt these processes. The normal survival of the lens is facilitated by an extensive network of gap junctions formed predominantly of connexin46 and connexin50. Mutations of the genes that encode these connexins (GJA3 and GJA8 have been identified and linked to inheritance of cataracts in human families and mouse lines. In vitro expression studies of several of these mutants have shown that they exhibit abnormalities that may lead to disease. Many of the mutants reduce or modify intercellular communication due to channel alterations (including loss of function or altered gating or due to impaired cellular trafficking which reduces the number of gap junction channels within the plasma membrane. However, the abnormalities detected in studies of other mutants suggest that they cause cataracts through other mechanisms including gain of hemichannel function (leading to cell injury and death and formation of cytoplasmic accumulations (that may act as light scattering particles. These observations and the anticipated results of ongoing studies should elucidate the mechanisms of cataract development due to mutations of lens connexins and abnormalities of other lens proteins. They may also contribute to our understanding of the mechanisms of disease due to connexin mutations in other tissues.

  2. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    International Nuclear Information System (INIS)

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  3. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  5. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  6. Directed Evolution of Carbonyl Reductase from Rhodosporidium toruloides and Its Application in Stereoselective Synthesis of tert-Butyl (3R,5S)-6-Chloro-3,5-dihydroxyhexanoate.

    Science.gov (United States)

    Liu, Zhi-Qiang; Wu, Lin; Zhang, Xiao-Jian; Xue, Ya-Ping; Zheng, Yu-Guo

    2017-05-10

    tert-Butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate ((3R,5S)-CDHH) is a key intermediate of atorvastatin and rosuvastatin synthesis. Carbonyl reductase RtSCR9 from Rhodosporidium toruloides exhibited excellent activity toward tert-butyl (S)-6-chloro-5-hydroxy-3-oxohexanoate ((S)-CHOH). For the activity of RtSCR9 to be improved, random mutagenesis and site-saturation mutagenesis were performed. Three positive mutants were obtained (mut-Gln95Asp, mut-Ile144Lys, and mut-Phe156Gln). These mutants exhibited 1.94-, 3.03-, and 1.61-fold and 1.93-, 3.15-, and 1.97-fold improvement in the specific activity and k cat /K m , respectively. Asymmetric reduction of (S)-CHOH by mut-Ile144Lys coupled with glucose dehydrogenase was conducted. The yield and enantiomeric excess of (3R,5S)-CDHH reached 98 and 99%, respectively, after 8 h bioconversion in a single batch reaction with 1 M (S)-CHOH, and the space-time yield reached 542.83 mmol L -1 h -1 g -1 wet cell weight. This study presents a new carbonyl reductase for efficient synthesis of (3R,5S)-CDHH.

  7. Photorepair mutants of Arabidopsis

    International Nuclear Information System (INIS)

    Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

    1997-01-01

    UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

  8. Construindo Marcas Mutantes

    Directory of Open Access Journals (Sweden)

    Elizete De Azevedo Kreutz

    2012-09-01

    Full Text Available O presente artigo é o resultado de estudos realizados desde 2000 e busca instrumentalizar os proñssionals para a construção de Marcas Mutantes, que é   uma tendência contemporânea nas estratégias comunicacionais e de branding. Embora esta estratégia ainda não esteja consolidada, observamos que a mesma tem obtido um crescimento constante e tem sido adotadas pelas mais diferentes categorias de marcas e não apenas por aquelas direcionadas aos jovens, ao esporte, ao entretenimento, como era no principia. Com base na Hermenêutica de Profundidade de Thompson (1995, alicerçada nas pesquisas bibliográficas, de intemet, entrevistas e análise semiótica, desenhamos um método de construção de Marcas Mutantes dividido em sete fases. Como resultado, esperamos que este estudo possa auxiliar na compreensão dos processos envolvidos, ao mesmo tempo que provoque a discussão sobreo mesmo e, por consequência, o seu aprimoramento.

  9. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    International Nuclear Information System (INIS)

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  10. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Science.gov (United States)

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in

  11. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    International Nuclear Information System (INIS)

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  12. Isozyme differences in barley mutants

    Energy Technology Data Exchange (ETDEWEB)

    AI-Jibouri, A A.M.; Dham, K M [Department of Botany, Nuclear Research Centre, Baghdad (Iraq)

    1990-01-01

    Full text: Thirty mutants (M{sub 11}) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  13. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  14. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  15. Evaluation of tall rice mutant

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1989-01-01

    One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs

  16. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    Science.gov (United States)

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  17. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  18. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  19. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  20. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  1. The Swedish mutant barley collection

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-07-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  2. Selective Negative Allosteric Modulation Of Metabotropic Glutamate Receptors - A Structural Perspective of Ligands and Mutants

    DEFF Research Database (Denmark)

    Harpsøe, Kasper; Isberg, Vignir; Tehan, Benjamin G

    2015-01-01

    modulators. In this analysis, we make the first comprehensive structural comparison of all metabotropic glutamate receptors, placing selective negative allosteric modulators and critical mutants into the detailed context of the receptor binding sites. A better understanding of how the different m......Glu allosteric modulator binding modes relates to selective pharmacological actions will be very valuable for rational design of safer drugs....

  3. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  4. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  5. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  6. Mutant fatty acid desaturase and methods for directed mutagenesis

    Science.gov (United States)

    Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY

    2008-01-29

    The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.

  7. The 5S methodology as a tool for improving the organisation

    OpenAIRE

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  8. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  9. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    International Nuclear Information System (INIS)

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  10. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  11. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  12. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  13. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  14. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  15. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  16. Root hair mutants of barley

    International Nuclear Information System (INIS)

    Engvild, K.C.; Rasmussen, K.

    2005-01-01

    Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

  17. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

    Science.gov (United States)

    Metts, J; West, J; Doares, S H; Matthysse, A G

    1991-02-01

    Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.

  18. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Probing the binding of coumarins and cyclothialidines to DNA gyrase

    DEFF Research Database (Denmark)

    Kampranis, S C; Gormley, N A; Tranter, R

    1999-01-01

    B and coumarin and cyclothialidine drugs and made mutations by site-directed mutagenesis. We used proteolysis as a probe of drug binding to wild-type and mutant proteins. Limited proteolysis of gyrase revealed that binding of these antibiotics is associated with a characteristic proteolytic fingerprint......, suggesting a drug-induced conformational change. The ability of the mutants to bind the drugs was studied by testing their ability to induce the coumarin-associated proteolytic signature and to bind to a novobiocin-affinity column. To analyze further the interaction of the drugs with gyrase, we studied...

  20. Identification of diphtheria toxin R domain mutants with enhanced inhibitory activity against HB-EGF.

    Science.gov (United States)

    Suzuki, Keisuke; Mizushima, Hiroto; Abe, Hiroyuki; Iwamoto, Ryo; Nakamura, Haruki; Mekada, Eisuke

    2015-05-01

    Heparin-binding epidermal growth factor-like growth factor (HB-EGF), a ligand of EGF receptor, is involved in the growth and malignant progression of cancers. Cross-reacting material 197, CRM197, a non-toxic mutant of diphtheria toxin (DT), specifically binds to the EGF-like domain of HB-EGF and inhibits its mitogenic activity, thus CRM197 is currently under evaluation in clinical trials for cancer therapy. To develop more potent DT mutants than CRM197, we screened various mutant proteins of R domain of DT, the binding site for HB-EGF. A variety of R-domain mutant proteins fused with maltose-binding protein were produced and their inhibitory activity was evaluated in vitro. We found four R domain mutants that showed much higher inhibitory activity against HB-EGF than wild-type (WT) R domain. These R domain mutants suppressed HB-EGF-dependent cell proliferation more effectively than WT R domain. Surface plasmon resonance revealed their higher affinity to HB-EGF than WT R domain. CRM197(R460H) carrying the newly identified mutation showed increased cell proliferation inhibitory activity and affinity to HB-EGF. These results suggest that CRM197(R460H) or other recombinant proteins carrying newly identified mutation(s) in the R domain are potential therapeutics targeting HB-EGF. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  1. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  2. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  3. Mutants induced in winter rye (Secale cereale L.): Short straw-mutant No. 2714 and late-senescence mutant

    Energy Technology Data Exchange (ETDEWEB)

    Muszynski, S; Darlewska, M [Department of Plant Breeding and Seed Science, Warsaw Agricultural University, Warsaw (Poland)

    1990-01-01

    Full text: Mutants were induced by treating dormant seeds with ionizing radiation (fast neutrons) or chemicals (N-nitroso-N-ethyl urea or sodium azide). Among several mutants obtained, of special value is the short-straw mutant No. 2714 and a late senescent mutant. (author)

  4. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  5. Pollen irradiation method to obtain mutants in cucumber

    International Nuclear Information System (INIS)

    Iida, S.; Amano, E.

    1988-01-01

    Seed irradiation for mutation induction in dioecious crops like cucumber is not very useful because chimerism of the mutated tissues makes the segregation of mutants in the M 2 generation nearly impossible. This problem does not exist with pollen irradiation. Cucumber (Cucumis sativus L. var. Nishikisuyo) was used for a model experiment. The petals of male and female flowers were closed by pinching with binding wire before flowering to prevent pollination by insects. On the flowering day, the male flowers were collected and irradiated with 1kR to 10 kR of acute gamma rays (137-Cs), then used to pollinate the female flowers. The M 1 seeds thus obtained are not chimeric but heterozygous for induced mutations. When planted, no mutant phenotype appeared. Selfing within a plant lead to segregation of mutants in the M 2 generation. Seedling examination revealed eight mutants. One mutant line, in which the shape of leaves changed from pentagonal to round heart shape, was found under field conditions. The optimal dose for pollen irradiation seems to be between 2 kR and 4kR

  6. Decay rate ratios of Υ(5S)→B anti B reactions

    International Nuclear Information System (INIS)

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  7. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  8. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  9. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    International Nuclear Information System (INIS)

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  10. Ensemble-based computational approach discriminates functional activity of p53 cancer and rescue mutants.

    Directory of Open Access Journals (Sweden)

    Özlem Demir

    2011-10-01

    Full Text Available The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain ("cancer mutants". Activity can be restored by second-site suppressor mutations ("rescue mutants". This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD, without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC metric was strongly correlated (r(2 = 0.77 with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i p53 cancer mutants were more flexible than wild-type protein, (ii second-site rescue mutations decreased the flexibility of cancer mutants, and (iii negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants.

  11. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  12. Isolation and characterization of Tn917lac-generated competence mutants of Bacillus subtilis

    International Nuclear Information System (INIS)

    Hahn, J.; Albano, M.; Dubnau, D.

    1987-01-01

    The authors isolated 28 mutants of Bacillus subtilis deficient in the development of competence by using the transposon Tn917lacZ as a mutagen. The mutant strains were poorly transformable with plasmid and chromosomal DNAs but were normally transducible and exhibited wild-type resistance to DNA-damaging agents. The mutations were genetically mapped, and the mutants were characterized with respect to their abilities to bind and take up radiolabeled DNA. All were defective in uptake, and some failed to bind significantly amounts of DNA. The abilities of the mutant strains to resolve into two buoyant density classes on Renografin gradients were studied. Most resolved normally, but several banded in Renografin only at the buoyant density of noncompetent cells. The genetic mapping studies and the other analyses suggested that the mutations define a minimum of seven distinct com genes

  13. Quinone reduction via secondary B-branch electron transfer in mutant bacterial reaction centers.

    Science.gov (United States)

    Laible, Philip D; Kirmaier, Christine; Udawatte, Chandani S M; Hofman, Samuel J; Holten, Dewey; Hanson, Deborah K

    2003-02-18

    Symmetry-related branches of electron-transfer cofactors-initiating with a primary electron donor (P) and terminating in quinone acceptors (Q)-are common features of photosynthetic reaction centers (RC). Experimental observations show activity of only one of them-the A branch-in wild-type bacterial RCs. In a mutant RC, we now demonstrate that electron transfer can occur along the entire, normally inactive B-branch pathway to reduce the terminal acceptor Q(B) on the time scale of nanoseconds. The transmembrane charge-separated state P(+)Q(B)(-) is created in this manner in a Rhodobacter capsulatus RC containing the F(L181)Y-Y(M208)F-L(M212)H-W(M250)V mutations (YFHV). The W(M250)V mutation quantitatively blocks binding of Q(A), thereby eliminating Q(B) reduction via the normal A-branch pathway. Full occupancy of the Q(B) site by the native UQ(10) is ensured (without the necessity of reconstitution by exogenous quinone) by purification of RCs with the mild detergent, Deriphat 160-C. The lifetime of P(+)Q(B)(-) in the YFHV mutant RC is >6 s (at pH 8.0, 298 K). This charge-separated state is not formed upon addition of competitive inhibitors of Q(B) binding (terbutryn or stigmatellin). Furthermore, this lifetime is much longer than the value of approximately 1-1.5 s found when P(+)Q(B)(-) is produced in the wild-type RC by A-side activity alone. Collectively, these results demonstrate that P(+)Q(B)(-) is formed solely by activity of the B-branch carriers in the YFHV RC. In comparison, P(+)Q(B)(-) can form by either the A or B branches in the YFH RC, as indicated by the biexponential lifetimes of approximately 1 and approximately 6-10 s. These findings suggest that P(+)Q(B)(-) states formed via the two branches are distinct and that P(+)Q(B)(-) formed by the B side does not decay via the normal (indirect) pathway that utilizes the A-side cofactors when present. These differences may report on structural and energetic factors that further distinguish the functional

  14. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  15. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  16. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    OpenAIRE

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  17. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  18. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Science.gov (United States)

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  19. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    International Nuclear Information System (INIS)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  20. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    International Nuclear Information System (INIS)

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  1. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  2. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  3. Y(5S): What has been learned and what can be learned

    International Nuclear Information System (INIS)

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  4. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Directory of Open Access Journals (Sweden)

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  5. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    Science.gov (United States)

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  6. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  7. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  8. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Deregulation of the Arginine Deiminase (arc) Operon in Penicillin-Tolerant Mutants of Streptococcus gordonii

    OpenAIRE

    Caldelari, I.; Loeliger, B.; Langen, H.; Glauser, M. P.; Moreillon, P.

    2000-01-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log10 CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost ≤2 log10 CFU/ml/24 h. The mutants had unchanged penicillin-binding proteins but contained increased amounts of two proteins ...

  10. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  11. The role of the lysyl binding site of tissue-type plasminogen activator in the interaction with a forming fibrin clot

    NARCIS (Netherlands)

    Bakker, A.H.F.; Weening-Verhoeff, E.J.D.; Verheijen, J.H.

    1995-01-01

    To describe the role of the lysyl binding site in the interaction of tissue-type plasminogen activator (t-PA, FGK1K2P) with a forming fibrin clot, we performed binding experiments with domain deletion mutants GK1K2P, K2P, and the corresponding point mutants lacking the lysyl binding site in the

  12. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  13. Mutant power: using mutant allele collections for yeast functional genomics.

    Science.gov (United States)

    Norman, Kaitlyn L; Kumar, Anuj

    2016-03-01

    The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  15. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  16. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  17. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  18. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  19. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  20. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Directory of Open Access Journals (Sweden)

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  1. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  2. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  3. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    International Nuclear Information System (INIS)

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  4. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  5. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  6. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  7. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  8. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  9. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  10. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    OpenAIRE

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  11. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    OpenAIRE

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  12. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    International Nuclear Information System (INIS)

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. An extra early mutant of pigeonpea

    International Nuclear Information System (INIS)

    Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

    2001-01-01

    The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

  15. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  16. GPNMB ameliorates mutant TDP-43-induced motor neuron cell death.

    Science.gov (United States)

    Nagahara, Yuki; Shimazawa, Masamitsu; Ohuchi, Kazuki; Ito, Junko; Takahashi, Hitoshi; Tsuruma, Kazuhiro; Kakita, Akiyoshi; Hara, Hideaki

    2017-08-01

    Glycoprotein nonmetastatic melanoma protein B (GPNMB) aggregates are observed in the spinal cord of amyotrophic lateral sclerosis (ALS) patients, but the detailed localization is still unclear. Mutations of transactive response DNA binding protein 43kDa (TDP-43) are associated with neurodegenerative diseases including ALS. In this study, we evaluated the localization of GPNMB aggregates in the spinal cord of ALS patients and the effect of GPNMB against mutant TDP-43 induced motor neuron cell death. GPNMB aggregates were not localized in the glial fibrillary acidic protein (GFAP)-positive astrocyte and ionized calcium binding adaptor molecule-1 (Iba1)-positive microglia. GPNMB aggregates were localized in the microtubule-associated protein 2 (MAP-2)-positive neuron and neurofilament H non-phosphorylated (SMI-32)-positive neuron, and these were co-localized with TDP-43 aggregates in the spinal cord of ALS patients. Mock or TDP-43 (WT, M337V, and A315T) plasmids were transfected into mouse motor neuron cells (NSC34). The expression level of GPNMB was increased by transfection of mutant TDP-43 plasmids. Recombinant GPNMB ameliorated motor neuron cell death induced by transfection of mutant TDP-43 plasmids and serum-free stress. Furthermore, the expression of phosphorylated ERK1/2 and phosphorylated Akt were decreased by this stress, and these expressions were increased by recombinant GPNMB. These results indicate that GPNMB has protective effects against mutant TDP-43 stress via activating the ERK1/2 and Akt pathways, and GPNMB may be a therapeutic target for TDP-43 proteinopathy in familial and sporadic ALS. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. Probing the remarkable thermal kinetics of visual rhodopsin with E181Q and S186A mutants

    Science.gov (United States)

    Guo, Ying; Hendrickson, Heidi P.; Videla, Pablo E.; Chen, Ya-Na; Ho, Junming; Sekharan, Sivakumar; Batista, Victor S.; Tully, John C.; Yan, Elsa C. Y.

    2017-06-01

    We recently reported a very unusual temperature dependence of the rate of thermal reaction of wild type bovine rhodopsin: the Arrhenius plot exhibits a sharp "elbow" at 47 °C and, in the upper temperature range, an unexpectedly large activation energy (114 ± 8 kcal/mol) and an enormous prefactor (1072±5 s-1). In this report, we present new measurements and a theoretical model that establish convincingly that this behavior results from a collective, entropy-driven breakup of the rigid hydrogen bonding networks (HBNs) that hinder the reaction at lower temperatures. For E181Q and S186A, two rhodopsin mutants that disrupt the HBNs near the binding pocket of the 11-cis retinyl chromophore, we observe significant decreases in the activation energy (˜90 kcal/mol) and prefactor (˜1060 s-1), consistent with the conclusion that the reaction rate is enhanced by breakup of the HBN. The results provide insights into the molecular mechanism of dim-light vision and eye diseases caused by inherited mutations in the rhodopsin gene that perturb the HBNs.

  18. GTP-dependent binding and nuclear transport of RNA polymerase II by Npa3 protein

    DEFF Research Database (Denmark)

    Staresincic, Lidija; Walker, Jane; Dirac-Svejstrup, A Barbara

    2011-01-01

    in yeast extracts. Indeed, Npa3 depletion in vivo affects nuclear localization of RNAPII; the polymerase accumulates in the cytoplasm. Npa3 is a member of the GPN-LOOP family of GTPases. Npa3 mutants that either cannot bind GTP or that bind but cannot hydrolyze it are inviable and unable to support nuclear...... transport of RNAPII. Surprisingly, we were unable to detect interactions between Npa3 and proteins in the classical importin a/ß pathway for nuclear import. Interestingly, Npa3-RNAPII binding is significantly increased by the addition of GTP or its slowly hydrolyzable analogue guanosine 5'-3-O......-(thio)triphosphate (GTP¿S). Moreover, the Npa3 mutant that binds GTP, but cannot hydrolyze it, binds RNAPII even in the absence of added GTP, whereas the mutant that cannot bind GTP is unable to bind the polymerase. Together, our data suggest that Npa3 defines an unconventional pathway for nuclear import of RNAPII, which...

  19. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Science.gov (United States)

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  20. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Ba 5s photoionization in the region of the second Cooper minimum

    International Nuclear Information System (INIS)

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  2. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  3. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  4. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    International Nuclear Information System (INIS)

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  5. Dwarf mutant of rice variety Seratus Malam

    International Nuclear Information System (INIS)

    Mugiono, P. S.; Soemanggono, A.M.R.

    1989-01-01

    Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)

  6. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    Science.gov (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  7. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Science.gov (United States)

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  8. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  9. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  10. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  11. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  12. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  13. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  14. A detailed study of gerJ mutants of Bacillus subtilis.

    Science.gov (United States)

    Warburg, R J; Buchanan, C E; Parent, K; Halvorson, H O

    1986-08-01

    A total of nine gerJ mutants have now been isolated in Bacillus subtilis. All are defective in their spore germination properties, being blocked at an intermediate (phase grey) stage. The dormant spores are sensitive to heating at 90 degrees C and two of the mutants (generated by transposon insertion) produce spores sensitive at 80 degrees C. The spores of these two more extreme mutants had a visibly defective cortex when studied by electron microscopy, as did some of the other mutants. During sporulation, the acquisition of spore resistance properties and the appearance of the sporulation-specific penicillin-binding protein PBP5* were delayed. A strain probably carrying a lacZ fusion to the gerJ promoter demonstrated increased expression between t2 and t4. We propose that the gerJ locus is involved in the control of one or more sporulation-specific genes.

  15. PNRI mutant variety: Cordyline 'Afable'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2012-01-01

    Cordyline 'Afable', registered by the Philippine Nuclear Research Institute as NSIC 2009 Or-83, is an induced mutant developed from Cordyline 'Kiwi' by treating stem cuttings with acute gamma radiation from a Cobalt-60 source. The new mutant is identical to Cordyline 'Kiwi' in growth habit but differs in foliage color, and exhibits field resistance to Phytophthora sp., a fungus that causes leaf blight and rot in Ti plants. Results of this mutation breeding experiment showed that leaf color was altered by gamma irradiation and resistance to fungal diseases was improved. It also demonstrated how mutations that occur in nature may be generated artificially. Propagation of cordyline 'Afable' is true-to-type by vegetative propagation methods, such as separation of suckers and offshoots, shoot tip cutting, and top cutting. Aside from landscaping material, terrarium or dish-garden plant, it is ideal as containerized plant for indoor and outdoor use. The leaves or shoots may be harvested as cut foliage for flower arrangements. (author)

  16. Gamma ray induced mutants in Coleus

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

  17. Gamma ray induced mutants in Coleus

    Energy Technology Data Exchange (ETDEWEB)

    Vasudevan, K; Jos, J S [Central Tuber Crops Research Institute, Trivandrum, Kerala (India)

    1988-07-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M{sub 1}V{sub 1} generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m{sup 2} area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing.

  18. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Science.gov (United States)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  19. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  20. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  1. Implementation of 5S tools as a starting point in business process reengineering

    Directory of Open Access Journals (Sweden)

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  2. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  3. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Science.gov (United States)

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  4. Mutant DnaAs of Escherichia coli that are refractory to negative control.

