WorldWideScience

Sample records for bind mutant 5s

  1. Non-canonical binding interactions of the RNA recognition motif (RRM domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP.

    Directory of Open Access Journals (Sweden)

    Anyango D Kamina

    Full Text Available RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP and P34 binds to 5S ribosomal RNA (rRNA and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  2. Agrobacterium rhizogenes mutants that fail to bind to plant cells.

    OpenAIRE

    Crews, J L; Colby, S; Matthysse, A G

    1990-01-01

    Transposon insertion mutants of Agrobacterium rhizogenes were screened to obtain mutant bacteria that failed to bind to carrot suspension culture cells. A light microscope binding assay was used. The bacterial isolates that were reduced in binding to carrot cells were all avirulent on Bryophyllum diagremontiana leaves and on carrot root disks. The mutants did not appear to be altered in cellulose production. The composition of the medium affected the ability of the parent and mutant bacteria ...

  3. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  4. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    ., & Garrett, R. A. (1981) Biochemistry 20, 7301--7307], reveal an extensive interaction site for protein L18 and a more localized one for L25. Generally comparable results, with a few important differences, were obtained in a study of the binding sites of the two E. coli proteins on Bacillus...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...... experiments were performed for both RNAs. The effects of the bound proteins on the ribonuclease digestion of the RNAs could generally be correlated with the results obtained with the E. coli proteins L18 and L25, although there was evidence for an additional protein-induced conformational change in the B...

  5. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the r...... adenosine and the adjacent guanosine-67 of the RNA and glutamine-19 of the protein L18.......Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  6. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired......Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... adenosine and the adjacent guanosine-67 of the RNA and glutamine-19 of the protein L18....

  7. New non detrimental DNA binding mutants of the Escherichia coli initiator protein DnaA

    DEFF Research Database (Denmark)

    Asklund, Marlene; Atlung, Tove

    2004-01-01

    The initiator protein DnaA has several unique DNA-binding features. It binds with high affinity as a monomer to the nonamer DnaA box. In the ATP form, DnaA binds cooperatively to the low-affinity ATP-DnaA boxes, and to single-stranded DNA in the 13mer region of the origin. We have carried out...... an extensive mutational analysis of the DNA-binding domain of the Escherichia coli DnaA protein using mutagenic PCR. We analyzed mutants exhibiting more or less partial activity by selecting for complementation of a dnaA(Ts) mutant strain at different expression levels of the new mutant proteins. The selection...... gave rise to 30 single amino acid substitutions and, including double substitutions, more than 100 mutants functional in initiation of chromosome replication were characterized. The analysis indicated that all regions of the DNA-binding domain are involved in DNA binding, but the most important amino...

  8. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  9. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    Science.gov (United States)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  10. AFM images of complexes between amylose and Aspergillus niger glucoamylase mutants, native and mutant starch binding domains: a model for the action of glucoamylase

    DEFF Research Database (Denmark)

    Morris, V. M.; Gunning, A. P.; Faults, C. B.

    2005-01-01

    Atomic force microscopy has been used to investigate the complexes formed between high molecular weight amylose chains and Aspergillus niger glucoamylase mutants (E400Q and W52F), wild-type A. niger starch binding domains (SBDS), and mutant SBDs (W563K and W590K) lacking either of the two starch ...

  11. Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants

    Science.gov (United States)

    Einav, Tal; Duque, Julia; Phillips, Rob

    2018-02-01

    Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.

  12. A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A; Wagner, R

    1979-01-01

    An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

  13. Congenital heart block: identification of autoantibody binding site on the extracellular loop (domain I, S5-S6) of alpha(1D) L-type Ca channel.

    Science.gov (United States)

    Karnabi, Eddy; Qu, Yongxia; Wadgaonkar, Raj; Mancarella, Salvatore; Yue, Yuankun; Chahine, Mohamed; Clancy, Robert M; Buyon, Jill P; Boutjdir, Mohamed

    2010-03-01

    Congenital heart block (CHB) is an autoimmune disease associated with autoantibodies against intracellular ribonucleoproteins SSB/La and SSA/Ro. The hallmark of CHB is complete atrioventricular block. We have recently established that anti-SSA/Ro -SSB/La autoantibodies inhibit alpha(1D) L-type Ca current, I(Ca-L), and cross-react with the alpha(1D) Ca channel protein. This study aims at identifying the possible binding sites on alpha(1D) protein for autoantibodies from sera of mothers with CHB children. GST fusion proteins of the extracellular regions between the transmembrane segments (S5-S6) of each of the four alpha(1D) Ca channel protein domains I-IV were prepared and tested for reactivity with sera from mothers with CHB children and controls using ELISA. Sera containing anti-Ro/La autoantibodies from 118 mothers with CHB children and from 15 mothers with anti-Ro/La autoantibodies but have healthy children, and from 28 healthy mothers without anti-Ro/La autoantibodies and healthy children were evaluated. Seventeen of 118 (14.4%) sera from mothers with CHB children reacted with the extracellular loop of domain I S5-S6 region (E1). In contrast, only 2 of 28 (7%) of sera from healthy mothers (-anti-Ro/La) and healthy children reacted with E1 loop and none (0 of 15) of sera from healthy mothers (+anti-Ro/La) and healthy children reacted with the E1 loop. Preincubation of E1 loop with the positive sera decreased the O.D reading establishing the specificity of the response. Electrophysiological characterization of the ELISA positive sera and purified IgG showed inhibition (44.1% and 49.8%, respectively) of the alpha(1D) I(Ca-L) expressed in tsA201 cells. The inhibition was abolished when the sera were pre-incubated with E1 fusion protein. The results identified the extracellular loop of domain I S5-S6 of L-type Ca channel alpha(1D) subunit as a target for autoantibodies from a subset of mothers with CHB children. This novel finding provides insights into the

  14. Epilepsy, Behavioral Abnormalities, and Physiological Comorbidities in Syntaxin-Binding Protein 1 (STXBP1 Mutant Zebrafish.

    Directory of Open Access Journals (Sweden)

    Brian P Grone

    Full Text Available Mutations in the synaptic machinery gene syntaxin-binding protein 1, STXBP1 (also known as MUNC18-1, are linked to childhood epilepsies and other neurodevelopmental disorders. Zebrafish STXBP1 homologs (stxbp1a and stxbp1b have highly conserved sequence and are prominently expressed in the larval zebrafish brain. To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing "dark-flash" visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity. Our findings in these newly generated mutant lines of zebrafish suggest that zebrafish recapitulate clinical phenotypes associated with human syntaxin-binding protein 1 mutations.

  15. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    ) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... delayed relative to that of the wild-type virus, molecular tumor analysis indicated that all the primer binding site-modified viruses induce T-cell lymphomas similar to those induced by the wild-type virus in terms of frequencies of genomic rearrangements within the T-cell receptor beta......, recombination with endogenous viruses resulting in the generation of recombinant viruses carrying a glutamine primer binding site was detected in the majority of the tumors induced by the SL3-3 Lys3 mutant as well as in two tumors induced by wild-type SL3-3 and the SL3-3 Arg1,2 mutant....

  16. Rhizobium meliloti mutants that overproduce the R. meliloti acidic Calcofluor-binding exopolysaccharide

    International Nuclear Information System (INIS)

    Doherty, D.; Glazebrook, J.; Walker, G.C.; Leigh, J.A.

    1988-01-01

    The acidic Calcofluor-binding exopolysaccharide of Rhizobium meliloti Rm1021 plays one or more critical roles in nodule invasion and possible in nodule development. Two loci, exoR and exoS, that effect the regulation of synthesis of this exopolysaccharide were identified by screening for derivatives of strain Rm1021 that formed mucoid colonies that fluoresced extremely brightly under UV light when grown on medium containing Calcofluor. The exopolysaccharide produced in large quantities by the exoR95::Tn5 and exoS96::Tn5 strains was indistinguishable from that produced by the parental strain Rm1021, and its synthesis required the function of at least the exoA, exoB, and exoF genes. Both the exoR and exoS loci were located on the chromosome, and the exo96::Tn5 mutation was 84% linked to the trp-33 mutation by ΦM12 transduction. Synthesis of the Calcofluor-binding exopolysaccharide by strain Rm1021 was greatly stimulated by starvation for ammonia. In contrast, the exoR95::Tn5 mutant produced high levels of exopolysaccharide regardless of the presence or absence of ammonia in the medium. The exoS96::Tn5 mutant produced elevated amounts of exopolysaccharide in the presence of ammonia, but higher amounts were observed after starvation for ammonia. The presence of either mutation increased the level of expression of exoF::TnphoA and exoP::TnphoA fusions. Analyses of results obtained when alfalfa seedlings were inoculated with the exoR95::Tn5 strain indicated that the mutant strain could not invade nodules. However, pseudorevertants that retained the original exoR95::Tn5 mutant but acquired unlinked suppressors so that they produced an approximately normal amount of exopolysaccharide were able to invade nodules and fix nitrogen

  17. Atomistic simulation of nanowires in the sp3d5s* tight-binding formalism: From boundary conditions to strain calculations

    Science.gov (United States)

    Luisier, Mathieu; Schenk, Andreas; Fichtner, Wolfgang; Klimeck, Gerhard

    2006-11-01

    As the active dimensions of metal-oxide field-effect transistors are approaching the atomic scale, the electronic properties of these “nanowire” devices must be treated on a quantum mechanical level. In this paper, the transmission coefficients and the density of states of biased and unbiased Si and GaAs nanowires are simulated using the sp3d5s* empirical tight-binding method. Each atom, as well as the connections to its nearest neighbors, is represented explicitly. The material parameters are optimized to reproduce bulk band-structure characteristics in various crystal directions and various strain conditions. A scattering boundary method to calculate the open boundary conditions in nanowire transistors is developed to reduce the computational burden. Existing methods such as iterative or generalized eigenvalue problem approaches are significantly more expensive than the transport simulation through the device. The algorithm can be coupled to nonequilibrium Green’s function and wave function transport calculations. The speed improvement is even larger if the wire transport direction is different from [100]. Finally, it is demonstrated that strain effects can be easily included in the present nanowire simulations.

  18. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  19. Substrate binding activates the designed triple mutant of the colicin E7 metallonuclease

    DEFF Research Database (Denmark)

    Németh, Eszter; Körtvélyesi, Tamás; Kožíšek, Milan

    2014-01-01

    The nuclease domain of colicin E7 (NColE7) cleaves DNA nonspecifically. The active center is a Zn(2+)-containing HNH motif at the C-terminus. The N-terminal loop is essential for the catalytic activity providing opportunity for allosteric modulation of the enzyme. To identify the key residues...... responsible for the structural integrity of NColE7, a virtual alanine scan was performed on a semiempirical quantum chemical level within the 25 residue long N-terminal sequence (446-470). Based on the calculations the T454A/K458A/W464A-NColE7 triple mutant (TKW) was expressed and purified. According...... to the agarose gel electrophoresis experiments and linear dichroism spectra the catalytic activity of the TKW mutant decreased in comparison with wild-type NColE7. The distorted structure and weakened Zn(2+) binding may account for this as revealed by circular dichroism spectra, mass spectrometry, fluorescence...

  20. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein

    NARCIS (Netherlands)

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-01-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were

  1. Differential regulation of wild-type and mutant alpha-synuclein binding to synaptic membranes by cytosolic factors

    Directory of Open Access Journals (Sweden)

    Figeys Daniel

    2008-09-01

    Full Text Available Abstract Background Alpha-Synuclein (α-syn, a 140 amino acid protein associated with presynaptic membranes in brain, is a major constituent of Lewy bodies in Parkinson's disease (PD. Three missense mutations (A30P, A53T and E46K in the α-syn gene are associated with rare autosomal dominant forms of familial PD. However, the regulation of α-syn's cellular localization in neurons and the effects of the PD-linked mutations are poorly understood. Results In the present study, we analysed the ability of cytosolic factors to regulate α-syn binding to synaptic membranes. We show that co-incubation with brain cytosol significantly increases the membrane binding of normal and PD-linked mutant α-syn. To characterize cytosolic factor(s that modulate α-syn binding properties, we investigated the ability of proteins, lipids, ATP and calcium to modulate α-syn membrane interactions. We report that lipids and ATP are two of the principal cytosolic components that modulate Wt and A53T α-syn binding to the synaptic membrane. We further show that 1-O-hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (C16:0 PAF is one of the principal lipids found in complex with cytosolic proteins and is required to enhance α-syn interaction with synaptic membrane. In addition, the impaired membrane binding observed for A30P α-syn was significantly mitigated by the presence of protease-sensitive factors in brain cytosol. Conclusion These findings suggest that endogenous brain cytosolic factors regulate Wt and mutant α-syn membrane binding, and could represent potential targets to influence α-syn solubility in brain.

  2. A mutant of SWAP-70, a phosphatidylinositoltrisphosphate binding protein, transforms mouse embryo fibroblasts, which is inhibited by sanguinarine.

    Directory of Open Access Journals (Sweden)

    Yasuhisa Fukui

    2010-12-01

    Full Text Available SWAP-70, a phosphatidylinositol trisphosphate (PtdIns(3,4,5P(3 binding protein, has been suggested to be involved in transformation of mouse embryo fibroblasts (MEFs as well as membrane ruffling after growth factor stimulation of the cells. A mutant, SWAP-70-374, was found to be able to bind to F-actin in vitro, whereas wild-type SWAP-70 failed to do so. This mutant was present at the plasma membrane without any stimulation while the wild-type protein was present only in the cytosol unless cells were stimulated with EGF. Expression of this mutant in MEFs resulted in morphologic transformation, fast growth, and loss of contact inhibition, suggesting that SWAP-70 with this mutation can transform the cells. ERK1/2 was activated in SWAP-70-374-transformed cells. Use of MEK inhibitors revealed that the ERK1/2 pathway does not affect the cell growth of MEFs but is responsible for loss of contact inhibition. To investigate the function of SWAP-70 further, drugs that can inhibit SWAP-70-dependent cell responses were screened. Among various drugs, sanguinarine was found to inhibit transformation of MEFs by SWAP-70-374. This drug was able to inhibit SWAP-70-mediated membrane ruffling as well, suggesting that its effect was closely related to the SWAP-70 signaling pathway. These results suggest that SWAP-70-374 can activate some signaling pathways, including the ERK1/2 pathway, to transform MEFs.

  3. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein

    OpenAIRE

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-01-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were previously isolated, which demonstrated a role of single substitutions in the non-structural 3A protein in conferring resistance. Besides the 3A substitutions (i.e., 3A-I54F and 3A-H57Y) in coxsackieviru...

  4. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft

    DEFF Research Database (Denmark)

    Kandra, L.; Abou Hachem, Maher; Gyemant, G.

    2006-01-01

    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....

  5. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  6. Substrate binding activates the designed triple mutant of the colicin E7 metallonuclease

    Czech Academy of Sciences Publication Activity Database

    Németh, E.; Körtvélyesi, T.; Kožíšek, Milan; Thulstrup, P. W.; Christensen, H. E. M.; Asaka, M. N.; Nagata, K.; Gyurcsik, B.

    2014-01-01

    Roč. 19, č. 8 (2014), s. 1295-1303 ISSN 0949-8257 Grant - others:OPPC(XE) CZ.2.16/3.1.00/24016; Seventh Framework Programme of the European Union(XE) FP7-312284 Institutional support: RVO:61388963 Keywords : binding affinity * calorimetry * zinc nuclease * substrate induced folding * protein engineering Subject RIV: CE - Biochemistry Impact factor: 2.538, year: 2014

  7. A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-β and Regulates Its Clearance from the Mouse Brain*

    Science.gov (United States)

    Sagare, Abhay P.; Bell, Robert D.; Srivastava, Alaka; Sengillo, Jesse D.; Singh, Itender; Nishida, Yoichiro; Chow, Nienwen; Zlokovic, Berislav V.

    2013-01-01

    Soluble low density lipoprotein receptor-related protein-1 (sLRP1) binds ∼70% of amyloid β-peptide (Aβ) in human plasma. In Alzheimer disease (AD) and individuals with mild cognitive impairment converting to AD, plasma sLRP1 levels are reduced and sLRP1 is oxidized, which results in diminished Aβ peripheral binding and higher levels of free Aβ in plasma. Experimental studies have shown that free circulating Aβ re-enters the brain and that sLRP1 and/or its recombinant wild type cluster IV (WT-LRPIV) prevent Aβ from entering the brain. Treatment of Alzheimer APPsw+/0 mice with WT-LRPIV has been shown to reduce brain Aβ pathology. In addition to Aβ, LRPIV binds multiple ligands. To enhance LRPIV binding for Aβ relative to other LRP1 ligands, we generated a library of LRPIV-derived fragments and full-length LRPIV variants with glycine replacing aspartic acid residues 3394, 3556, and 3674 in the calcium binding sites. Compared with WT-LRPIV, a lead LRPIV-D3674G mutant had 1.6- and 2.7-fold higher binding affinity for Aβ40 and Aβ42 in vitro, respectively, and a lower binding affinity for other LRP1 ligands (e.g. apolipoprotein E2, E3, and E4 (1.3–1.8-fold), tissue plasminogen activator (2.7-fold), matrix metalloproteinase-9 (4.1-fold), and Factor Xa (3.8-fold)). LRPIV-D3674G cleared mouse endogenous brain Aβ40 and Aβ42 25–27% better than WT-LRPIV. A 3-month subcutaneous treatment of APPsw+/0 mice with LRPIV-D3674G (40 μg/kg/day) reduced Aβ40 and Αβ42 levels in the hippocampus, cortex, and cerebrospinal fluid by 60–80% and improved cerebral blood flow responses and hippocampal function at 9 months of age. Thus, LRPIV-D3674G is an efficient new Aβ clearance therapy. PMID:23580652

  8. An autoactive mutant of the M flax rust resistance protein has a preference for binding ATP, whereas wild-type M protein binds ADP.

    Science.gov (United States)

    Williams, Simon J; Sornaraj, Pradeep; deCourcy-Ireland, Emma; Menz, R Ian; Kobe, Bostjan; Ellis, Jeffrey G; Dodds, Peter N; Anderson, Peter A

    2011-08-01

    Resistance (R) proteins are key regulators of the plant innate immune system and are capable of pathogen detection and activation of the hypersensitive cell death immune response. To understand the molecular mechanism of R protein activation, we undertook a phenotypic and biochemical study of the flax nucleotide binding (NB)-ARC leucine-rich repeat protein, M. Using Agrobacterium-mediated transient expression in flax cotyledons, site-directed mutations of key residues within the P-loop, kinase 2, and MHD motifs within the NB-ARC domain of M were shown to affect R protein function. When purified using a yeast expression system and assayed for ATP and ADP, these mutated proteins exhibited marked differences in the quantity and identity of the bound nucleotide. ADP was bound to recombinant wild-type M protein, while the nonfunctional P-loop mutant did not have any nucleotides bound. In contrast, ATP was bound to an autoactive M protein mutated in the highly conserved MHD motif. These data provide direct evidence supporting a model of R protein function in which the "off" R protein binds ADP and activation of R protein defense signaling involves the exchange of ADP for ATP.