    Science.gov (United States)

    Chodavarapu, Sundari; Felczak, Magdalena M; Simmons, Lyle A; Murillo, Alec; Kaguni, Jon M

    2013-12-01

    DnaA is the initiator of DNA replication in bacteria. A mutant DnaA named DnaAcos is unusual because it is refractory to negative regulation. We developed a genetic method to isolate other mutant DnaAs that circumvent regulation to extend our understanding of mechanisms that control replication initiation. Like DnaAcos, one mutant bearing a tyrosine substitution for histidine 202 (H202Y) withstands the regulation exerted by datA, hda and dnaN (β clamp), and both DnaAcos and H202Y resist inhibition by the Hda-β clamp complex in vitro. Other mutant DnaAs carrying G79D, E244K, V303M or E445K substitutions are either only partially sensitive or refractory to inhibition by the Hda-β clamp complex in vitro but are responsive to hda expression in vivo. All mutant DnaAs remain able to interact directly with Hda. Of interest, both DnaAcos and DnaAE244K bind more avidly to Hda. These mutants, by sequestrating Hda, may limit its availability to regulate other DnaA molecules, which remain active to induce extra rounds of DNA replication. Other evidence suggests that a mutant bearing a V292M substitution hyperinitiates by escaping the effect of an unknown regulatory factor. Together, our results provide new insight into the mechanisms that regulate replication initiation in Escherichia coli.

  5. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  6. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    International Nuclear Information System (INIS)

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  7. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  8. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    International Nuclear Information System (INIS)

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  9. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  10. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Science.gov (United States)

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  11. Evidence-based management of otitis media: a 5S model approach.

    Science.gov (United States)

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  12. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Science.gov (United States)

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  13. Distraction manipulation reduction of an L5-S1 disk herniation.

    Science.gov (United States)

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  14. Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

    Science.gov (United States)

    Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

    2018-06-01

    There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

  15. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  16. Recombination Phenotypes of Escherichia coli greA Mutants

    Directory of Open Access Journals (Sweden)

    Poteete Anthony R

    2011-03-01

    Full Text Available Abstract Background The elongation factor GreA binds to RNA polymerase and modulates transcriptional pausing. Some recent research suggests that the primary role of GreA may not be to regulate gene expression, but rather, to promote the progression of replication forks which collide with RNA polymerase, and which might otherwise collapse. Replication fork collapse is known to generate dsDNA breaks, which can be recombinogenic. It follows that GreA malfunction could have consequences affecting homologous recombination. Results Escherichia coli mutants bearing substitutions of the active site acidic residues of the transcription elongation factor GreA, D41N and E44K, were isolated as suppressors of growth inhibition by a toxic variant of the bacteriophage lambda Red-beta recombination protein. These mutants, as well as a D41A greA mutant and a greA deletion, were tested for proficiency in recombination events. The mutations were found to increase the efficiency of RecA-RecBCD-mediated and RecA-Red-mediated recombination, which are replication-independent, and to decrease the efficiency of replication-dependent Red-mediated recombination. Conclusion These observations provide new evidence for a role of GreA in resolving conflicts between replication and transcription.

  17. Structural dataset for the PPARγ V290M mutant

    Directory of Open Access Journals (Sweden)

    Ana C. Puhl

    2016-06-01

    Full Text Available Loss-of-function mutation V290M in the ligand-binding domain of the peroxisome proliferator activated receptor γ (PPARγ is associated with a ligand resistance syndrome (PLRS, characterized by partial lipodystrophy and severe insulin resistance. In this data article we discuss an X-ray diffraction dataset that yielded the structure of PPARγ LBD V290M mutant refined at 2.3 Å resolution, that allowed building of 3D model of the receptor mutant with high confidence and revealed continuous well-defined electron density for the partial agonist diclofenac bound to hydrophobic pocket of the PPARγ. These structural data provide significant insights into molecular basis of PLRS caused by V290M mutation and are correlated with the receptor disability of rosiglitazone binding and increased affinity for corepressors. Furthermore, our structural evidence helps to explain clinical observations which point out to a failure to restore receptor function by the treatment with a full agonist of PPARγ, rosiglitazone.

  18. Studies on reduced height mutants in rice

    International Nuclear Information System (INIS)

    Narahari, P.; Bhagwat, S.G.

    1984-01-01

    Two cross-bred derivatives of the mutant TR5xTR17 and TR21 continued to show promise and were advanced to wider scale testing. TR5 was found to carry a semi-dwarfing gene different from that in IR8. New semi-dwarf mutants were screened from M 2 through M 4 from two separate radiation experiments. The gibberellin response of seedlings of mutant and tester strains was evaluated and crosses of tester stocks and mutant semi-dwarfs were made for genetic analyses. (author)

  19. Molecular Determinants of Mutant Phenotypes, Inferred from Saturation Mutagenesis Data.

    Science.gov (United States)

    Tripathi, Arti; Gupta, Kritika; Khare, Shruti; Jain, Pankaj C; Patel, Siddharth; Kumar, Prasanth; Pulianmackal, Ajai J; Aghera, Nilesh; Varadarajan, Raghavan

    2016-11-01

    Understanding how mutations affect protein activity and organismal fitness is a major challenge. We used saturation mutagenesis combined with deep sequencing to determine mutational sensitivity scores for 1,664 single-site mutants of the 101 residue Escherichia coli cytotoxin, CcdB at seven different expression levels. Active-site residues could be distinguished from buried ones, based on their differential tolerance to aliphatic and charged amino acid substitutions. At nonactive-site positions, the average mutational tolerance correlated better with depth from the protein surface than with accessibility. Remarkably, similar results were observed for two other small proteins, PDZ domain (PSD95 pdz3 ) and IgG-binding domain of protein G (GB1). Mutational sensitivity data obtained with CcdB were used to derive a procedure for predicting functional effects of mutations. Results compared favorably with those of two widely used computational predictors. In vitro characterization of 80 single, nonactive-site mutants of CcdB showed that activity in vivo correlates moderately with thermal stability and solubility. The inability to refold reversibly, as well as a decreased folding rate in vitro, is associated with decreased activity in vivo. Upon probing the effect of modulating expression of various proteases and chaperones on mutant phenotypes, most deleterious mutants showed an increased in vivo activity and solubility only upon over-expression of either Trigger factor or SecB ATP-independent chaperones. Collectively, these data suggest that folding kinetics rather than protein stability is the primary determinant of activity in vivo This study enhances our understanding of how mutations affect phenotype, as well as the ability to predict fitness effects of point mutations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Genetic fingerprinting of mutant rose cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S; Prasad, K V; Singh, K P; Singh, A.P. [Division of Floriculture and Landscaping, Indian Agricultural Research Institute, Pusa, New Delhi (India)], E-mail: kvprasad66@gmail.com

    2008-07-01

    Six rose mutants evolved at the Indian Agricultural Research Institute, New Delhi from four parent cultivars were characterized based on RAPD markers. Contrary to the earlier findings our effort has conclusively proven that the RAPD markers are indeed robust tools to discern the mutants from their parents. Among 40 primers screened, 7 primers produced inconsistent banding pattern. The number of polymorphic bands varied between 4 (OPA 14) and 10 (OPA1) with an average of 6.5 bands per primer. The percentage polymorphism ranged from 62.5 (OPM 9) to 100 percent (OPA 1). Most of the primers produced monomorphic bands between parent and mutant rose cultivars. When primer OPA 2 was used a specific band of 2.5 kb was noticed in mutant cv. Pusa Urmil and cv. Pusa Abhishek but was absent in parent cv. Jantar Mantar. A polymorphic band of 750 bp was noticed in the parent Kiss of Fire and helped in differentiating the parent from its mutant when amplified with OPK 3. Primer OPS 16 produced discriminatory band of 800 bp in mutant cv. Pink Sport of Montezuma while it was absent in its parent cv. Montezuma. Another specific band of 650 bp was present in parent cv. Montezuma and absent in its mutant cv. Pink Sport of Montezuma signifying the uniqueness of the mutant. Primer OPM 5 brought out distinct polymorphism among the parent Jantar Mantar and its three mutants with absence of a specific band of 1.5 kb in the parent. The four parents and 6 mutants were divided into four distinct groups in the Dendogram constructed by UPGMA method. The most genetically similar cultivar among the 10 cultivars analyzed are Montezuma and its pink sport of Montezuma whereas Abhisarika a mutant of cv. Kiss of Fire was distinctly different and formed a separate cluster. (author)

  1. 5S-MENETELMÄN KÄYTTÖÖNOTTO: LUVATA PORI OY

    OpenAIRE

    Rantanen, Suvi

    2015-01-01

    Opinnäytetyön aiheena oli 5S-menetelmän käyttöönotto Luvata Pori Oy:n tuotannos-sa. Tutkimuksen lähtökohtana ja ongelmana oli siisteyden ja järjestyksen puute. Ta-voitteena oli aikaansaada valittuun pilottikohteeseen toimivat, siistit ja turvalliset tuotantotilat sekä luoda järjestelmä, jonka avulla ylläpidetään saavutettu taso. Lisäksi tavoiteltiin hukan poistamista ja Luvatan Lean toimintatavan syventämistä. Projekti toteutettiin toimintatutkimuksena syksyn 2015 aikana. Tutkimuksen teor...

  2. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  3. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

    Science.gov (United States)

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

    2014-07-23

    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The Collagen-Binding Adhesin Is a Virulence Factor in Staphylococcus aureus Keratitis

    Science.gov (United States)

    Rhem, Marcus N.; Lech, Elizabeth M.; Patti, Joseph M.; McDevitt, Damien; Höök, Magnus; Jones, Dan B.; Wilhelmus, Kirk R.

    2000-01-01

    A collagen-binding strain of Staphylococcus aureus produced suppurative inflammation in a rabbit model of soft contact lens-associated bacterial keratitis more often than its collagen-binding-negative isogenic mutant. Reintroduction of the cna gene on a multicopy plasmid into the mutant helped it regain its corneal adherence and infectivity. The topical application of a collagen-binding peptide before bacterial challenge decreased S. aureus adherence to deepithelialized corneas. These data suggest that the collagen-binding adhesin is involved in the pathogenesis of S. aureus infection of the cornea. PMID:10816547

  5. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    Science.gov (United States)

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  6. ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.

    Science.gov (United States)

    Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining

    2016-10-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.

  7. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

  8. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Science.gov (United States)

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  9. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    Science.gov (United States)

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  10. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  11. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  12. Susceptibility of glucokinase-MODY mutants to inactivation by oxidative stress in pancreatic β-cells.

    Science.gov (United States)

    Cullen, Kirsty S; Matschinsky, Franz M; Agius, Loranne; Arden, Catherine

    2011-12-01

    The posttranslational regulation of glucokinase (GK) differs in hepatocytes and pancreatic β-cells. We tested the hypothesis that GK mutants that cause maturity-onset diabetes of the young (GK-MODY) show compromised activity and posttranslational regulation in β-cells. Activity and protein expression of GK-MODY and persistent hyperinsulinemic hypoglycemia of infancy (PHHI) mutants were studied in β-cell (MIN6) and non-β-cell (H4IIE) models. Binding of GK to phosphofructo-2-kinase, fructose-2,6-bisphosphatase (PFK2/FBPase2) was studied by bimolecular fluorescence complementation in cell-based models. Nine of 11 GK-MODY mutants that have minimal effect on enzyme kinetics in vitro showed decreased specific activity relative to wild type when expressed in β-cells. A subset of these were stable in non-β-cells but showed increased inactivation in conditions of oxidative stress and partial reversal of inactivation by dithiothreitol. Unlike the GK-MODY mutants, four of five GK-PHHI mutants had similar specific activity to wild type and Y214C had higher activity than wild type. The GK-binding protein PFK2/FBPase2 protected wild-type GK from oxidative inactivation and the decreased stability of GK-MODY mutants correlated with decreased interaction with PFK2/FBPase2. Several GK-MODY mutants show posttranslational defects in β-cells characterized by increased susceptibility to oxidative stress and/or protein instability. Regulation of GK activity through modulation of thiol status may be a physiological regulatory mechanism for the control of GK activity in β-cells.

  13. Characterization and protective property of Brucella abortus cydC and looP mutants.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Barate, Abhijit Kashinath; Kim, Suk; Hahn, Tae-Wook

    2014-11-01

    Brucella abortus readily multiplies in professional or nonprofessional phagocytes in vitro and is highly virulent in mice. Isogenic mutants of B. abortus biovar 1 strain IVKB9007 lacking the ATP/GDP-binding protein motif A (P-loop) (named looP; designated here the IVKB9007 looP::Tn5 mutant) and the ATP-binding/permease protein (cydC; designated here the IVKB9007 cydC::Tn5 mutant) were identified and characterized by transposon mutagenesis using the mini-Tn5Km2 transposon. Both mutants were found to be virtually incapable of intracellular replication in both murine macrophages (RAW264.7) and the HeLa cell line, and their virulence was significantly impaired in BALB/c mice. Respective complementation of the IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants restored their ability to survive in vitro and in vivo to a level comparable with that of the wild type. These findings indicate that the cydC and looP genes play important roles in the virulence of B. abortus. In addition, intraperitoneal immunization of mice with a dose of the live IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants provided a high degree of protection against challenge with pathogenic B. abortus strain 544. Both mutants should be evaluated further as a live attenuated vaccine against bovine brucellosis for their ability to stimulate a protective immune response. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. A mutant of a mutant of a mutant of a ...: Irradiation of progressive radiation-induced mutants in a mutation-breeding programme with Chrysanthenum morifolium RAM

    International Nuclear Information System (INIS)

    Broertjes, C.; Koene, P.; Veen, J.W.H. van.

    1980-01-01

    Radiation-induced sports in Chrysanthemum morifolium RAM. have been reported for several years. It has become an everyday practice to produce flower-colour mutants from outstanding cross-breeding products, even before they are distributed for the commercial production of cut flowers. One of the most successful and recent examples is that of cv. Horim, of which hundreds of mutants were produced by successive use of radiation-induced mutants in the mutation-breeding programme. Over about 4 years a variety of flower-colour mutants was obtained, not only largely including the outstanding characteristics of the original cultivar but sometimes even with an appreciable improvement in quality and yield. It is expected that the latter types, the Miros group, will soon completely supersede the spontaneous or raditation-induced Horim sports and mutants and take over the leading position of the Horim group in the production of all-year-round (AYR) cut-flowers. (orig.)

  15. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    International Nuclear Information System (INIS)

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  16. Los mutantes de la escuela

    Directory of Open Access Journals (Sweden)

    Diego Armando Jaramillo-Ocampo

    2013-01-01

    Full Text Available El presente artículo muestra los resultados parciales del estudio “Juegos en el recreo escolar: un escenario para la formación ciudadana”, cuya pretensión fue comprender los imaginarios sociales de juego en el recreo escolar y su relación con la convivencia social desde la proximidad del enfoque de complementariedad y el diseño de investigación emergente, planteado por Murcia y Jaramillo (2008. Se presentan los desarrollos logrados en dos categorías centrales del estudio: el patio y el cuerpo; dos categorías que mutan constantemente como entidades vivas en la escuela, hacia la configuración de sujetos que reconocen en el otro y lo otro su posibilidad. La escuela viva, donde es posible “ser en relación con”… se reduce a un espacio temporal y físico, limitado por la campana, “el recreo”. El texto muestra, desde la voz de los actores, esa vida que se da y se quita en la escuela y que se posiciona como una más de las imposiciones normalizadas para controlar. Reconoce, finalmente, una propuesta desde la posibilidad que estos dos mutantes propician para una escuela libre y dinámica.

  17. High- and low-affinity binding of S-citalopram to the human serotonin transporter mutated at 20 putatively important amino acid positions

    DEFF Research Database (Denmark)

    Plenge, Per; Wiborg, Ove

    2005-01-01

    of presumed importance. Binding of S-citalopram, both to the high-affinity-binding site and to the allosteric binding site, was measured in these mutants with the purpose of investigating the connection between the two binding sites. The amino acid substitutions did not introduce large changes in the two...

  18. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Energy Technology Data Exchange (ETDEWEB)

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  19. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  20. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  1. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  2. Severity of mutant phenotype in a series of chlorophyll-deficient wheat mutants depends on light intensity and the severity of the block in chlorophyll synthesis.

    Science.gov (United States)

    Falbel, T G; Meehl, J B; Staehelin, L A

    1996-10-01

    Analyses of a series of allelic chlorina mutants of wheat (Triticum aestivum L.), which have partial blocks in chlorophyll (Chl) synthesis and, therefore, a limited Chl supply, reinforce the principle that Chl is required for the stable accumulation of Chl-binding proteins and that only reaction centers accumulate when the supply of Chl is severely limited. Depending on the rate of Chl accumulation (determined by the severity of the mutation) and on the rate of turnover of Chl and its precursors (determined by the environment in which the plant is grown), the mutants each reach an equilibrium of Chl synthesis and degradation. Together these mutants generate a spectrum of phenotypes. Under the harshest conditions (high illumination), plants with moderate blocks in Chl synthesis have membranes with very little Chl and Chl-proteins and membrane stacks resembling the thylakoids of the lethal xantha mutants of barely grown at low to medium light intensities (which have more severe blocks). In contrast, when grown under low-light conditions the same plants with moderate blocks have thylakoids resembling those of the wild type. The wide range of phenotypes of Chl b-deficient mutants has historically produced more confusion than enlightenment, but incomparable growth conditions can now explain the discrepancies reported in the literature.

  3. Rescuing mutant CFTR: a multi-task approach to a better outcome in treating cystic fibrosis.

    Science.gov (United States)

    Amaral, Margarida D; Farinha, Carlos M

    2013-01-01

    Correcting multiple defects of mutant CFTR with small molecule compounds has been the goal of an increasing number of recent Cystic Fibrosis (CF) drug discovery programmes. However, the mechanism of action (MoA) by which these molecules restore mutant CFTR is still poorly understood, in particular of CFTR correctors, i.e., compounds rescuing to the cells surface the most prevalent mutant in CF patients--F508del-CFTR. However, there is increasing evidence that to fully restore the multiple defects associated with F508del-CFTR, different small molecules with distinct corrective properties may be required. Towards this goal, a better insight into MoA of correctors is needed and several constraints should be addressed. The methodological approaches to achieve this include: 1) testing the combined effect of compounds with that of other (non-pharmacological) rescuing strategies (e.g., revertants or low temperature); 2) assessing effects in multiple cellular models (non-epithelial vs epithelial, non-human vs human, immortalized vs primary cultures, polarized vs non polarized, cells vs tissues); 3) assessing compound effects on isolated CFTR domains (e.g., compound binding by surface plasmon resonance, assessing effects on domain folding and aggregation); and finally 4) assessing compounds specificity in rescuing different CFTR mutants and other mutant proteins. These topics are reviewed and discussed here so as to provide a state-of-the art review on how to combine multiple ways of rescuing mutant CFTR to the ultimate benefit of CF patients.

  4. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Willson Richard C

    2010-12-01

    Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

  5. A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

    Science.gov (United States)

    Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

    2007-06-01

    A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

  6. Cooperation of nuclear reactor controller ARM-5S and turbine TVER-02

    International Nuclear Information System (INIS)

    Wagner, K.; Lnenicka, B.; Pokorny, F.; Prochazka, F.

    1985-01-01

    Turbines of Czechoslovak make provided with controllers TVER-02 are installed in WWER-440 nuclear power plants under construction in Czechoslovakia. Reactor output is controlled using Soviet-made controllers ARM-5S which already comprise turbine controllers. The problems are analyzed of cooperation of both controllers, especially their parameters and transient processes in typical operating situations. The analysis uses the results of measurements performed during the power start-up of Unit 1 of the V-2 nuclear power plant at Jaslovske Bohunice. The results show that two types of control modes can be selected for the operation of the entire unit: the control to constant unit output, and control of unit output varying with turbine load selected on the TVER-02 controller or given by the demand of the power network. (Z.M.)

  7. Induction of Mutants in Durum Wheat

    International Nuclear Information System (INIS)

    AL-Ubaidi, M.; Ibrahim, I.; AL-Hadithi, A.

    2002-01-01

    This investigation presents a breeding program for induction and development of a new genotype of durum wheat, resistant to lodging with high yield, by irradiation durum wheat hybrids (F2) with gamma rays 100 Gy, during 1990-1997 cultivation seasons. This program involves: induction of variability, selection evaluation of the mutants at three locations: Twaitha (Baghdad) Latifya ( Babylon) and Swari (Kutt). All mutants showed resistance to lodging and there was a significant reduction in plant height. Mutant SIXIZ-22 surpassed other mutants and its origin in lodging resistance and plant height (83.5,82.8 and 89.4 cm) in the three locations at generation M5 and M6, respectively. Also, there were significant differences between mutant and their origin in the number of spikes/M 2 and grain yild during the two successive generation. On the other hand, mutant IZxCO-105 surpassed other mutants in the number of spikes/M 2 (231.8,242.3 and 292) and grain yield (4336,3376 and 5232 kg/ha) in all testing location, respectively . (authors) 14 refs., 4 tabs

  8. The Adenovirus Type 3 Dodecahedron's RGD Loop Comprises an HSPG Binding Site That Influences Integrin Binding

    Directory of Open Access Journals (Sweden)

    E. Gout

    2010-01-01

    Full Text Available Human type 3 adenovirus dodecahedron (a virus like particle made of twelve penton bases features the ability to enter cells through Heparan Sulphate Proteoglycans (HSPGs and integrins interaction and is used as a versatile vector to deliver DNA or proteins. Cryo-EM reconstruction of the pseudoviral particle with Heparan Sulphate (HS oligosaccharide shows an extradensity on the RGD loop. A set of mutants was designed to study the respective roles of the RGD sequence (RGE mutant and of a basic sequence located just downstream. Results showed that the RGE mutant binding to the HS deficient CHO-2241 cells was abolished and unexpectedly, mutation of the basic sequence (KQKR to AQAS dramatically decreased integrin recognition by the viral pseudoparticle. This basic sequence is thus involved in integrin docking, showing a close interplay between HSPGs and integrin receptors.

  9. Ligand and proton exchange dynamics in recombinant human myoglobin mutants.

    Science.gov (United States)

    Lambright, D G; Balasubramanian, S; Boxer, S G

    1989-05-05

    Site-specific mutants of human myoglobin have been prepared in which lysine 45 is replaced by arginine (K45R) and aspartate 60 by glutamate (D60E), in order to examine the influence of these residues and their interaction on the dynamics of the protein. These proteins were studied by a variety of methods, including one and two-dimensional proton nuclear magnetic resonance spectroscopy, exchange kinetics for the distal and proximal histidine NH protons as a function of pH in the met cyano forms, flash photolysis of the CO forms, and ligand replacement kinetics. The electronic absorption and proton nuclear magnetic resonance spectra of the CO forms of these proteins are virtually identical, indicating that the structure of the heme pocket is unaltered by these mutations. There are, however, substantial changes in the dynamics of both CO binding and proton exchange for the mutant K45R, whereas the mutant D60E exhibits behavior indistinguishable from the reference human myoglobin. K45R has a faster CO bimolecular recombination rate and slower CO off-rate relative to the reference. The kinetics for CO binding are independent of pH (6.5 to 10) as well as ionic strength (0 to 1 M-NaCl). The exchange rate for the distal histidine NH is substantially lower for K45R than the reference, whereas the proximal histidine NH exchange rate is unaltered. The exchange behavior of the human proteins is similar to that reported for a comparison of the exchange rates for myoglobins having lysine at position 45 with sperm whale myoglobin, which has arginine at this position. This indicates that the differences in exchange rates reflects largely the Lys----Arg substitution. The lack of a simple correlation for the CO kinetics with this substitution means that these are sensitive to other factors as well. Specific kinetic models, whereby substitution of arginine for lysine at position 45 can affect ligand binding dynamics, are outlined. These experiments demonstrate that a relatively

  10. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  11. Novel mutations in β-tubulin gene in Trichoderma harzianum mutants resistant to methyl benzimidazol-2-yl carbamate.

    Science.gov (United States)

    Li, M; Zhang, H Y; Liang, B

    2013-01-01

    Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.

  12. Spectrum of induced floral mutants in Petunia

    International Nuclear Information System (INIS)

    Padmaja, V.; Sudhakar, P.

    1987-01-01

    A total of six floral mutants of garden Petunia isolated from the populations raised from the seed treatment with γ-rays, 2, 4-D and sodium azide are described. Five of the mutants viz. stellata, Campyloflora, Rubriflora mixed, Grandiflora and Albiflora mixed originated as segregants in M 2 generation while the chimeral floral phenotype was expressed in M 1 generation itself. Breeding behaviour of these horticulturally interesting altered floral phenotypes were studied in subsequent generations and appropriate conclusions were drawn regarding mode of inheritance of the mutant traits. 15 refs., 4 figures, 1 table. (author)

  13. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  14. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    International Nuclear Information System (INIS)

    Johnson, W. R.; Cheng, K. T.

    2001-01-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled

  15. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  16. Variations in 5S rDNAs in diploid and tetraploid offspring of red crucian carp × common carp.

    Science.gov (United States)

    Ye, Lihai; Zhang, Chun; Tang, Xiaojun; Chen, Yiyi; Liu, Shaojun

    2017-08-08

    The allotetraploid hybrid fish (4nAT) that was created in a previous study through an intergeneric cross between red crucian carp (Carassius auratus red var., ♀) and common carp (Cyprinus carpio L., ♂) provided an excellent platform to investigate the effect of hybridization and polyploidization on the evolution of 5S rDNA. The 5S rDNAs of paternal common carp were made up of a coding sequence (CDS) and a non-transcribed spacer (NTS) unit, and while the 5S rDNAs of maternal red crucian carp contained a CDS and a NTS unit, they also contained a variable number of interposed regions (IPRs). The CDSs of the 5S rDNAs in both parental fishes were conserved, while their NTS units seemed to have been subjected to rapid evolution. The diploid hybrid 2nF 1 inherited all the types of 5S rDNAs in both progenitors and there were no signs of homeologous recombination in the 5S rDNAs of 2nF 1 by sequencing of PCR products. We obtained two segments of 5S rDNA with a total length of 16,457 bp from allotetraploid offspring 4nAT through bacterial artificial chromosome (BAC) sequencing. Using this sequence together with the 5S rDNA sequences amplified from the genomic DNA of 4nAT, we deduced that the 5S rDNAs of 4nAT might be inherited from the maternal progenitor red crucian carp. Additionally, the IPRs in the 5S rDNAs of 4nAT contained A-repeats and TA-repeats, which was not the case for the IPRs in the 5S rDNAs of 2nF 1 . We also detected two signals of a 200-bp fragment of 5S rDNA in the chromosomes of parental progenitors and hybrid progenies by fluorescence in situ hybridization (FISH). We deduced that during the evolution of 5S rDNAs in different ploidy hybrid fishes, interlocus gene conversion events and tandem repeat insertion events might occurred in the process of polyploidization. This study provided new insights into the relationship among the evolution of 5S rDNAs, hybridization and polyploidization, which were significant in clarifying the genome evolution of

  17. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  18. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  19. Integrating structural and mutagenesis data to elucidate GPCR ligand binding

    DEFF Research Database (Denmark)

    Munk, Christian; Harpsøe, Kasper; Hauser, Alexander S

    2016-01-01

    is reported that exhibit activity through multiple receptors, binding in allosteric sites, and bias towards different intracellular signalling pathways. Furthermore, a wealth of single point mutants has accumulated in literature and public databases. Integrating these structural and mutagenesis data will help...

  20. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  1. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Semi-dwarf mutants for rice improvement

    International Nuclear Information System (INIS)

    Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli

    1990-01-01

    Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)

  3. X-rays sensitive mammalian cell mutant

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1982-01-01

    A phenomenon that in x-ray-sensitive mammalian-cell mutants, cellular death due to x-ray radiation was not increased by caffeine, but on the contrary, the dead cells were resuscitated by it was discussed. The survival rate of mutant cells increased by caffein in a low concentration. This suggested that caffeine may have induced some mechanism to produce x-ray resistant mutant cells. Postirradiation treatment with caffeine increased considerably the survival rate of the mutant cells, and this suggested the existence of latent caffeine-sensitive potentially lethal damage repair system. This system, after a few hours, is thought to be substituted by caffeine-resistant repair system which is induced by caffeine, and this may be further substituted by x-ray-resistant repair system. The repair system was also induced by adenine. (Ueda, J.)

  4. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    acer

    2014-01-08

    Jan 8, 2014 ... aquatic ecosystems were studied. In the present ... logy and photosynthesis research (Stolbov, 1995;. Pedersen ... Microalgal strain and cultivation conditions ..... evaluated for their ecotoxicological effects using 124y-1 mutant.

  5. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  6. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  7. Structural features and activity of Brazzein and its mutants upon substitution of a surfaced exposed alanine.

    Science.gov (United States)

    Ghanavatian, Parisa; Khalifeh, Khosrow; Jafarian, Vahab

    2016-12-01

    Brazzein (Brz) is a member of sweet-tasting protein containing four disulfide bonds. It was reported as a compact and heat-resistant protein. Here, we have used site-directed mutagenesis and replaced a surface-exposed alanine with aspartic acid (A19D mutant), lysine (A19K mutant) and glycine (A19G mutant). Activity comparisons of wild-type (WT) and mutants using taste panel test procedure showed that A19G variant has the same activity as WT protein. However, introduction of a positive charge in A19K mutant led to significant increase in Brz's sweetness, while A19D has reduced sweetness compared to WT protein. Docking studies showed that mutation at position 19 results in slight chain mobility of protein at the binding surface and changing the patterns of interactions toward more effective binding of E9K variant in the concave surface of sweet taste receptor. Far-UV CD data spectra have a characteristic shape of beta structure for all variants, however different magnitudes of spectra suggest that beta-sheet structure in WT and A19G is more stable than that of A19D and A19K. Equilibrium unfolding studies with fluorescence spectroscopy and using urea and dithiothritol (DTT) as chemical denaturants indicates that A19G mutant gains more stability against urea denaturation; while conformational stability of A19D and A19K decreases when compared with WT and A19G variants. We concluded that the positive charge at the surface of protein is important factor responsible for the interaction of protein with the human sweet receptor and Ala 19 can be considered as a key region for investigating the mechanism of the interaction of Brz with corresponding receptor. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  8. Crystallization and preliminary X-ray analysis of Ebola VP35 interferon inhibitory domain mutant proteins

    International Nuclear Information System (INIS)

    Leung, Daisy W.; Borek, Dominika; Farahbakhsh, Mina; Ramanan, Parameshwaran; Nix, Jay C.; Wang, Tianjiao; Prins, Kathleen C.; Otwinowski, Zbyszek; Honzatko, Richard B.; Helgeson, Luke A.; Basler, Christopher F.; Amarasinghe, Gaya K.

    2010-01-01

    Three mutant forms of Ebola VP35 interferon inhibitory domain were crystallized in three different space groups. VP35 is one of seven structural proteins encoded by the Ebola viral genome and mediates viral replication, nucleocapsid formation and host immune suppression. The C-terminal interferon inhibitory domain (IID) of VP35 is critical for dsRNA binding and interferon inhibition. The wild-type VP35 IID structure revealed several conserved residues that are important for dsRNA binding and interferon antagonism. Here, the expression, purification and crystallization of recombinant Zaire Ebola VP35 IID mutants R312A, K319A/R322A and K339A in space groups P6 1 22, P2 1 2 1 2 1 and P2 1 , respectively, are described. Diffraction data were collected using synchrotron sources at the Advanced Light Source and the Advanced Photon Source

  9. Exploring the Oxidation of Lignin-Derived Phenols by a Library of Laccase Mutants

    Directory of Open Access Journals (Sweden)

    Isabel Pardo

    2015-09-01

    Full Text Available Saturation mutagenesis was performed over six residues delimiting the substrate binding pocket of a fungal laccase previously engineered in the lab. Mutant libraries were screened using sinapic acid as a model substrate, and those mutants presenting increased activity were selected for exploring the oxidation of lignin-derived phenols. The latter comprised a battery of phenolic compounds of interest due to their use as redox mediators or precursors of added-value products and their biological activity. The new laccase variants were investigated in a multi-screening assay and the structural determinants, at both the substrate and the protein level, for the oxidation of the different phenols are discussed. Laccase activity greatly varied only by changing one or two residues of the enzyme pocket. Our results suggest that once the redox potential threshold is surpassed, the contribution of the residues of the enzymatic pocket for substrate recognition and binding strongly influence the overall rate of the catalytic reaction.

  10. Functionality screen of streptavidin mutants by non-denaturing SDS-PAGE using biotin-4-fluorescein.

    Science.gov (United States)

    Humbert, Nicolas; Ward, Thomas R

    2008-01-01

    Site-directed mutagenesis or directed evolution of proteins often leads to the production of inactive mutants. For streptavidin and related proteins, mutations may lead to the loss of their biotin-binding properties. With high-throughput screening methodologies in mind, it is imperative to detect, prior to the high-density protein production, the bacteria that produce non-functional streptavidin isoforms. Based on the incorporation of biotin-4-fluorescein in streptavidin mutants present in Escherichia coli bacterial extracts, we detail a functional screen that allows the identification of biotin-binding streptavidin variants. Bacteria are cultivated in a small volume, followed by a rapid treatment of the cells; biotin-4-fluorescein is added to the bacterial extract and loaded on an Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis (SDS-PAGE) under non-denaturing conditions. Revealing is performed using a UV transilluminator. This screen is thus easy to implement, cheap and requires only readily available equipment.

  11. Molecular analysis of waxy mutants in rice

    International Nuclear Information System (INIS)

    Yatou, O.; Amano, E.

    1990-01-01

    Full text: The 'waxy' gene is a structural gene coding a glycosyl transferase which synthesises amylose in the endosperm tissue. 'Non-waxy' rice cultivars have an active gene and their amylose content is 18-25% depending upon gene performance and modifier genes. In 'waxy' rice, no amylose is found because the enzyme is absent. In mutants induced by gamma rays, neutrons, EI or EMS, amylose content ranged from 0 to 20%, i.e. there are intermediate phenotypes as well. Some of them had the same amount of the enzyme as a 'non-waxy' cultivar, even fully 'waxy' mutants showed a certain amount of the enzyme. This suggests that in mutants there may be no structural change in the enzyme gene but the enzyme produced might be less active. By molecular analysis of the mutants' genes it was found that only two mutants induced by thermal neutrons show structural alterations, the changes in other mutants are either too small to be detected by Southern analysis or are outside the structural gene in question. (author)

  12. Commercialization Of Orchid Mutants For Floriculture Industry

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Zaiton Ahmad

    2014-01-01

    Orchids are the main contributors to cut flower industry in Malaysia with an existing good market and a huge business potential. Orchid industry has been established in Malaysia since 1960s but only started to develop and expand since 1980s. Continuous development of new orchid varieties is essential to meet customers' demands. Orchid mutagenesis research using gamma irradiation at Malaysian Nuclear Agency has successfully generated a number of new orchid varieties with commercial potentials. Therefore, Nuclear Malaysia has collaborated with an industrial partner, Hexagon Green Sdn Bhd (HGSB), to carry out commercialization research on these mutants under a Technofund project entitled 'Pre-Commercialization of Mutant Orchids for Cut Flowers Industry' from July 2011 to July 2014. Through this collaboration, Dendrobium orchid mutant plants developed by Nuclear Malaysia were transferred to HGSB's commercial orchid nursery at Bukit Changgang Agrotechnology Park, Banting, Selangor, for mass-propagation. The activities include evaluations on plant growth performance, flower quality, post harvest and market potential of these mutants. Mutants with good field performance have been identified and filed for Plant Variety Protection (PVP) with Department of Agriculture Malaysia. This paper describes outputs from this collaboration and activities undertaken in commercializing these mutants. (author)

  13. Effect of prosthesis endplate lordosis angles on L5-S1 kinematics after disc arthroplasty.

    Science.gov (United States)

    Tsitsopoulos, Parmenion P; Wojewnik, Bartosz; Voronov, Leonard I; Havey, Robert M; Renner, Susan M; Zelenakova, Julia; McIntosh, Braden; Carandang, Gerard; Abjornson, Celeste; Patwardhan, Avinash G

    2012-06-01

    We hypothesized that L5-S1 kinematics will not be affected by the lordosis distribution between the prosthesis endplates. Twelve cadaveric lumbosacral spines (51.3 ± 9.8 years) were implanted with 6° or 11° prostheses (ProDisc-L) with four combinations of superior/inferior lordosis (6°/0°, 3°/3°, 11°/0°, 3°/8°). Specimens were tested intact and after prostheses implantation with different lordosis distributions. Center of rotation (COR) and range of motion (ROM) were quantified. Six-degree lordosis prostheses (n = 7) showed no difference in flexion-extension ROM, regardless of design (6°/0° or 3°/3°) (p > 0.05). In lateral bending (LB), both designs reduced ROM (p lordosis prostheses (n = 5) showed no difference in flexion-extension ROM for either design (p > 0.05). LB ROM decreased with distributed lordosis prostheses (3°/8°) (p lordosis distribution among the two prosthesis endplates. The ProDisc-L prosthesis design where all lordosis is concentrated in the superior endplate yielded COR locations that were anterior and caudal to intact controls. The prosthesis with lordosis distributed between the two endplates yielded a COR that tended to be closer to intact. Further clinical and biomechanical studies are needed to assess the long-term impact of lordosis angle distribution on the fate of the facet joints.

  14. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  15. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  16. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  17. [Substrate specificities of bile salt hydrolase 1 and its mutants from Lactobacillus salivarius].

    Science.gov (United States)

    Bi, Jie; Fang, Fang; Qiu, Yuying; Yang, Qingli; Chen, Jian

    2014-03-01

    In order to analyze the correlation between critical residues in the catalytic centre of BSH and the enzyme substrate specificity, seven mutants of Lactobacillus salivarius bile salt hydrolase (BSH1) were constructed by using the Escherichia coli pET-20b(+) gene expression system, rational design and site-directed mutagenesis. These BSH1 mutants exhibited different hydrolytic activities against various conjugated bile salts through substrate specificities comparison. Among the residues being tested, Cys2 and Thr264 were deduced as key sites for BSH1 to catalyze taurocholic acid and glycocholic acid, respectively. Moreover, Cys2 and Thr264 were important for keeping the catalytic activity of BSH1. The high conservative Cys2 was not the only active site, other mutant amino acid sites were possibly involved in substrate binding. These mutant residues might influence the space and shape of the substrate-binding pockets or the channel size for substrate passing through and entering active site of BSH1, thus, the hydrolytic activity of BSH1 was changed to different conjugated bile salt.

  18. Importance of Residues Outside the Cation Binding Pocket for Na+ and K+ Binding to the Na+/K+-ATPase

    DEFF Research Database (Denmark)

    Christiansen, Line; Toustrup-Jensen, Mads Schak; Einholm, Anja P.

    Mutagenesis studies have identified several oxygen-containing residues in the transmembrane region which are important for the coordination of Na+ and/or K+. These were later confirmed by the high-resolution crystal structures of the Na+/K+-ATPase with bound Na+ or K+. However, more information...... aromatic ring, while Arg882 and Asp886 were mutated to leucine and alanine, respectively, to investigate the importance of charge and size of the residues. All three mutants could sustain growth and proliferation under ouabain pressure. However, the mutants exhibited a reduced turnover number. All three...... mutants displayed an increased apparent K+ affinity at the external binding sites in measurements of ATPase activity: for Phe318Trp, Arg882Leu, and Asp886Ala 2.2-, 5.1-, and 1.8-fold increases compared to the wild type, respectively. Similarly the three mutants exhibited 10-, 6.4-, and 4.1-fold decreases...

  19. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  20. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    International Nuclear Information System (INIS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-01-01

    With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)

  1. A molecular dynamics investigation into the mechanisms of alectinib resistance of three ALK mutants.

    Science.gov (United States)

    He, Muyang; Li, Weikang; Zheng, Qingchuan; Zhang, Hongxing

    2018-01-11

    Alectinib, a highly selective next-genetation anaplastic lymphoma kinase (ALK) inhibitor, has demonstrated promising antitumor activity in patients with ALK-positive non-small cell lung carcinomas (NSCLC). However, the therapeutic benefits of alectinib is inescapably hampered by the development of acquired resistant mutations in ALK. Despite the availability of ample experimental mutagenesis data, the molecular origin and the structural motifs under alectinib binding affinity deficiencies are still ambiguous. Here, molecular dynamics (MD) simulations and molecular mechanics generalized born surface area (MM-GBSA) calculation approaches were employed to elucidate the mechanisms of alectinib resistance induced by the mutations I1171N, V1180L, and L1198F. The MD results reveal that the studied mutations could trigger the dislocation of alectinib as well as conformational changes at the inhibitor binding site, thus induce the interactional changes between alectinib and mutants. The most influenced regions are the ligand binding entrance and the hinge region, which are considered to be the dominant binding motifs accounting for the binding affinity loss in mutants. The "key and lock mechanism" between the ethyl group at position 9 of alectinib and a recognition cavity in the hinge region of ALK is presented to illustrate the major molecular origin of drug resistance. Our results provide mechanistic insight into the effect of ALK mutations resistant to alectinib, which could contribute to further rational design of inhibitors to combat the acquired resistance. © 2018 Wiley Periodicals, Inc.

  2. A recombinant hypoallergenic parvalbumin mutant for immunotherapy of IgE-mediated fish allergy.

    Science.gov (United States)

    Swoboda, Ines; Bugajska-Schretter, Agnes; Linhart, Birgit; Verdino, Petra; Keller, Walter; Schulmeister, Ulrike; Sperr, Wolfgang R; Valent, Peter; Peltre, Gabriel; Quirce, Santiago; Douladiris, Nikolaos; Papadopoulos, Nikolaos G; Valenta, Rudolf; Spitzauer, Susanne

    2007-05-15

    IgE-mediated allergy to fish is a frequent cause of severe anaphylactic reactions. Parvalbumin, a small calcium-binding protein, is the major fish allergen. We have recently isolated a cDNA coding for carp parvalbumin, Cyp c 1, and expressed in Escherichia coli a recombinant Cyp c 1 molecule, which contained most IgE epitopes of saltwater and freshwater fish. In this study, we introduced mutations into the calcium-binding domains of carp parvalbumin by site-directed mutagenesis and produced in E. coli three parvalbumin mutants containing amino acid exchanges either in one (single mutants; Mut-CD and Mut-EF) or in both of the calcium-binding sites (double mutant; Mut-CD/EF). Circular dichroism analyses of the purified derivatives and the wild-type allergen showed that Mut-CD/EF exhibited the greatest reduction of overall protein fold. Dot blot assays and immunoblot inhibition experiments performed with sera from 21 fish-allergic patients showed that Mut-CD/EF had a 95% reduced IgE reactivity and represented the derivative with the least allergenic activity. The latter was confirmed by in vitro basophil histamine release assays and in vivo skin prick testing. The potential applicability for immunotherapy of Mut-CD/EF was demonstrated by the fact that mouse IgG Abs could be raised by immunization with the mutated molecule, which cross-reacted with parvalbumins from various fish species and inhibited the binding of fish-allergic patients' IgE to the wild-type allergen. Using the hypoallergenic carp parvalbumin mutant Mut-CD/EF, it may be possible to treat fish allergy by immunotherapy.

  3. From one body mutant to one cell mutant. A progress of radiation breeding in crops

    International Nuclear Information System (INIS)

    Nagatomi, Shigeki

    1996-01-01

    An effective method was established to obtain non-chimeral mutants with wide spectrum of flower colors, regenerated from floral organs on which mutated sectors were come out on chronic irradiated plants. By this way, six mutant varieties of flower colors have been selected from one pink flower of chrysanthemum, and cultivated for cut-flower production. By the same method, 3 mutant varieties with small and spray type flowers were selected in Eustoma. Mutant varieties such as a rust disease resistant in sugarcane, 6 dwarfs in Cytisus and pure-white mushroom in velvet shank have been selected successively for short period. (J.P.N.)

  4. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 2. Comparison of Various Mutants

    International Nuclear Information System (INIS)

    Balchiuniene, L.

    1995-01-01

    Spontaneous and gamma-induced mutability was compared in two groups of genetically unstable barley ear structure mutants - tweaky spike (tw) and branched ear (be). Instability in different loci causes different levels of spontaneous and gamma-induced mutability. A high spontaneous level of chlorophyll mutations is peculiar to be-ust mutants. It is suggested that the high level of induced chlorophyll mutations in allelic tw mutants is a result of better surviving of chlorophyll mutation carriers in the genotypical-physiological environment created by mutant tw alleles. (author). 6 refs., 2 tabs

  5. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  6. Atomic resolution structure of the double mutant (K53,56M) of bovine pancreatic phospholipase A2

    International Nuclear Information System (INIS)

    Sekar, K.; Yogavel, M.; Gayathri, D.; Velmurugan, D.; Krishna, R.; Poi, M.-J.; Dauter, Z.; Dauter, M.; Tsai, M.-D.

    2005-01-01

    The atomic resolution crystal structure of the double mutant (K53,56M) of bovine pancreatic phospholipase A 2 is reported. The structure of the double mutant K53,56M has previously been refined at 1.9 Å resolution using room-temperature data. The present paper reports the crystal structure of the same mutant K53,56M refined against 1.1 Å data collected using synchrotron radiation. A total of 116 main-chain atoms from 29 residues and 44 side chains are modelled in alternate conformations. Most of the interfacial binding residues are found to be disordered and alternate conformations could be recognized. The second calcium ion-binding site residue Glu92 adopts two alternate conformations. The minor and major conformations of Glu92 correspond to the second calcium ion bound and unbound states

  7. Kinetic characterization of tissue-type plasminogen activator (t-PA) and t-PA deletion mutants

    NARCIS (Netherlands)

    de Vries, C. [=Carlie J. M.; Veerman, H.; Nesheim, M. E.; Pannekoek, H.

    1991-01-01

    The binding of t-PA to fibrin is mediated both by its "finger" (F) and its "kringle 2" (K2) domain. In addition, these domains are involved in the stimulation of t-PA activity by fibrin. We analyzed the kinetic characteristics of Glu-plasminogen activation by t-PA and a set of t-PA deletion mutants

  8. Isolation of αL I domain mutants mediating firm cell adhesion using a novel flow-based sorting method.

    Science.gov (United States)

    Pepper, Lauren R; Parthasarathy, Ranganath; Robbins, Gregory P; Dang, Nicholas N; Hammer, Daniel A; Boder, Eric T

    2013-08-01

    The inserted (I) domain of αLβ2 integrin (LFA-1) contains the entire binding site of the molecule. It mediates both rolling and firm adhesion of leukocytes at sites of inflammation depending on the activation state of the integrin. The affinity change of the entire integrin can be mimicked by the I domain alone through mutations that affect the conformation of the molecule. High-affinity mutants of the I domain have been discovered previously using both rational design and directed evolution. We have found that binding affinity fails to dictate the behavior of I domain adhesion under shear flow. In order to better understand I domain adhesion, we have developed a novel panning method to separate yeast expressing a library of I domain variants on the surface by adhesion under flow. Using conditions analogous to those experienced by cells interacting with the post-capillary vascular endothelium, we have identified mutations supporting firm adhesion that are not found using typical directed evolution techniques that select for tight binding to soluble ligands. Mutants isolated using this method do not cluster with those found by sorting with soluble ligand. Furthermore, these mutants mediate shear-driven cell rolling dynamics decorrelated from binding affinity, as previously observed for I domains bearing engineered disulfide bridges to stabilize activated conformational states. Characterization of these mutants supports a greater understanding of the structure-function relationship of the αL I domain, and of the relationship between applied force and bioadhesion in a broader context.