  9. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein.

    Science.gov (United States)

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-11-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were previously isolated, which demonstrated a role of single substitutions in the non-structural 3A protein in conferring resistance. Besides the 3A substitutions (i.e., 3A-I54F and 3A-H57Y) in coxsackievirus B3 (CVB3), substitution N2D in 2C was identified in each of the PI4KB-inhibitor resistant CVB3 pools, but its possible benefit has not been investigated yet. In this study, we set out to investigate the possible role of 2C-N2D in the resistance to PI4KB and OSBP inhibition. We show that 2C-N2D by itself did not confer any resistance to inhibitors of PI4KB and OSBP. However, the double mutant (i.e., 2C-N2D/3A-H57Y) showed better replication than the 3A-H57Y single mutant in the presence of inhibitors. Growing evidence suggests that alterations in lipid homeostasis affect the proteolytic processing of the poliovirus polyprotein. Therefore, we studied the effect of PI4KB or OSBP inhibition on proteolytic processing of the CVB3 polyprotein during infection as well as in a replication-independent system. We show that both PI4KB and OSBP inhibitors specifically affected the cleavage at the 3A-3B junction, and that mutation 3A-H57Y recovered impaired proteolytic processing at this junction. Although 2C-N2D enhanced replication of the 3A-H57Y single mutant, we did not detect additional effects of this substitution on polyprotein processing, which leaves the mechanism of how 2C-N2D contributes to the resistance to be revealed. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Dynamic fluorescence spectroscopy on single tryptophan mutants of EIImtl in detergent micelles : Effects of substrate binding and phosphorylation on the fluorescence and anisotropy decay

    NARCIS (Netherlands)

    Swaving Dijkstra, Dolf; Broos, J.; Visser, Antonie J.W.G.; van Hoek, A.; Robillard, George

    1997-01-01

    The effects of substrate and substrate analogue binding and phosphorylation on the conformational dynamics of the mannitol permease of Escherichia coli were investigated, using time-resolved fluorescence spectroscopy on mutants containing five single tryptophans situated in the membrane-embedded C

  11. Laminopathy-inducing lamin A mutants can induce redistribution of lamin binding proteins into nuclear aggregates.

    Science.gov (United States)

    Hübner, S; Eam, J E; Hübner, A; Jans, D A

    2006-01-15

    Lamins, members of the family of intermediate filaments, form a supportive nucleoskeletal structure underlying the nuclear envelope and can also form intranuclear structures. Mutations within the A-type lamin gene cause a variety of degenerative diseases which are collectively referred to as laminopathies. At the molecular level, laminopathies have been shown to be linked to a discontinuous localization pattern of A-type lamins, with some laminopathies containing nuclear lamin A aggregates. Since nuclear aggregate formation could lead to the mislocalization of proteins interacting with A-type lamins, we set out to examine the effects of FLAG-lamin A N195K and R386K protein aggregate formation on the subnuclear distribution of the retinoblastoma protein (pRb) and the sterol responsive element binding protein 1a (SREBP1a) after coexpression as GFP-fusion proteins in HeLa cells. We observed strong recruitment of both proteins into nuclear aggregates. Nuclear aggregate recruitment of the NPC component nucleoporin NUP153 was also observed and found to be dependent on the N-terminus. That these effects were specific was implied by the fact that a number of other coexpressed karyophilic GFP-fusion proteins, such as the nucleoporin NUP98 and kanadaptin, did not coaggregate with FLAG-lamin A N195K or R386K. Immunofluorescence analysis further indicated that the precursor form of lamin A, pre-lamin A, could be found in intranuclear aggregates. Our results imply that redistribution into lamin A-/pre-lamin A-containing aggregates of proteins such as pRb and SREBP1a could represent a key aspect underlying the molecular pathogenesis of certain laminopathies.

  12. Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

    International Nuclear Information System (INIS)

    Wang Qishan; Bag, Jnanankur

    2008-01-01

    Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO 4 , and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40, and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein

  13. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  14. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with SV40 T-antigen mutants defective in RB and P53 binding domains

    International Nuclear Information System (INIS)

    LingNah Su; Little, J.B.

    1992-01-01

    A series of human diploid fibroblast cell clones were developed by DNA transfection with either wild-type SV40 T-antigen (SV40T) or T-antigen mutants defective in its various functional domains. Cell clones expressing the wild-type SV40 T were significantly radioresistant as compared with clones transfected with the neo gene only (D o 192 ± 13 vs 127 ± 19). This radioresistance persisted in post-crisis, immortalized cell lines. A series of mutants with point or deletion mutations within each functionally active domain of SV40 T were also examined for their ability to alter radiosensitivity and induce morphological transformation. Cell clones transfected with T-antigen mutants defective in nuclear localization or origin binding showed increased radioresistance similar to clones transfected with wild-type T-antigen, and expressed morphological changes characteristic of SV40 T-transfected cells. (author)

  15. Combining substrate dynamics, binding statistics, and energy barriers to rationalize regioselective hydroxylation of octane and lauric acid by CYP102A1 and mutants.

    Science.gov (United States)

    Feenstra, K Anton; Starikov, Eugene B; Urlacher, Vlada B; Commandeur, Jan N M; Vermeulen, Nico P E

    2007-03-01

    Hydroxylations of octane and lauric acid by Cytochrome P450-BM3 (CYP102A1) wild-type and three active site mutants--F87A, L188Q/A74G, and F87V/L188Q/A74G--were rationalized using a combination of substrate orientation from docking, substrate binding statistics from molecular dynamics simulations, and barrier energies for hydrogen atom abstraction from quantum mechanical calculations. Wild-type BM3 typically hydroxylates medium- to long-chain fatty acids on subterminal (omega-1, omega-2, omega-3) but not the terminal (omega) positions. The known carboxylic anchoring site Y51/R47 for lauric acid, and hydrophobic interactions and steric exclusion, mainly by F87, for octane as well as lauric acid, play a role in the binding modes of the substrates. Electrostatic interactions between the protein and the substrate strongly modulate the substrate's regiodependent activation barriers. A combination of the binding statistics and the activation barriers of hydrogen-atom abstraction in the substrates is proposed to determine the product formation. Trends observed in experimental product formation for octane and lauric acid by wild-type BM3 and the three active site mutants were qualitatively explained. It is concluded that the combination of substrate binding statistics and hydrogen-atom abstraction barrier energies is a valuable tool to rationalize substrate binding and product formation and constitutes an important step toward prediction of product ratios.

  16. Combining substrate dynamics, binding statistics, and energy barriers to rationalize regioselective hydroxylation of octane and lauric acid by CYP102A1 and mutants

    NARCIS (Netherlands)

    Feenstra, K Anton; Starikov, Eugene B; Urlacher, Vlada B; Commandeur, Jan N M; Vermeulen, Nico P E

    Hydroxylations of octane and lauric acid by Cytochrome P450-BM3 (CYP102A1) wild-type and three active site mutants--F87A, L188Q/A74G, and F87V/L188Q/A74G--were rationalized using a combination of substrate orientation from docking, substrate binding statistics from molecular dynamics simulations,

  17. Environment of copper in Pseudomonas aeruginosa azurin probed by binding of exogenous ligands to Met121X (X = Gly, Ala, Val, Leu, or Asp) mutants.

    Science.gov (United States)

    Bonander, N; Karlsson, B G; Vänngård, T

    1996-02-20

    The binding of small exogenous ligands to mutants of the blue copper protein azurin from Pseudomonas aeruginosa, altered in the axial position, Met121X (X = Gly, Ala, Val, Leu, or Asp), has been studied with optical and electron paramagnetic resonance (EPR) spectroscopy. The results show that small molecules can enter the pocket left by the side chain of Met121. For azide, the dissociation constants are Leu > Val > Ala, reflecting the increasing space available. The Gly and Asp mutants bind azide less strongly than the Ala mutant, due to competition with water (Gly) and the polar side chain (Asp). Similar trends are found for thiocyanate. Cyanide binds equally well to the Ala and Val mutants. A number of other small potential ligands were tried. Alcohols do not affect room-temperature optical spectra, but at low temperatures, the EPR spectrum is stellacyanin-like, indicative of a weak axial interaction. Ligands binding with a carboxyl group or nitrogen (e.g. acetate or azide) convert the metal center to a form intermediate between regular types 1 and 2, presumably by pulling the copper ion out of the trigonal plane formed by Cys(S) and two His(N). Cyanide interacts strongly as shown by the hyperfine coupling to the 13C nucleus. With increasing strength of the axial interaction, the two major bands in the visible region (600 and 400-500 nm) shift in parallel to higher energy, and at the same time, the strength of the latter transition increases at the expense of the former. This demonstrates that these transitions have a common origin, namely S-to-Cu charge transfer transition.

  18. Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects

    Science.gov (United States)

    Ruegger, M.; Dewey, E.; Hobbie, L.; Brown, D.; Bernasconi, P.; Turner, J.; Muday, G.; Estelle, M.

    1997-01-01

    Polar auxin transport plays a key role in the regulation of plant growth and development. To identify genes involved in this process, we have developed a genetic procedure to screen for mutants of Arabidopsis that are altered in their response to auxin transport inhibitors. We recovered a total of 16 independent mutants that defined seven genes, called TRANSPORT INHIBITOR RESPONSE (TIR) genes. Recessive mutations in one of these genes, TIR3, result in altered responses to transport inhibitors, a reduction in polar auxin transport, and a variety of morphological defects that can be ascribed to changes in indole-3-acetic acid distribution. Most dramatically, tir3 seedlings are strongly deficient in lateral root production, a process that is known to depend on polar auxin transport from the shoot into the root. In addition, tir3 plants display a reduction in apical dominance as well as decreased elongation of siliques, pedicels, roots, and the inflorescence. Biochemical studies indicate that tir3 plants have a reduced number of N-1-naphthylphthalamic (NPA) binding sites, suggesting that the TIR3 gene is required for expression, localization, or stabilization of the NPA binding protein (NBP). Alternatively, the TIR3 gene may encode the NBP. Because the tir3 mutants have a substantial defect in NPA binding, their phenotype provides genetic evidence for a role for the NBP in plant growth and development.

  19. Biofilm formation and binding specificities of CFA/I, CFA/II and CS2 adhesions of enterotoxigenic Escherichia coli and Cfae-R181A mutant.

    Science.gov (United States)

    Liaqat, Iram; Sakellaris, Harry

    2012-07-01

    Enterotoxigenic Escherichia coli (ETEC) strains are leading causes of childhood diarrhea in developing countries. Adhesion is the first step in pathogenesis of ETEC infections and ETEC pili designated colonization factor antigens (CFAs) are believed to be important in the biofim formation, colonization and host cell adhesions. As a first step, we have determined the biofilm capability of ETEC expressing various types of pili (CFA/I, CfaE-R181A mutant/CfaE tip mutant, CFA/II and CS2). Further, enzyme-linked immunosorbent assay (ELISA) assay were developed to compare the binding specificity of CFA/I, CFA/II (CS1 - CS3) and CS2 of ETEC, using extracted pili and piliated bacteria. CFA/II strain (E24377a) as well as extracted pili exhibited significantly higher binding both in biofilm and ELISA assays compared to non piliated wild type E24377a, CFA/I and CS2 strains. This indicates that co-expression of two or more CS2 in same strain is more efficient in increasing adherence. Significant decrease in binding specificity of DH5αF'lacI (q)/∆cotD (CS2) strain and MC4100/pEU2124 (CfaE-R181A) mutant strain indicated the important contribution of tip proteins in adherence assays. However, CS2 tip mutant strain (DH5αF'lacI (q)/pEU5881) showed that this specific residue may not be important as adhesions in these strains. In summary, our data suggest that pili, their minor subunits are important for biofilm formation and adherence mechanisms. Overall, the functional reactivity of strains co expressing various antigens, particularly minor subunit antigen observed in this study suggest that fewer antibodies may be required to elicit immunity to ETEC expressing a wider array of related pili.

  20. Biofilm formation and binding specificities of CFA/I, CFA/II and CS2 adhesions of Enterotoxigenic Escherichia coli and CfaE-R181A mutant

    Directory of Open Access Journals (Sweden)

    Iram Liaqat

    2012-09-01

    Full Text Available Enterotoxigenic Escherichia coli (ETEC strains are leading causes of childhood diarrhea in developing countries. Adhesion is the first step in pathogenesis of ETEC infections and ETEC pili designated colonization factor antigens (CFAs are believed to be important in the biofim formation, colonization and host cell adhesions. As a first step, we have determined the biofilm capability of ETEC expressing various types of pili (CFA/I, CfaE-R181A mutant/ CfaE tip mutant, CFA/II and CS2. Further, enzyme-linked immunosorbent assay (ELISA assay were developed to compare the binding specificity of CFA/I, CFA/II (CS1 - CS3 and CS2 of ETEC, using extracted pili and piliated bacteria. CFA/II strain (E24377a as well as extracted pili exhibited significantly higher binding both in biofilm and ELISA assays compared to non piliated wild type E24377a, CFA/I and CS2 strains. This indicates that co-expression of two or more CS2 in same strain is more efficient in increasing adherence. Significant decrease in binding specificity of DH5αF'lacIq/∆cotD (CS2 strain and MC4100/pEU2124 (CfaE-R181A mutant strain indicated the important contribution of tip proteins in adherence assays. However, CS2 tip mutant strain (DH5αF'lacIq/pEU5881 showed that this specific residue may not be important as adhesions in these strains. In summary, our data suggest that pili, their minor subunits are important for biofilm formation and adherence mechanisms. Overall, the functional reactivity of strains co expressing various antigens, particularly minor subunit antigen observed in this study suggest that fewer antibodies may be required to elicit immunity to ETEC expressing a wider array of related pili.

  1. Analysis of Metal-Binding Features of the Wild Type and Two Domain-Truncated Mutant Variants of Littorina littorea Metallothionein Reveals Its Cd-Specific Character

    Directory of Open Access Journals (Sweden)

    Òscar Palacios

    2017-07-01

    Full Text Available After the resolution of the 3D structure of the Cd9-aggregate of the Littorina littorea metallothionein (MT, we report here a detailed analysis of the metal binding capabilities of the wild type MT, LlwtMT, and of two truncated mutants lacking either the N-terminal domain, Lltr2MT, or both the N-terminal domain, plus four extra flanking residues (SSVF, Lltr1MT. The recombinant synthesis and in vitro studies of these three proteins revealed that LlwtMT forms unique M9-LlwtMT complexes with Zn(II and Cd(II, while yielding a complex mixture of heteronuclear Zn,Cu-LlwtMT species with Cu(I. As expected, the truncated mutants gave rise to unique M6-LltrMT complexes and Zn,Cu-LltrMT mixtures of lower stoichiometry with respect to LlwtMT, with the SSVF fragment having an influence on their metal binding performance. Our results also revealed a major specificity, and therefore a better metal-coordinating performance of the three proteins for Cd(II than for Zn(II, although the analysis of the Zn(II/Cd(II displacement reaction clearly demonstrates a lack of any type of cooperativity in Cd(II binding. Contrarily, the analysis of their Cu(I binding abilities revealed that every LlMT domain is prone to build Cu4-aggregates, the whole MT working by modules analogously to, as previously described, certain fungal MTs, like those of C. neoformans and T. mesenterica. It is concluded that the Littorina littorea MT is a Cd-specific protein that (beyond its extended binding capacity through an additional Cd-binding domain confers to Littorina littorea a particular adaptive advantage in its changeable marine habitat.

  2. Mutants of the major ryegrass pollen allergen, Lol p 5, with reduced IgE-binding capacity: candidates for grass pollen-specific immunotherapy.

    Science.gov (United States)

    Swoboda, Ines; De Weerd, Nicole; Bhalla, Prem L; Niederberger, Verena; Sperr, W R; Valent, Peter; Kahlert, Helga; Fiebig, Helmut; Verdino, Petra; Keller, Walter; Ebner, Christof; Spitzauer, Susanne; Valenta, Rudolf; Singh, Mohan B

    2002-01-01

    More than 400 million individuals are sensitized to grass pollen allergens. Group 5 allergens represent the most potent grass pollen allergens recognized by more than 80 % of grass pollen allergic patients. The aim of our study was to reduce the allergenic activity of group 5 allergens for specific immunotherapy of grass pollen allergy. Based on B- and T-cell epitope mapping studies and on sequence comparison of group 5 allergens from different grasses, point mutations were introduced by site-directed mutagenesis in highly conserved sequence domains of Lol p 5, the group 5 allergen from ryegrass. We obtained Lol p 5 mutants with low IgE-binding capacity and reduced allergenic activity as determined by basophil histamine release and by skin prick testing in allergic patients. Circular dichroism analysis showed that these mutants exhibited an overall structural fold similar to the recombinant Lol p 5 wild-type allergen. In addition, Lol p 5 mutants retained the ability to induce proliferation of group 5 allergen-specific T cell lines and clones. Our results demonstrate that a few point mutations in the Lol p 5 sequence yield mutants with reduced allergenic activity that represent potential vaccine candidates for immunotherapy of grass pollen allergy.

  3. An allosteric binding site at the human serotonin transporter mediates the inhibition of escitalopram by R-citalopram: kinetic binding studies with the ALI/VFL-SI/TT mutant.

    Science.gov (United States)

    Zhong, Huailing; Hansen, Kasper B; Boyle, Noel J; Han, Kiho; Muske, Galina; Huang, Xinyan; Egebjerg, Jan; Sánchez, Connie

    2009-10-25

    The human serotonin transporter (hSERT) has primary and allosteric binding sites for escitalopram and R-citalopram. Previous studies have established that the interaction of these two compounds at a low affinity allosteric binding site of hSERT can affect the dissociation of [(3)H]escitalopram from hSERT. The allosteric binding site involves a series of residues in the 10th, 11th, and 12th trans-membrane domains of hSERT. The low affinity allosteric activities of escitalopram and R-citalopram are essentially eliminated in a mutant hSERT with changes in some of these residues, namely A505V, L506F, I507L, S574T, I575T, as measured in dissociation binding studies. We confirm that in association binding experiments, R-citalopram at clinically relevant concentrations reduces the association rate of [(3)H]escitalopram as a ligand to wild type hSERT. We demonstrate that the ability of R-citalopram to reduce the association rate of escitalopram is also abolished in the mutant hSERT (A505V, L506F, I507L, S574T, I575T), along with the expected disruption the low affinity allosteric function on dissociation binding. This suggests that the allosteric binding site mediates both the low affinity and higher affinity interactions between R-citalopram, escitalopram, and hSERT. Our data add an additional structural basis for the different efficacies of escitalopram compared to racemic citalopram reported in animal studies and clinical trials, and substantiate the hypothesis that hSERT has complex allosteric mechanisms underlying the unexplained in vivo activities of its inhibitors.