  9. Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli

    DEFF Research Database (Denmark)

    Riber, Leise; Fujimitsu, K.; Katayama, T.

    2009-01-01

    in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However...

  10. Activities of Native and Tyrosine-69 Mutant Phospholipases A2 on Phospholipid Analogues. A Reevaluation of the Minimal Substrate Requirements

    NARCIS (Netherlands)

    Kuipers, Oscar P.; Dekker, Nicolaas; Verheij, Hubertus M.; Haas, Gerard H. de

    1990-01-01

    The role of Tyr-69 of porcine pancreatic phospholipase A2 in substrate binding was studied with the help of proteins modified by site-directed mutagenesis and phospholipid analogues with a changed head-group geometry. Two mutants were used containing Phe and Lys, respectively, at position 69.

  11. Uncoupling in Secondary Transport Proteins. A Mechanistic Explanation for Mutants of lac Permease with an Uncoupled Phenotype

    NARCIS (Netherlands)

    Lolkema, J.S.; Poolman, B.

    1995-01-01

    The kinetic behavior of a H+-substrate symporter has been studied in which in addition to the unloaded (E) and fully loaded states (E.S.H) of the carrier also one of the binary complexes (E.S or E.H) may reorient its binding sites. This results in two types of uncoupled mutants, the ES leak and the

  12. Finding Inhibitors of Mutant Superoxide Dismutase-1 for Amyotrophic Lateral Sclerosis Therapy from Traditional Chinese Medicine

    Directory of Open Access Journals (Sweden)

    Hung-Jin Huang

    2014-01-01

    Full Text Available Superoxide dismutase type 1 (SOD1 mutations cause protein aggregation and decrease protein stability, which are linked to amyotrophic lateral sclerosis (ALS disease. This research utilizes the world’s largest traditional Chinese medicine (TCM database to search novel inhibitors of mutant SOD1, and molecular dynamics (MD simulations were used to analyze the stability of protein that interacted with docked ligands. Docking results show that hesperidin and 2,3,5,4′-tetrahydroxystilbene-2-O-β-D-glucoside (THSG have high affinity to mutant SOD1 and then dopamine. For MD simulation analysis, hesperidin and THSG displayed similar value of RMSD with dopamine, and the migration analysis reveals stable fluctuation at the end of MD simulation time. Interestingly, distance between the protein and ligand has distinct difference, and hesperidin changes the position from initial binding site to the other place. In flexibility of residues analysis, the secondary structure among all complexes does not change, indicating that the structure are not affect ligand binding. The binding poses of hesperidin and THSG are similar to dopamine after molecular simulation. Our result indicated that hesperidin and THSG might be potential lead compound to design inhibitors of mutant SOD1 for ALS therapy.

  13. Structural and optical properties of AgIn5S8

    Science.gov (United States)

    Rincón, Carlos A. Durante; Durán, Larissa T.; Medina, Josefa Estévez; Castro, Jaime A.; León, Máximo; Fermín, Jose R.

    2017-12-01

    Compounds of the chalcogenide family Ag-In-VI (VI = S, Se, Te) are interesting materials due to their stoichiometric stability and potential application in nonlinear optics and solar cells. A polycrystalline ingot of AgIn5S8, an ordered vacancy semiconductor, was prepared by direct fusion of the stoichiometric mixture of the elements in an evacuated quartz ampoule. The presence of a single phase with cubic structure was confirmed by X-ray powder diffraction at room temperature. The lattice parameter, a, was calculated, giving 10.821750 Å. Samples in evacuated quartz ampoules were used to perform Differential Thermal Analysis measurements, showing congruent melting at 1110∘C. Transmittance and reflectivity measurements were used to calculate the absorption coefficient α. From the plot of (αhν)2 versus hν, two direct transitions are observed at 1.25 eV and 1.88 eV. While the higher energy direct transition has been observed by other authors, the direct nature of the lower energy transition was confirmed from the fitting of the plot of the reflectivity versus 1/hν between 0.53 eV-1 (1.89 eV) and 0.55 eV-1 (1.82 eV), obtaining a value of 1.29 eV. The real refractive index n and the high-frequency dielectric constant 𝜀∞ were also obtained from the fit of the reflectivity, resulting to be 2.68 and 7.2, respectively.

  14. Officially released mutant varieties in China

    International Nuclear Information System (INIS)

    Liu, L.; Van Zanten, L.; Shu, Q.Y.; Maluszynski, M.

    2004-01-01

    The use of mutation techniques for crop improvement in China has a long and well-established tradition of more than 50 years. As the result of intensive research in many institutes dealing with application of nuclear technologies more than 620 cultivars of 44 crop species have been released. Numerous mutant varieties have been grown on a large scale bringing significant economic impact, sustaining crop production and greatly contributing to increase of food production also in stress prone areas of the country. However, there is still missing information not only on the number of mutant varieties released in particular crop species but also on mutagens applied, selection approaches and on the use of mutants in cross breeding. Numerous Chinese scientists collected and systematized this information. Results of their work were often published in local scientific journals in the Chinese language and as such were unavailable to breeders from other countries. Having this in mind, we requested Dr. Liu Luxiang, the Director of the Department of Plant Mutation Breeding and Genetics, Institute for Application of Atomic Energy, Chinese Academy of Agricultural Sciences in Beijing to help us in finding as much information as possible on mutant varieties officially released in China. The data has been collected in close collaboration with his colleagues from various institutions all over the country and then evaluated, edited and prepared for publication by our team responsible for the FAO/IAEA Database of Officially Released Mutant Varieties. We would like to thank all Chinese colleagues who contributed to this list of Chinese mutant varieties. We hope that this publication will stimulate plant breeders in China to collect more information on released mutant varieties and especially on the use of mutated genes in cross breeding. (author)

  15. Development of high yielding mutants in lentil

    International Nuclear Information System (INIS)

    Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.

    2001-01-01

    Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)

  16. Rescue of glaucoma-causing mutant myocilin thermal stability by chemical chaperones

    Science.gov (United States)

    Burns, J. Nicole; Orwig, Susan D.; Harris, Julia L.; Watkins, J. Derrick; Vollrath, Douglas; Lieberman, Raquel L.

    2010-01-01

    Mutations in myocilin cause an inherited form of open angle glaucoma, a prevalent neurodegenerative disorder associated with increased intraocular pressure. Myocilin forms part of the trabecular meshwork extracellular matrix presumed to regulate intraocular pressure. Missense mutations, clustered in the olfactomedin (OLF) domain of myocilin, render the protein prone to aggregation in the endoplasmic reticulum of trabecular meshwork cells, causing cell dysfunction and death. Cellular studies have demonstrated temperature-sensitive secretion of myocilin mutants, but difficulties in expression and purification have precluded biophysical characterization of wild-type (wt) myocilin and disease-causing mutants in vitro. We have overcome these limitations by purifying wt and select glaucoma-causing mutant (D380A, I477N, I477S, K423E) forms of the OLF domain (228–504) fused to maltose binding protein (MBP) from E. coli. Monomeric fusion proteins can be isolated in solution. To determine the relative stability of wt and mutant OLF domains, we developed a fluorescence thermal stability assay without removal of MBP, and provide the first direct evidence that mutated OLF is folded but less thermally stable than wt. We tested the ability of seven chemical chaperones to stabilize mutant myocilin. Only sarcosine and trimethylamine N-oxide were capable of shifting the melting temperature of all mutants tested to near that of wt OLF. Our work lays the foundation for the identification of tailored small molecules capable of stabilizing mutant myocilin and promoting secretion to the extracellular matrix, to better control intraocular pressure and ultimately delay the onset of myocilin glaucoma. PMID:20334347

  17. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  18. Discussion on the method to increase the successful rate of L5/S1 intervertebral disc puncture

    International Nuclear Information System (INIS)

    Zhong Xianyi; Li Liangjun; Yu Chengxin

    2007-01-01

    Objective: To study the effective methods of L 5 /S 1 intervertebral disc puncture without drilling to solve the barriers from iliaca. Methods: (1) puncturing with belly-buttock sticking out: to enlarge waist sacro-iliaca angle to move the puncture point up; (2) puncturing through intervertebral edge: puncturing through L 5 to 1/3 intervertebral disc to make the puncture point move Up; (3) puncturing through L 5 /S 1 intervertebral disc with the self-made puncture location instrument. Results with the methods, 280 cases with L 5 /S 1 intervertebral disc protrusion have been successfully punctured, with successful rate 100%. Conclusion: These methods are ideal and easy to use to treat L 5 /S 1 intervertebral disc protrusion puncture, and worth popularizing. (authors)

  19. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  20. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  1. Absolute transition probabilities of 5s-5p transitions of Kr I from interferometric measurements in LTE-plasmas

    International Nuclear Information System (INIS)

    Kaschek, K.; Ernst, G.K.; Boetticher, W.

    1984-01-01

    Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)

  2. Isolation and characterization of Candida albicans morphological mutants derepressed for the formation of filamentous hypha-type structures

    International Nuclear Information System (INIS)

    Gil, C.; Pomes, R.; Nombela, C.

    1990-01-01

    Several Candida albicans morphological mutants were obtained by a procedure based on a combined treatment with nitrous acid plus UV irradiation and a double-enrichment step to increase the proportion of mutants growing as long filamentous structures. Altered cell morphogenesis in these mutants correlated with an altered colonial phenotype. Two of these mutants, C. albicans NEL102 and NEL103, were selected and characterized. Mutant blastoconidia initiated budding but eventually gave rise to filamentous hypha-type formations. These filaments were long and septate, and they branched very regularly at positions near septa. Calcofluor white (which is known to bind chitin-rich areas) stained septa, branching zones, and filament tips very intensely, as observed under the fluorescence microscope. Wild-type hybrids were obtained by fusing protoplasts of strain NEL102 with B14, another morphological mutant previously described as being permanently pseudomycelial, indicating that genetic determinants responsible for the two altered phenotypes are different. The mutants characterized in this work seemed to sequentially express the morphogenic characteristics of C. albicans, from blastoconidia to hyphae, in the absence of any inducer. Further characterization of these strains could be relevant to gain understanding of the genetic control of dimorphism in this species

  3. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  4. Measurements of the Exclusive Decays of the Υ(5S) to B Meson Final States and Improved Bs* Mass Measurement

    International Nuclear Information System (INIS)

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-01-01

    Using 420 pb -1 of data collected on the Υ(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of Υ(5S) into B meson final states. We measure the inclusive B cross section to be σ(Υ(5S)→BB(X))=(0.177±0.030±0.016) nb and make the first measurements of the production rates of σ(Υ(5S)→B*B*)=(0.131±0.025±0.014) nb and σ(Υ(5S)→BB*)=(0.043±0.016±0.006) nb, respectively. We set 90% confidence level limits of σ(Υ(5S)→BB) ( * ) B ( * ) π) s * mass to date, M(B s *)=(5411.7±1.6±0.6) MeV/c 2

  5. The research progress on plant mutant germplasm resources in China

    International Nuclear Information System (INIS)

    He Cexi; Ji Linzhen; Zhao Shirong

    1991-07-01

    Mutants induced by nuclear radiation or other mutagens are new artificial germplasm resources. Some mutants have been applied in plant breeding and great achievements have been reached. The status and progress on the collection, identification and utilization of mutants in China are introduced. A proposal for developing mutant germplasm resources with good agronomic characters is suggested

  6. NMR studies of differences in the conformations and dynamics of ligand complexes formed with mutant dihydrofolate reductases

    International Nuclear Information System (INIS)

    Birdsall, B.; Andrews, J.; Ostler, G.; Tendler, S.J.B.; Feeney, J.; Roberts, G.C.K.; Davies, R.W.; Cheung, H.T.A.

    1989-01-01

    Two mutants of Lactobacillus casei dihydrofolate reductase, Trp 21 → Leu and Asp 26 → Glu, have been prepared by using site-directed mutagenesis methods, and their ligand binding and structural properties have been compared with those of the wild-type enzyme. 1 H, 13 C, and 31 P NMR studies have been carried out to characterize the structural changes in the complexes of the mutant and wild-type enzymes. Replacement of the conserved Trp 21 by a Leu residue causes a decrease in activity of the enzyme and reduces the NADPH binding constant by a factor of 400. The binding of substrates and substrate analogues is only slightly affected. 1 H NMR studies of the Trp 21 → Leu enzyme complexes have confirmed the original resonance assignments for Trp 21. In complexes formed with methotrexate and the mutant enzyme, the results indicate some small changes in conformation occurring as much as 14 angstrom away from the site of substitution. For the enzyme-NADPH complexes, the chemical shifts of nuclei in the bound coenzyme indicate that the nicotinamide ring binds differently in complexes with the mutant and the wild-type enzyme. There are complexes where the wild-type enzyme has been shown to exist in solution as a mixture of conformations, and studies on the corresponding complexes with the Trp 21 → Leu mutant indicate that the delicately poised equilibria can be perturbed. Some conformational adjustments are required to allow the carboxylate of Glu 26 to bind effectively to the N1 proton of inhibitors such as methotrexate and trimethoprim

  7. Transcriptional dysregulation in NIPBL and cohesin mutant human cells.

    Directory of Open Access Journals (Sweden)

    Jinglan Liu

    2009-05-01

    Full Text Available Cohesin regulates sister chromatid cohesion during the mitotic cell cycle with Nipped-B-Like (NIPBL facilitating its loading and unloading. In addition to this canonical role, cohesin has also been demonstrated to play a critical role in regulation of gene expression in nondividing cells. Heterozygous mutations in the cohesin regulator NIPBL or cohesin structural components SMC1A and SMC3 result in the multisystem developmental disorder Cornelia de Lange Syndrome (CdLS. Genome-wide assessment of transcription in 16 mutant cell lines from severely affected CdLS probands has identified a unique profile of dysregulated gene expression that was validated in an additional 101 samples and correlates with phenotypic severity. This profile could serve as a diagnostic and classification tool. Cohesin binding analysis demonstrates a preference for intergenic regions suggesting a cis-regulatory function mimicking that of a boundary/insulator interacting protein. However, the binding sites are enriched within the promoter regions of the dysregulated genes and are significantly decreased in CdLS proband, indicating an alternative role of cohesin as a transcription factor.

  8. Coupling ligand recognition to protein folding in an engineered variant of rabbit ileal lipid binding protein.

    Science.gov (United States)

    Kouvatsos, Nikolaos; Meldrum, Jill K; Searle, Mark S; Thomas, Neil R

    2006-11-28

    We have engineered a variant of the beta-clam shell protein ILBP which lacks the alpha-helical motif that caps the central binding cavity; the mutant protein is sufficiently destabilised that it is unfolded under physiological conditions, however, it unexpectedly binds its natural bile acid substrates with high affinity forming a native-like beta-sheet rich structure and demonstrating strong thermodynamic coupling between ligand binding and protein folding.

  9. Biofilm formation in Escherichia coli cra mutants is impaired due to down-regulation of curli biosynthesis.

    Science.gov (United States)

    Reshamwala, Shamlan M S; Noronha, Santosh B

    2011-10-01

    Cra is a pleiotropic regulatory protein that controls carbon and energy flux in enteric bacteria. Recent studies have shown that Cra also regulates other cell processes and influences biofilm formation. The purpose of the present study was to investigate the role of Cra in biofilm formation in Escherichia coli. Congo red-binding studies suggested that curli biosynthesis is impaired in cra mutants. Microarray analysis of wild-type and mutant E. coli cultivated in conditions promoting biofilm formation revealed that the curli biosynthesis genes, csgBAC and csgDEFG, are poorly expressed in the mutant, suggesting that transcription of genes required for curli production is regulated by Cra. Four putative Cra-binding sites were identified in the curli intergenic region, which were experimentally validated by performing electromobility shift assays. Site-directed mutagenesis of three Cra-binding sites in the promoter region of the csgDEFG operon suggests that Cra activates transcription of this operon upon binding to operator regions both downstream and upstream of the transcription start site. Based on the Cra-binding sites identified in this and other studies, the Cra consensus sequence is refined.

  10. Bacterio-opsin mutants of Halobacterium halobium

    Science.gov (United States)

    Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

    1983-01-01

    The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

  11. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  12. Chlorophyll mutants in Phaseolus vulgaris (L.) Savi

    International Nuclear Information System (INIS)

    Svetleva, D.; Petkova, S.

    1991-01-01

    Three-year investigations were conducted on chlorophyll mutants of three type: viridissima, claroviridis, flavoviridis, viridocostata and xanthomarginata produced post gamma irradiation ( 60 Co, 8 krad, 280 rad/min). Cell division rate in spectrum and in quantity of induced aberrations was found to have no significant differences with the control. Chlorophyll mutations compared to the control are less developed and their productive characters are less manifested. Cell division rate and the quantity of induced aberrations have no relation to the elements of productivity in the mutants investigated. 3 tabs., 12 refs

  13. Reversion of autocrine transformation by a dominant negative platelet-derived growth factor mutant.

    Science.gov (United States)

    Vassbotn, F S; Andersson, M; Westermark, B; Heldin, C H; Ostman, A

    1993-07-01

    A non-receptor-binding mutant of the platelet-derived growth factor (PDGF) A chain, PDGF-0, was generated by exchanging 7 amino acids in the sequence. The mutant chains formed dimers that were similar to wild-type PDGF-AA with regard to stability and rate of processing to the mature 30-kDa secreted forms. Moreover, the mutant chains formed disulfide-bonded heterodimers with the PDGF B chain in NIH 3T3 cells heterodimer underwent the same processing and secretion as PDGF-AB. Transfection of c-sis-expressing 3T3 cells with PDGF-0 significantly inhibited the transformed phenotype of these cells, as determined by the following criteria. (i) Compared with PDGF-0-negative clones, PDGF-0-producing clones showed a reverted morphology. (ii) Clones producing PDGF-0 grew more slowly than PDGF-0-negative clones, with a fivefold difference in cell number after 14 days in culture. (iii) The expression of PDGF-0 completely inhibited the ability of the c-sis-expressing 3T3 cells to form colonies in soft agar; this inhibition was overcome by the addition of recombinant PDGF-BB to the culture medium, showing that the lack of colony formation of these cells was not due to a general unresponsiveness to PDGF. The specific expression of a PDGF-0/PDGF wild-type heterodimer in COS cells revealed that the affinity of the mutant heterodimer for the PDGF alpha receptor was decreased by approximately 50-fold compared with that of PDGF-AA. Thus, we show that a non-receptor-binding PDGF A-chain mutant neutralizes in a trans-dominant manner the autocrine transforming potential of the c-sis/PDGF B chain by forming low-affinity heterodimers with wild-type PDGF chains. This method of specifically antagonizing the effect of PDGF may be useful in investigations of the role of PDGF in normal and pathological conditions.

  14. The cation-deficient Ruddlesden-Popper oxysulfide Y2Ti2O5S2 as a layered sulfide: topotactic potassium intercalation to form KY2Ti2O5S2.

    Science.gov (United States)

    Rutt, Oliver J; Hill, Timothy L; Gál, Zoltán A; Hayward, Michael A; Clarke, Simon J

    2003-12-01

    Potassium intercalation into the cation-deficient n = 2 Ruddlesden-Popper oxysulfide Y(2)Ti(2)O(5)S(2) to form KY(2)Ti(2)O(5)S(2) has been carried out by reaction of the oxysulfide with potassium vapor in sealed metal tubes at 400 degrees C, potassium naphthalide in THF at 50 degrees C, or potassium in liquid ammonia at temperatures as low as -78 degrees C. Insertion of potassium is topotactic, and although a site 12-coordinate by oxide ions is vacant in the perovskite-type oxide slabs of the structure, potassium is too large to enter this site via the 4-coordinate window, and instead enters the rock-salt-type sulfide layers of the structure which necessitates a 30% increase in the lattice parameter c normal to the layers. In contrast with one of the sodium intercalates of Y(2)Ti(2)O(5)S(2) (beta-NaY(2)Ti(2)O(5)S(2)) in which sodium occupies a tetrahedral site in the sulfide layers, potassium favors an 8-coordinate site which necessitates a relative translation of adjacent oxide slabs. KY(2)Ti(2)O(5)S(2) is tetragonal: P4/mmm, a = 3.71563(4) A, c = 14.8682(2) A (at 298 K), Z = 1. Although the resistivity (3.4(1) x 10(3) Omega cm) is larger than would be expected for a metal, temperature independent paramagnetism dominates the magnetic susceptibility, and the material is electronically very similar to the analogous sodium intercalate beta-NaY(2)Ti(2)O(5)S(2) which features reduced-titanium-containing oxide layers of very similar geometry and electron count.

  15. Endoplasmic Reticulum-Targeted Subunit Toxins Provide a New Approach to Rescue Misfolded Mutant Proteins and Revert Cell Models of Genetic Diseases

    OpenAIRE

    Adnan, Humaira; Zhang, Zhenbo; Park, Hyun-Joo; Tailor, Chetankumar; Che, Clare; Kamani, Mustafa; Spitalny, George; Binnington, Beth; Lingwood, Clifford

    2016-01-01

    Many germ line diseases stem from a relatively minor disturbance in mutant protein endoplasmic reticulum (ER) 3D assembly. Chaperones are recruited which, on failure to correct folding, sort the mutant for retrotranslocation and cytosolic proteasomal degradation (ER-associated degradation-ERAD), to initiate/exacerbate deficiency-disease symptoms. Several bacterial (and plant) subunit toxins, retrograde transport to the ER after initial cell surface receptor binding/internalization. The A subu...

  16. Applicability of the 5S management method for quality improvement in health-care facilities: a review.

    Science.gov (United States)

    Kanamori, Shogo; Shibanuma, Akira; Jimba, Masamine

    2016-01-01

    The 5S management method (where 5S stands for sort, set in order, shine, standardize, and sustain) was originally implemented by manufacturing enterprises in Japan. It was then introduced to the manufacturing sector in the West and eventually applied to the health sector for organizing and standardizing the workplace. 5S has recently received attention as a potential solution for improving government health-care services in low- and middle-income countries. We conducted a narrative literature review to explore its applicability to health-care facilities globally, with a focus on three aspects: (a) the context of its application, (b) its impacts, and (c) its adoption as part of government initiatives. To identify relevant research articles, we researched public health databases in English, including CINAHL, PubMed, ScienceDirect, and Web of Science. We found 15 of the 114 articles obtained from the search results to be relevant for full-text analysis of the context and impacts of the 5S application. To identify additional information particularly on its adoption as part of government initiatives, we also examined other types of resources including reference books, reports, didactic materials, government documents, and websites. The 15 empirical studies highlighted its application in primary health-care facilities and a wide range of hospital areas in Brazil, India, Jordan, Senegal, Sri Lanka, Tanzania, the UK, and the USA. The review also found that 5S was considered to be the starting point for health-care quality improvement. Ten studies presented its impacts on quality improvements; the changes resulting from the 5S application were classified into the three dimensions of safety, efficiency, and patient-centeredness. Furthermore, 5S was adopted as part of government quality improvement strategies in India, Senegal, Sri Lanka, and Tanzania. 5S could be applied to health-care facilities regardless of locations. It could be not only a tool for health workers and

  17. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  18. Ethanol production using engineered mutant E. coli

    Science.gov (United States)

    Ingram, Lonnie O.; Clark, David P.

    1991-01-01

    The subject invention concerns novel means and materials for producing ethanol as a fermentation product. Mutant E. coli are transformed with a gene coding for pyruvate decarboxylase activity. The resulting system is capable of producing relatively large amounts of ethanol from a variety of biomass sources.

  19. Molecular Genetic Identification Of Some Flax Mutants

    International Nuclear Information System (INIS)

    AMER, I.M.; MOUSTAFA, H.A.M.

    2009-01-01

    Five flax genotypes (Linum usitatissimum L.) i.e., commercial cultivar Sakha 2, the mother variety Giza 4 and three mutant types induced by gamma rays, were screened for their salinity tolerance in field experiments (salinity concentration was 8600 and 8300 ppm for soil and irrigation water, respectively). Mutation 6 was the most salt tolerant as compared to the other four genotypes.RAPD technique was used to detect some molecular markers associated with salt tolerance in flax (Mut 6), RAPD-PCR results using 12 random primers exhibited 149 amplified fragments; 91.9% of them were polymorphic and twelve molecular markers (8.1%) for salt tolerant (mutant 6) were identified with molecular size ranged from 191 to 4159 bp and only eight primers successes to amplify these specific markers. Concerning the other mutants, Mut 15 and Mut 25 exhibited 4.3% and 16.2% specific markers, respectively. The induced mutants exhibited genetic similarity to the parent variety were about 51%, 58.3% and 61.1% for Mut 25, Mut 6 and Mut 15, respectively. These specific markers (SM) are used for identification of the induced mutations and it is important for new variety registration.

  20. Induced mutants for cereal grain protein improvement

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 17 papers and one summary presented, six dealing with the genetic improvement of seed protein using ionizing radiations fall within the INIS subject scope. Other topics discussed were non-radiation induced mutants used for cereal grain protein improvement

  1. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  2. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  3. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  4. Functional rescue of mutant ABCA1 proteins by sodium 4-phenylbutyrate.

    Science.gov (United States)

    Sorrenson, Brie; Suetani, Rachel J; Williams, Michael J A; Bickley, Vivienne M; George, Peter M; Jones, Gregory T; McCormick, Sally P A

    2013-01-01

    Mutations in the ATP-binding cassette transporter A1 (ABCA1) are a major cause of decreased HDL cholesterol (HDL-C), which infers an increased risk of cardiovascular disease (CVD). Many ABCA1 mutants show impaired localization to the plasma membrane. The aim of this study was to investigate whether the chemical chaperone, sodium 4-phenylbutyrate (4-PBA) could improve cellular localization and function of ABCA1 mutants. Nine different ABCA1 mutants (p.A594T, p.I659V, p.R1068H, p.T1512M, p.Y1767D, p.N1800H, p.R2004K, p.A2028V, p.Q2239N) expressed in HEK293 cells, displaying different degrees of mislocalization to the plasma membrane and discrete impacts on cholesterol efflux, were subject to treatment with 4-PBA. Treatment restored localization to the plasma membrane and increased cholesterol efflux function for the majority of mutants. Treatment with 4-PBA also increased ABCA1 protein expression in all transfected cell lines. In fibroblast cells obtained from low HDL-C subjects expressing two of the ABCA1 mutants (p.R1068H and p.N1800H), 4-PBA increased cholesterol efflux without any increase in ABCA1 expression. Our study is the first to investigate the effect of the chemical chaperone, 4-PBA on ABCA1 and shows that it is capable of restoring plasma membrane localization and enhancing the cholesterol efflux function of mutant ABCA1s both in vitro and ex vivo. These results suggest 4-PBA may warrant further investigation as a potential therapy for increasing cholesterol efflux and HDL-C levels.

  5. Shallow Boomerang-shaped Influenza Hemagglutinin G13A Mutant Structure Promotes Leaky Membrane Fusion*

    Science.gov (United States)

    Lai, Alex L.; Tamm, Lukas K.

    2010-01-01

    Our previous studies showed that an angled boomerang-shaped structure of the influenza hemagglutinin (HA) fusion domain is critical for virus entry into host cells by membrane fusion. Because the acute angle of ∼105° of the wild-type fusion domain promotes efficient non-leaky membrane fusion, we asked whether different angles would still support fusion and thus facilitate virus entry. Here, we show that the G13A fusion domain mutant produces a new leaky fusion phenotype. The mutant fusion domain structure was solved by NMR spectroscopy in a lipid environment at fusion pH. The mutant adopted a boomerang structure similar to that of wild type but with a shallower kink angle of ∼150°. G13A perturbed the structure of model membranes to a lesser degree than wild type but to a greater degree than non-fusogenic fusion domain mutants. The strength of G13A binding to lipid bilayers was also intermediate between that of wild type and non-fusogenic mutants. These membrane interactions provide a clear link between structure and function of influenza fusion domains: an acute angle is required to promote clean non-leaky fusion suitable for virus entry presumably by interaction of the fusion domain with the transmembrane domain deep in the lipid bilayer. A shallower angle perturbs the bilayer of the target membrane so that it becomes leaky and unable to form a clean fusion pore. Mutants with no fixed boomerang angle interacted with bilayers weakly and did not promote any fusion or membrane perturbation. PMID:20826788

  6. A Yersinia pestis tat mutant is attenuated in bubonic and small-aerosol pneumonic challenge models of infection but not as attenuated by intranasal challenge.

    Directory of Open Access Journals (Sweden)

    Joel Bozue

    Full Text Available Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge.

  7. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  8. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Science.gov (United States)

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  9. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C.; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    Background The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. Design A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results Backward stepwise linear regression (n=1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014). Additional regression analyses showed significant score increases of 0.44 (p=0.002), 0.14 (p=0.002), 0.06 (p=0.019), and 0.17 (p=0.044) points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities

  10. Impact of the Japanese 5S management method on patients' and caretakers' satisfaction: a quasi-experimental study in Senegal.

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Backward stepwise linear regression ( n= 1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention ( p= 0.014). Additional regression analyses showed significant score increases of 0.44 ( p= 0.002), 0.14 ( p= 0.002), 0.06 ( p= 0.019), and 0.17 ( p= 0.044) points on four items, which, respectively were healthcare staff members' communication, explanations about illnesses or cases, and consultation duration, and clients' overall satisfaction. The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities, further studies need to address the

  11. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  12. Investigating the structure and dynamics of the PIK3CA wild-type and H1047R oncogenic mutant.

    Directory of Open Access Journals (Sweden)

    Paraskevi Gkeka

    2014-10-01

    Full Text Available The PIK3CA gene is one of the most frequently mutated oncogenes in human cancers. It encodes p110α, the catalytic subunit of phosphatidylinositol 3-kinase alpha (PI3Kα, which activates signaling cascades leading to cell proliferation, survival, and cell growth. The most frequent mutation in PIK3CA is H1047R, which results in enzymatic overactivation. Understanding how the H1047R mutation causes the enhanced activity of the protein in atomic detail is central to developing mutant-specific therapeutics for cancer. To this end, Surface Plasmon Resonance (SPR experiments and Molecular Dynamics (MD simulations were carried out for both wild-type (WT and H1047R mutant proteins. An expanded positive charge distribution on the membrane binding regions of the mutant with respect to the WT protein is observed through MD simulations, which justifies the increased ability of the mutated protein variant to bind to membranes rich in anionic lipids in our SPR experiments. Our results further support an auto-inhibitory role of the C-terminal tail in the WT protein, which is abolished in the mutant protein due to loss of crucial intermolecular interactions. Moreover, Functional Mode Analysis reveals that the H1047R mutation alters the twisting motion of the N-lobe of the kinase domain with respect to the C-lobe and shifts the position of the conserved P-loop residues in the vicinity of the active site. These findings demonstrate the dynamical and structural differences of the two proteins in atomic detail and propose a mechanism of overactivation for the mutant protein. The results may be further utilized for the design of mutant-specific PI3Kα inhibitors that exploit the altered mutant conformation.

  13. Mutagenesis of the redox-active disulfide in mercuric ion reductase: Catalysis by mutant enzymes restricted to flavin redox chemistry

    International Nuclear Information System (INIS)

    Distefano, M.D.; Au, K.G.; Walsh, C.T.

    1989-01-01

    Mercuric reductase, a flavoenzyme that possesses a redox-active cystine, Cys 135 Cys 140 , catalyzes the reduction of Hg(II) to Hg(0) by NADPH. As a probe of mechanism, the authors have constructed mutants lacking a redox-active disulfide by eliminating Cys 135 (Ala 135 Cys 140 ), Cys 14 (Cys 135 Ala 140 ), or both (Ala 135 Ala 140 ). Additionally, they have made double mutants that lack Cys 135 (Ala 135 Cys 139 Cys 140 ) or Cys 140 (Cys 135 Cys 139 Ala 140 ) but introduce a new Cys in place of Gly 139 with the aim of constructing dithiol pairs in the active site that do not form a redox-active disulfide. The resulting mutant enzymes all lack redox-active disulfides and are hence restricted to FAD/FADH 2 redox chemistry. Each mutant enzyme possesses unique physical and spectroscopic properties that reflect subtle differences in the FAD microenvironment. Preliminary evidence for the Ala 135 Cys 139 Cys 14 mutant enzyme suggests that this protein forms a disulfide between the two adjacent Cys residues. Hg(II) titration experiments that correlate the extent of charge-transfer quenching with Hg(II) binding indicate that the Ala 135 Cys 140 protein binds Hg(II) with substantially less avidity than does the wild-type enzyme. All mutant mercuric reductases catalyze transhydrogenation and oxygen reduction reactions through obligatory reduced flavin intermediates at rates comparable to or greater than that of the wild-type enzyme. In multiple-turnover assays which monitored the production of Hg(0), two of the mutant enzymes were observed to proceed through at least 30 turnovers at rates ca. 1000-fold slower than that of wild-type mercuric reductase. They conclude that the Cys 135 and Cys 140 thiols serve as Hg(II) ligands that orient the Hg(II) for subsequent reduction by a reduced flavin intermediate

  14. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    Science.gov (United States)

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  15. Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice.

    Science.gov (United States)

    Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T

    2013-11-04

    Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Relationship between intracellular Na+ concentration and reduced Na+ affinity in Na+,K+-ATPase mutants causing neurological disease

    DEFF Research Database (Denmark)

    Toustrup-Jensen, Mads Schak; Einholm, Anja P.; Schack, Vivien

    The neurological disorders familial hemiplegic migraine type 2 (FHM2), alternating hemiplegia of childhood (AHC), and rapid-onset dystonia parkinsonism (RDP) are caused by mutations of Na+,K+-ATPase α2 and α3 isoforms, expressed in glial and neuronal cells, respectively. Although these disorders......, addressing the question to what extent they cause a change of the intracellular Na+ and K+ concentrations ([Na+]i and [K+]i) in COS cells. C-terminal extension mutants generally showed dramatically reduced Na+ affinity without disturbance of K+ binding, as did other RDP mutants. No phosphorylation from ATP...

  17. Molecular mechanism of action of pharmacoperone rescue of misrouted GPCR mutants: the GnRH receptor.

    Science.gov (United States)

    Janovick, Jo Ann; Patny, Akshay; Mosley, Ralph; Goulet, Mark T; Altman, Michael D; Rush, Thomas S; Cornea, Anda; Conn, P Michael

    2009-02-01

    The human GnRH receptor (hGnRHR), a G protein-coupled receptor, is a useful model for studying pharmacological chaperones (pharmacoperones), drugs that rescue misfolded and misrouted protein mutants and restore them to function. This technique forms the basis of a therapeutic approach of rescuing mutants associated with human disease and restoring them to function. The present study relies on computational modeling, followed by site-directed mutagenesis, assessment of ligand binding, effector activation, and confocal microscopy. Our results show that two different chemical classes of pharmacoperones act to stabilize hGnRHR mutants by bridging residues D(98) and K(121). This ligand-mediated bridge serves as a surrogate for a naturally occurring and highly conserved salt bridge (E(90)-K(121)) that stabilizes the relation between transmembranes 2 and 3, which is required for passage of the receptor through the cellular quality control system and to the plasma membrane. Our model was used to reveal important pharmacophoric features, and then identify a novel chemical ligand, which was able to rescue a D(98) mutant of the hGnRHR that could not be rescued as effectively by previously known pharmacoperones.

  18. Adaptation of the S-5-S Pendulím Seismometer for Measurement of Rotational Ground Motion

    Czech Academy of Sciences Publication Activity Database

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-01-01

    Roč. 16, č. 4 (2012), s. 649-656 ISSN 1383-4649 Institutional support: RVO:68145535 Keywords : rotation al ground motion * experimental measurement * mining induced seismicity * S-5-S seismometer Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.388, year: 2012 http://link.springer.com/article/10.1007%2Fs10950-012-9279-6

  19. Evolution of primary and secondary structures in 5S and 5.8S rRNA

    International Nuclear Information System (INIS)

    Curtiss, W.C.

    1986-01-01

    The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented

  20. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  1. A transcriptionally active estrogen receptor mutant is a novel type of dominant negative inhibitor of estrogen action.

    Science.gov (United States)

    McInerney, E M; Ince, B A; Shapiro, D J; Katzenellenbogen, B S

    1996-12-01

    We have characterized a human estrogen receptor (ER) mutant, V364E, which has a single amino acid substitution in its hormone-binding domain. This ER mutant is fully active or even superactive at saturating levels of estradiol (10(-8) M E2) yet has the capacity to act as a strong dominant negative inhibitor of the wild type ER. In transient transfection assays using ER-negative Chinese hamster ovary (CHO) cells and two different estrogen response element (ERE)-containing promoter reporter genes, V364E treated with 10(-8) M E2 exhibited approximately 250% and 100% of the activity of the wild type ER with these two promoter contexts, respectively. Despite the high activity of V364E when present alone in cells, coexpression of both V364E and wild type ER causes a significant decrease in overall ER-mediated transcriptional activity. On the TATA promoter, where V364E was more inhibitory, estrogen-stimulated activity was reduced by approximately 50% at a 1:1 ratio of mutant to wild type ER expression vector, and at a 10:1 ratio, 75% of ER activity was inhibited. V364E was expressed at lower levels than wild type ER and has a approximately 40-fold lower affinity for E2 compared with wild type ER. In promoter interference assays, V364E exhibited a strict dependence upon E2 for binding to an ERE. Surprisingly, even when V364E was unable to bind to ERE DNA (i.e. either at low E2 concentration or by mutation of its DNA-binding domain), this mutant retained full dominant negative activity. This highly active ER mutant is, thus, able to repress ER-mediated transcription when the mutant and wild type ER are present together in cells, even without DNA binding. Since competition for ERE binding and the formation of inactive heterodimers cannot fully account for the dominant negative activity of V364E, it is probable that altered interactions with proteins important in ER-mediated transcription play a key role in the repression of transcription by V364E. The properties and probable

  2. Pharmacokinetic properties of radiolabeled mutant Interleukin-2v: a PET imaging study.

    Science.gov (United States)

    Hartimath, Siddesh V; Manuelli, Valeria; Zijlma, Rolf; Signore, Alberto; Nayak, Tapan K; Freimoser-Grundschober, Anne; Klein, Christian; Dierckx, Rudi A J O; de Vries, Erik F J

    2018-01-23

    Interleukin-2 (IL2) is a cytokine that can stimulate cytotoxic immune cells to attack infected and malignant cells. Unfortunately, IL2 can also cause serious immune-related toxicity. Recently, a mutant of IL2 (IL2v) with abolished CD25 binding, increased plasma half-life and less toxicity was engineered. Unlike wild-type IL2 (wt-IL2), mutant IL2v does not bind to the α-subunit (CD25) of the high affinity IL2αβγ receptor, but only to its β and γ subunit. Here, we investigated the biological properties of IL2v and compared with the wt-IL2 using fluorine-18 and PET. [ 18 F]FB-IL2v binds specifically to IL2 receptors (IL2R) on activated human peripheral blood monocytes (hPBMCs) and is cleared mainly by the kidneys (Balb/c mice). [ 18 F]FB-IL2v PET studies in SCID mice injected with hPBMCs revealed high uptake in the implant (0.85 ± 0.15 SUV), which was significantly reduced after pretreatment with wt-IL2 or mutant IL2v (SUV 0.26 ± 0.1 and 0.46 ± 0.1, p FB-IL2v to IL2R was reversible. The volume of distribution (V T ) and the non-displaceable binding potential (BP nd ) of mutant [ 18 F]FB-IL2v in the implant were approximately 3 times lower than those of wild-type [ 18 F]FB-IL2 ( p FB-IL2v in the implant ( p FB-IL2 binds stronger to IL2R and has faster kinetics than [18F]FB-IL2v, which makes it less suitable as a therapeutic drug. [ 18 F]FB-IL2v, on the other hand, seems to have better properties for use as a therapeutic drug.

  3. Energetic basis for drug resistance of HIV-1 protease mutants against amprenavir

    Science.gov (United States)

    Kar, Parimal; Knecht, Volker

    2012-02-01

    Amprenavir (APV) is a high affinity (0.15 nM) HIV-1 protease (PR) inhibitor. However, the affinities of the drug resistant protease variants V32I, I50V, I54V, I54M, I84V and L90M to amprenavir are decreased 3 to 30-fold compared to the wild-type. In this work, the popular molecular mechanics Poisson-Boltzmann surface area method has been used to investigate the effectiveness of amprenavir against the wild-type and these mutated protease variants. Our results reveal that the protonation state of Asp25/Asp25' strongly affects the dynamics, the overall affinity and the interactions of the inhibitor with individual residues. We emphasize that, in contrast to what is often assumed, the protonation state may not be inferred from the affinities but requires pKa calculations. At neutral pH, Asp25 and Asp25' are ionized or protonated, respectively, as suggested from pKa calculations. This protonation state was thus mainly considered in our study. Mutation induced changes in binding affinities are in agreement with the experimental findings. The decomposition of the binding free energy reveals the mechanisms underlying binding and drug resistance. Drug resistance arises from an increase in the energetic contribution from the van der Waals interactions between APV and PR (V32I, I50V, and I84V mutant) or a rise in the energetic contribution from the electrostatic interactions between the inhibitor and its target (I54M and I54V mutant). For the V32I mutant, also an increased free energy for the polar solvation contributes to the drug resistance. For the L90M mutant, a rise in the van der Waals energy for APV-PR interactions is compensated by a decrease in the polar solvation free energy such that the net binding affinity remains unchanged. Detailed understanding of the molecular forces governing binding and drug resistance might assist in the design of new inhibitors against HIV-1 PR variants that are resistant against current drugs.

  4. PNRI mutant variety: sansevieria 'Sword of Ibe'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2011-01-01

    Sansevieria 'Sword of Ibe,' registered by the Philippine Nuclear Research Institute as NSIC 2008 Or-66, is a chlorophyll mutant of Sansevieria trifasciata 'Moonshine' developed by treating its suckers or shoots arising from a rhizome with acute gamma radiation from a Cobalt-60 source. The new mutant is identical in growth habit and vigor to Sansevieria 'Moonshine,' also known as Moonglow. Results of this mutation breeding experiment showed that leaf color and flowering were altered by gamma irradiation without changing the other characteristics of the plant. Propagation is true-to-type by separation of sucker and top cutting. The plant is recommended for use as landscaping material and as pot plant for indoor and outdoor use. The leaves may be harvested as cut foliage for Japanese flower arrangements. (author)

  5. Serine:glyoxylate aminotransferase mutant of barley

    International Nuclear Information System (INIS)

    Blackwell, R.; Murray, A.; Joy, K.; Lea, P.

    1987-01-01

    A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO 2 at twice the wild type rate when it was fed [ 14 C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO 2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

  6. Intact interval timing in circadian CLOCK mutants.

    Science.gov (United States)

    Cordes, Sara; Gallistel, C R

    2008-08-28

    While progress has been made in determining the molecular basis for the circadian clock, the mechanism by which mammalian brains time intervals measured in seconds to minutes remains a mystery. An obvious question is whether the interval-timing mechanism shares molecular machinery with the circadian timing mechanism. In the current study, we trained circadian CLOCK +/- and -/- mutant male mice in a peak-interval procedure with 10 and 20-s criteria. The mutant mice were more active than their wild-type littermates, but there were no reliable deficits in the accuracy or precision of their timing as compared with wild-type littermates. This suggests that expression of the CLOCK protein is not necessary for normal interval timing.

  7. The application of shortened upper leaf mutant in barley breeding

    International Nuclear Information System (INIS)

    Jin Hua

    2004-01-01

    The shortened upper leaf mutant was induced from Fuji Nigo by γ-ray irradiation. Fuji Nigo, the mutant, cross-cut F 1 , F 2 and back-cross F 1 , F 2 were used to analyze mutant heredity by comparative study. The yield, chlorophyll content, light intensity, dry matter of mutant were investigated. The results showed that (1) the mutant character was controlled by a couple of nuclear genes which were partial dominance; (2) the transmittance of the mutant colony was better than that of Fuji Nigo and bottom dry matter was much more than that of Fuji Nigo; (3) under the condition of high fertilizer and high plant population , the yield of mutant was higher than that of Fuji Nigo; (4) the content of chlorophyll a in the mutant was higher than that in Fuji Nigo

  8. ''Fushi'' - excellent mutant germplasm for peanut improvement

    International Nuclear Information System (INIS)

    Jiang, X.; Zhou, Y.

    1989-01-01

    Full text: The mutant line ''Fushi'' was selected following seed treatment of the variety ''Shi Xuan 64'' in 1960 with 32 P. Many good peanut varieties were developed using ''Fushi'' in cross-breeding (ref. Mutation Breeding Newsletter No. 30 (July 1987) p. 2-3). In the past 10 years, planting areas of these varieties added up to 3,3 million ha in South China, peanut production was increased by more than 500 000 t valued 500 million Yuan. (author)

  9. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  10. Grain product of 34 soya mutant lines

    International Nuclear Information System (INIS)

    Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A.

    2009-01-01

    This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R 4 M 18 ) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co 60 gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L 25 and L 32 produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

  11. Multivariate analysis for selecting apple mutants

    International Nuclear Information System (INIS)

    Faedi, W.; Bagnara, G.L.; Rosati, P.; Cecchini, M.

    1992-01-01

    The mutlivariate analysis of four year records on several vegetative and productive traits of twenty-one apple mutants (3 of 'Jonathan', 3 of 'Ozark Gold', 14 of 'Mollie's Delicious', 1 of 'Neipling's Early Stayman)' induced by gamma radiations showed that observation of some traits of one-year-old shoots is the most efficient way to reveal compact growing apple mutants. In particular, basal cross-section area, total length and leaf area resulted the most appropriate parameters, while internode length together with conopy height and width are less appropriate. The most interesting mutants we found are: one of 'Mollie's Delicious for the best balance among tree and fruit traits and for high skin color; one of 'Neipling's Early Stayman' with an earlier and more extensively red colored apple than the original clone. (author)

  12. Probiotic features of Lactobacillus plantarum mutant strains.

    Science.gov (United States)

    Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela

    2012-10-01

    In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.