  4. Crl Binds to Domain 2 of σS and Confers a Competitive Advantage on a Natural rpoS Mutant of Salmonella enterica Serovar Typhi▿

    Science.gov (United States)

    Monteil, Véronique; Kolb, Annie; Mayer, Claudine; Hoos, Sylviane; England, Patrick; Norel, Françoise

    2010-01-01

    The RpoS sigma factor (σS) is the master regulator of the bacterial response to a variety of stresses. Mutants in rpoS arise in bacterial populations in the absence of stress, probably as a consequence of a subtle balance between self-preservation and nutritional competence. We characterized here one natural rpoS mutant of Salmonella enterica serovar Typhi (Ty19). We show that the rpoS allele of Ty19 (rpoSTy19) led to the synthesis of a σSTy19 protein carrying a single glycine-to-valine substitution at position 282 in σS domain 4, which was much more dependent than the wild-type σS protein on activation by Crl, a chaperone-like protein that increases the affinity of σS for the RNA polymerase core enzyme (E). We used the bacterial adenylate cyclase two-hybrid system to demonstrate that Crl bound to residues 72 to 167 of σS domain 2 and that G282V substitution did not directly affect Crl binding. However, this substitution drastically reduced the ability of σSTy19 to bind E in a surface plasmon resonance assay, a defect partially rescued by Crl. The modeled structure of the EσS holoenzyme suggested that substitution G282V could directly disrupt a favorable interaction between σS and E. The rpoSTy19 allele conferred a competitive fitness when the bacterial population was wild type for crl but was outcompeted in Δcrl populations. Thus, these results indicate that the competitive advantage of the rpoSTy19 mutant is dependent on Crl and suggest that crl plays a role in the appearance of rpoS mutants in bacterial populations. PMID:20935100

  5. Crl binds to domain 2 of σ(S) and confers a competitive advantage on a natural rpoS mutant of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Monteil, Véronique; Kolb, Annie; Mayer, Claudine; Hoos, Sylviane; England, Patrick; Norel, Françoise

    2010-12-01

    The RpoS sigma factor (σ(S)) is the master regulator of the bacterial response to a variety of stresses. Mutants in rpoS arise in bacterial populations in the absence of stress, probably as a consequence of a subtle balance between self-preservation and nutritional competence. We characterized here one natural rpoS mutant of Salmonella enterica serovar Typhi (Ty19). We show that the rpoS allele of Ty19 (rpoS(Ty19)) led to the synthesis of a σ(S)(Ty19) protein carrying a single glycine-to-valine substitution at position 282 in σ(S) domain 4, which was much more dependent than the wild-type σ(S) protein on activation by Crl, a chaperone-like protein that increases the affinity of σ(S) for the RNA polymerase core enzyme (E). We used the bacterial adenylate cyclase two-hybrid system to demonstrate that Crl bound to residues 72 to 167 of σ(S) domain 2 and that G282V substitution did not directly affect Crl binding. However, this substitution drastically reduced the ability of σ(S)(Ty19) to bind E in a surface plasmon resonance assay, a defect partially rescued by Crl. The modeled structure of the Eσ(S) holoenzyme suggested that substitution G282V could directly disrupt a favorable interaction between σ(S) and E. The rpoS(Ty19) allele conferred a competitive fitness when the bacterial population was wild type for crl but was outcompeted in Δcrl populations. Thus, these results indicate that the competitive advantage of the rpoS(Ty19) mutant is dependent on Crl and suggest that crl plays a role in the appearance of rpoS mutants in bacterial populations.

  6. Role of SH3b binding domain in a natural deletion mutant of Kayvirus endolysin LysF1 with a broad range of lytic activity.

    Science.gov (United States)

    Benešík, Martin; Nováček, Jiří; Janda, Lubomír; Dopitová, Radka; Pernisová, Markéta; Melková, Kateřina; Tišáková, Lenka; Doškař, Jiří; Žídek, Lukáš; Hejátko, Jan; Pantůček, Roman

    2018-02-01

    The spontaneous host-range mutants 812F1 and K1/420 are derived from polyvalent phage 812 that is almost identical to phage K, belonging to family Myoviridae and genus Kayvirus. Phage K1/420 is used for the phage therapy of staphylococcal infections. Endolysin of these mutants designated LysF1, consisting of an N-terminal cysteine-histidine-dependent aminohydrolase/peptidase (CHAP) domain and C-terminal SH3b cell wall-binding domain, has deleted middle amidase domain compared to wild-type endolysin. In this work, LysF1 and both its domains were prepared as recombinant proteins and their function was analyzed. LysF1 had an antimicrobial effect on 31 Staphylococcus species of the 43 tested. SH3b domain influenced antimicrobial activity of LysF1, since the lytic activity of the truncated variant containing the CHAP domain alone was decreased. The results of a co-sedimentation assay of SH3b domain showed that it was able to bind to three types of purified staphylococcal peptidoglycan 11.2, 11.3, and 11.8 that differ in their peptide bridge, but also to the peptidoglycan type 11.5 of Streptococcus uberis, and this capability was verified in vivo using the fusion protein with GFP and fluorescence microscopy. Using several different approaches, including NMR, we have not confirmed the previously proposed interaction of the SH3b domain with the pentaglycine bridge in the bacterial cell wall. The new naturally raised deletion mutant endolysin LysF1 is smaller than LysK, has a broad lytic spectrum, and therefore is an appropriate enzyme for practical use. The binding spectrum of SH3b domain covering all known staphylococcal peptidoglycan types is a promising feature for creating new chimeolysins by combining it with more effective catalytic domains.

  7. [3H] dihydrostreptomycin accumulation and binding to ribosomes in Rhizobium mutants with different levels of streptomycin resistance.

    Science.gov (United States)

    Zelazna-Kowalska, I

    1977-10-01

    Rhizobium trifolii B1, a symbiotic nitrogen fixer, is sensitive to streptomycin (10 microgram/ml) and spontaneously produces spheroplast-like forms during cultivation. Streptomycin-resistant mutants selected with high doses of antibiotic (1,000 microgram/ml) showed pleiotropic changes, including loss of spheroplast formation and infectivity to plants, whereas mutants selected with low doses of streptomycin (10 to 100 microgram/ml) retained properties of parent strain B1 (I. Zelazna-Kowalska, Acta Microbiol. Pol., in press). The present studies revealed that strain B1 and its mutant with a high level of streptomycin resistance, B1 strH, accumulated the antibiotic at similar rates. Mutant B1 strL, with a low level of streptomycin resistance (up to 100 microgram/ml), accumulated the antibiotic at a lower rate. Ribosomes isolated from strains B1 and B2 strL bound [3H]dihydrostreptomycin, whereas those from strain B1 strH did not. These observations indicate that, in R. trifolii B1, mutation to a high level of streptomycin resistance affects ribosomal structure, whereas low-level resistance involves a change in membrane permeability.

  8. nr3c1 null mutant zebrafish are viable and reveal DNA-binding-independent activities of the glucocorticoid receptor.

    Science.gov (United States)

    Facchinello, N; Skobo, T; Meneghetti, G; Colletti, E; Dinarello, A; Tiso, N; Costa, R; Gioacchini, G; Carnevali, O; Argenton, F; Colombo, L; Dalla Valle, L

    2017-06-29

    Glucocorticoids (GCs) play important roles in developmental and physiological processes through the transcriptional activity of their cognate receptor (Gr). Using CRISPR/Cas9 technology, we established a zebrafish null Gr mutant line and compared its phenotypes with wild type and a zebrafish line with partially silenced gr (gr s357/s357 ). Homozygous gr -/- larvae are morphologically inconspicuous and, in contrast to GR -/- knockout mice, viable through adulthood, although with reduced fitness and early life survival. Mutants gr -/- are fertile, but their reproductive capabilities fall at around 10 months of age, when, together with cardiac and intestinal abnormalities already visible at earlier stages, increased fat deposits are also observed. Mutants show higher levels of whole-body cortisol associated with overstimulated basal levels of crh and pomca transcripts along the HPI axis, which is unresponsive to a mechanical stressor. Transcriptional activity linked to immune response is also hampered in the gr -/- line: after intestinal damage by dextran sodium sulphate exposure, there are neither inflammatory nor anti-inflammatory cytokine gene responses, substantiating the hypothesis of a dual-action of the GC-GR complex on the immune system. Hence, the zebrafish gr mutant line appears as a useful tool to investigate Gr functions in an integrated in vivo model.

  9. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  10. An attenuated Shigella mutant lacking the RNA-binding protein Hfq provides cross-protection against Shigella strains of broad serotype.

    Science.gov (United States)

    Mitobe, Jiro; Sinha, Ritam; Mitra, Soma; Nag, Dhrubajyoti; Saito, Noriko; Shimuta, Ken; Koizumi, Nobuo; Koley, Hemanta

    2017-07-01

    Few live attenuated vaccines protect against multiple serotypes of bacterial pathogen because host serotype-specific immune responses are limited to the serotype present in the vaccine strain. Here, immunization with a mutant of Shigella flexneri 2a protected guinea pigs against subsequent infection by S. dysenteriae type 1 and S. sonnei strains. This deletion mutant lacked the RNA-binding protein Hfq leading to increased expression of the type III secretion system via loss of regulation, resulting in attenuation of cell viability through repression of stress response sigma factors. Such increased antigen production and simultaneous attenuation were expected to elicit protective immunity against Shigella strains of heterologous serotypes. Thus, the vaccine potential of this mutant was tested in two guinea pig models of shigellosis. Animals vaccinated in the left eye showed fewer symptoms upon subsequent challenge via the right eye, and even survived subsequent intestinal challenge. In addition, oral vaccination effectively induced production of immunoglobulins without severe side effects, again protecting all animals against subsequent intestinal challenge with S. dysenteriae type 1 or S. sonnei strains. Antibodies against common virulence proteins and the O-antigen of S. flexneri 2a were detected by immunofluorescence microscopy. Reaction of antibodies with various strains, including enteroinvasive Escherichia coli, suggested that common virulence proteins induced protective immunity against a range of serotypes. Therefore, vaccination is expected to cover not only the most prevalent serotypes of S. sonnei and S. flexneri 2a, but also various Shigella strains, including S. dysenteriae type 1, which produces Shiga toxin.

  11. Usf1, a suppressor of the circadian Clock mutant, reveals the nature of the DNA-binding of the CLOCK:BMAL1 complex in mice

    Science.gov (United States)

    Shimomura, Kazuhiro; Kumar, Vivek; Koike, Nobuya; Kim, Tae-Kyung; Chong, Jason; Buhr, Ethan D; Whiteley, Andrew R; Low, Sharon S; Omura, Chiaki; Fenner, Deborah; Owens, Joseph R; Richards, Marc; Yoo, Seung-Hee; Hong, Hee-Kyung; Vitaterna, Martha H; Bass, Joseph; Pletcher, Mathew T; Wiltshire, Tim; Hogenesch, John; Lowrey, Phillip L; Takahashi, Joseph S

    2013-01-01

    Genetic and molecular approaches have been critical for elucidating the mechanism of the mammalian circadian clock. Here, we demonstrate that the ClockΔ19 mutant behavioral phenotype is significantly modified by mouse strain genetic background. We map a suppressor of the ClockΔ19 mutation to a ∼900 kb interval on mouse chromosome 1 and identify the transcription factor, Usf1, as the responsible gene. A SNP in the promoter of Usf1 causes elevation of its transcript and protein in strains that suppress the Clock mutant phenotype. USF1 competes with the CLOCK:BMAL1 complex for binding to E-box sites in target genes. Saturation binding experiments demonstrate reduced affinity of the CLOCKΔ19:BMAL1 complex for E-box sites, thereby permitting increased USF1 occupancy on a genome-wide basis. We propose that USF1 is an important modulator of molecular and behavioral circadian rhythms in mammals. DOI: http://dx.doi.org/10.7554/eLife.00426.001 PMID:23580255

  12. Four novel FBN1 mutations: Significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Dietz, H.C.; McIntosh, I.; Pyeritz, R.E.; Francomano, C.A. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)); Sakai, L.Y.; Corson, G.M.; Chalberg, S.C. (Oregon Health Sciences Univ., Portland (United States))

    1993-08-01

    Defects of fibrillin (FBN1), a glycoprotein component of the extracellular microfibril, cause Marfan syndrome. This disorder is characterized by marked inter- and intrafamilial variation in phenotypic severity. To understand the molecular basis for this clinical observation, the authors have screened the fibrillin gene (FBN1) on chromosome 15, including the newly cloned 5[prime] coding sequence, for disease-producing alterations in a panel of patients with a wide range of manifestations and clinical severity. All the missense mutations identified to date, including two novel mutations discussed here, are associated with classic and moderate to severe disease and occur at residues with putative significance for calcium binding to epidermal growth factor (EGF)-like domains. In contrast, two new mutations that create premature signals for termination of translation of mRNA and are associated with reduction in the amount of mutant allele transcript produce a range of phenotypic severity. The patient with the lowest amount of mutant transcript has the mildest disease. These data support a role for altered calcium binding to EGF-like domains in the pathogenesis of Marfan syndrome and suggest a dominant negative mechanism for the pathogenesis of this disorder. 26 refs., 6 figs., 1 tab.

  13. Identification of a 34 kDa protein altered in the LF-1 mutant as the herbicide-binding D1 protein of photosystem II

    International Nuclear Information System (INIS)

    Metz, J.; Pakrasi, H.; Seibert, M.; Arntzen, C.

    1986-01-01

    The LF-1 mutant of Scenedesmus has a complete block on the oxidizing side of its PSII reaction center. However, the reaction center as well as the reducing side of PSII is fully functional in this mutant. Compared to the wildtype (WT) the only detected protein difference in the PSII complex of LF-1 is the change in mobility of a 34 kDa protein to 36 kDa. This protein has been implicated to have a major role in Mn-binding and water-oxidation. The authors have recently shown that photoaffinity labeling of thylakoids with azido-[ 14 C]-atrazine tags the 34 kDa protein in WT and the 36 kDa protein in LF-1. It has been shown that the azido-atrazine labeled protein, called D1, functions in herbicide binding and Q/sub A/ to Q/sub B/ electron transfer on the reducing side of PSII. Polyclonal antibodies directed against the D1 protein of Amaranthus hybridus (Ohad, et al., EMBOJ 1985) were found to recognize the Scenedesmus 34 kDa (WT) and 36 kDa (LF-1) proteins. The implied dual function for the D1 protein on the reducing as well as the oxidizing side of PSII reaction center will be discussed

  14. Hyperactivity of the Arabidopsis cryptochrome (cry1) L407F mutant is caused by a structural alteration close to the cry1 ATP-binding site.

    Science.gov (United States)

    Orth, Christian; Niemann, Nils; Hennig, Lars; Essen, Lars-Oliver; Batschauer, Alfred

    2017-08-04

    Plant cryptochromes (cry) act as UV-A/blue light receptors. The prototype, Arabidopsis thaliana cry1, regulates several light responses during the life cycle, including de-etiolation, and is also involved in regulating flowering time. The cry1 photocycle is initiated by light absorption by its FAD chromophore, which is most likely fully oxidized (FAD ox ) in the dark state and photoreduced to the neutral flavin semiquinone (FADH°) in its lit state. Cryptochromes lack the DNA-repair activity of the closely related DNA photolyases, but they retain the ability to bind nucleotides such as ATP. The previously characterized L407F mutant allele of Arabidopsis cry1 is biologically hyperactive and seems to mimic the ATP-bound state of cry1, but the reason for this phenotypic change is unclear. Here, we show that cry1 L407F can still bind ATP, has less pronounced photoreduction and formation of FADH° than wild-type cry1, and has a dark reversion rate 1.7 times lower than that of the wild type. The hyperactivity of cry1 L407F is not related to a higher FADH° occupancy of the photoreceptor but is caused by a structural alteration close to the ATP-binding site. Moreover, we show that ATP binds to cry1 in both the dark and the lit states. This binding was not affected by cry1's C-terminal extension, which is important for signal transduction. Finally, we show that a recently discovered chemical inhibitor of cry1, 3-bromo-7-nitroindazole, competes for ATP binding and thereby diminishes FADH° formation, which demonstrates that both processes are important for cry1 function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. An ethylenamine inhibitor binds tightly to both wild type and mutant HIV-1 proteases. Structure and energy study

    Czech Academy of Sciences Publication Activity Database

    Skálová, Tereza; Hašek, Jindřich; Dohnálek, Jan; Petroková, Hana; Buchtelová, Eva; Dušková, Jarmila; Souček, Milan; Majer, Pavel; Kondrová, Taťána; Konvalinka, Jan

    2003-01-01

    Roč. 46, č. 9 (2003), s. 1636-1644 ISSN 0022-2623 R&D Projects: GA AV ČR IAA4050811; GA AV ČR KJB4050312; GA ČR GV203/98/K023; GA ČR GA204/00/P091; GA ČR GA203/00/D117; GA MZd NI6339 Institutional research plan: CEZ:AV0Z4050913; CEZ:AV0Z4055905 Keywords : mutant HIV-1 protease * ethylenamine inhibitor * structure Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.820, year: 2003

  16. A dominant-negative mutant of Max that inhibits sequence-specific DNA binding by Myc proteins

    NARCIS (Netherlands)

    Billaud, Marc; Isselbacher, Kurt J.; Bernards, R.A.

    1993-01-01

    Myc proteins are basic helix-loop-helix/ leucine-zipper proteins that bind to specific DNA sequences. In vivo, Myc proteins have been found associated with Max, another basic helix4oop-helix/leucine-zipper protein. However, it is not known to what extent the dimerization of Myc with Max is

  17. An attenuated Shigella mutant lacking the RNA-binding protein Hfq provides cross-protection against Shigella strains of broad serotype.

    Directory of Open Access Journals (Sweden)

    Jiro Mitobe

    2017-07-01

    Full Text Available Few live attenuated vaccines protect against multiple serotypes of bacterial pathogen because host serotype-specific immune responses are limited to the serotype present in the vaccine strain. Here, immunization with a mutant of Shigella flexneri 2a protected guinea pigs against subsequent infection by S. dysenteriae type 1 and S. sonnei strains. This deletion mutant lacked the RNA-binding protein Hfq leading to increased expression of the type III secretion system via loss of regulation, resulting in attenuation of cell viability through repression of stress response sigma factors. Such increased antigen production and simultaneous attenuation were expected to elicit protective immunity against Shigella strains of heterologous serotypes. Thus, the vaccine potential of this mutant was tested in two guinea pig models of shigellosis. Animals vaccinated in the left eye showed fewer symptoms upon subsequent challenge via the right eye, and even survived subsequent intestinal challenge. In addition, oral vaccination effectively induced production of immunoglobulins without severe side effects, again protecting all animals against subsequent intestinal challenge with S. dysenteriae type 1 or S. sonnei strains. Antibodies against common virulence proteins and the O-antigen of S. flexneri 2a were detected by immunofluorescence microscopy. Reaction of antibodies with various strains, including enteroinvasive Escherichia coli, suggested that common virulence proteins induced protective immunity against a range of serotypes. Therefore, vaccination is expected to cover not only the most prevalent serotypes of S. sonnei and S. flexneri 2a, but also various Shigella strains, including S. dysenteriae type 1, which produces Shiga toxin.

  18. Structure-Function Analysis of Friedreich's Ataxia Mutants Reveals Determinants of Frataxin Binding and Activation of the Fe-S Assembly Complex

    Energy Technology Data Exchange (ETDEWEB)

    Bridwell-Rabb, Jennifer; Winn, Andrew M; Barondeau, David P [TAM

    2012-08-01

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease associated with the loss of function of the protein frataxin (FXN) that results from low FXN levels due to a GAA triplet repeat expansion or, occasionally, from missense mutations in the FXN gene. Here biochemical and structural properties of FXN variants, including three FRDA missense mutations (N146K, Q148R, and R165C) and three related mutants (N146A, Q148G, and Q153A), were determined in an effort to understand the structural basis for the loss of function. In vitro assays revealed that although the three FRDA missense mutations exhibited similar losses of cysteine desulfurase and Fe-S cluster assembly activities, the causes for these activation defects were distinct. The R165C variant exhibited a kcat/KM higher than that of native FXN but weak binding to the NFS1, ISD11, and ISCU2 (SDU) complex, whereas the Q148R variant exhibited the lowest kcat/KM of the six tested FXN variants and only a modest binding deficiency. The order of the FXN binding affinities for the SDU Fe-S assembly complex was as follows: FXN > Q148R > N146A > Q148G > N146K > Q153A > R165C. Four different classes of FXN variants were identified on the basis of their biochemical properties. Together, these structure-function studies reveal determinants for the binding and allosteric activation of the Fe-S assembly complex and provide insight into how FRDA missense mutations are functionally compromised.

  19. Rescue of Na+ and H+ binding in Na+,K+-ATPase M8 aspartate mutants by secondary mutation

    DEFF Research Database (Denmark)

    Holm, Rikke; Einholm, Anja P.; Andersen, Jens Peter

    A mutation replacing the aspartate in transmembrane segment M8 in the a3-isoform of Na,K-ATPase with asparagine has been found in patients with rapid-onset dystonia parkinsonism or alternating hemiplegia of childhood. This aspartate may be a critical Na+ coordinating residue, but the crystal......-isoforms of Na,K-ATPase, and much smaller effects were seen for other mutations to the M8 aspartate, which were less disruptive of Na+ binding than mutations to other residues related to Na+ site III. The D928 (rat a1 numbering) mutations strongly diminished the cooperativity of Na+ binding. Moreover the p......H optimum of Na,K-ATPase activity was left-shifted, again with D928N being most disruptive. The reduced affinity for activating Na+ and for inhibitory protons, caused by D928N and D928A mutations, could be rescued by introduction of an additional mutation of a glutamate located far away from D928....

  20. The capacity of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette transporters to form biofilms and comparison with the wild type

    Directory of Open Access Journals (Sweden)

    Marina Ceruso

    2014-02-01

    Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.

  1. Role of IGF-binding protein 3 in the resistance of EGFR mutant lung cancer cells to EGFR-tyrosine kinase inhibitors.

    Directory of Open Access Journals (Sweden)

    Yun Jung Choi

    Full Text Available Most patients treated with EGFR-tyrosine kinase inhibitors (EGFR-TKIs eventually develop acquired resistance. Loss of expression of insulin-like growth factor (IGF-binding protein-3 (IGFBP-3 has been suggested as a possible mechanism of resistance to EGFR-TKIs in the A431 and HN11 cell lines. Here, we investigated IGFBP-3 expression in two EGFR mutant lung cancer cell lines with resistance to EGFR-TKIs and examined the value of serum IGFBP-3 level as a marker of resistance. The effect of the induction or suppression of IGFBP-3 expression on resistance was also evaluated. HCC827 sublines with resistance to gefitinib (HCC827/GR and erlotinib (HCC827/ER were established. Loss of IGFBP-3 expression was detected by Western blotting in both cell lines without changes in transcriptional activity, and ELISA showed significantly lower amounts of secreted IGFBP-3 in the culture media of the mutant cell lines than in that of the parental line. Despite the loss of IGFBP-3 expression, IGFR signalling activity remained unchanged. Forced expression of IGFBP-3 by adenovirus-mediated transfection or recombinant IGFBP-3 slightly increased the growth-inhibitory and apoptotic effects of EGFR-TKIs, whereas suppression of IGFBP-3 did not affect sensitivity to EGFR-TKI. Serum IGFBP-3 levels measured by ELISA before and after the development of EGFR-TKI resistance in 20 patients showed no significant changes (1815.3±94.6 ng/mL before treatment vs. 1778.9±87.8 ng/mL after EGFR-TKI resistance. In summary, although IGFBP-3 downregulation is associated with the acquisition of resistance to EGFR-TKIs regardless of the mechanism, its effect on resistance was not significant, indicating that IGFBP-3 may not play an important role in resistance to EGFR-TKIs and serum IGFBP-3 level is not a reliable indicator of resistance.

  2. Client Proteins and Small Molecule Inhibitors Display Distinct Binding Preferences for Constitutive and Stress-Induced HSP90 Isoforms and Their Conformationally Restricted Mutants.

    Directory of Open Access Journals (Sweden)

    Thomas L Prince

    Full Text Available The two cytosolic/nuclear isoforms of the molecular chaperone HSP90, stress-inducible HSP90α and constitutively expressed HSP90β, fold, assemble and maintain the three-dimensional structure of numerous client proteins. Because many HSP90 clients are important in cancer, several HSP90 inhibitors have been evaluated in the clinic. However, little is known concerning possible unique isoform or conformational preferences of either individual HSP90 clients or inhibitors. In this report, we compare the relative interaction strength of both HSP90α and HSP90β with the transcription factors HSF1 and HIF1α, the kinases ERBB2 and MET, the E3-ubiquitin ligases KEAP1 and RHOBTB2, and the HSP90 inhibitors geldanamycin and ganetespib. We observed unexpected differences in relative client and drug preferences for the two HSP90 isoforms, with HSP90α binding each client protein with greater apparent affinity compared to HSP90β, while HSP90β bound each inhibitor with greater relative interaction strength compared to HSP90α. Stable HSP90 interaction was associated with reduced client activity. Using a defined set of HSP90 conformational mutants, we found that some clients interact strongly with a single, ATP-stabilized HSP90 conformation, only transiently populated during the dynamic HSP90 chaperone cycle, while other clients interact equally with multiple HSP90 conformations. These data suggest different functional requirements among HSP90 clientele that, for some clients, are likely to be ATP-independent. Lastly, the two inhibitors examined, although sharing the same binding site, were differentially able to access distinct HSP90 conformational states.

  3. Involvement of the Eukaryote-Like Kinase-Phosphatase System and a Protein That Interacts with Penicillin-Binding Protein 5 in Emergence of Cephalosporin Resistance in Cephalosporin-Sensitive Class A Penicillin-Binding Protein Mutants in Enterococcus faecium

    Directory of Open Access Journals (Sweden)

    Charlene Desbonnet

    2016-04-01

    Full Text Available The intrinsic resistance of Enterococcus faecium to ceftriaxone and cefepime (here referred to as “cephalosporins” is reliant on the presence of class A penicillin-binding proteins (Pbps PbpF and PonA. Mutants lacking these Pbps exhibit cephalosporin susceptibility that is reversible by exposure to penicillin and by selection on cephalosporin-containing medium. We selected two cephalosporin-resistant mutants (Cro1 and Cro2 of class A Pbp-deficient E. faecium CV598. Genome analysis revealed changes in the serine-threonine kinase Stk in Cro1 and a truncation in the associated phosphatase StpA in Cro2 whose respective involvements in resistance were confirmed in separate complementation experiments. In an additional effort to identify proteins linked to cephalosporin resistance, we performed tandem affinity purification using Pbp5 as bait in penicillin-exposed E. faecium; these experiments yielded a protein designated Pbp5-associated protein (P5AP. Transcription of the P5AP gene was increased after exposure to penicillin in wild-type strains and in Cro2 and suppressed in Cro2 complemented with the wild-type stpA. Transformation of class A Pbp-deficient strains with the plasmid-carried P5AP gene conferred cephalosporin resistance. These data suggest that Pbp5-associated cephalosporin resistance in E. faecium devoid of typical class A Pbps is related to the presence of P5AP, whose expression is influenced by the activity of the serine-threonine phosphatase/kinase system.

  4. Involvement of the Eukaryote-Like Kinase-Phosphatase System and a Protein That Interacts with Penicillin-Binding Protein 5 in Emergence of Cephalosporin Resistance in Cephalosporin-Sensitive Class A Penicillin-Binding Protein Mutants in Enterococcus faecium.

    Science.gov (United States)

    Desbonnet, Charlene; Tait-Kamradt, Amelia; Garcia-Solache, Monica; Dunman, Paul; Coleman, Jeffrey; Arthur, Michel; Rice, Louis B

    2016-04-05

    The intrinsic resistance of Enterococcus faecium to ceftriaxone and cefepime (here referred to as "cephalosporins") is reliant on the presence of class A penicillin-binding proteins (Pbps) PbpF and PonA. Mutants lacking these Pbps exhibit cephalosporin susceptibility that is reversible by exposure to penicillin and by selection on cephalosporin-containing medium. We selected two cephalosporin-resistant mutants (Cro1 and Cro2) of class A Pbp-deficient E. faecium CV598. Genome analysis revealed changes in the serine-threonine kinase Stk in Cro1 and a truncation in the associated phosphatase StpA in Cro2 whose respective involvements in resistance were confirmed in separate complementation experiments. In an additional effort to identify proteins linked to cephalosporin resistance, we performed tandem affinity purification using Pbp5 as bait in penicillin-exposed E. faecium; these experiments yielded a protein designated Pbp5-associated protein (P5AP). Transcription of the P5AP gene was increased after exposure to penicillin in wild-type strains and in Cro2 and suppressed in Cro2 complemented with the wild-type stpA Transformation of class A Pbp-deficient strains with the plasmid-carried P5AP gene conferred cephalosporin resistance. These data suggest that Pbp5-associated cephalosporin resistance in E. faecium devoid of typical class A Pbps is related to the presence of P5AP, whose expression is influenced by the activity of the serine-threonine phosphatase/kinase system. β-Lactam antibiotics remain our most effective therapies against susceptible Gram-positive bacteria. The intrinsic resistance of Enterococcus faecium to β-lactams, particularly to cephalosporins, therefore represents a major limitation of therapy. Although the primary mechanism of resistance to β-lactams in E. faecium is the presence of low-affinity monofunctional transpeptidase (class B) penicillin-binding protein Pbp5, the interaction of Pbp5 with other proteins is fundamental to maintain a

  5. Structural and functional consequences of binding site mutations in transferrin: crystal structures of the Asp63Glu and Arg124Ala mutants of the N-lobe of human transferrin.

    Science.gov (United States)

    Baker, Heather M; He, Qing-Yu; Briggs, Sara K; Mason, Anne B; Baker, Edward N

    2003-06-17

    Human transferrin is a serum protein whose function is to bind Fe(3+) with very high affinity and transport it to cells, for delivery by receptor-mediated endocytosis. Structurally, the transferrin molecule is folded into two globular lobes, representing its N-terminal and C-terminal halves, with each lobe possessing a high-affinity iron binding site, in a cleft between two domains. Central to function is a highly conserved set of iron ligands, including an aspartate residue (Asp63 in the N-lobe) that also hydrogen bonds between the two domains and an arginine residue (Arg124 in the N-lobe) that binds an iron-bound carbonate ion. To further probe the roles of these residues, we have determined the crystal structures of the D63E and R124A mutants of the N-terminal half-molecule of human transferrin. The structure of the D63E mutant, determined at 1.9 A resolution (R = 0.245, R(free) = 0.261), showed that the carboxyl group still binds to iron despite the larger size of the Glu side chain, with some slight rearrangement of the first turn of alpha-helix residues 63-72, to which it is attached. The structure of the R124A mutant, determined at 2.4 A resolution (R = 0.219, R(free) = 0.288), shows that the loss of the arginine side chain results in a 0.3 A displacement of the carbonate ion, and an accompanying movement of the iron atom. In both mutants, the iron coordination is changed slightly, the principal change being in each case a lengthening of the Fe-N(His249) bond. Both mutants also release iron more readily than the wild type, kinetically and in terms of acid lability of iron binding. We attribute this to more facile protonation of the synergistically bound carbonate ion, in the case of R124A, and to strain resulting from the accommodation of the larger Glu side chain, in the case of D63E. In both cases, the weakened Fe-N(His) bond may also contribute, consistent with protonation of the His ligand being an early intermediate step in iron release, following the

  6. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

    Science.gov (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

    2008-09-01

    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  7. In Silico Molecular Modeling and Docking Studies on Novel Mutants (E229V, H225P and D230C) of the Nucleotide-Binding Domain of Homo sapiens Hsp70.

    Science.gov (United States)

    Elengoe, Asita; Hamdan, Salehhuddin

    2017-12-01

    In this study, we explored the possibility of determining the synergistic interactions between nucleotide-binding domain (NBD) of Homo sapiens heat-shock 70 kDa protein (Hsp70) and E1A 32 kDa of adenovirus serotype 5 motif (PNLVP) in the efficiency of killing of tumor cells in cancer treatment. At present, the protein interaction between NBD and PNLVP motif is still unknown, but believed to enhance the rate of virus replication in tumor cells. Three mutant models (E229V, H225P and D230C) were built and simulated, and their interactions with PNLVP motif were studied. The PNLVP motif showed the binding energy and intermolecular energy values with the novel E229V mutant at -7.32 and -11.2 kcal/mol. The E229V mutant had the highest number of hydrogen bonds (7). Based on the root mean square deviation, root mean square fluctuation, hydrogen bonds, salt bridge, secondary structure, surface-accessible solvent area, potential energy and distance matrices analyses, it was proved that the E229V had the strongest and most stable interaction with the PNLVP motif among all the four protein-ligand complex structures. The knowledge of this protein-ligand complex model would help in designing Hsp70 structure-based drug for cancer therapy.

  8. ATM mutants

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. ATM mutants. ATM (Ataxia Telangiectasia Mutated). AT2BE and AT5B1 cells – fibroblast cell lines from Ataxia telangiectasia patients. Deletion mutants expressing truncated ATM protein which is inactive. Have been used in studies looking at the role of ATM in DNA damage ...

  9. Characterization of the Escherichia coli prsA1-encoded mutant phosphoribosylpyrophosphate synthetase identifies a divalent cation-nucleotide binding site

    DEFF Research Database (Denmark)

    Bower, Stanley G.; Harlow, Kenneth W.; Switzer, Robert L.

    1989-01-01

    by chemical determination of the amino acid sequence of a tryptic peptide derived from the purified mutant enzyme. The mutation lies at the N-terminal end of a 16 residue sequence that is highly conserved in E. coli, Bacillus subtilis, and rat PRPP synthetases and has the following consensus sequence......The prsA1 allele, specifying a mutant Escherichia coli phosphoribosylpyrophosphate (PRPP) synthetase, has been cloned. The mutation was shown by nucleotide sequence analysis to result from substitution of Asp-128 (GAT) in the wild type by Ala (GCT) in prsA1. This alteration was confirmed...

  10. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Characterization of the Escherichia coli prsA1-encoded mutant phosphoribosylpyrophosphate synthetase identifies a divalent cation-nucleotide binding site

    DEFF Research Database (Denmark)

    Bower, Stanley G.; Harlow, Kenneth W.; Switzer, Robert L.

    1989-01-01

    -fold lower affinity for Ca2+, as judged by the ability of Ca2+ to inhibit the reaction in the presence of 10 mM Mg2+. Wild type PRPP synthetase is subject to product inhibition by AMP, but AMP inhibition of the prsA1 mutant enzyme could not be detected. It has been previously proposed that a divalent...

  12. Mutant p53 is a transcriptional co-factor that binds to G-rich regulatory regions of active genes and generates transcriptional plasticity

    Czech Academy of Sciences Publication Activity Database

    Quante, T.; Otto, B.; Brázdová, Marie; Kejnovská, Iva; Deppert, W.; Tolstonog, G.V.

    2012-01-01

    Roč. 11, č. 17 (2012), s. 3290-3303 ISSN 1538-4101 R&D Projects: GA ČR(CZ) GAP301/10/2370 Institutional research plan: CEZ:AV0Z50040702 Keywords : mutant p53 * transcription * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 5.243, year: 2012

  13. DESIGNER LEAN PRODUCTION PROCESSES AND 5S

    OpenAIRE

    Amalia Venera Todorut; Doru Cîrnu

    2010-01-01

    One of the challenges faced by businesses today is the combined pressure to reduce price and to provide an increased a variety of options at lower volumes. This paper will present what we call 5S method as part of the Lean philosophy. It will explain how to introduce this concept and how can it be adapted in our institutions. 5 S is a Japanese concept. It is a methodical approach for eliminating time and material waste. The reality is that a crowded and unorganized workplace is filled with wa...

  14. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  15. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  16. Spontaneous nisin-resistant Listeria monocytogenes mutants with increased expression of a putative penicillin-binding protein and their sensitivity to various antibiotics

    DEFF Research Database (Denmark)

    Gravesen, Anne; Sorensen, K.; Aarestrup, Frank Møller

    2001-01-01

    A concern regarding the use of bacteriocins, as for example the lantibiotic nisin, for biopreservation of certain food products is the possibility of resistance development and potential cross-resistance to antibiotics in the target organism. The genetic basis for nisin resistance development...... is as yet unknown. We analyzed changes in gene expression following nisin resistance development in Listeria monocytogenes 412 by restriction fragment differential display. The mutant had increased expression of a protein with strong homology to the glycosyltransferase domain of high...... a prevalent nisin resistance mechanism under the employed isolation conditions. Increased expression of the putative PBP may affect the cell wall composition and thereby alter the sensitivity to cell wall-targeting compounds, The mutants had an isolate-specific increase in sensitivity to different beta...

  17. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  18. A KAS2 cDNA complements the phenotypes of the Arabidopsis fab1 mutant that differs in a single residue bordering the substrate binding pocket

    DEFF Research Database (Denmark)

    Carlsson, A.S.; LaBrie, S.T.; Kinney, A.J.

    2002-01-01

    in Arabidopsis KAS2 that results in a Leu337Phe substitution. The Leu337 residue is conserved among plant and bacterial KAS proteins, and in the crystal structures of E. coli KAS I and KAS II, this leucine abuts a phenylalanine whose imidazole ring extends into the substrate binding cavity causing the fatty acid...... chain to bend. For functional analysis the equivalent Leu207Phe mutation was introduced into the fabB gene encoding the E. coli KAS I enzyme. Compared to wild-type, the Leu207Phe protein showed a 10-fold decrease in binding affinity for the fatty acid substrate, exhibited a modified behavior during size...