  13. Amphitrite ornata Dehaloperoxidase (DHP): Investigations of Structural Factors That Influence the Mechanism of Halophenol Dehalogenation Using ;Peroxidase-like; Myoglobin Mutants and ;Myoglobin-like; DHP Mutants

    Energy Technology Data Exchange (ETDEWEB)

    Du, Jing; Huang, Xiao; Sun, Shengfang; Wang, Chunxue; Lebioda, Lukasz; Dawson, John H. (SC)

    2012-05-14

    Dehaloperoxidase (DHP), discovered in the marine terebellid polychaete Amphitrite ornata, is the first heme-containing globin with a peroxidase activity. The sequence and crystal structure of DHP argue that it evolved from an ancient O{sub 2} transport and storage globin. Thus, DHP retains an oxygen carrier function but also has the ability to degrade halophenol toxicants in its living environment. Sperm whale myoglobin (Mb) in the ferric state has a peroxidase activity {approx}10 times lower than that of DHP. The catalytic activity enhancement observed in DHP appears to have been generated mainly by subtle changes in the positions of the proximal and distal histidine residues that appeared during DHP evolution. Herein, we report investigations into the mechanism of action of DHP derived from examination of 'peroxidase-like' Mb mutants and 'Mb-like' DHP mutants. The dehalogenation ability of wild-type Mb is augmented in the peroxidase-like Mb mutants (F43H/H64L, G65T, and G65I Mb) but attenuated in the Mb-like T56G DHP variant. X-ray crystallographic data show that the distal His residues in G65T Mb and G65I are positioned {approx}0.3 and {approx}0.8 {angstrom}, respectively, farther from the heme iron compared to that in the wild-type protein. The H93K/T95H double mutant Mb with the proximal His shifted to the 'DHP-like' position has an increased peroxidase activity. In addition, a better dehaloperoxidase (M86E DHP) was generated by introducing a negative charge near His89 to enhance the imidazolate character of the proximal His. Finally, only minimal differences in dehalogenation activities are seen among the exogenous ligand-free DHP, the acetate-bound DHP, and the distal site blocker L100F DHP mutant. Thus, we conclude that binding of halophenols in the internal binding site (i.e., distal cavity) is not essential for catalysis. This work provides a foundation for a new structure-function paradigm for peroxidases and for the

  14. Amphitrite ornata dehaloperoxidase (DHP): investigations of structural factors that influence the mechanism of halophenol dehalogenation using "peroxidase-like" myoglobin mutants and "myoglobin-like" DHP mutants.

    Science.gov (United States)

    Du, Jing; Huang, Xiao; Sun, Shengfang; Wang, Chunxue; Lebioda, Lukasz; Dawson, John H

    2011-09-27

    Dehaloperoxidase (DHP), discovered in the marine terebellid polychaete Amphitrite ornata, is the first heme-containing globin with a peroxidase activity. The sequence and crystal structure of DHP argue that it evolved from an ancient O(2) transport and storage globin. Thus, DHP retains an oxygen carrier function but also has the ability to degrade halophenol toxicants in its living environment. Sperm whale myoglobin (Mb) in the ferric state has a peroxidase activity ∼10 times lower than that of DHP. The catalytic activity enhancement observed in DHP appears to have been generated mainly by subtle changes in the positions of the proximal and distal histidine residues that appeared during DHP evolution. Herein, we report investigations into the mechanism of action of DHP derived from examination of "peroxidase-like" Mb mutants and "Mb-like" DHP mutants. The dehalogenation ability of wild-type Mb is augmented in the peroxidase-like Mb mutants (F43H/H64L, G65T, and G65I Mb) but attenuated in the Mb-like T56G DHP variant. X-ray crystallographic data show that the distal His residues in G65T Mb and G65I are positioned ∼0.3 and ∼0.8 Å, respectively, farther from the heme iron compared to that in the wild-type protein. The H93K/T95H double mutant Mb with the proximal His shifted to the "DHP-like" position has an increased peroxidase activity. In addition, a better dehaloperoxidase (M86E DHP) was generated by introducing a negative charge near His89 to enhance the imidazolate character of the proximal His. Finally, only minimal differences in dehalogenation activities are seen among the exogenous ligand-free DHP, the acetate-bound DHP, and the distal site blocker L100F DHP mutant. Thus, we conclude that binding of halophenols in the internal binding site (i.e., distal cavity) is not essential for catalysis. This work provides a foundation for a new structure-function paradigm for peroxidases and for the molecular evolution of the dual-function enzyme DHP.

  15. Identification of nucleic acid binding sites on translin-associated factor X (TRAX protein.

    Directory of Open Access Journals (Sweden)

    Gagan Deep Gupta

    Full Text Available Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity.

  16. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    Science.gov (United States)

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  17. Radiation studies in Cajanus cajan: meiotic behaviour in some M/sub 2/ mutants

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, S.S.N.; Akhaury, S.B. (Ranchi Univ. (India). Dept. of Botany)

    1982-01-01

    A qualitative study of the mutants produced in M/sub 2/ generation has been made. The mutants were classified as: (1) chlorophyll mutant, (2) morphological mutant, (3) pollen mutant, (4) semi-sterile and (5) sterile mutant. Cytological investigations of pollen mutants, sterile and semi-sterile mutants have revealed that these mutants generally arise at higher dose levels (20 Kr and 25 Kr).

  18. Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs.

    Science.gov (United States)

    Mandal, Debabrata; Köhrer, Caroline; Su, Dan; Babu, I Ramesh; Chan, Clement T Y; Liu, Yuchen; Söll, Dieter; Blum, Paul; Kuwahara, Masayasu; Dedon, Peter C; Rajbhandary, Uttam L

    2014-02-01

    Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the methionine codon AUG. To understand why a modified C, and not U or modified U, is used to base pair with A, we mutated the C34 in the anticodon of Haloarcula marismortui isoleucine tRNA (tRNA2(Ile)) to U, expressed the mutant tRNA in Haloferax volcanii, and purified and analyzed the tRNA. Ribosome binding experiments show that although the wild-type tRNA2(Ile) binds exclusively to the isoleucine codon AUA, the mutant tRNA binds not only to AUA but also to AUU, another isoleucine codon, and to AUG, a methionine codon. The G34 to U mutant in the anticodon of another H. marismortui isoleucine tRNA species showed similar codon binding properties. Binding of the mutant tRNA to AUG could lead to misreading of the AUG codon and insertion of isoleucine in place of methionine. This result would explain why most archaea and bacteria do not normally use U or a modified U in the anticodon wobble position of isoleucine tRNA for reading the codon AUA. Biochemical and mass spectrometric analyses of the mutant tRNAs have led to the discovery of a new modified nucleoside, 5-cyanomethyl U in the anticodon wobble position of the mutant tRNAs. 5-Cyanomethyl U is present in total tRNAs from euryarchaea but not in crenarchaea, eubacteria, or eukaryotes.

  19. Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

    Science.gov (United States)

    Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

    2015-10-01

    Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

  20. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Molecular analysis of mutants of the Neurospora adenylosuccinate ...

    Indian Academy of Sciences (India)

    2012-08-07

    Aug 7, 2012 ... and mutants induced with X-ray, UV or chemical mutagens. ... We have sequenced the ad-8 locus from 13 of these mutants and identified the molecular nature ..... mutants in yeast by selection for constitutive behavior in pig-.

  2. Biological changes in Barley mutants resistant to powdery mildew disease

    International Nuclear Information System (INIS)

    Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

    2012-12-01

    physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

  3. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  4. PBP deletion mutants of Escherichia coli exhibit irregular distribution of MreB at the deformed zones.

    Science.gov (United States)

    Vijayan, Saptha; Mallick, Sathi; Dutta, Mouparna; Narayani, M; Ghosh, Anindya S

    2014-02-01

    MreB is a cytoskeletal protein, which is responsible for maintaining proper cellular morphology and is essential for cell survival. Likewise, penicillin-binding protein 5 (PBP5) helps in maintaining cell shape, though non-essential for survival. The contradicting feature of these two proteins paves the way for this study, wherein we attempt to draw a relation on the nature of distribution of MreB in PBP deletion mutants. The study revealed that the uniform MreB helices/patches were destabilized/disturbed at the zone of deformities of the PBP mutants, whereas the helical patterns were retained at the regions maintaining a rod shape. We interpret that MreB remains functional irrespective of its distribution being misguided by the aberrant shapes of PBP mutants.

  5. Host factor I, Hfq, binds to Escherichia coli ompA mRNA in a growth rate-dependent fashion and regulates its stability

    DEFF Research Database (Denmark)

    Vytvytska, O; Jakobsen, J S; Balcunaite, G

    1998-01-01

    RNA. In hfq mutant cells with a deficient Hfq gene product, the RNA-binding activity is missing, and analysis of the ompA mRNA showed that the growth-rate dependence of degradation is lost. Furthermore, the half-life of the ompA mRNA is prolonged in the mutant cells, irrespective of growth rate. Hfq has...

  6. Mutants of Agrobacterium tumefaciens with elevated vir gene expression

    International Nuclear Information System (INIS)

    Pazour, G.J.; Ta, C.N.; Das, A.

    1991-01-01

    Expression of Agrobacterium tumefaciens virulence (vir) genes requires virA, virG, and a plant-derived inducing compound such as acetosyringone. To identify the critical functional domains of virA and virG, a mutational approach was used. Agrobacterium A136 harboring plasmid pGP159, which contains virA, virG, and a reporter virB:lacZ gene fusion, was mutagenized with UV light or nitrosoguanidine. Survivors that formed blue colonies on a plate containing 5-bromo-4-chloro-3-indolyl beta-D-galactoside were isolated and analyzed. Quantification of beta-galactosidase activity in liquid assays identified nine mutant strains. By plasmid reconstruction and other procedures, all mutations mapped to the virA locus. These mutations caused an 11- to 560-fold increase in the vegetative level of virB:lacZ reporter gene expression. DNA sequence analysis showed that the mutations are located in four regions of VirA: transmembrane domain one, the active site, a glycine-rich region with homology to ATP-binding sites, and a region at the C terminus that has homology to the N terminus of VirG

  7. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    Directory of Open Access Journals (Sweden)

    Nezih Akca

    2014-01-01

    Full Text Available Context: Little seems to be known about the sexual dysfunction (SD in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois. The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was

  8. The engine maintenance scheduling by using reliability centered maintenance method and the identification of 5S application in PT. XYZ

    Science.gov (United States)

    Sembiring, N.; Panjaitan, N.; Saragih, A. F.

    2018-02-01

    PT. XYZ is a manufacturing company that produces fresh fruit bunches (FFB) to Crude Palm Oil (CPO) and Palm Kernel Oil (PKO). PT. XYZ consists of six work stations: receipt station, sterilizing station, thressing station, pressing station, clarification station, and kernelery station. So far, the company is still implementing corrective maintenance maintenance system for production machines where the machine repair is done after damage occurs. Problems at PT. XYZ is the absence of scheduling engine maintenance in a planned manner resulting in the engine often damaged which can disrupt the smooth production. Another factor that is the problem in this research is the kernel station environment that becomes less convenient for operators such as there are machines and equipment not used in the production area, slippery, muddy, scattered fibers, incomplete use of PPE, and lack of employee discipline. The most commonly damaged machine is in the seed processing station (kernel station) which is cake breaker conveyor machine. The solution of this problem is to propose a schedule plan for maintenance of the machine by using the method of reliability centered maintenance and also the application of 5S. The result of the application of Reliability Centered maintenance method is obtained four components that must be treated scheduled (time directed), namely: for bearing component is 37 days, gearbox component is 97 days, CBC pen component is 35 days and conveyor pedal component is 32 days While after identification the application of 5S obtained the proposed corporate environmental improvement measures in accordance with the principles of 5S where unused goods will be moved from the production area, grouping goods based on their use, determining the procedure of cleaning the production area, conducting inspection in the use of PPE, and making 5S slogans.

  9. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 1. Chlorophyll Mutations in Allelic tw Mutants and Their Revertants

    International Nuclear Information System (INIS)

    Vaitkuniene, V.

    1995-01-01

    Genotypical environment is an essential factor determining the mutability of mutants of the same type. Decreased chlorophyll mutant frequency was a common characteristic of all tested tw type (tw, tw 1 , tw 2 ) mutants induced in barley c. 'Auksiniai II'. The mutability of all the tested revertants was close to that of the initial c. 'Auksiniai II'. (author). 9 refs., 2 tabs

  10. [Work organisation improvement methods applied to activities of Blood Transfusion Establishments (BTE): Lean Manufacturing, VSM, 5S].

    Science.gov (United States)

    Bertholey, F; Bourniquel, P; Rivery, E; Coudurier, N; Follea, G

    2009-05-01

    Continuous improvement of efficiency as well as new expectations from customers (quality and safety of blood products) and employees (working conditions) imply constant efforts in Blood Transfusion Establishments (BTE) to improve work organisations. The Lean method (from "Lean" meaning "thin") aims at identifying wastages in the process (overproduction, waiting, over-processing, inventory, transport, motion) and then reducing them in establishing a mapping of value chain (Value Stream Mapping). It consists in determining the added value of each step of the process from a customer perspective. Lean also consists in standardizing operations while implicating and responsabilizing all collaborators. The name 5S comes from the first letter of five operations of a Japanese management technique: to clear, rank, keep clean, standardize, make durable. The 5S method leads to develop the team working inducing an evolution of the way in the management is performed. The Lean VSM method has been applied to blood processing (component laboratory) in the Pays de la Loire BTE. The Lean 5S method has been applied to blood processing, quality control, purchasing, warehouse, human resources and quality assurance in the Rhône-Alpes BTE. The experience returns from both BTE shows that these methods allowed improving: (1) the processes and working conditions from a quality perspective, (2) the staff satisfaction, (3) the efficiency. These experiences, implemented in two BTE for different processes, confirm the applicability and usefulness of these methods to improve working organisations in BTE.

  11. Effects of the substrate temperature on the properties of CuIn{sub 5}S{sub 8} thin films

    Energy Technology Data Exchange (ETDEWEB)

    Gannouni, M., E-mail: gm_mounir@yahoo.fr [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia); Kanzari, M. [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia)

    2011-10-01

    Structural, optical and electrical properties of CuIn{sub 5}S{sub 8} thin films grown by thermal evaporation have been studied relating the effects of substrate heating conditions of these properties. The CuIn{sub 5}S{sub 8} thin films were carried out at substrate temperatures in the temperature range 100-300 deg. C. The effects of heated substrate on their physico-chemical properties were investigated using X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), optical transmission and hot probe method. X-ray diffraction revealed that the films are strong preferred orientation along the (3 1 1) plane upon substrate temperature 200 deg. C and amorphous for the substrate temperatures below 200 deg. C. No secondary phases are observed for all the films. The composition is greatly affected by heated substrate. From the optical transmission and reflection, an important absorption coefficient exceeds 10{sup 5} cm{sup -1} at 800 nm was found. As increasing the substrate temperature, the optical energy band gap decreases from 1.70 eV for the unheated films to 1.25 eV for the deposited films at 300 deg. C. It was found that CuIn{sub 5}S{sub 8} thin film is an n-type semiconductor at 250 deg. C.

  12. Effects of the substrate temperature on the properties of CuIn5S8 thin films

    International Nuclear Information System (INIS)

    Gannouni, M.; Kanzari, M.

    2011-01-01

    Structural, optical and electrical properties of CuIn 5 S 8 thin films grown by thermal evaporation have been studied relating the effects of substrate heating conditions of these properties. The CuIn 5 S 8 thin films were carried out at substrate temperatures in the temperature range 100-300 deg. C. The effects of heated substrate on their physico-chemical properties were investigated using X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), optical transmission and hot probe method. X-ray diffraction revealed that the films are strong preferred orientation along the (3 1 1) plane upon substrate temperature 200 deg. C and amorphous for the substrate temperatures below 200 deg. C. No secondary phases are observed for all the films. The composition is greatly affected by heated substrate. From the optical transmission and reflection, an important absorption coefficient exceeds 10 5 cm -1 at 800 nm was found. As increasing the substrate temperature, the optical energy band gap decreases from 1.70 eV for the unheated films to 1.25 eV for the deposited films at 300 deg. C. It was found that CuIn 5 S 8 thin film is an n-type semiconductor at 250 deg. C.

  13. Intermixing, band alignment and charge transport in AgIn5S8/CuI heterojunctions

    International Nuclear Information System (INIS)

    Konovalov, I.; Makhova, L.; Hesse, R.; Szargan, R.

    2005-01-01

    Possibilities of creating photovoltaic devices using CuI/AgIn 5 S 8 heterojunctions are considered. Among other properties, preferential formation of polar (111) surfaces makes n-type AgIn 5 S 8 an attractive candidate for absorber layers of top cells in 4-terminal tandem structures. Cu-Ag exchange at the interface with p-type CuI was observed. This intermixing results in an additional component of Ag 3d5 photoelectron line after deposition of CuI, in the Cu (but not I) contamination of the surface after a chemical removal of CuI, and in a photoelectric sensitivity of the junction at energies below the band gaps. Valence band offsets of 0.4 and 0.5 eV (cliff) were found at interfaces with thin film and bulk AgIn 5 S 8 , supporting a conduction mechanism through interface recombination. Pinning conflict at the interface between materials with contradictory doping limitations is likely to promote the intermixing

  14. Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

    Science.gov (United States)

    Zhang, Yawei; Li, Gang

    2018-01-01

    Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

  15. Simulasi Pengembangan Bengkel Fabrikasi Jurusan Pendidikan Teknik Mesin Sesuai Kaidah 5S Menggunakan Aplikasi 3ds Max

    Directory of Open Access Journals (Sweden)

    Putut Hargiyarto

    2014-10-01

    Full Text Available The objectives of this study were to assess the risks involved in workshops, to apply the Seiso, Seiton, Seiri, Seiketsu, Shitsuke (5S concept for workshops development and to develop the fabrication workshop for the Department of Mechanical Engineering Education, Faculty of Engineering, YSU using the 3DS Max simulation application. This study was categorised into Research and Development. The first steps were designing and creating the product using 3DS Max application. The next step was testing the product by implementing it to perform the workshops policy. The results of this study showed the risks consisted of noise, strong light, harmful gases and the mechanical hazards due to falling and moving objects. The implementation of 5S concept, K3 and ergonomics were required to maintain the regularity, efficiency and work discipline, to prevent and to minimize workplace accidents. The development of fabrication workshops using the 3DS Max simulation applicationis is beneficial for implementing the aspects of 5S, K3, ergonomics and provides a reference in redesigning a workshop.

  16. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  17. Progranulin is neurotrophic in vivo and protects against a mutant TDP-43 induced axonopathy.

    Directory of Open Access Journals (Sweden)

    Angela S Laird

    Full Text Available Mislocalization, aberrant processing and aggregation of TAR DNA-binding protein 43 (TDP-43 is found in the neurons affected by two related diseases, amyotrophic lateral sclerosis (ALS and frontotemporal lobe dementia (FTLD. These TDP-43 abnormalities are seen when TDP-43 is mutated, such as in familial ALS, but also in FTLD, caused by null mutations in the progranulin gene. They are also found in many patients with sporadic ALS and FTLD, conditions in which only wild type TDP-43 is present. The common pathological hallmarks and symptomatic cross over between the two diseases suggest that TDP-43 and progranulin may be mechanistically linked. In this study we aimed to address this link by establishing whether overexpression of mutant TDP-43 or knock-down of progranulin in zebrafish embryos results in motor neuron phenotypes and whether human progranulin is neuroprotective against such phenotypes. Mutant TDP-43 (A315T mutation induced a motor axonopathy characterized by short axonal outgrowth and aberrant branching, similar, but more severe, than that induced by mutant SOD1. Knockdown of the two zebrafish progranulin genes, grna and grnb, produced a substantial decrease in axonal length, with knockdown of grna alone producing a greater decrease in axonal length than grnb. Progranulin overexpression rescued the axonopathy induced by progranulin knockdown. Interestingly, progranulin also rescued the mutant TDP-43 induced axonopathy, whilst it failed to affect the mutant SOD1-induced phenotype. TDP-43 was found to be nuclear in all conditions described. The findings described here demonstrate that progranulin is neuroprotective in vivo and may have therapeutic potential for at least some forms of motor neuron degeneration.

  18. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  19. Specificity of anion-binding in the substrate-pocket ofbacteriorhodopsin

    Energy Technology Data Exchange (ETDEWEB)

    Facciotti, Marc T.; Cheung, Vincent S.; Lunde, Christopher S.; Rouhani, Shahab; Baliga, Nitin S.; Glaeser, Robert M.

    2003-08-30

    The structure of the D85S mutant of bacteriorhodopsin with a nitrate anion bound in the Schiff-base binding site, and the structure of the anion-free protein have been obtained in the same crystal form. Together with the previously solved structures of this anion pump, in both the anion-free state and bromide-bound state, these new structures provide insight into how this mutant of bacteriorhodopsin is able to bind a variety of different anions in the same binding pocket. The structural analysis reveals that the main structural change that accommodates different anions is the repositioning of the polar side-chain of S85. On the basis of these x-ray crystal structures, the prediction is then made that the D85S/D212N double mutant might bind similar anions and do so over a broader pH range than does the single mutant. Experimental comparison of the dissociation constants, K{sub d}, for a variety of anions confirms this prediction and demonstrates, in addition, that the binding affinity is dramatically improved by the D212N substitution.

  20. Investigation of growth and characterization of nanostructured CuIn5S8 thin films produced by glancing angle deposition

    International Nuclear Information System (INIS)

    Sinaoui, A.; Chaffar-Akkari, F.; Gallas, B.; Demaille, D.; Kanzari, M.