  19. Frataxin directly stimulates mitochondrial cysteine desulfurase by exposing substrate-binding sites, and a mutant Fe-S cluster scaffold protein with frataxin-bypassing ability acts similarly.

    Science.gov (United States)

    Pandey, Alok; Gordon, Donna M; Pain, Jayashree; Stemmler, Timothy L; Dancis, Andrew; Pain, Debkumar

    2013-12-27

    For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the "buried" substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation.

  20. Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant

    Energy Technology Data Exchange (ETDEWEB)

    Atwell, Shane; Brouillette, Christie G.; Conners, Kris; Emtage, Spencer; Gheyi, Tarun; Guggino, William B.; Hendle, Jorg; Hunt, John F.; Lewis, Hal A.; Lu, Frances; Protasevich, Irina I.; Rodgers, Logan A.; Romero, Rich; Wasserman, Stephen R.; Weber, Patricia C.; Wetmore, Diana; Zhang, Feiyu F.; Zhao, Xun (Cystic); (UAB); (JHU); (Columbia); (Lilly)

    2010-04-26

    Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646({Delta}405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-{angstrom} resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The {Delta}F508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

  1. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase.

    Science.gov (United States)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-11-01

    Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2-β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  2. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    in 4.5 S RNA, a dramatic loss in protein synthesis activity, and eventual cell death. Tagging of the chromosomal ffs region with a kanamycin-resistance gene allowed mapping of the 4.5 S RNA gene. Results from this analysis place ffs near lon at approximately ten minutes on the E. coli linkage map.......The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...

  3. Specific transcription of an Acanthamoeba castellanii 5S RNA gene in homologous nuclear extracts.

    Science.gov (United States)

    Zwick, M G; Imboden, M A; Paule, M R

    1991-01-01

    An RNA polymerase III in vitro transcription system has been developed from the protist Acanthamoeba castellanii. The system is dependent on a cloned 5S RNA gene and utilizes a nuclear extract which contains all the necessary protein components. The system is assembled from completely homologous components. Primer extension and RNA sequencing analysis confirm that the in vitro 5S RNA transcript is identical to the 5S RNA isolated from cells. The transcription complex forms unusually rapidly on the 5S RNA gene and is stable to challenge by excess competitor templates. Several 5' deletion mutants were constructed and indicate that the region upstream of -33 is dispensable. Deletion to +16 show the region between -33 and +16 to be required for transcription, a region outside the canonical internal control region. Images PMID:2027775

  4. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  5. Binding events of (S )-N -(3-oxo-octanoyl)-homoserine lactone with agrobacterium tumefaciens mutant cells studied by saturation transfer difference NMR

    International Nuclear Information System (INIS)

    Cabeca, Luis Fernando; Pomini, Armando Mateus; Cruz, Pedro Luiz R.; Marsaioli, Anita J.

    2011-01-01

    Quorum-sensing is a widely studied communication phenomenon in bacteria, which involves the production and detection of signaling substances in relation with cell density and colony behavior. Herein, the membrane binding interactions of the signal (S)-N-(3-oxo-octanoyl)-HSL with A. tumefaciens NTL4(pZLR4) cells were studied using saturation transfer difference NMR spectroscopy (STD-NMR). The substance epitope map was obtained showing that the hydrophobic acyl chain is the most important interacting site for the signal and the cell membrane. Results were interpreted upon comparisons with a simpler system, using liposomes as membrane models. Some insights on the use of b-cyclodextrin as acyl-HSL carrier were also provided. (author)

  6. Binding events of (S )-N -(3-oxo-octanoyl)-homoserine lactone with agrobacterium tumefaciens mutant cells studied by saturation transfer difference NMR

    Energy Technology Data Exchange (ETDEWEB)

    Cabeca, Luis Fernando; Pomini, Armando Mateus; Cruz, Pedro Luiz R.; Marsaioli, Anita J. [University of Campinas (UNICAMP), SP (Brazil). Chemistry Inst.

    2011-07-01

    Quorum-sensing is a widely studied communication phenomenon in bacteria, which involves the production and detection of signaling substances in relation with cell density and colony behavior. Herein, the membrane binding interactions of the signal (S)-N-(3-oxo-octanoyl)-HSL with A. tumefaciens NTL4(pZLR4) cells were studied using saturation transfer difference NMR spectroscopy (STD-NMR). The substance epitope map was obtained showing that the hydrophobic acyl chain is the most important interacting site for the signal and the cell membrane. Results were interpreted upon comparisons with a simpler system, using liposomes as membrane models. Some insights on the use of b-cyclodextrin as acyl-HSL carrier were also provided. (author)

  7. Amyotrophic lateral sclerosis mutant vesicle-associated membrane protein-associated protein-B transgenic mice develop TAR-DNA-binding protein-43 pathology.

    LENUS (Irish Health Repository)

    Tudor, E L

    2010-05-19

    Cytoplasmic ubiquitin-positive inclusions containing TAR-DNA-binding protein-43 (TDP-43) within motor neurons are the hallmark pathology of sporadic amyotrophic lateral sclerosis (ALS). TDP-43 is a nuclear protein and the mechanisms by which it becomes mislocalized and aggregated in ALS are not properly understood. A mutation in the vesicle-associated membrane protein-associated protein-B (VAPB) involving a proline to serine substitution at position 56 (VAPBP56S) is the cause of familial ALS type-8. To gain insight into the molecular mechanisms by which VAPBP56S induces disease, we created transgenic mice that express either wild-type VAPB (VAPBwt) or VAPBP56S in the nervous system. Analyses of both sets of mice revealed no overt motor phenotype nor alterations in survival. However, VAPBP56S but not VAPBwt transgenic mice develop cytoplasmic TDP-43 accumulations within spinal cord motor neurons that were first detected at 18 months of age. Our results suggest a link between abnormal VAPBP56S function and TDP-43 mislocalization.

  8. Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Moore, P.B.

    1987-01-01

    The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

  9. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    Science.gov (United States)

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  10. Deletion mutants of the Escherichia coli K-12 mannitol permease: dissection of transport-phosphorylation, phospho-exchange, and mannitol-binding activities.

    Science.gov (United States)

    Grisafi, P L; Scholle, A; Sugiyama, J; Briggs, C; Jacobson, G R; Lengeler, J W

    1989-05-01

    We have constructed a series of deletion mutations of the cloned Escherichia coli K-12 mtlA gene, which encodes the mannitol-specific enzyme II of the phosphoenolpyruvate (PEP)-dependent carbohydrate phosphotransferase system. This membrane-bound permease consists of 637 amino acid residues and is responsible for the concomitant transport and phosphorylation of D-mannitol in E. coli. Deletions into the 3' end of mtlA were constructed by exonuclease III digestion. Restriction mapping of the resultant plasmids identified several classes of deletions that lacked approximately 5% to more than 75% of the gene. Immunoblotting experiments revealed that many of these plasmids expressed proteins within the size range predicted by the restriction analyses, and all of these proteins were membrane localized, which demonstrated that none of the C-terminal half of the permease is required for membrane insertion. Functional analyses of the deletion proteins, expressed in an E. coli strain deleted for the chromosomal copy of mtlA, showed that all but one of the strains containing confirmed deletions were inactive in transport and PEP-dependent phosphorylation of mannitol, but deletions removing up to at least 117 amino acid residues from the C terminus of the permease were still active in catalyzing phospho exchange between mannitol 1-phosphate and mannitol. A deletion protein that lacked 240 residues from the C terminus of the permease was inactive in phospho exchange but still bound mannitol with high affinity. These experiments localize sites important for transport and PEP-dependent phosphorylation to the extreme C terminus of the mannitol permease, sites important for phospho exchange to between residues 377 and 519, and sites necessary for mannitol binding to the N-terminal 60% of the molecule. The results are discussed with respect to the fact that the mannitol permease consists of structurally independent N- and C-terminal domains.

  11. Sample (S): SE5_S01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE5_S01 Physcomitrella patens subsp. patens Physcomitrella patens subsp. patens NCB...I taxonomy:145481 Physcomitrella patens subsp. patens are grown on plant culture box filled by 1/2MS culture

  12. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  13. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  14. 5S activities and its application at a sample company

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-20

    Apr 20, 2009 ... Total Productive Maintenance (TPM) targets enabling the machine operators to undertake the maintenance activities and therefore to increase the efficiency of the equipments. It struggles with six great losses decreasing the efficiency of the equipment. 5S, which is the pre-step of TPM, is a systematic ...

  15. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  16. Photocurrent analysis of AgIn5S8 crystal

    Indian Academy of Sciences (India)

    cell applications [13–16]. Impurities and/or oxygen in many crystals play impor- ... literature on the application of solar cells by using AgIn5S8 crystals. Even in this work there is no information about the ..... ther study is certainly required to know how the photoelectric properties are affected by the density and the distribution ...

  17. Photocurrent analysis of AgIn5S8 crystal

    Indian Academy of Sciences (India)

    The photocurrent (PC) spectrum of AgIn 5 S 8 crystal consists of a single peak, which provides to determine the bandgap energy by applying the Moss rule. The temperature dependence of the bandgap energy was alsocalculated. The PC dramatically increased by pre-illumination with light having wavelength ...

  18. Promising rice mutants

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1988-01-01

    Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs

  19. Mutant heterosis in rice

    International Nuclear Information System (INIS)

    1987-01-01

    In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent

  20. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    Energy Technology Data Exchange (ETDEWEB)

    Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: w.n.hunter@dundee.ac.uk [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: w.n.hunter@dundee.ac.uk [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)

    2015-07-28

    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.

  1. Observation of Bs production at the Y(5S) resonance.

    Science.gov (United States)

    Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Bornheim, A; Pappas, S P; Weinstein, A J; Asner, D M; Edwards, K W; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weaver, K M; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Williams, J; Wiss, J; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Maravin, Y; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the Y(5S) resonance. We find 14 candidates consistent with Bs decays into final states with a J/psi or a Ds(*)- . The probability that we have observed a background fluctuation is less than 8 x 10(-10) . We have established that at the energy of the Y(5S) resonance Bs production proceeds predominantly through the creation of Bs*Bs* pairs. We find sigma(e+e- --> Bs*Bs*) = [0.11(-0.03))(+0.04)(stat) +/- 0.02(syst)]nb , and set the following limits: sigma(e+e- --> BsBs)/ sigma(e+ e- --> Bs*Bs*) BsBs*) + sigma(e+e- --> Bs*Bs)]/sigma(e+e- -->Bs*Bs*) < 0.16 (90% C.L.). The mass of the Bs* meson is measured to be M(Bs*) = [5.414+/- 0.001(stat) +/- 0.003(syst)] GeV/c2 .

  2. Mutants of common bean alpha-amylase inhibitor-2 as an approach to investigate binding specificity to alpha-amylases Mutantes do inibidor-2 de alfa-amilase do feijão-comum para investigação da especificidade de ligação a alfa-amilases

    Directory of Open Access Journals (Sweden)

    Maria Cristina Mattar da Silva

    2004-03-01

    Full Text Available Despite the presence of a family of defense proteins, Phaseolus vulgaris can be attacked by bruchid insects resulting in serious damage to stored grains. The two distinct active forms of a-amylase inhibitors, a-AI1 and a-AI2, in P. vulgaris show different specificity toward a-amylases. Zabrotes subfasciatus a-amylase is inhibited by a-AI2 but not by a-AI1. In contrast, porcine a-amylase is inhibited by a-AI1 but not by a-AI2. The objective of this work was to understand the molecular basis of the specificity of two inhibitors in P. vulgaris (a-AI1 and a-AI2 in relation to a-amylases. Mutants of a-AI2 were made and expressed in tobacco plants. The results showed that all the a-AI2 mutant inhibitors lost their activity against the insect a-amylases but none exhibited activity toward the mammalian a-amylase. The replacement of His33 of a-AI2 with the a-AI1-like sequence Ser-Tyr-Asn abolished inhibition of Z. subfasciatus a-amylase. From structural modeling, the conclusion is that the size and complexity of the amylase-inhibitor interface explain why mutation of the N-terminal loop and resultant abolition of Z. subfasciatus a-amylase inhibition are not accompanied by gain of inhibitory activity against porcine a-amylase.Apesar de possuir uma família de proteínas de defesa, o feijão-comum (Phaseolus vulgaris L. pode ser atacado por insetos bruquídeos causando sérios danos aos grãos armazenados. O P. vulgaris possui duas formas ativas de inibidores de a-amilases, denominadas a-AI1 e a-AI2, que apresentam diferentes especificidades em relação às a-amilases. A a-amilase de Zabrotes subfasciatus é inibida por a-AI2 mas não por a-AI1. Em contraste, a a-amilase pancreática de porco é inibida por a-AI1 mas não é por a-AI2. O objetivo deste trabalho foi entender as bases moleculares da especificidade desses inibidores em relação às a-amilases. Para tanto, foram construídos mutantes do a-AI2, os quais foram expressados em plantas de fumo

  3. Frataxin Directly Stimulates Mitochondrial Cysteine Desulfurase by Exposing Substrate-binding Sites, and a Mutant Fe-S Cluster Scaffold Protein with Frataxin-bypassing Ability Acts Similarly*♦

    Science.gov (United States)

    Pandey, Alok; Gordon, Donna M.; Pain, Jayashree; Stemmler, Timothy L.; Dancis, Andrew; Pain, Debkumar

    2013-01-01

    For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the “buried” substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation. PMID:24217246

  4. Productive mutants of niger

    International Nuclear Information System (INIS)

    Misra, R.C.

    2001-01-01

    Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

  5. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  6. Novel molecular determinants in the pore region of sodium channels regulate local anesthetic binding.

    Science.gov (United States)

    Yamagishi, Toshio; Xiong, Wei; Kondratiev, Andre; Vélez, Patricio; Méndez-Fitzwilliam, Ailsa; Balser, Jeffrey R; Marbán, Eduardo; Tomaselli, Gordon F

    2009-10-01

    The pore of the Na+ channel is lined by asymmetric loops formed by the linkers between the fifth and sixth transmembrane segments (S5-S6). We investigated the role of the N-terminal portion (SS1) of the S5-S6 linkers in channel gating and local anesthetic (LA) block using site-directed cysteine mutagenesis of the rat skeletal muscle (Na(V)1.4) channel. The mutants examined have variable effects on voltage dependence and kinetics of fast inactivation. Of the cysteine mutants immediately N-terminal to the putative DEKA selectivity filter in four domains, only Q399C in domain I and F1236C in domain III exhibit reduced use-dependent block. These two mutations also markedly accelerated the recovery from use-dependent block. Moreover, F1236C and Q399C significantly decreased the affinity of QX-314 for binding to its channel receptor by 8.5- and 3.3-fold, respectively. Oddly enough, F1236C enhanced stabilization of slow inactivation by both hastening entry into and delaying recovery from slow inactivation states. It is noteworthy that symmetric applications of QX-314 on both external and internal sides of F1236C mutant channels reduced recovery from use-dependent block, indicating an allosteric effect of external QX-314 binding on the recovery of availability of F1236C. These observations suggest that cysteine mutation in the SS1 region, particularly immediate adjacent to the DEKA ring, may lead to a structural rearrangement that alters binding of permanently charged QX-314 to its receptor. The results lend further support for a role for the selectivity filter region as a structural determinant for local anesthetic block.

  7. Expression and crystallization of several forms of the Propionibacterium shermanii transcarboxylase 5S subunit.

    Science.gov (United States)

    Hall, Pamela R; Zheng, Run; Pusztai-Carey, Marianne; van den Akker, Focco; Carey, Paul R; Yee, Vivien C

    2004-03-01

    The dimeric outer 5S subunit of transcarboxylase has been expressed in three different forms and crystallized: native 5S, 5S-His(6) and selenomethione-5S-His(6). All the crystals have an orthorhombic space group, but while native 5S forms primitive orthorhombic crystals, 5S-His(6) crystals are either C-centered or primitive and SeMet-5S-His(6) crystals are C-centered. Crystallization of native 5S requires the addition of lithium sulfate, whereas this salt prevented crystallization of 5S-His(6). All 5S crystals diffract to approximately 2.0 A resolution with synchrotron radiation. Efforts are under way to solve the structure of SeMet-5S-His(6) using MAD.

  8. Allosteric Mutant IDH1 Inhibitors Reveal Mechanisms for IDH1 Mutant and Isoform Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xiaoling; Baird, Daniel; Bowen, Kimberly; Capka, Vladimir; Chen, Jinyun; Chenail, Gregg; Cho, YoungShin; Dooley, Julia; Farsidjani, Ali; Fortin, Pascal; Kohls, Darcy; Kulathila, Raviraj; Lin, Fallon; McKay, Daniel; Rodrigues, Lindsey; Sage, David; Touré, B. Barry; van der Plas, Simon; Wright, Kirk; Xu, Ming; Yin, Hong; Levell, Julian; Pagliarini, Raymond A. (Novartis)

    2017-03-01

    Oncogenic IDH1 and IDH2 mutations contribute to cancer via production of R-2-hydroxyglutarate (2-HG). Here, we characterize two structurally distinct mutant- and isoform-selective IDH1 inhibitors that inhibit 2-HG production. Both bind to an allosteric pocket on IDH1, yet shape it differently, highlighting the plasticity of this site. Oncogenic IDH1R132H mutation destabilizes an IDH1 “regulatory segment,” which otherwise restricts compound access to the allosteric pocket. Regulatory segment destabilization in wild-type IDH1 promotes inhibitor binding, suggesting that destabilization is critical for mutant selectivity. We also report crystal structures of oncogenic IDH2 mutant isoforms, highlighting the fact that the analogous segment of IDH2 is not similarly destabilized. This intrinsic stability of IDH2 may contribute to observed inhibitor IDH1 isoform selectivity. Moreover, discrete residues in the IDH1 allosteric pocket that differ from IDH2 may also guide IDH1 isoform selectivity. These data provide a deeper understanding of how IDH1 inhibitors achieve mutant and isoform selectivity.

  9. Biochemical activities of T-antigen proteins encoded by simian virus 40 A gene deletion mutants.

    OpenAIRE

    Clark, R; Peden, K; Pipas, J M; Nathans, D; Tjian, R

    1983-01-01

    We have analyzed T antigens produced by a set of simian virus 40 (SV40) A gene deletion mutants for ATPase activity and for binding to the SV40 origin of DNA replication. Virus stocks of nonviable SV40 A gene deletion mutants were established in SV40-transformed monkey COS cells. Mutant T antigens were produced in mutant virus-infected CV1 cells. The structures of the mutant T antigens were characterized by immunoprecipitation with monoclonal antibodies directed against distinct regions of th...

  10. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  11. Insulator dysfunction and oncogene activation in IDH mutant gliomas.