    2015-01-01

    Ternary chalcogenide of copper and indium (CuIn 5 S 8 ) thin films were grown by thermal evaporation method using GLancing Angle Deposition (GLAD) technique. The samples were prepared under different incident angles (α = 0°, 40°, 60° and 85° measured from the normal to the substrate surface) with a substrate rotation of 2 rpm. X-ray diffraction, scanning electron microscopy, and ultraviolet–visible-infrared spectra are employed to characterize the microstructure and optical properties of the CuIn 5 S 8 thin films deposited by this technique. Under the GLAD conditions, we demonstrate that with substrate rotation, the columns were grown vertically due to the shadowing symmetry. The optical constants of the deposited films were determined from the analysis of transmission and reflection data. The results show that the refractive index and the thickness were decreased as α rises from 0° to 85° while the porosity and the Urbach energy were increased with increasing of the incident angle. The minimum refractive index is found to be 2.03 for the helical CuIn 5 S 8 film deposited at an angle of 85° and the Urbach energy was found to increase from 0.29 to 0.5 eV as α rises from 0° to 85°. Such changes of the optical behaviors are correlated with changes of the microstructure, especially a porous architecture which is favored for high incident angle. These properties exhibit potential for use in applications such as photonic crystals, graded index optical filters, and birefrigent omnidirectional reflectors. - Highlights: • GLancing angle deposition technique was employed to prepare CuIn 5 S 8 thin films. • CuIn 5 S 8 films exhibit a spinel structure with a preferred orientation along 311. • With substrate rotation, the columns were grown vertically due to shadowing symmetry. • The refractive index decreases with increasing glancing angle deposition. • Variations of the optical behaviors were correlated to the highly porous structure

  1. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  2. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi

    1975-01-01

    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  3. Tumor suppressor PTEN affects tau phosphorylation: deficiency in the phosphatase activity of PTEN increases aggregation of an FTDP-17 mutant Tau

    Directory of Open Access Journals (Sweden)

    Zhang Xue

    2006-07-01

    Full Text Available Abstract Background Aberrant hyperphosphorylation of tau protein has been implicated in a variety of neurodegenerative disorders. Although a number of protein kinases have been shown to phosphorylate tau in vitro and in vivo, the molecular mechanisms by which tau phosphorylation is regulated pathophysiologically are largely unknown. Recently, a growing body of evidence suggests a link between tau phosphorylation and PI3K signaling. In this study, phosphorylation, aggregation and binding to the microtubule of a mutant frontal temporal dementia and parkinsonism linked to chromosome 17 (FTDP-17 tau in the presence of tumor suppressor PTEN, a major regulatory component in PI3K signaling, were investigated. Results Phosphorylation of the human mutant FTDP-17 tau, T40RW, was evaluated using different phospho-tau specific antibodies in the presence of human wild-type or phosphatase activity null mutant PTEN. Among the evaluated phosphorylation sites, the levels of Ser214 and Thr212 phospho-tau proteins were significantly decreased in the presence of wild-type PTEN, and significantly increased when the phosphatase activity null mutant PTEN was ectopically expressed. Fractionation of the mutant tau transfected cells revealed a significantly increased level of soluble tau in cytosol when wild-type PTEN was expressed, and an elevated level of SDS-soluble tau aggregates in the presence of the mutant PTEN. In addition, the filter/trap assays detected more SDS-insoluble mutant tau aggregates in the cells overexpressing the mutant PTEN compared to those in the cells overexpressing wild-type PTEN and control DNA. This notion was confirmed by the immunocytochemical experiment which demonstrated that the overexpression of the phosphatase activity null mutant PTEN caused the mutant tau to form aggregates in the COS-7 cells. Conclusion Tumor suppressor PTEN can alleviate the phosporylation of the mutant FTDP-17 tau at specific sites, and the phosphatase activity

  4. Structural Characterization of Heme Environmental Mutants of CgHmuT that Shuttles Heme Molecules to Heme Transporters

    Directory of Open Access Journals (Sweden)

    Norifumi Muraki

    2016-05-01

    Full Text Available Corynebacteria contain a heme uptake system encoded in hmuTUV genes, in which HmuT protein acts as a heme binding protein to transport heme to the cognate transporter HmuUV. The crystal structure of HmuT from Corynebacterium glutamicum (CgHmuT reveals that heme is accommodated in the central cleft with His141 and Tyr240 as the axial ligands and that Tyr240 forms a hydrogen bond with Arg242. In this work, the crystal structures of H141A, Y240A, and R242A mutants were determined to understand the role of these residues for the heme binding of CgHmuT. Overall and heme environmental structures of these mutants were similar to those of the wild type, suggesting that there is little conformational change in the heme-binding cleft during heme transport reaction with binding and the dissociation of heme. A loss of one axial ligand or the hydrogen bonding interaction with Tyr240 resulted in an increase in the redox potential of the heme for CgHmuT to be reduced by dithionite, though the wild type was not reduced under physiological conditions. These results suggest that the heme environmental structure stabilizes the ferric heme binding in CgHmuT, which will be responsible for efficient heme uptake under aerobic conditions where Corynebacteria grow.

  5. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    Science.gov (United States)

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional

  6. Activities of Native and Tyrosine-69 Mutant Phospholipases A2 on Phospholipid Analogues. A Reevaluation of the Minimal Substrate Requirements

    OpenAIRE

    Kuipers, Oscar P.; Dekker, Nicolaas; Verheij, Hubertus M.; Haas, Gerard H. de

    1990-01-01

    The role of Tyr-69 of porcine pancreatic phospholipase A2 in substrate binding was studied with the help of proteins modified by site-directed mutagenesis and phospholipid analogues with a changed head-group geometry. Two mutants were used containing Phe and Lys, respectively, at position 69. Modifications in the phospholipids included introduction of a sulfur at the phosphorus (thionophospholipids), removal of the negative charge at phosphorus (phosphatidic acid dimethyl ester), and reductio...

  7. Evolution of inhibitor-resistant natural mutant forms of HIV-1 protease probed by pre-steady state kinetic analysis.

    Science.gov (United States)

    Zakharova, Maria Yu; Kuznetsova, Alexandra A; Kaliberda, Elena N; Dronina, Maria A; Kolesnikov, Alexander V; Kozyr, Arina V; Smirnov, Ivan V; Rumsh, Lev D; Fedorova, Olga S; Knorre, Dmitry G; Gabibov, Alexander G; Kuznetsov, Nikita A

    2017-11-01

    Pre-steady state kinetic analysis of mechanistic features of substrate binding and processing is crucial for insight into the evolution of inhibitor-resistant forms of HIV-1 protease. These data may provide a correct vector for rational drug design assuming possible intrinsic dynamic effects. These data should also give some clues to the molecular mechanism of protease action and resistance to inhibitors. Here we report pre-steady state kinetics of the interaction of wild type or mutant forms of HIV-1 protease with a FRET-labeled peptide. The three-stage "minimal" kinetic scheme with first and second reversible steps of substrate binding and with following irreversible peptide cleavage step adequately described experimental data. For the first time, a set of "elementary" kinetic parameters of wild type HIV-1 protease and its natural mutant inhibitor-resistant forms MDR-HM, ANAM-11 and prDRV4 were compared. Inhibitors of the first and second generation were used to estimate the inhibitory effects on HIV-1 protease activity. The resulting set of kinetic data supported that the mutant forms are kinetically unaffected by inhibitors of the first generation, proving their functional resistance to these compounds. The second generation inhibitor darunavir inhibited mutant forms MDR-HM and ANAM-11, but was ineffective against prDRV4. Our kinetic data revealed that these inhibitors induced different conformational changes in the enzyme and, thereby they have different mode of binding in the enzyme active site. These data confirmed hypothesis that the driving force of the inhibitor-resistance evolution is disruption of enzyme-inhibitor complex by changing of the contact network in the inhibitor binding site. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  8. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil

    2007-01-01

    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  9. Radiation induced desynaptic mutants in barley

    International Nuclear Information System (INIS)

    Srivastava, H.M.

    1974-01-01

    Spontaneous occurrence of asynapsis and desynapsis has been frequently reported in a number of crop plants (Beadle 1930, 1933; Beasley and Brown 1942; Li et al. 1945; Magoon et al. 1961; Miller 1963) and other angiospermic texa (Calarier 1955; Chennaveraiah and Krisnappa 1968; Ehrenberg 1949; Johnson 1941, 1944; Roy and Jha 1958). However, there are only a few reports of induced asynapsis or desynapsis (Gottschalk and Baquar 1971; Martini and Bozzini 1966). The present paper deals with the morphology and meiotic behavior of gamma-ray induced barley mutants showing high degree of desynapsis resulting in partial to complete sterility. (author)

  10. Ubiquinone accumulates in the mitochondria of yeast mutated in the ubiquinone binding protein, Qcr8p

    International Nuclear Information System (INIS)

    Hagerman, Ruth A.; Waring, Natashya J.; Willis, Richard A.; Hagerman, Ann E.

    2006-01-01

    In Saccharomyces cerevisiae, the trans-membrane helix of Qcr8p, the ubiquinone binding protein of complex III, contributes to the Q binding site. In wild-type cells, residue 62 of the helix is non-polar (proline). Substitution of proline 62 with a polar, uncharged residue does not impair the ability of the cells to respire, complex III assembly is unaffected, ubiquinone occupancy of the Q binding site is unchanged, and mitochondrial ubiquinone levels are in the wild-type range. Substitution with a +1 charged residue is associated with partial respiratory competence, impaired complex III assembly, and loss of cytochrome b. Although ubiquinone occupancy of the Q binding site is similar to wild-type, total mitochondrial ubiquinone doubled in these mutants. Mutants with a +2 charged substitution at position 62 are unable to respire. These results suggest that the accumulation of ubiquinone in the mitochondria may be a compensatory mechanism for impaired electron transport at cytochrome b

  11. Insights into regioselective metabolism of mefenamic acid by cytochrome P450 BM3 mutants through crystallography, docking, molecular dynamics, and free energy calculations

    DEFF Research Database (Denmark)

    Capoferri, Luigi; Leth, Rasmus; Ter Haar, Ernst

    2016-01-01

    of the protein mutant M11 was expressed, purified, and crystallized, and its X-ray structure was used as template for modeling. A multistep approach was used that combines molecular docking, molecular dynamics (MD) simulation, and binding free-energy calculations to address protein flexibility. In this way...... active-site mutations such as V87I were reported to invert regioselectivity in NSAID hydroxylation. In this work, we combine crystallography and molecular simulation to study the effect of single mutations on binding and regioselective metabolism of mefenamic acid by M11 mutants. The heme domain...... of mefenamic acid by M11 and its mutants by including protein flexibility and dynamics in free-energy computation. In addition, we could obtain structural insights into the change in regioselectivity of mefenamic acid hydroxylation due to single active-site mutations. Our findings confirm that use of MD...

  12. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    Science.gov (United States)

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  13. Identification of the upper exciton component of the B850 bacteriochlorophylls of the LH2 antenna complex, using a B800-free mutant of Rhodobacter sphaeroides.

    NARCIS (Netherlands)

    Koolhaas, M.H.C.; Frese, R.N.; Fowler, G.J.S.; Bibby, T.S.; Georgakopoulou, S.; van der Zwan, G.; Hunter, C.N.; van Grondelle, R.

    1998-01-01

    In this paper, we report the circular dichroism (CD) spectra of two types of LH2 -only mutants of Rhodobacter sphaeroides. In the first, only the wild type LH2 is present, while in the second, the B800 binding site of LH2 has been either destabilized or removed. For the first time, we have

  14. Analysis of Yellow Striped Mutants of Zea mays Reveals Novel Loci Contributing to Iron Deficiency Chlorosis

    Directory of Open Access Journals (Sweden)

    David Chan-Rodriguez

    2018-02-01

    Full Text Available The micronutrient iron (Fe is essential for photosynthesis, respiration, and many other processes, but it is only sparingly soluble in aqueous solution, making adequate acquisition by plants a serious challenge. Fe is a limiting factor for plant growth on approximately 30% of the world’s arable lands. Moreover, Fe deficiency in humans is a global health issue, affecting 1.62 billion people, or about 25% of the world’s population. It is imperative that we gain a better understanding of the mechanisms that plants use to regulate iron homeostasis, since these will be important targets for future biofortification and crop improvement strategies. Grasses and non-grasses have evolved independent mechanisms for primary iron uptake from the soil. The grasses, which include most of the world’s staple grains, have evolved a distinct ‘chelation’ mechanism to acquire iron from the soil. Strong iron chelators called phytosiderophores (PSs are synthesized by grasses and secreted into the rhizosphere where they bind and solubilize Fe(III. The Fe(III-PS complex is then taken up into root cells via transporters specific for the Fe(III-PS complex. In this study, 31 novel, uncharacterized striped maize mutants available through the Maize Genetics Cooperation Stock Center (MGCSC were analyzed to determine whether their mutant phenotypes are caused by decreased iron. Many of these proved to be either pale yellow or white striped mutants. Complementation tests were performed by crossing the MGCSC mutants to ys1 and ys3 reference mutants. This allowed assignment of 10 ys1 alleles and 4 ys3 alleles among the novel mutants. In addition, four ys∗ mutant lines were identified that are not allelic to either ys1 or ys3. Three of these were characterized as being non-allelic to each other and as having low iron in leaves. These represent new genes involved in iron acquisition by maize, and future cloning of these genes may reveal novel aspects of the grass iron

  15. Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.

    Science.gov (United States)

    Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav

    2011-09-01

    The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

  16. Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli.

    Science.gov (United States)

    Riber, Leise; Fujimitsu, Kazuyuki; Katayama, Tsutomu; Løbner-Olesen, Anders

    2009-01-01

    Initiation of chromosome replication in Escherichia coli is limited by the initiator protein DnaA associated with ATP. Within the replication origin, binding sites for DnaA associated with ATP or ADP (R boxes) and the DnaA(ATP) specific sites (I-boxes, tau-boxes and 6-mer sites) are found. We analysed chromosome replication of cells carrying mutations in conserved regions of oriC. Cells carrying mutations in DnaA-boxes I2, I3, R2, R3 and R5 as well as FIS and IHF binding sites resembled wild-type cells with respect to origin concentration. Initiation of replication in these mutants occurred in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However, competition between I-box mutant and wild-type origins, revealed a positive role of I-boxes on initiation. On the other hand, mutations affecting DnaA-box R4 were found to be compromised for initiation and could not be augmented by an increase in cellular DnaA(ATP)/DnaA(ADP) ratio. Compared with the sites tested here, R4 therefore seems to contribute to initiation most critically.

  17. [Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

    Science.gov (United States)

    Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

    2008-10-01

    To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

  18. Peramivir analogues bearing hydrophilic side chains exhibit higher activities against H275Y mutant than wild-type influenza virus.

    Science.gov (United States)

    Chiu, Din-Chi; Lin, Tzu-Chen; Huang, Wen-I; Cheng, Ting-Jen; Tsai, Keng-Chang; Fang, Jim-Min

    2017-11-29

    Peramivir is an effective anti-influenza drug in the clinical treatment of influenza, but its efficacy toward the H275Y mutant is reduced. The previously reported cocrystal structures of inhibitors in the mutant neuraminidase (NA) suggest that the hydrophobic side chain should be at the origin of reduced binding affinity. In contrast, zanamivir having a hydrophilic glycerol side chain still possesses high affinity toward the H275Y NA. We thus designed five peramivir analogues (5-9) carrying hydrophilic glycol or glycerol side chains, and evaluated their roles in anti-influenza activity, especially for the H275Y mutant. The synthetic sequence involves a key step of (3 + 2) cycloaddition reactions between alkenes and nitrile oxides to construct the scaffold of peramivir carrying the desired hydrophilic side chains and other appropriate functional groups. The molecular docking experiments reveal that the hydrophilic side chain can provide extra hydrogen bonding with the translocated Glu-276 residue in the H275Y NA active site. Thus, the H275Y mutant may be even more sensitive than wild-type virus toward the peramivir analogues bearing hydrophilic side chains. Notably, the peramivir analogue bearing a glycerol side chain inhibits the H275Y mutant with an IC 50 value of 35 nM, which is better than the WSN virus by 9 fold.

  19. Effect of Detergents on Galactoside Binding by Melibiose Permeases.

    Science.gov (United States)

    Amin, Anowarul; Hariharan, Parameswaran; Chae, Pil Seok; Guan, Lan

    2015-09-29

    The effect of various detergents on the stability and function of the melibiose permeases of Escherichia coli (MelBEc) and Salmonella typhimurium (MelBSt) was studied. In n-dodecyl-β-d-maltoside (DDM) or n-undecyl-β-d-maltoside (UDM), WT MelBSt binds melibiose with an affinity similar to that in the membrane. However, with WT MelBEc or MelBSt mutants (Arg141 → Cys, Arg295 → Cys, or Arg363 → Cys), galactoside binding is not detected in these detergents, but binding to the phosphotransferase protein IIA(Glc) is maintained. In the amphiphiles lauryl maltose neopentyl glycol (MNG-3) or glyco-diosgenin (GDN), galactoside binding with all of the MelB proteins is observed, with slightly reduced affinities. MelBSt is more thermostable than MelBEc, and the thermostability of either MelB is largely increased in MNG-3 or GDN. Therefore, the functional defect with DDM or UDM likely results from the relative instability of the sensitive MelB proteins, and stability, as well as galactoside binding, is retained in MNG-3 or GDN. Furthermore, isothermal titration calorimetry of melibiose binding with MelBSt shows that the favorable entropic contribution to the binding free energy is decreased in MNG-3, indicating that the conformational dynamics of MelB is restricted in this detergent.

  20. Loss of Catalytic Activity in the E134D, H67A, and H349A Mutants of DapE: Mechanistic Analysis with QM/MM Investigation.

    Science.gov (United States)

    Dutta, Debodyuti; Mishra, Sabyashachi

    2016-11-17

    In the fight against bacterial infections and antibiotic resistance, the dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) is a potentially safe target enzyme. The role of the Glu134, His67, and His349 residues in the binding and hydrolysis of N-succinyl-l,l-diaminopimelic acid (SDAP) is investigated by employing molecular dynamics simulation and hybrid quantum mechanical-molecular mechanical (MM) calculations of the E134D, H67A, and H349A mutants of DapE. The free energy of substrate binding obtained from the MM-Poisson-Boltzmann surface area approach correctly reproduced the experimentally observed ordering of substrate affinity, that is, E134D > wt > H67A > H349A. The mechanism of catalytic action by the E134D mutant is elucidated by structurally and energetically characterizing the intermediates and the transition states along the reaction pathway. The rate-determining step in the general acid-base hydrolysis reaction by the E134D mutant is found to be the nucleophilic attack step, which involves an activation energy barrier 10 kcal/mol greater than that in the wild-type (wt)-DapE. This explains the 3 orders of magnitude decrease in the experimentally determined k cat value for the E134D mutant compared to that of wt-DapE. In the H67A and H349A mutants, the Glu134 residue undergoes a conformational change and exhibits a strong coordination with the metal centers. This not only results in a weaker substrate binding in the two histidine mutants but also hinders the activation of the catalytic water molecule, which constitutes the first step of the substrate hydrolysis by DapE. This leads to an effective quenching of the catalytic activity in the H67A and H349A mutants.

  1. Induction of drought tolerant mutants of rice

    International Nuclear Information System (INIS)

    El-Hissewy, A.A.; Abd Allah, A.

    2001-01-01

    The ultimate goal of crop breeding is to develop varieties with a high yield potential and desirable agronomic characteristics. In Egypt, the most important qualities sought by breeders have been high yield potential, resistance to major diseases and insects, and improved grain and eating quality. However, breeding efforts should concentrate on varieties with the potential to minimize yield losses under unfavorable conditions such as drought, and to maximize yields when conditions are favorable. Rice (Oryza sativa L.) in Egypt is completely irrigated and a significant portion of the rice cultivated area is subject to water deficit resulting from an inadequate or insufficient irrigation supply. Drought tolerance is a complex trait in that it results from the interaction of histological and physiological characters of plant with environmental factors, both above-ground and under-ground. Accordingly, root characters are closely related to drought tolerance. Little attention has been paid in Egyptian breeding programs to root characters and their relation to shoot characters. Furthermore, induced mutations are considered as one of the most important methods to induce useful mutants, especially with improved root characters, to overcome the drought problem. The present investigation aimed to study the effect of different doses of gamma rays on several characters of three Egyptian rice varieties, i.e. 'Giza 171', 'Giza 175' and 'Giza 176' and to induce one or more mutants possessing drought tolerance

  2. Indy mutants: live long and prosper

    Directory of Open Access Journals (Sweden)

    Stewart eFrankel

    2012-02-01

    Full Text Available Indy encodes the fly homologue of a mammalian transporter of di and tricarboxylatecomponents of the Krebs cycle. Reduced expression of fly Indy or two of the C. elegansIndy homologs leads to an increase in life span. Fly and worm tissues that play key roles inintermediary metabolism are also the places where Indy genes are expressed. One of themouse homologs of Indy (mIndy is mainly expressed in the liver. It has been hypothesizedthat decreased INDY activity creates a state similar to caloric restriction (CR. Thishypothesis is supported by the physiological similarities between Indy mutant flies on highcalorie food and control flies on CR, such as increased physical activity and decreases inweight, egg production, triglyceride levels, starvation resistance, and insulin signaling. Inaddition, Indy mutant flies undergo changes in mitochondrial biogenesis also observed inCR animals. Recent findings with mIndy knockout mice support and extend the findingsfrom flies. mIndy-/- mice display an increase in hepatic mitochondrial biogenesis, lipidoxidation and decreased hepatic lipogenesis. When mIndy-/- mice are fed high calorie foodthey are protected from adiposity and insulin resistance. These findings point to INDY as apotential drug target for the treatment of metabolic syndrome, type 2 diabetes and obesity.

  3. Flower morphology of Dendrobium Sonia mutants

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Azhar Mohamad; Affrida Abu Hassan; Zaiton Ahmad; Mohd Nazir Basiran

    2010-01-01

    Dendrobium Sonia is a commercial hybrid which is popular as cut flower and potted plant in Malaysia. Variability in flower is important for new variety to generate more demands and choices in selection. Mutation induction is a tool in creating variability for new flower color and shape. In vitro cultures of protocorm-like bodies (PLBs) were exposed to gamma ray at dose 35 Gy. Phenotypic characteristics of the flower were observed at fully bloomed flower with emphasis on shape and color. Approximately 2000 regenerated irradiated plants were observed and after subsequent flowering, 100 plants were finally selected for further evaluation. Most of the color and shape changes are expressed in different combinations of petal, sepal and lip of the flower. In this work, 11 stable mutants were found different at flower phenotype as compared to control. Amongst these, four mutant varieties with commercial potential has been named as Dendrobium 'SoniaKeenaOval', Dendrobium 'SoniaKeenaRadiant', Dendrobium 'SoniaKeenaHiengDing' and Dendrobium 'Sonia KeenaAhmadSobri'. In this paper, variations in flower morphology and flower color were discussed, giving emphasis on variations in flower petal shape. (author)

  4. High yielding rice mutants for West Bengal

    International Nuclear Information System (INIS)

    Debnath, A.R.; Sen, S.

    1980-01-01

    Four high yielding mutants with specific genetic corrections of the simply inherited characters were developed from IR-8 through X-irradiation. Recurrent selections of the promising isolates were made under diverse agro-climatic conditions in Winter and Summer seasons of West Bengal. The isolates CNM 6 and CNM 25 belonging to early maturity group and CNM 20 and CNM 31, to mid-early maturity group were finally selected at X 5 generation on the basis of their resistance qualities, maturity period and grain yield. They were evaluated upto X 10 qeneration at multi-locations as Pre-release and Minikit Varieties at State level. They were also placed at the National Screening Nursery (NSN) for screening against multiple diseases and pests at the National level. CNM 6 is reported to be promising in IRTP nurseries. It is reported that CNM 25 (IET 5646) ranked 2nd on the basis of average grain yield, CNM 20 (IET 5937) and CNM 31 (IET 5936) were resistant to diseases and with yield comparable to Jaya. These four productive mutants of superior types are widely accepted. CNM 6 is recommended for cultivation in Bankura and Birbhum districts and CNM 25 and CNM 31 in the different agro-climatic zones of West Bengal. (author)

  5. Isolation of reovirus T3D mutants capable of infecting human tumor cells independent of junction adhesion molecule-A.

    Directory of Open Access Journals (Sweden)

    Diana J M van den Wollenberg

    Full Text Available Mammalian Reovirus is a double-stranded RNA virus with a distinctive preference to replicate in and lyse transformed cells. On that account, Reovirus type 3 Dearing (T3D is clinically evaluated as oncolytic agent. The therapeutic efficacy of this approach depends in part on the accessibility of the reovirus receptor Junction Adhesion Molecule-A (JAM-A on the target cells. Here, we describe the isolation and characterization of reovirus T3D mutants that can infect human tumor cells independent of JAM-A. The JAM-A-independent (jin mutants were isolated on human U118MG glioblastoma cells, which do not express JAM-A. All jin mutants harbour mutations in the S1 segments close to the region that encodes the sialic acid-binding pocket in the shaft of the spike protein. In addition, two of the jin mutants encode spike proteins with a Q336R substitution in their head domain. The jin mutants can productively infect a wide range of cell lines that resist wt reovirus T3D infection, including chicken LMH cells, hamster CHO cells, murine endothelioma cells, human U2OS and STA-ET2.1 cells, but not primary human fibroblasts. The jin-mutants rely on the presence of sialic-acid residues on the cell surface for productive infection, as is evident from wheat germ agglutinin (WGA inhibition experiments, and from the jin-reovirus resistance of CHO-Lec2 cells, which have a deficiency of sialic-acids on their glycoproteins. The jin mutants may be useful as oncolytic agents for use in tumors in which JAM-A is absent or inaccessible.