    Science.gov (United States)

    Flavahan, William A; Drier, Yotam; Liau, Brian B; Gillespie, Shawn M; Venteicher, Andrew S; Stemmer-Rachamimov, Anat O; Suvà, Mario L; Bernstein, Bradley E

    2016-01-07

    Gain-of-function IDH mutations are initiating events that define major clinical and prognostic classes of gliomas. Mutant IDH protein produces a new onco-metabolite, 2-hydroxyglutarate, which interferes with iron-dependent hydroxylases, including the TET family of 5'-methylcytosine hydroxylases. TET enzymes catalyse a key step in the removal of DNA methylation. IDH mutant gliomas thus manifest a CpG island methylator phenotype (G-CIMP), although the functional importance of this altered epigenetic state remains unclear. Here we show that human IDH mutant gliomas exhibit hypermethylation at cohesin and CCCTC-binding factor (CTCF)-binding sites, compromising binding of this methylation-sensitive insulator protein. Reduced CTCF binding is associated with loss of insulation between topological domains and aberrant gene activation. We specifically demonstrate that loss of CTCF at a domain boundary permits a constitutive enhancer to interact aberrantly with the receptor tyrosine kinase gene PDGFRA, a prominent glioma oncogene. Treatment of IDH mutant gliomaspheres with a demethylating agent partially restores insulator function and downregulates PDGFRA. Conversely, CRISPR-mediated disruption of the CTCF motif in IDH wild-type gliomaspheres upregulates PDGFRA and increases proliferation. Our study suggests that IDH mutations promote gliomagenesis by disrupting chromosomal topology and allowing aberrant regulatory interactions that induce oncogene expression.

  12. Photorepair mutants of Arabidopsis

    International Nuclear Information System (INIS)

    Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

    1997-01-01

    UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

  13. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  14. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  15. Population distribution of 45S and 5S rDNA in golden mahseer, Tor ...

    Indian Academy of Sciences (India)

    But FISH data showed significant difference between the populations, four of the five populations showed six 18S (three pairs) and two 5S (one pair) signals with positional polymorphism, while one population showed eight 18S and four 5S signals, respectively. Southern blot data confirms that 5S rDNA clusters present on ...

  16. Evaluation of tall rice mutant

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1989-01-01

    One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs

  17. Molecular organization of 5S rDNA in sharks of the genus Rhizoprionodon: insights into the evolutionary dynamics of 5S rDNA in vertebrate genomes.

    Science.gov (United States)

    Pinhal, Danillo; Araki, Carlos S; Gadig, Otto B F; Martins, Cesar

    2009-02-01

    In this study, we attempted a molecular characterization of the 5S rDNA in two closely related species of carcharhiniform sharks, Rhizoprionodon lalandii and Rhizoprionodon porosus, as well as a further comparative analysis of available data on lampreys, several fish groups and other vertebrates. Our data show that Rhizoprionodon sharks carry two 5S rDNA classes in their genomes: a short repeat class (termed class I) composed of approximately 185 bp repeats, and a large repeat class (termed class II) arrayed in approximately 465 bp units. These classes were differentiated by several base substitutions in the 5S coding region and by completely distinct non-transcribed spacers (NTS). In class II, both species showed a similar composition for both the gene coding region and the NTS region. In contrast, class I varied extensively both within and between the two shark species. A comparative analysis of 5S rRNA gene sequences of elasmobranchs and other vertebrates showed that class I is closely related to the bony fishes, whereas the class II gene formed a separate cartilaginous clade. The presence of two variant classes of 5S rDNA in sharks likely maintains the tendency for dual ribosomal classes observed in other fish species. The present data regarding the 5S rDNA organization provide insights into the dynamics and evolution of this multigene family in the fish genome, and they may also be useful in clarifying aspects of vertebrate genome evolution.

  18. Clear Plaque Mutants of Lactococcal Phage TP901-1

    DEFF Research Database (Denmark)

    Kot, Witold; Kilstrup, Mogens; Vogensen, Finn K.

    2016-01-01

    We report a method for obtaining turbid plaques of the lactococcal bacteriophage TP901-1 and its derivative TP901-BC1034. We have further used the method to isolate clear plaque mutants of this phage. Analysis of 8 such mutants that were unable to lysogenize the host included whole genome...... protein involved in the DNA binding. The conclusion is that cI is the only gene involved in clear plaque formation i.e. the CI protein is the determining factor for the lysogenic pathway and its maintenance in the lactococcal phage TP901-1....

  19. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  20. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    Science.gov (United States)

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2). Images PMID:6340063

  1. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  2. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  3. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  4. Generation and Characterization of dickkopf3 Mutant Mice

    Science.gov (United States)

    del Barco Barrantes, Ivan; Montero-Pedrazuela, Ana; Guadaño-Ferraz, Ana; Obregon, Maria-Jesus; Martinez de Mena, Raquel; Gailus-Durner, Valérie; Fuchs, Helmut; Franz, Tobias J.; Kalaydjiev, Svetoslav; Klempt, Martina; Hölter, Sabine; Rathkolb, Birgit; Reinhard, Claudia; Morreale de Escobar, Gabriella; Bernal, Juan; Busch, Dirk H.; Wurst, Wolfgang; Wolf, Eckhard; Schulz, Holger; Shtrom, Svetlana; Greiner, Erich; Hrabé de Angelis, Martin; Westphal, Heiner; Niehrs, Christof

    2006-01-01

    dickkopf (dkk) genes encode a small family of secreted Wnt antagonists, except for dkk3, which is divergent and whose function is poorly understood. Here, we describe the generation and characterization of dkk3 mutant mice. dkk3-deficient mice are viable and fertile. Phenotypic analysis shows no major alterations in organ morphology, physiology, and most clinical chemistry parameters. Since Dkk3 was proposed to function as thyroid hormone binding protein, we have analyzed deiodinase activities, as well as thyroid hormone levels. Mutant mice are euthyroid, and the data do not support a relationship of dkk3 with thyroid hormone metabolism. Altered phenotypes in dkk3 mutant mice were observed in the frequency of NK cells, immunoglobulin M, hemoglobin, and hematocrit levels, as well as lung ventilation. Furthermore, dkk3-deficient mice display hyperactivity. PMID:16508007

  5. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  6. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  7. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  8. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  9. Probing the binding of coumarins and cyclothialidines to DNA gyrase

    DEFF Research Database (Denmark)

    Kampranis, S C; Gormley, N A; Tranter, R

    1999-01-01

    B and coumarin and cyclothialidine drugs and made mutations by site-directed mutagenesis. We used proteolysis as a probe of drug binding to wild-type and mutant proteins. Limited proteolysis of gyrase revealed that binding of these antibiotics is associated with a characteristic proteolytic fingerprint......, suggesting a drug-induced conformational change. The ability of the mutants to bind the drugs was studied by testing their ability to induce the coumarin-associated proteolytic signature and to bind to a novobiocin-affinity column. To analyze further the interaction of the drugs with gyrase, we studied...

  10. Identification of diphtheria toxin R domain mutants with enhanced inhibitory activity against HB-EGF.

    Science.gov (United States)

    Suzuki, Keisuke; Mizushima, Hiroto; Abe, Hiroyuki; Iwamoto, Ryo; Nakamura, Haruki; Mekada, Eisuke

    2015-05-01

    Heparin-binding epidermal growth factor-like growth factor (HB-EGF), a ligand of EGF receptor, is involved in the growth and malignant progression of cancers. Cross-reacting material 197, CRM197, a non-toxic mutant of diphtheria toxin (DT), specifically binds to the EGF-like domain of HB-EGF and inhibits its mitogenic activity, thus CRM197 is currently under evaluation in clinical trials for cancer therapy. To develop more potent DT mutants than CRM197, we screened various mutant proteins of R domain of DT, the binding site for HB-EGF. A variety of R-domain mutant proteins fused with maltose-binding protein were produced and their inhibitory activity was evaluated in vitro. We found four R domain mutants that showed much higher inhibitory activity against HB-EGF than wild-type (WT) R domain. These R domain mutants suppressed HB-EGF-dependent cell proliferation more effectively than WT R domain. Surface plasmon resonance revealed their higher affinity to HB-EGF than WT R domain. CRM197(R460H) carrying the newly identified mutation showed increased cell proliferation inhibitory activity and affinity to HB-EGF. These results suggest that CRM197(R460H) or other recombinant proteins carrying newly identified mutation(s) in the R domain are potential therapeutics targeting HB-EGF. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  11. Pollen irradiation method to obtain mutants in cucumber

    International Nuclear Information System (INIS)

    Iida, S.; Amano, E.

    1988-01-01

    Seed irradiation for mutation induction in dioecious crops like cucumber is not very useful because chimerism of the mutated tissues makes the segregation of mutants in the M 2 generation nearly impossible. This problem does not exist with pollen irradiation. Cucumber (Cucumis sativus L. var. Nishikisuyo) was used for a model experiment. The petals of male and female flowers were closed by pinching with binding wire before flowering to prevent pollination by insects. On the flowering day, the male flowers were collected and irradiated with 1kR to 10 kR of acute gamma rays (137-Cs), then used to pollinate the female flowers. The M 1 seeds thus obtained are not chimeric but heterozygous for induced mutations. When planted, no mutant phenotype appeared. Selfing within a plant lead to segregation of mutants in the M 2 generation. Seedling examination revealed eight mutants. One mutant line, in which the shape of leaves changed from pentagonal to round heart shape, was found under field conditions. The optimal dose for pollen irradiation seems to be between 2 kR and 4kR

  12. Degradation routes of trafficking-defective VLDLR mutants associated with Dysequilibrium syndrome.

    Science.gov (United States)

    Kizhakkedath, Praseetha; John, Anne; Al-Gazali, Lihadh; Ali, Bassam R

    2018-01-25

    Low density lipoprotein receptor (LDLR) family members are involved in signaling in the developing brain. Previously we have reported that missense mutations in the Very Low Density Lipoprotein Receptor gene (VLDLR), causing Dysequilibrium syndrome (DES), disrupt ligand-binding, due to endoplasmic reticulum (ER) retention of the mutants. We explored the degradation routes of these VLDLR mutants in cultured cells. Our results indicate that VLDLR mutants are retained in the ER for prolonged periods which could be facilitated by association with the ER-resident chaperone calnexin. The mutants were prone to aggregation and capable of eliciting ER stress. The VLDLR mutants were found to be degraded predominantly by the proteasomal pathway, since ubiquitinated VLDLR was found to accumulate in response to proteasomal inhibition. Further, the mutants were found to interact with the ER degradation adaptor protein SEL1L. The degradation of VLDLR wild type and mutant were delayed in CRISPR/Cas9 edited SEL1L knock-out cells which was reversed by exogenous expression of SEL1L. In summary, ER retention of pathogenic VLDLR mutants involves binding to calnexin, elevated ER stress, and delayed degradation which is dependent on SEL1L. Since core LDLR family members share common structural domains, common mechanisms may be involved in their ER processing.

  13. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  14. Percutaneous Endoscopic Lumbar Discectomy for L5-S1 Disc Herniation: Consideration of the Relation between the Iliac Crest and L5-S1 Disc.

    Science.gov (United States)

    Choi, Kyung Chul; Park, Choon-Keun

    2016-02-01

    Percutaneous transforaminal techniques for the treatment of lumbar disc herniation have markedly evolved. Percutaneous endoscopic lumbar discectomy (PELD) for L5-S1 disc herniation is regarded as challenging due to the unique anatomy of the iliac crest, large facet joint, and inclinatory disc space. Among these, the iliac crest is considered a major obstacle. There are no studies regarding the height of the iliac crest and their appropriate procedures in PELD. This study discusses PELD for L5-S1 disc herniation and the appropriate approach according to the height of iliac crest. Retrospective evaluation. 100 consecutive patients underwent PELD via the transforaminal route for L5-S1 disc herniation by a single surgeon. The study was divided into 2 groups: the foraminoplasty group requiring foraminal widening to access the herniated disc and the non-foraminoplasty group treated by conventional posterolateral access. Radiological parameters such as iliac height, the relative position of the iliac crest to the landmarks of the L5-S1 level, iliosacral angle and foraminal height, and disc location were considered. Clinical outcomes were assessed by the Visual Analogue Scale (VAS, 0 - 10) for back and leg pain, the Oswestry Disability Index (ODI, 0 - 100%), and the modified MacNab criteria. The overall VAS scores for back and leg pain decreased from 6.0 to 2.3 and from 7.5 to 1.7. The mean ODI (%) improved from 54.0 to 11.6. Using modified MacNab criteria, a good outcome was 92%. Foraminoplasty was required in 19 patients. Iliac crest height was significantly higher in the foraminoplasty group than the non-foraminoplasty group (37.7 mm vs 30.1 mm, P disc height between the 2 groups. In addition, there were no differences in clinical outcome between the 2 groups. This study is a retrospective analysis and simplifies the complexity of the L5-S1 level and iliac bone using two-dimensional radiography. In high iliac crest cases where the iliac crest is above the mid L5 pedicle

  15. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    OpenAIRE

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  16. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  17. Targeting ESR1-Mutant Breast Cancer

    Science.gov (United States)

    2015-09-01

    we have developed models of mutant ER driven cancer in which to characterize gene expression. Specifically, tetracycline inducible MCF7 cells that...expression profiling. Figure 1: Degradation of WT and mutant ER with ARN810. MCF7 cells stably transfected with tet-inducible WT and mutant...mutant ER. MCF7 cells stably transfected with tet- inducible WT and mutant ER are treated for 24 hours with estradiol and gene expression profiling

  18. Y(5S): What has been learned and what can be learned

    International Nuclear Information System (INIS)

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  19. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  20. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Directory of Open Access Journals (Sweden)

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  1. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Science.gov (United States)

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  2. Low-temperature photoluminescence in CuIn5S8 single crystals

    Indian Academy of Sciences (India)

    at 300 K and 1.57 eV at 96 K [9]. Infrared reflection and Raman scattering spectra of. CuIn5S8 have also been investigated and analysed [10]. In this article, we present the results of a systematic experimental analysis of the photo- luminescence (PL) of CuIn5S8 crystals in the 720–1020 nm wavelength region and in the.

  3. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    Directory of Open Access Journals (Sweden)

    Hikmet Turan Suslu

    2011-01-01

    Full Text Available Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches.

  4. Wild Accessions and Mutant Resources

    DEFF Research Database (Denmark)

    Kawaguchi, Masayoshi; Sandal, Niels Nørgaard

    2014-01-01

    Lotus japonicus, Lotus burttii, and Lotus filicaulis are species of Lotus genus that are utilized for molecular genetic analysis such as the construction of a linkage map and QTL analysis. Among them, a number of mutants have been isolated from two wild accessions: L. japonicus Gifu B-129...

  5. components in induced sorghum mutants

    African Journals Online (AJOL)

    (1984) evaluated induced mutation and hybridisation methods for producing genetic variability in 15 quantitative characters of sorghum. Their results showed large variability in grain yield, plant maturity, plant height and panicles length. Selected mutants with favorable properties can be directly combined in varietal hybrids.

  6. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (pjob and setting up a safe environment created a statistically significant effect on employees, and some sufficient satisfaction was

  7. Risk factors for L5-S1 disk height reduction after lumbar posterolateral floating fusion surgery.

    Science.gov (United States)

    Inoue, Gen; Takaso, Masashi; Miyagi, Masayuki; Kamoda, Hiroto; Ishikawa, Tetsuhiro; Nakazawa, Toshiyuki; Imura, Takayuki; Ueno, Masaki; Saito, Wataru; Uchida, Kentaro; Toyone, Tomoaki; Takahashi, Kazuhisa; Ohtori, Seiji

    2014-07-01

    This is a retrospective study. To investigate the risk factors for radiographic L5-S1 disk height reduction after lumbar posterolateral floating fusion surgery. We investigated data from 86 patients (45 men) who underwent posterolateral floating fusion surgery from 2007 to 2010. The follow-up was from 2 to 6 years. The mean age of the patients was 65.4 years. L5-S1 disk height was calculated and >2 mm reduction was defined as significant. Age, sex, height, weight, body mass index, number of fused levels, grade of disk degeneration, disk height and diameter, sacrolumbar alignment, alignment of fused level, achievement of union, and proximal adjacent segment disorder at final follow-up were compared. Univariate and multivariate logistic regressions were performed. L5-S1 disk height reduction occurred in 14 patients (30.2%). The number of fused levels was significantly greater (1.8±0.8 vs. 1.4±0.6) in patients without disk height reduction. Radiology showed a significant change of L1-S1 sacrolumbar alignment after surgery in patients without disk height reduction (0.3±6.6 vs. -4.5±7.6 degrees). The height of the disk posterior to the L5-S1 intervertebral disk before surgery was significantly greater (7.3±2.1 vs. 6.1±2.1 mm) in patients without disk height reduction. In multivariate logistic regression analysis, fusion of >3 levels was a significant risk factor for L5-S1 disk height reduction. In posterolateral floating fusion surgery, there was a higher risk of L5-S1 disk height reduction and consequent foraminal stenosis in patients with multiple-level fusion. Surgical methods and fusion levels should be chosen after considering their association with L5-S1 disk height reduction.

  8. Induced High Lysine Mutants in Barley

    DEFF Research Database (Denmark)

    Doll, Hans; Køie, B.; Eggum, B. O.

    1974-01-01

    variety. Comparisons of six high lysine mutants with the parent variety showed that grain yield and seed size of the mutants are reduced between 10 and 30 per cent. However, the most promising mutant had the lowest reduction in grain yield, and the absolute lysine yield of this mutant was some 30 per cent...... above that of the parent variety. Feeding tests with rats revealed substantial increases in the biological value of the high lysine mutant protein. Also the net protein utilization was improved but less so because of a somewhat reduced digestibility of the mutant protein....

  9. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  10. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Directory of Open Access Journals (Sweden)

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  11. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  12. Transcriptome analysis of integument differentially expressed genes in the pigment mutant (quail during molting of silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Hongyi Nie

    Full Text Available In the silkworm Bombyx mori, pigment mutants with diverse body colors have been maintained throughout domestication for about 5000 years. The silkworm larval body color is formed through the mutual interaction of melanin, ommochromes, pteridines and uric acid. These pigments/compounds are synthesized by the cooperative action of various genes and enzymes. Previous reports showed that melanin, ommochrome and pteridine are increased in silkworm quail (q mutants. To understand the pigment increase and alterations in pigment synthesis in q mutant, transcriptome profiles of the silkworm integument were investigated at 16 h after head capsule slippage in the fourth molt in q mutants and wild-type (Dazao. Compared to the wild-type, 1161 genes were differentially expressed in the q mutant. Of these modulated genes, 62.4% (725 genes were upregulated and 37.6% (436 genes were downregulated in the q mutant. The molecular function of differently expressed genes was analyzed by Blast2GO. The results showed that upregulated genes were mainly involved in protein binding, small molecule binding, transferase activity, nucleic acid binding, specific DNA-binding transcription factor activity and chromatin binding, while exclusively down-expressed genes functioned in oxidoreductase activity, cofactor binding, tetrapyrrole binding, peroxidase activity and pigment binding. We focused on genes related to melanin, pteridine and ommochrome biosynthesis; transport of uric acid; and juvenile hormone metabolism because of their importance in integument coloration during molting. This study identified differently expressed genes implicated in silkworm integument formation and pigmentation using silkworm q mutant. The results estimated the number and types of genes that drive new integument formation.

  13. IGFBP2 expression predicts IDH-mutant glioma patient survival.

    Science.gov (United States)

    Huang, Lin Eric; Cohen, Adam L; Colman, Howard; Jensen, Randy L; Fults, Daniel W; Couldwell, William T

    2017-01-03

    Mutations of the isocitrate dehydrogenase (IDH) 1 and 2 genes occur in ~80% of lower-grade (WHO grade II and grade III) gliomas. Mutant IDH produces (R)-2-hydroxyglutarate, which induces DNA hypermethylation and presumably drives tumorigenesis. Interestingly, IDH mutations are associated with improved survival in glioma patients, but the underlying mechanism for the difference in survival remains unclear. Through comparative analyses of 286 cases of IDH-wildtype and IDH-mutant lower-grade glioma from a TCGA data set, we report that IDH-mutant gliomas have increased expression of tumor-suppressor genes (NF1, PTEN, and PIK3R1) and decreased expression of oncogenes(AKT2, ARAF, ERBB2, FGFR3, and PDGFRB) and glioma progression genes (FOXM1, IGFBP2, and WWTR1) compared with IDH-wildtype gliomas. Furthermore, each of these genes is prognostic in overall gliomas; however, within the IDH-mutant group, none remains prognostic except IGFBP2 (encodinginsulin-like growth factor binding protein 2). Through validation in an independent cohort, we show that patients with low IGFBP2 expressiondisplay a clear advantage in overall and disease-free survival, whereas those with high IGFBP2 expressionhave worse median survival than IDH-wildtype patients. These observations hold true across different histological and molecular subtypes of lower-grade glioma. We propose therefore that an unexpected biological consequence of IDH mutations in glioma is to ameliorate patient survival by promoting tumor-suppressor signaling while inhibiting that of oncogenes, particularly IGFBP2.

  14. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  15. Global Sustainable Development Through the Integrated Lean Management (Green 5-S Model for TQM

    Directory of Open Access Journals (Sweden)

    Ho Samuel K. M.

    2014-11-01

    Full Text Available Based on the 'Best Paper-2010' by the TQM Journal, the author has a chance to test out the model in a number of firms in Malaysia through SIRIM. Furthermore, riding on the success, SIRIM has named it as the SIRIM Green 5-S Model. As a result, the aim of this paper is to share the experience of the “SIRIM Green 5-S Model for Sustainable Development”. Since 1993, the author used the proprietary 5-S Checklist for training and consultancy in no less than 10 countries with over 50,000 persons from around 2,000 organisatioins world-wide. On the other hand, HKSAR takes the lead in the global oil energy consumption/GPD. The experience will be shared in this article.

  16. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  17. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  18. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  19. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  20. Saint Louis Encephalitis Temperature-Sensitive Mutants.

    Science.gov (United States)

    1981-01-01

    group II contains two mutants and group III contains three mutants. Examination of the ability of mutants to grow at 300C, 40 C or 37 C indicates that...importance. Information from studies with Poliovirus has shown that the use of live attenuated virus vaccines result in longer lasting, more effec- tive...sensitive mutant to grow at internal body temperature may have a significant effect on the ability of the virus to induce a protective immune response or

  1. An extra early mutant of pigeonpea

    International Nuclear Information System (INIS)

    Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

    2001-01-01

    The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

  2. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  3. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Science.gov (United States)

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  4. 5S activities and its application at a sample company | Korkut ...

    African Journals Online (AJOL)

    Total Productive Maintenance (TPM) targets enabling the machine operators to undertake the maintenance activities and therefore to increase the efficiency of the equipments. It struggles with six great losses decreasing the efficiency of the equipment. 5S, which is the pre-step of TPM, is a systematic approach providing the ...

  5. Journal of Fundamental and Applied Sciences - Vol 9, No 5S (2017)

    African Journals Online (AJOL)

    Towards an Islamic spirituality model in increasing academic performance of accounting students · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. G Rosliza, A.A. Inayah, T Emiza, C.A. Merani, Y Yusliena, 921-931. http://dx.doi.org/10.4314/jfas.v9i5s.65 ...

  6. Physical mapping of 5S and 45S rDNA in Chrysanthemum and ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 91; Issue 2. Physical mapping of 5S and 45S rDNA in Chrysanthemum and related genera of the Anthemideae by FISH, and species relationships. Magdy Hussein Abd El-Twab Katsuhiko Kondo. Research Note Volume 91 Issue 2 August 2012 pp 245-249 ...

  7. 5. S Shivaji - Cold loving microbes.htm | sshivaji | 80am talks ...

    Indian Academy of Sciences (India)

    Home; public; Resources; meetings; annmeet; 80am talks; sshivaji; 5. S Shivaji - Cold loving microbes.htm. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 ...

  8. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  9. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    International Nuclear Information System (INIS)

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  10. Probing the remarkable thermal kinetics of visual rhodopsin with E181Q and S186A mutants

    Science.gov (United States)

    Guo, Ying; Hendrickson, Heidi P.; Videla, Pablo E.; Chen, Ya-Na; Ho, Junming; Sekharan, Sivakumar; Batista, Victor S.; Tully, John C.; Yan, Elsa C. Y.

    2017-06-01

    We recently reported a very unusual temperature dependence of the rate of thermal reaction of wild type bovine rhodopsin: the Arrhenius plot exhibits a sharp "elbow" at 47 °C and, in the upper temperature range, an unexpectedly large activation energy (114 ± 8 kcal/mol) and an enormous prefactor (1072±5 s-1). In this report, we present new measurements and a theoretical model that establish convincingly that this behavior results from a collective, entropy-driven breakup of the rigid hydrogen bonding networks (HBNs) that hinder the reaction at lower temperatures. For E181Q and S186A, two rhodopsin mutants that disrupt the HBNs near the binding pocket of the 11-cis retinyl chromophore, we observe significant decreases in the activation energy (˜90 kcal/mol) and prefactor (˜1060 s-1), consistent with the conclusion that the reaction rate is enhanced by breakup of the HBN. The results provide insights into the molecular mechanism of dim-light vision and eye diseases caused by inherited mutations in the rhodopsin gene that perturb the HBNs.

  11. Helical propensity in an intrinsically disordered protein accelerates ligand binding

    DEFF Research Database (Denmark)

    Iesmantavicius, Vytautas; Dogan, Jakob; Jemth, Per

    2014-01-01

    domain of the activator for thyroid hormone and retinoid receptors (ACTR) is intrinsically disordered and folds upon binding to the nuclear coactivator binding domain (NCBD) of the CREB binding protein. A number of mutants was designed that selectively perturbs the amount of secondary structure......Many intrinsically disordered proteins fold upon binding to other macromolecules. The secondary structure present in the well-ordered complex is often formed transiently in the unbound state. The consequence of such transient structure for the binding process is, however, not clear. The activation...... the notion of preformed secondary structure as an important determinant for molecular recognition in intrinsically disordered proteins....

  12. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  13. Enhancers of Conidiation Mutants in Aspergillus Nidulans

    OpenAIRE

    Gems, D. H.; Clutterbuck, A. J.

    1994-01-01

    Mutants at a number of loci, designated sthenyo, have been isolated as enhancers of the oligoconidial mutations at the medA locus. Two loci have been mapped: sthA on linkage group I, and sthB on linkage group V. Two probable alleles have been identified at each locus but two further mutants were unlinked to either sthA or sthB. Neither sthA nor sthB mutants have conspicuous effects on morphology on their own, nor could the sthA1 sthB2 double mutant be distinguished from wild type. Mutants at ...

  14. Dwarf mutant of rice variety Seratus Malam

    International Nuclear Information System (INIS)

    Mugiono, P. S.; Soemanggono, A.M.R.

    1989-01-01

    Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)

  15. GTP-dependent binding and nuclear transport of RNA polymerase II by Npa3 protein

    DEFF Research Database (Denmark)

    Staresincic, Lidija; Walker, Jane; Dirac-Svejstrup, A Barbara

    2011-01-01

    transport of RNAPII. Surprisingly, we were unable to detect interactions between Npa3 and proteins in the classical importin a/ß pathway for nuclear import. Interestingly, Npa3-RNAPII binding is significantly increased by the addition of GTP or its slowly hydrolyzable analogue guanosine 5'-3-O......-(thio)triphosphate (GTP¿S). Moreover, the Npa3 mutant that binds GTP, but cannot hydrolyze it, binds RNAPII even in the absence of added GTP, whereas the mutant that cannot bind GTP is unable to bind the polymerase. Together, our data suggest that Npa3 defines an unconventional pathway for nuclear import of RNAPII, which...

  16. Cytosine hypomethylation at CHG and CHH sites in the pleiotropic mutants of Mendelian inheritance in Catharanthus roseus.

    Science.gov (United States)

    Kumari, Renu; Yadav, Gitanjali; Sharma, Vishakha; Sharma, Vinay; Kumar, Sushil

    2013-12-01

    The 5S and 18S rDNA sequences of Catharanthus roseus cv 'Nirmal' (wild type) and its leafless inflorescence (lli), evergreen dwarf (egd) and irregular leaf lamina (ill) single mutants and lli egd, lli ill and egd ill double mutants were characterized. The lli, egd and ill mutants of Mendelian inheritance bore the names after their most conspicuous morphological feature(s). They had been chemically induced and isolated for their salt tolerance. The double mutants were isolated as morphological segregants from crosses between single mutants. The morphological features of the two parents accompanied salt tolerance in the double mutants. All the six mutants were hypomethylated at repeat sequences, upregulated and downregulated for many genes and carried pleiotropic alterations for several traits. Here the 5S and 18S rDNAs of C. roseus were found to be relatively low in cytosine content. Cytosines were preponderantly in CG context (53%) and almost all of them were methylated (97%). The cytosines in CHH and CHG (where H = A, T or C) contexts were largely demethylated (92%) in mutants. The demethylation was attributable to reduced expression of RDR2 and DRM2 led RNA dependant DNA methylation and CMT3 led maintenance methylation pathways. Mutants had gained some cytosines by substitution of C at T sites. These perhaps arose on account of errors in DNA replication, mediated by widespread cytosine demethylation at CHG and CHH sites. It was concluded that the regulation of cytosine ethylation mechanisms was disturbed in the mutants. ILL, EGD and LLI genes were identified as the positive regulators of other genes mediating the RdDM and CMT3 pathways, for establishment and maintenance of cytosine methylation in C. roseus.

  17. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  18. Mutant p53 shapes the enhancer landscape of cancer cells in response to chronic immune signaling.

    Science.gov (United States)

    Rahnamoun, Homa; Lu, Hanbin; Duttke, Sascha H; Benner, Christopher; Glass, Christopher K; Lauberth, Shannon M

    2017-09-29

    Inflammation influences cancer development, progression, and the efficacy of cancer treatments, yet the mechanisms by which immune signaling drives alterations in the cancer cell transcriptome remain unclear. Using ChIP-seq, RNA-seq, and GRO-seq, here we demonstrate a global overlap in the binding of tumor-promoting p53 mutants and the master proinflammatory regulator NFκB that drives alterations in enhancer and gene activation in response to chronic TNF-α signaling. We show that p53 mutants interact directly with NFκB and that both factors impact the other's binding at diverse sets of active enhancers. In turn, the simultaneous and cooperative binding of these factors is required to regulate RNAPII recruitment, the synthesis of enhancer RNAs, and the activation of tumor-promoting genes. Collectively, these findings establish a mechanism by which chronic TNF-α signaling orchestrates a functional interplay between mutant p53 and NFκB that underlies altered patterns of cancer-promoting gene expression.Inflammation is known to affect cancer development, yet the mechanisms by which immune signaling drives transformation remain unclear. Here, the authors provide evidence that chronic TNF-α signaling promotes the enhancer binding and transcriptional interplay between mutant p53 and NFκB.

  19. Mutational scanning of the human serotonin transporter reveals fast translocating serotonin transporter mutants

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Larsen, Mads B; Johnsen, Laust B

    2004-01-01

    and anxiety. In the present study we have undertaken a mutational scanning of human SERT in order to identify residues that are responsible for individual differences among related monoamine transporters. One mutant, G100A, was inactive in transport. However, ligand binding affinity was similar to wild...

  20. PNRI mutant variety: Cordyline 'Afable'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2012-01-01

    Cordyline 'Afable', registered by the Philippine Nuclear Research Institute as NSIC 2009 Or-83, is an induced mutant developed from Cordyline 'Kiwi' by treating stem cuttings with acute gamma radiation from a Cobalt-60 source. The new mutant is identical to Cordyline 'Kiwi' in growth habit but differs in foliage color, and exhibits field resistance to Phytophthora sp., a fungus that causes leaf blight and rot in Ti plants. Results of this mutation breeding experiment showed that leaf color was altered by gamma irradiation and resistance to fungal diseases was improved. It also demonstrated how mutations that occur in nature may be generated artificially. Propagation of cordyline 'Afable' is true-to-type by vegetative propagation methods, such as separation of suckers and offshoots, shoot tip cutting, and top cutting. Aside from landscaping material, terrarium or dish-garden plant, it is ideal as containerized plant for indoor and outdoor use. The leaves or shoots may be harvested as cut foliage for flower arrangements. (author)

  1. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  2. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  3. Miniopen Oblique Lateral L5-S1 Interbody Fusion: A Report of 2 Cases

    Directory of Open Access Journals (Sweden)

    Keijiro Kanno

    2014-01-01

    Full Text Available Extreme lateral interbody fusion (XLIF has been widely used for minimally invasive anterior lumbar interbody fusion (ALIF, but an approach to L5-S1 is difficult because of the iliac crest. In the current study, we present 2 cases using minimally invasive oblique lateral interbody fusion (OLIF of L5-S1. The patients showed foraminal stenosis between L5 and S1 and severe low back and leg pain. The patients were placed in a lateral decubitus position and underwent OLIF surgery (using a cage and bone graft from the iliac crest without posterior decompression. Posterior screws were used in the patients. Pain scores significantly improved after surgery. There was no spinal nerve, major vessel, peritoneal, or urinary injury. OLIF surgery was minimally invasive and produced good surgical results without complications.

  4. Implementation of 5S tools as a starting point in business process reengineering

    Directory of Open Access Journals (Sweden)

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  5. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  6. Riding the Populist Web: Contextualizing the Five Star Movement (M5S in Italy

    Directory of Open Access Journals (Sweden)

    Liza Lanzone

    2015-08-01

    Full Text Available This article focuses on three mechanisms to explain the rise of populist movements across Europe. They are politicization of resentment, exploitation of social cleavages, and polarization of resentment and feelings of non-representation. We conceptualize populism as a strategic power game aiming to transform potential majorities into real ones by creating or reframing social cleavages. Our theoretical model is used to explain the rise of the Five Star Movement (M5S. Beppe Grillo’s M5S gained notoriety on the national political scene in Italy just before the 2013 elections and succeeded in get-ting nearly 25 percent of the overall vote. Moreover, it was the only political force that was able to attract votes across the different regions in Italy, making it the country’s only truly national party.

  7. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  8. Perbaikan Tata Kelola Warehouse PT Mustika Ratu Semarang dengan Konsep 5s + Pengaplikasian Rak Barang

    OpenAIRE

    Prasetyo, Mochammad Sidiq Saifuddin; Sriyanto, Sriyanto

    2016-01-01

    REDESIGN OF PT MUSTIKA RATU SEMARANG'S WAREHOUSE USING 5S CONCEPT AND GOODS RACK – The goal of this research if to identify and analyze the problem of warehouse management in PT Mustika Ratu Semarang, calculate the needs of warehouse volume to store the goods, calculate the rack dimension include the amount of the needs, and arrange the effective and efficient layout. The primary data came from interview and observation, while the secondary data came from PT Mustika Ratu Semarang's warehouse ...

  9. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  10. Plant 5S rDNA has multiple alternative nucleosome positions

    Czech Academy of Sciences Publication Activity Database

    Fulneček, Jaroslav; Matyášek, Roman; Kovařík, Aleš

    2006-01-01

    Roč. 49, č. 7 (2006), s. 840-850 ISSN 0831-2796 R&D Projects: GA ČR(CZ) GP204/03/P104; GA ČR(CZ) GA521/04/0775; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507 Keywords : 5S rRNA genes * chromatin * repeat length Subject RIV: BO - Biophysics Impact factor: 1.972, year: 2006

  11. Gamma ray induced mutants in Coleus

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

  12. Ail binding to fibronectin facilitates Yersinia pestis binding to host cells and Yop delivery.

    Science.gov (United States)

    Tsang, Tiffany M; Felek, Suleyman; Krukonis, Eric S

    2010-08-01

    Yersinia pestis, the causative agent of plague, evades host immune responses and rapidly causes disease. The Y. pestis adhesin Ail mediates host cell binding and is critical for Yop delivery. To identify the Ail receptor(s), Ail was purified following overexpression in Escherichia coli. Ail bound specifically to fibronectin, an extracellular matrix protein with the potential to act as a bridge between Ail and host cells. Ail expressed by E. coli also mediated binding to purified fibronectin, and Ail-mediated E. coli adhesion to host cells was dependent on fibronectin. Ail expressed by Y. pestis bound purified fibronectin, as did the Y. pestis adhesin plasminogen activator (Pla). However, a KIM5 Delta ail mutant had decreased binding to host cells, while a KIM5 Delta pla mutant had no significant defect in adhesion. Furthermore, treatment with antifibronectin antibodies decreased Ail-mediated adhesion by KIM5 and the KIM5 Delta pla mutant, indicating that the Ail-fibronectin interaction was important for cell binding. Finally, antifibronectin antibodies inhibited the KIM5-mediated cytotoxicity of host cells in an Ail-dependent fashion. These data indicate that Ail is a key adhesin that mediates binding to host cells through interaction with fibronectin on the surface of host cells, and this interaction is important for Yop delivery by Y. pestis.

  13. Ail Binding to Fibronectin Facilitates Yersinia pestis Binding to Host Cells and Yop Delivery▿

    Science.gov (United States)

    Tsang, Tiffany M.; Felek, Suleyman; Krukonis, Eric S.