  6. Programa 5S's adaptado ao gerenciamento da alimentação escolar no contexto da descentralização The 5S's program adapted to school meals in the context of decentralization

    Directory of Open Access Journals (Sweden)

    Ana Iris Mendes Coelho

    1999-12-01

    Full Text Available O processo de descentralização da alimentação escolar desencadeou um aumento da demanda por assessoria técnica, principalmente no que se refere ao seu planejamento e execução. Este trabalho relata a experiência da utilização do programa 5S's no município de Viçosa, MG, durante o período de fevereiro de 1995 a dezembro de 1997, para auxiliar no gerenciamento da alimentação escolar, atuando em pontos críticos detectados nos estabelecimentos de ensino, bem como apresenta a adaptação do Programa idealizada para este fim. Os resultados evidenciaram que a metodologia utilizada foi eficaz neste processo.The school meals decentralization has broken out an increasing demand for technical assistance, particularly because of the faults in its planning and execution. The present paper gives an account of the experience from 5S's Program used in the city of Viçosa, MG during the period of 1995 February until 1997 December, acting in critical points to help with school meals management, as well as to present the Program adaptation idealized for this purpose. The results showed that the methodology used in this process was effective for this case.

  7. N1421K mutation in the glycoprotein Ib binding domain impairs ristocetin- and botrocetin-mediated binding of von Willebrand factor to platelets

    DEFF Research Database (Denmark)

    Lanke, E.; Kristoffersson, A.C.; Isaksson, C.

    2008-01-01

    , moderately decreased plasma factor VIII (FVIII) and VWF levels, and disproportionately low-plasma VWF:RCo levels. The patients were found to be heterozygous for the novel N1421K mutation, caused by a 4263C > G transversion in exon 28 of the VWF gene coding for the A1 domain. Botrocetin- and ristocetin-mediated...... binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...

  8. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  9. Characterization of a Weak Allele of Zebrafish cloche Mutant

    Science.gov (United States)

    Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

    2011-01-01

    Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

  10. Insight into the molecular mechanism of yeast acetyl-coenzyme A carboxylase mutants F510I, N485G, I69E, E477R, and K73R resistant to soraphen A

    Science.gov (United States)

    Gao, Jian; Liang, Li; Chen, Qingqing; Zhang, Ling; Huang, Tonghui

    2018-02-01

    Acetyl-coenzyme A carboxylases (ACCs) is the first committed enzyme of fatty acid synthesis pathway. The inhibition of ACC is thought to be beneficial not only for diseases related to metabolism, such as type-2 diabetes, but also for infectious disease like bacterial infection disease. Soraphen A, a potent allosteric inhibitor of BC domain of yeast ACC, exhibit lower binding affinities to several yeast ACC mutants and the corresponding drug resistance mechanisms are still unknown. We report here a theoretical study of binding of soraphen A to wild type and yeast ACC mutants (including F510I, N485G, I69E, E477R, and K73R) via molecular dynamic simulation and molecular mechanics/generalized Born surface area free energy calculations methods. The calculated binding free energies of soraphen A to yeast ACC mutants are weaker than to wild type, which is highly consistent with the experimental results. The mutant F510I weakens the binding affinity of soraphen A to yeast ACC mainly by decreasing the van der Waals contributions, while the weaker binding affinities of Soraphen A to other yeast ACC mutants including N485G, I69E, E477R, and K73R are largely attributed to the decreased net electrostatic (ΔE ele + ΔG GB) interactions. Our simulation results could provide important insights for the development of more potent ACC inhibitors.

  11. Distinct neurobehavioural effects of cannabidiol in transmembrane domain neuregulin 1 mutant mice.

    Directory of Open Access Journals (Sweden)

    Leonora E Long

    Full Text Available The cannabis constituent cannabidiol (CBD possesses anxiolytic and antipsychotic properties. We have previously shown that transmembrane domain neuregulin 1 mutant (Nrg1 TM HET mice display altered neurobehavioural responses to the main psychoactive constituent of cannabis, Δ(9-tetrahydrocannabinol. Here we investigated whether Nrg1 TM HET mice respond differently to CBD and whether CBD reverses schizophrenia-related phenotypes expressed by these mice. Adult male Nrg1 TM HET and wild type-like littermates (WT received vehicle or CBD (1, 50 or 100 mg/kg i.p. for 21 days. During treatment and 48 h after withdrawal we measured behaviour, whole blood CBD concentrations and autoradiographic receptor binding. Nrg1 HET mice displayed locomotor hyperactivity, PPI deficits and reduced 5-HT(2A receptor binding density in the substantia nigra, but these phenotypes were not reversed by CBD. However, long-term CBD (50 and 100 mg/kg selectively enhanced social interaction in Nrg1 TM HET mice. Furthermore, acute CBD (100 mg/kg selectively increased PPI in Nrg1 TM HET mice, although tolerance to this effect was manifest upon repeated CBD administration. Long-term CBD (50 mg/kg also selectively increased GABA(A receptor binding in the granular retrosplenial cortex in Nrg1 TM HET mice and reduced 5-HT(2A binding in the substantia nigra in WT mice. Nrg1 appears necessary for CBD-induced anxiolysis since only WT mice developed decreased anxiety-related behaviour with repeated CBD treatment. Altered pharmacokinetics in mutant mice could not explain our findings since no genotype differences existed in CBD blood concentrations. Here we demonstrate that Nrg1 modulates acute and long-term neurobehavioural effects of CBD, which does not reverse the schizophrenia-relevant phenotypes.

  12. Restriction of phage T4 internal protein I mutants by a strain of Escherichia coli

    International Nuclear Information System (INIS)

    Black, L.W.; Abremski, K.

    1974-01-01

    Phage T4 internal protein I(IPI), a small (ca, 10,000 MW), basic protein injected into the host with the phage DNA, is not required for infection of most hosts, but mutants defective in IPI are restricted by at least one naturally occurring strain of Escherichia coli, CT 596 (CT). Phages lacking IPI (IPI - ) appear to inject their DNA and bind it to the membrane of CT cells as well as wild-type phage T4 does, but shutoff of host protein synthesis, initiation of T4 protein synthesis, and cell killing are abnormal in the IPI - mutant infected CT host. The injection of IPI appears to be important in allowing T4 DNA to carry out early steps involved in takeover of this host. Restriction of IPI - phage growth by CT cells appears to be due, at least in part, to a defective prophage it harbors which renders the host resistant to successful infection by phage T4 which lack IPI or rII functions. Bacteria cured of this prophage can be infected by mutants defective in these functions. The resistance of CT cells to other coliphages, and the question of T-even phage internal protein diversity are discussed. (U.S.)

  13. [Construction of FANCA mutant protein from Fanconi anemia patient and analysis of its function].

    Science.gov (United States)

    Chen, Fei; Zhang, Ke-Jian; Zuo, Xue-Lan; Zeng, Xian-Chang

    2007-11-01

    To study FANCA protein expression in Fanconi anemia patient's (FA) cells and explore its function. FANCA protein expression was analyzed in 3 lymphoblast cell lines derived from 3 cases of type A FA (FA-A) patients using Western blot. Nucleus and cytoplasm localization of FANCA protein was analyzed in one case of FA-A which contained a truncated FANCA (exon 5 deletion). The FANCA mutant was constructed from the same patient and its interaction with FANCG was evaluated by mammalian two-hybrid (M2H) assay. FANCA protein was not detected in the 3 FA-A patients by rabbit anti-human MoAb, but a truncated FANCA protein was detected in 1 of them by mouse anti-human MoAb. The truncated FANCA could not transport from cytoplasm into nucleus. The disease-associated FANCA mutant was defective in binding to FANCG in M2H system. FANCA proteins are defective in the 3 FA-A patients. Disfunction of disease-associated FANCA mutant proved to be the pathogenic mutations in FANCA gene. Exon 5 of FANCA gene was involved in the interaction between FANCA and FANCG.

  14. SHBG (Sex Hormone Binding Globulin)

    Science.gov (United States)

    ... Links Patient Resources For Health Professionals Subscribe Search Sex Hormone Binding Globulin (SHBG) Send Us Your Feedback ... As Testosterone-estrogen Binding Globulin TeBG Formal Name Sex Hormone Binding Globulin This article was last reviewed ...

  15. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  16. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  17. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    Science.gov (United States)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  18. Caffeic acid, tyrosol and p-coumaric acid are potent inhibitors of 5-S-cysteinyl-dopamine induced neurotoxicity.

    Science.gov (United States)

    Vauzour, David; Corona, Giulia; Spencer, Jeremy P E

    2010-09-01

    Parkinson's disease is characterized by a progressive and selective loss of dopaminergic neurons in the substantia nigra. Recent investigations have shown that conjugates such as the 5-S-cysteinyl-dopamine, possess strong neurotoxicity and may contribute to the underlying progression of the disease pathology. Although the neuroprotective actions of flavonoids are well reported, that of hydroxycinnamates and other phenolic acids is less established. We show that the hydroxycinnamates caffeic acid and p-coumaric acid, the hydroxyphenethyl alcohol, tyrosol, and a Champagne wine extract rich in these components protect neurons against injury induced by 5-S-cysteinyl-dopamine in vitro. The protection induced by these polyphenols was equal to or greater than that observed for the flavonoids, (+)-catechin, (-)-epicatechin and quercetin. For example, p-coumaric acid evoked significantly more protection at 1muM (64.0+/-3.1%) than both (-)-epicatechin (46.0+/-4.1%, p<0.05) and (+)-catechin (13.1+/-3.0%, p<0.001) at the same concentration. These data indicate that hydroxycinnamates, phenolic acids and phenolic alcohol are also capable of inducing neuroprotective effects to a similar extent to that seen with flavonoids. Copyright © 2010. Published by Elsevier Inc.

  19. Draft questions of 5S pre-audit with regard to health and safety standards for tires retreating plant

    Directory of Open Access Journals (Sweden)

    Andrzej Pacana

    2016-12-01

    Full Text Available A continuous technological progress forces an improvement of the production process. The article describes the sole beginning of changes in the process of tires retreading on the 5S management method with regard to health and safety standards. The authors point out that the process of the production of retreaded tires is associated with the relationship between a man and a machine. The process improvement can dispense only by improving the machines but it should also pay attention to the man. The improvement of the production process must precede the audit, which can show areas that require intervention. Any such change in the production process cannot be performed without the participation of health and safety inspector, because his knowledge, skills and competence are able to determine whether the proposed changes interfere with the level of safety at the workplace. The authors emphasize that the process of production improvement production should be compatible with the process of improving the health and safety of workers involved in the production process. The combination of 5S audit with health and safety standards results in a holistic approach to the improvement process.

  20. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    International Nuclear Information System (INIS)

    Dewi, Septika Rosiana; Setiawan, Budi; Susatyo Nugroho W P

    2013-01-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  1. Mutants of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity

    International Nuclear Information System (INIS)

    Upchurch, R.G.; Walker, D.C.; Rollins, J.A.; Ehrenshaft, M.; Daub, M.E.

    1991-01-01

    The authors have obtained spontaneous and UV-induced stable mutants, altered in the synthesis of cercosporin, of the fungal soybean pathogen Cercospora kikuchii. The mutants were isolated on the basis of colony color on minimal medium. The UV-induced mutants accumulated, at most, 2% of wild-type cercosporin levels on all media tested. In contrast, cercosporin accumulation by the spontaneous mutants was strongly medium regulated, occurring only on potato dextrose medium but at concentrations comparable to those produced by the wild-type strain. UV-induced mutants unable to synthesize cercosporin on any medium were unable to incite lesions when inoculated onto the soybean host. Cercosporin was reproducibly isolated from all inoculated leaves showing lesions. Although cercosporin involvement in disease has been indirectly suggested by many previous studies, this is the first report in which mutants blocked in cercosporin synthesis have been used to demonstrate that cercosporin is a crucial pathogenicity factor for this fungal genus

  2. Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard

    International Nuclear Information System (INIS)

    Mitra, J.; Chaudhari, K.L.

    1974-01-01

    Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)

  3. Identification of a mutant α1 Na/K-ATPase that pumps but is defective in signal transduction.

    Science.gov (United States)

    Lai, Fangfang; Madan, Namrata; Ye, Qiqi; Duan, Qiming; Li, Zhichuan; Wang, Shaomeng; Si, Shuyi; Xie, Zijian

    2013-05-10

    It has not been possible to study the pumping and signaling functions of Na/K-ATPase independently in live cells. Both cell-free and cell-based assays indicate that the A420P mutation abolishes the Src regulatory function of Na/K-ATPase. A420P mutant has normal pumping but not signaling function. Identification of Src regulation-null mutants is crucial for addressing physiological role of Na/K-ATPase. The α1 Na/K-ATPase possesses both pumping and signaling functions. However, it has not been possible to study these functions independently in live cells. We have identified a 20-amino acid peptide (Ser-415 to Gln-434) (NaKtide) from the nucleotide binding domain of α1 Na/K-ATPase that binds and inhibits Src in vitro. The N terminus of NaKtide adapts a helical structure. In vitro kinase assays showed that replacement of residues that contain a bulky side chain in the helical structure of NaKtide by alanine abolished the inhibitory effect of the peptide on Src. Similarly, disruption of helical structure by proline replacement, either single or in combination, reduced the inhibitory potency of NaKtide on Src. To identify mutant α1 that retains normal pumping function but is defective in Src regulation, we transfected Na/K-ATPase α1 knockdown PY-17 cells with expression vectors of wild type or mutant α1 carrying Ala to Pro mutations in the region of NaKtide helical structure and generated several stable cell lines. We found that expression of either A416P or A420P or A425P mutant fully restored the α1 content and consequently the pumping capacity of cells. However, in contrast to A416P, either A420P or A425P mutant was incapable of interacting and regulating cellular Src. Consequently, expression of these two mutants caused significant inhibition of ouabain-activated signal transduction and cell growth. Thus we have identified α1 mutant that has normal pumping function but is defective in signal transduction.

  4. Altered Regulation of Escherichia coli Biotin Biosynthesis in BirA Superrepressor Mutant Strains

    Science.gov (United States)

    Chakravartty, Vandana

    2012-01-01

    Transcription of the Escherichia coli biotin (bio) operon is directly regulated by the biotin protein ligase BirA, the enzyme that covalently attaches biotin to its cognate acceptor proteins. Binding of BirA to the bio operator requires dimerization of the protein, which is triggered by BirA-catalyzed synthesis of biotinoyl-adenylate (biotinoyl-5′-AMP), the obligatory intermediate of the ligation reaction. Although several aspects of this regulatory system are well understood, no BirA superrepressor mutant strains had been isolated. Such superrepressor BirA proteins would repress the biotin operon transcription in vivo at biotin concentrations well below those needed for repression by wild-type BirA. We isolated mutant strains having this phenotype by a combined selection-screening approach and resolved multiple mutations to give several birA superrepressor alleles, each having a single mutation, all of which showed repression dominant over that of the wild-type allele. All of these mutant strains repressed bio operon transcription in vivo at biotin concentrations that gave derepression of the wild-type strain and retained sufficient ligation activity for growth when overexpressed. All of the strains except that encoding G154D BirA showed derepression of bio operon transcription upon overproduction of a biotin-accepting protein. In BirA, G154D was a lethal mutation in single copy, and the purified protein was unable to transfer biotin from enzyme-bound biotinoyl-adenylate either to the natural acceptor protein or to a biotin-accepting peptide sequence. Consistent with the transcriptional repression data, each of the purified mutant proteins showed increased affinity for the biotin operator DNA in electrophoretic mobility shift assays. Surprisingly, although most of the mutations were located in the catalytic domain, all of those tested, except G154D BirA, had normal ligase activity. Most of the mutations that gave superrepressor phenotypes altered residues

  5. 4p-5s transitions in YVII, VIII, ZrVIII, IX, NbIX, X and MoX, XI

    International Nuclear Information System (INIS)

    Rahimullah, K.; Chaghtai, M.S.Z.; Khatoon, S.

    1976-01-01

    The spectra of Y VII, VIII, Zr VIII, IX, Nb X and Mo X, XI are studied for the first time and the 1971 analysis of Nb IX is improved. By analyses of the transitions 4s 2 4psup(k)-4s 2 4psup(k-1)5s all the levels of the configurations 4p 3 , 4p 2 5s, 4p 2 and 4p5s are established in the spectra concerned. (Auth.)

  6. Some mutants in maize obtained by irradiation with thermal neutrons

    International Nuclear Information System (INIS)

    Diaconu, P.

    1993-01-01

    Irradiation was carried out at the Bucharest Institute of Atomic Physics and the National Laboratory Brookhaven, USA. A description is given of 22 genic mutants affecting leaf color, plant size, and branching capacity. Characteristics related to pollen fertility and the vegetative period were affected in all the mutants. Improvement of pollen fertility was attempted over four generations without success. The maize mutants obtained by irradiation may be considered as being without practical significance. (author). 7 figs., 1 tab. 11 ref

  7. Chemotaxis-defective mutants of the nematode Caenorhabditis elegans.

    Science.gov (United States)

    Dusenbery, D B; Sheridan, R E; Russell, R L

    1975-06-01

    The technique of countercurrent separation has been used to isolate 17 independent chemotaxis-defective mutants of the nematode Caenorhabditis elegans. The mutants, selected to be relatively insensitive to the normally attractive salt NaCl, show varying degrees of residual sensitivity; some are actually weakly repelled by NaCl. The mutants are due to single gene defects, are autosomal and recessive, and identify at least five complementation groups.

  8. Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

    International Nuclear Information System (INIS)

    Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

    2006-01-01

    The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

  9. Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants

    OpenAIRE

    Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.

    2010-01-01

    Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic ...

  10. A molecular chaperone activity of CCS restores the maturation of SOD1 fALS mutants.

    Science.gov (United States)

    Luchinat, Enrico; Barbieri, Letizia; Banci, Lucia

    2017-12-12

    Superoxide dismutase 1 (SOD1) is an important metalloprotein for cellular oxidative stress defence, that is mutated in familiar variants of Amyotrophic Lateral Sclerosis (fALS). Some mutations destabilize the apo protein, leading to the formation of misfolded, toxic species. The Copper Chaperone for SOD1 (CCS) transiently interacts with SOD1 and promotes its correct maturation by transferring copper and catalyzing disulfide bond formation. By in vitro and in-cell NMR, we investigated the role of the SOD-like domain of CCS (CCS-D2). We showed that CCS-D2 forms a stable complex with zinc-bound SOD1 in human cells, that has a twofold stabilizing effect: it both prevents the accumulation of unstructured mutant SOD1 and promotes zinc binding. We further showed that CCS-D2 interacts with apo-SOD1 in vitro, suggesting that in cells CCS stabilizes mutant apo-SOD1 prior to zinc binding. Such molecular chaperone function of CCS-D2 is novel and its implications in SOD-linked fALS deserve further investigation.

  11. Photocycle dynamics of the E149A mutant of cryptochrome 3 from Arabidopsis thaliana.

    Science.gov (United States)

    Zirak, P; Penzkofer, A; Moldt, J; Pokorny, R; Batschauer, A; Essen, L-O

    2009-11-09

    The E149A mutant of the cryDASH member cryptochrome 3 (cry3) from Arabidopsis thaliana was characterized in vitro by optical absorption and emission spectroscopic studies. The mutant protein non-covalently binds the chromophore flavin adenine dinucleotide (FAD). In contrast to the wild-type protein it does not bind N5,N10-methenyl-5,6,7,8-tetrahydrofolate (MTHF). Thus, the photo-dynamics caused by FAD is accessible without the intervening coupling with MTHF. In dark adapted cry3-E149A, FAD is present in the oxidized form (FAD(ox)), semiquinone form (FADH(.)), and anionic hydroquinone form (FAD(red)H(-)). Blue-light photo-excitation of previously unexposed cry3-E149A transfers FAD(ox) to the anionic semiquinone form (FAD()(-)) with a quantum efficiency of about 2% and a back recovery time of about 10s (photocycle I). Prolonged photo-excitation leads to an irreversible protein re-conformation with structure modification of the U-shaped FAD and enabling proton transfer. Thus, a change in the photocycle dynamics occurs with photo-conversion of FAD(ox) to FADH(.), FADH(.) to FAD(red)H(-), and thermal back equilibration in the dark (photocycle II). The photocycle dynamics of cry3-E149A is compared with the photocycle behaviour of wild-type cry3 and other photo-sensory cryptochromes.

  12. How to orient the functional GroEL-SR1 mutant for atomic force microscopy investigations

    International Nuclear Information System (INIS)

    Schiener, Jens; Witt, Susanne; Hayer-Hartl, Manajit; Guckenberger, Reinhard

    2005-01-01

    We present high-resolution atomic force microscopy (AFM) imaging of the single-ring mutant of the chaperonin GroEL (SR-EL) from Escherichia coli in buffer solution. The native GroEL is generally unsuitable for AFM scanning as it is easily being bisected by forces exerted by the AFM tip. The single-ring mutant of GroEL with its simplified composition, but unaltered capability of binding substrates and the co-chaperone GroES, is a more suited system for AFM studies. We worked out a scheme to systematically investigate both the apical and the equatorial faces of SR-EL, as it binds in a preferred orientation to hydrophilic mica and hydrophobic highly ordered pyrolytic graphite. High-resolution topographical imaging and the interaction of the co-chaperone GroES were used to assign the orientations of SR-EL in comparison with the physically bisected GroEL. The usage of SR-EL facilitates single molecule studies on the folding cycle of the GroE system using AFM

  13. Aerobic dive limits of seals with mutant myoglobin using combined thermochemical and physiological data

    DEFF Research Database (Denmark)

    Dasmeh, Pouria; Davis, Randall W.; Kepp, Kasper Planeta

    2013-01-01

    This paper presents an integrated model of convective O2-transport, aerobic dive limits (ADL), and thermochemical data for oxygen binding to mutant myoglobin (Mb), used to quantify the impact of mutations in Mb on the dive limits of Weddell seals (Leptonychotes weddellii). We find that wild-type ...... that such conditions are mostly selected upon in seals. The model is capable of roughly quantifying the physiological impact of single-protein mutations and thus bridges an important gap between animal physiology and molecular (protein) evolution.......This paper presents an integrated model of convective O2-transport, aerobic dive limits (ADL), and thermochemical data for oxygen binding to mutant myoglobin (Mb), used to quantify the impact of mutations in Mb on the dive limits of Weddell seals (Leptonychotes weddellii). We find that wild-type Mb...... traits are only superior under specific behavioral and physiological conditions that critically prolong the ADL, action radius, and fitness of the seals. As an extreme example, the mutations in the conserved His-64 reduce ADL up to 14±2 min for routine aerobic dives, whereas many other mutations...

  14. Studies on mutant breeding of Hibiscus syriacus

    International Nuclear Information System (INIS)

    Song, Hi Sup; Kim, Jin Kyu; Lee, Ki Un; Kim, Young Taik.

    1997-01-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has such a characteristic of self-incompatibility that all the plant exist as natural hybrids and have heterogeneous genes. Many domestic 91 varieties of Hibiscus syriacus were collected. Radiosensitivity of H. Syriacus irradiated with γ-ray was investigated in plant cuttings. The plant height was reduced by 45% in 5KR irradiated group, compared to control group. The radiation dose of 5KR could be recommended for mutation breeding of Hibiscus cuttings. Radiosensitivity of γ-ray irr