    2010-01-01

    Yersinia pestis, the causative agent of plague, evades host immune responses and rapidly causes disease. The Y. pestis adhesin Ail mediates host cell binding and is critical for Yop delivery. To identify the Ail receptor(s), Ail was purified following overexpression in Escherichia coli. Ail bound specifically to fibronectin, an extracellular matrix protein with the potential to act as a bridge between Ail and host cells. Ail expressed by E. coli also mediated binding to purified fibronectin, and Ail-mediated E. coli adhesion to host cells was dependent on fibronectin. Ail expressed by Y. pestis bound purified fibronectin, as did the Y. pestis adhesin plasminogen activator (Pla). However, a KIM5 Δail mutant had decreased binding to host cells, while a KIM5 Δpla mutant had no significant defect in adhesion. Furthermore, treatment with antifibronectin antibodies decreased Ail-mediated adhesion by KIM5 and the KIM5 Δpla mutant, indicating that the Ail-fibronectin interaction was important for cell binding. Finally, antifibronectin antibodies inhibited the KIM5-mediated cytotoxicity of host cells in an Ail-dependent fashion. These data indicate that Ail is a key adhesin that mediates binding to host cells through interaction with fibronectin on the surface of host cells, and this interaction is important for Yop delivery by Y. pestis. PMID:20498264

  14. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    Science.gov (United States)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  15. Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

    Science.gov (United States)

    Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

    2018-02-02

    There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

  16. Recombination Phenotypes of Escherichia coli greA Mutants

    Directory of Open Access Journals (Sweden)

    Poteete Anthony R

    2011-03-01

    Full Text Available Abstract Background The elongation factor GreA binds to RNA polymerase and modulates transcriptional pausing. Some recent research suggests that the primary role of GreA may not be to regulate gene expression, but rather, to promote the progression of replication forks which collide with RNA polymerase, and which might otherwise collapse. Replication fork collapse is known to generate dsDNA breaks, which can be recombinogenic. It follows that GreA malfunction could have consequences affecting homologous recombination. Results Escherichia coli mutants bearing substitutions of the active site acidic residues of the transcription elongation factor GreA, D41N and E44K, were isolated as suppressors of growth inhibition by a toxic variant of the bacteriophage lambda Red-beta recombination protein. These mutants, as well as a D41A greA mutant and a greA deletion, were tested for proficiency in recombination events. The mutations were found to increase the efficiency of RecA-RecBCD-mediated and RecA-Red-mediated recombination, which are replication-independent, and to decrease the efficiency of replication-dependent Red-mediated recombination. Conclusion These observations provide new evidence for a role of GreA in resolving conflicts between replication and transcription.

  17. Mutants for plant height in hexaploid triticale

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Gupta, P.K.

    1988-01-01

    Full text: Four hexaploid triticale varieties namely Beagle, Coorong, TL 419 and Welsh were subjected to gamma rays (100 Gy, 200 Gy, 300 Gy) and to aqueous solution of EMS (0.5%, (8h, 12h, 16h). In all four varieties, three types of mutants for plant height were observed: Semidwarf - the mutant plants are 20-25 cm shorter than the shortest plant in the control. Dwarf - mutant plants grow up to 40-60 cm. Stunted - mutant plants grow up to 10-20 cm. The segregation pattern suggests that semidwarf mutants are quantitatively inherited, showing continuous segregation in M 3 , M 4 and M 5 , whereas dwarf and stunted are monogenic recessive. They showed true breeding in M 3 and later generations. The semi-dwarf, dwarf and stunted mutants can be used as initial material for development of new varieties with short straw and resistance to lodging. (author)

  18. Gamma ray induced mutants in Colocasia

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    Presented are selected treatments with 250 r, 500 r and 1000 r gamma rays Colocasia mutants with changes in morphological and yield characters. Results from a preliminary yield trial of four mutants with its control variety C 9 are presented. The mutant's characteristics are (i) erect and narrow leaf (ii) cup shaped leaf, dwarf, matures within 120 days against 180 days in control (iii) narrow and thicker leaves, colour of lamina chalky and pale green (iv) vigorous

  19. Structural dataset for the PPARγ V290M mutant

    Directory of Open Access Journals (Sweden)

    Ana C. Puhl

    2016-06-01

    Full Text Available Loss-of-function mutation V290M in the ligand-binding domain of the peroxisome proliferator activated receptor γ (PPARγ is associated with a ligand resistance syndrome (PLRS, characterized by partial lipodystrophy and severe insulin resistance. In this data article we discuss an X-ray diffraction dataset that yielded the structure of PPARγ LBD V290M mutant refined at 2.3 Å resolution, that allowed building of 3D model of the receptor mutant with high confidence and revealed continuous well-defined electron density for the partial agonist diclofenac bound to hydrophobic pocket of the PPARγ. These structural data provide significant insights into molecular basis of PLRS caused by V290M mutation and are correlated with the receptor disability of rosiglitazone binding and increased affinity for corepressors. Furthermore, our structural evidence helps to explain clinical observations which point out to a failure to restore receptor function by the treatment with a full agonist of PPARγ, rosiglitazone.

  20. Percutaneous endoscopic lumbar discectomy for L5-S1 disc herniation: transforaminal versus interlaminar approach.

    Science.gov (United States)

    Choi, Kyung Chul; Kim, Jin-Sung; Ryu, Kyeong-Sik; Kang, Byung Uk; Ahn, Yong; Lee, Sang-Ho

    2013-01-01

    Percutaneous endoscopic lumbar discectomy (PELD) is a minimally invasive spinal technique. The unique anatomic features of the L5-S1 space include a large facet joint, narrow foramen, small disc space, and a wide interlaminar space. PELD can be performed via 2 routes, transforaminal (TF-PELD) or interlaminar (IL-PELD). However, it is questionable that the decision of the endoscopic route for L5-S1 discs only depends on the surgeon's preference and anatomic relation between iliac bone and disc space. Thus far, no study has compared TF-PELD with IL-PELD for L5-S1 disc herniation. The goal of this study was to compare the radiologic features and results of TF-PELD and IL-PELD. We have clarified the patient selection for the PELD route for L5-S1 disc herniation. Retrospective evaluation. Thirty consecutive patients each were treated with TF-PELD and IL-PELD for L5-S1 disc herniation in 2 institutes, respectively. Radiological assessments were performed pre- and postoperatively. The disc type, disc size, location, migration, disc height, foraminal height, iliolumbar angle, iliac height, and interlaminar space were analyzed. Clinical data were compared with a 2-year follow-up period. Pre- and postoperative pain was measured using a visual analog scale (VAS; 0 - 10) and functional status was assessed using the Oswestry Disability Index (ODI; 0 - 100%) and the time to return to work. In the 2 groups, the mean VAS scores for back and leg pain, as well as the ODI, were significantly improved. The mean time to return to work was 4.9 weeks with TF-PELD and 4.4 weeks with IL-PELD. Incomplete removal, resulting in the need for subsequent open surgery, occurred in one case (3.3%) of TF-PELD and in 2 cases (6.6%) of IL-PELD. Postoperative dysesthesia developed in 2 patients (6.7%) after IL-PELD; however, there was no dysesthesia after TF-PELD. Recurrence occurred in 3.3% with TF-PELD and in 6.7% with IL-PELD during the 2-year follow-up. A significant difference between groups was

  1. A sialidase mutant displaying trans-sialidase activity.

    Science.gov (United States)

    Paris, Gastón; Ratier, Laura; Amaya, María Fernanda; Nguyen, Tong; Alzari, Pedro M; Frasch, Alberto Carlos C

    2005-01-28

    Trypanosoma cruzi, the agent of Chagas disease, expresses a modified sialidase, the trans-sialidase, which transfers sialic acid from host glycoconjugates to beta-galactose present in parasite mucins. Another American trypanosome, Trypanosoma rangeli, expresses a homologous protein that has sialidase activity but is devoid of transglycosidase activity. Based on the recently determined structures of T.rangeli sialidase (TrSA) and T.cruzi trans-sialidase (TcTS), we have now constructed mutants of TrSA with the aim of studying the relevant residues in transfer activity. Five mutations, Met96-Val, Ala98-Pro, Ser120-Tyr, Gly249-Tyr and Gln284-Pro, were enough to obtain a sialidase mutant (TrSA(5mut)) with trans-sialidase activity; and a sixth mutation increased the activity to about 10% that of wild-type TcTS. The crystal structure of TrSA(5mut) revealed the formation of a trans-sialidase-like binding site for the acceptor galactose, primarily defined by the phenol group of Tyr120 and the indole ring of Trp313, which adopts a new conformation, similar to that in TcTS, induced by the Gln284-Pro mutation. The transition state analogue 2,3-didehydro-2-deoxy-N-acetylneuraminic acid (DANA), which inhibits sialidases but is a poor inhibitor of trans-sialidase, was used to probe the active site conformation of mutant enzymes. The results show that the presence of a sugar acceptor binding-site, the fine-tuning of protein-substrate interactions and the flexibility of crucial active site residues are all important to achieve transglycosidase activity from the TrSA sialidase scaffold.

  2. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region...

  3. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two...... RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...

  4. Structural characterization of small Xe clusters using their 5s correlation satellite electron spectrum.

    Science.gov (United States)

    Patanen, Minna; Nicolas, Christophe; Liu, Xiao-Jing; Travnikova, Oksana; Miron, Catalin

    2013-07-07

    The Xe 5s photoelectron spectrum and 5p(4)nl correlation satellites have been studied in small Xe clusters of an average size of about 15 atoms. The satellite structures are interpreted with the help of the atomic Xe lines. Transition energy shifts between the atomic and the corner/edge/face/bulk components in clusters are divided into polarization screening and exchange interaction energy. Interestingly enough, the ratios between corner/edge/face/bulk polarization screening and exchange interaction energies are found to reflect the ratios of the coordination numbers of corner/edge/face/bulk atoms in these small icosahedral cluster structures.

  5. The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

    Science.gov (United States)

    Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

    2017-08-01

    The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

  6. Mutated Leguminous Lectin Containing a Heparin-Binding like Motif in a Carbohydrate-Binding Loop Specifically Binds to Heparin.

    Directory of Open Access Journals (Sweden)

    Hirohito Abo

    Full Text Available We previously introduced random mutations in the sugar-binding loops of a leguminous lectin and screened the resulting mutated lectins for novel specificities using cell surface display. Screening of a mutated peanut agglutinin (PNA, revealed a mutated PNA with a distinct preference for heparin. Glycan microarray analyses using the mutated lectin fused to the Fc region of human immunoglobulin, revealed that a particular sulfated glycosaminoglycan (GAG, heparin, had the highest binding affinity for mutated PNA among 97 glycans tested, although wild-type PNA showed affinity towards Galβ1-3GalNAc and similar galactosylated glycans. Further analyses of binding specificity using an enzyme-linked immunoadsorbent assay demonstrated that the mutated PNA specifically binds to heparin, and weakly to de-2-O-sulfated heparin, but not to other GAG chains including de-6-O-sulfated and de-N-sulfated heparins. The mutated PNA had six amino acid substitutions within the eight amino acid-long sugar-binding loop. In this loop, the heparin-binding like motif comprised three arginine residues at positions 124, 128, and 129, and a histidine at position 125 was present. Substitution of each arginine or histidine residue to alanine reduced heparin-binding ability, indicating that all of these basic amino acid residues contributed to heparin binding. Inhibition assay demonstrated that heparin and dextran sulfate strongly inhibited mutated PNA binding to heparin in dose-dependent manner. The mutated PNA could distinguish between CHO cells and proteoglycan-deficient mutant cells. This is the first report establishing a novel leguminous lectin that preferentially binds to highly sulfated heparin and may provide novel GAG-binding probes to distinguish between heterogeneous GAG repeating units.

  7. Mutated Leguminous Lectin Containing a Heparin-Binding like Motif in a Carbohydrate-Binding Loop Specifically Binds to Heparin.

    Science.gov (United States)

    Abo, Hirohito; Soga, Keisuke; Tanaka, Atsuhiro; Tateno, Hiroaki; Hirabayashi, Jun; Yamamoto, Kazuo

    2015-01-01

    We previously introduced random mutations in the sugar-binding loops of a leguminous lectin and screened the resulting mutated lectins for novel specificities using cell surface display. Screening of a mutated peanut agglutinin (PNA), revealed a mutated PNA with a distinct preference for heparin. Glycan microarray analyses using the mutated lectin fused to the Fc region of human immunoglobulin, revealed that a particular sulfated glycosaminoglycan (GAG), heparin, had the highest binding affinity for mutated PNA among 97 glycans tested, although wild-type PNA showed affinity towards Galβ1-3GalNAc and similar galactosylated glycans. Further analyses of binding specificity using an enzyme-linked immunoadsorbent assay demonstrated that the mutated PNA specifically binds to heparin, and weakly to de-2-O-sulfated heparin, but not to other GAG chains including de-6-O-sulfated and de-N-sulfated heparins. The mutated PNA had six amino acid substitutions within the eight amino acid-long sugar-binding loop. In this loop, the heparin-binding like motif comprised three arginine residues at positions 124, 128, and 129, and a histidine at position 125 was present. Substitution of each arginine or histidine residue to alanine reduced heparin-binding ability, indicating that all of these basic amino acid residues contributed to heparin binding. Inhibition assay demonstrated that heparin and dextran sulfate strongly inhibited mutated PNA binding to heparin in dose-dependent manner. The mutated PNA could distinguish between CHO cells and proteoglycan-deficient mutant cells. This is the first report establishing a novel leguminous lectin that preferentially binds to highly sulfated heparin and may provide novel GAG-binding probes to distinguish between heterogeneous GAG repeating units.

  8. Evolution of Mexican Bursera (Burseraceae) inferred from ITS, ETS, and 5S nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Becerra, Judith X

    2003-02-01

    I reconstructed a phylogeny of 66 species and varieties of Bursera and 9 outgroup species using sequences of the internal transcribed spacer region (ITS), the 5S non-transcribed region (5S-NTS), and the external transcribed region (ETS) of nuclear ribosomal DNA. This study extends a previously proposed parsimony-based phylogenetic study that used the ITS sequences of 57 Bursera species and five outgroups. Parsimony and maximum likelihood methods were used to infer the phylogeny in this new study. Analyses of the combined data sets largely confirmed the phylogenetic relationships proposed by the previous molecular study but generated a considerably more robust topology. The new phylogenies corroborate the monophyly of the genus, and its division into the two monophyletic subgenera or sections, Bursera and Bullockia. The current analyses also identify four main groups of species in section Bursera, and two in section Bullockia, confirming some of the previously proposed groups based on fruit, flower, and leaf morphology. One previously problematic species B. sarcopoda, which has sometimes been placed in Commiphora, is shown to belong in Bursera. Another controversial species, Commiphora leptophloeos, which was thought to belong to Bursera, falls within Commiphora.

  9. iPhone 4s and iPhone 5s Imaging of the Eye.

    Science.gov (United States)

    Jalil, Maaz; Ferenczy, Sandor R; Shields, Carol L

    2017-01-01

    To evaluate the technical feasibility of a consumer-grade cellular iPhone camera as an ocular imaging device compared to existing ophthalmic imaging equipment for documentation purposes. A comparison of iPhone 4s and 5s images was made with external facial images (macrophotography) using Nikon cameras, slit-lamp images (microphotography) using Zeiss photo slit-lamp camera, and fundus images (fundus photography) using RetCam II. In an analysis of six consecutive patients with ophthalmic conditions, both iPhones achieved documentation of external findings (macrophotography) using standard camera modality, tap to focus, and built-in flash. Both iPhones achieved documentation of anterior segment findings (microphotography) during slit-lamp examination through oculars. Both iPhones achieved fundus imaging using standard video modality with continuous iPhone illumination through an ophthalmic lens. Comparison to standard ophthalmic cameras, macrophotography and microphotography were excellent. In comparison to RetCam fundus photography, iPhone fundus photography revealed smaller field and was technically more difficult to obtain, but the quality was nearly similar to RetCam. iPhone versions 4s and 5s can provide excellent ophthalmic macrophotography and microphotography and adequate fundus photography. We believe that iPhone imaging could be most useful in settings where expensive, complicated, and cumbersome imaging equipment is unavailable.

  10. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Science.gov (United States)

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  11. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    Science.gov (United States)

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  12. ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.

    Science.gov (United States)

    Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining

    2016-10-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.

  13. Flocculation phenomenon of a mutant flocculent Saccharomyces ...

    African Journals Online (AJOL)

    The flocculation mechanism of a stable mutant flocculent yeast strain Saccharomyces cerevisiae KRM-1 was quantitatively investigated for potential industrial interest. It was found that the mutant flocculent strain was NewFlo phenotype by means of sugar inhibition test. The flocculation was completely inhibited by treatment ...

  14. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

  15. Los mutantes de la escuela

    Directory of Open Access Journals (Sweden)

    Diego Armando Jaramillo-Ocampo

    2013-01-01

    Full Text Available El presente artículo muestra los resultados parciales del estudio “Juegos en el recreo escolar: un escenario para la formación ciudadana”, cuya pretensión fue comprender los imaginarios sociales de juego en el recreo escolar y su relación con la convivencia social desde la proximidad del enfoque de complementariedad y el diseño de investigación emergente, planteado por Murcia y Jaramillo (2008. Se presentan los desarrollos logrados en dos categorías centrales del estudio: el patio y el cuerpo; dos categorías que mutan constantemente como entidades vivas en la escuela, hacia la configuración de sujetos que reconocen en el otro y lo otro su posibilidad. La escuela viva, donde es posible “ser en relación con”… se reduce a un espacio temporal y físico, limitado por la campana, “el recreo”. El texto muestra, desde la voz de los actores, esa vida que se da y se quita en la escuela y que se posiciona como una más de las imposiciones normalizadas para controlar. Reconoce, finalmente, una propuesta desde la posibilidad que estos dos mutantes propician para una escuela libre y dinámica.

  16. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  17. Transcriptome Analysis of Cold Acclimation in Barley Albina and Xantha Mutants1[W

    Science.gov (United States)

    Svensson, Jan T.; Crosatti, Cristina; Campoli, Chiara; Bassi, Roberto; Stanca, Antonio Michele; Close, Timothy J.; Cattivelli, Luigi

    2006-01-01

    Previously, we have shown that barley (Hordeum vulgare) plants carrying a mutation preventing chloroplast development are completely frost susceptible as well as impaired in the expression of several cold-regulated genes. Here we investigated the transcriptome of barley albina and xantha mutants and the corresponding wild type to assess the effect of the chloroplast on expression of cold-regulated genes. First, by comparing control wild type against cold-hardened wild-type plants 2,735 probe sets with statistically significant changes (P = 0.05; ≥2-fold change) were identified. Expression of these wild-type cold-regulated genes was then analyzed in control and cold-hardened mutants. Only about 11% of the genes cold regulated in wild type were regulated to a similar extent in all genotypes (chloroplast-independent cold-regulated genes); this class includes many genes known to be under C-repeat binding factor control. C-repeat binding factor genes were also equally induced in mutants and wild-type plants. About 67% of wild-type cold-regulated genes were not regulated by cold in any mutant (chloroplast-dependent cold-regulated genes). We found that the lack of cold regulation in the mutants is due to the presence of signaling pathway(s) normally cold activated in wild type but constitutively active in the mutants, as well as to the disruption of low-temperature signaling pathway(s) due to the absence of active chloroplasts. We also found that photooxidative stress signaling pathway is constitutively active in the mutants. These results demonstrate the major role of the chloroplast in the control of the molecular adaptation to cold. PMID:16603669

  18. Transcriptome analysis of cold acclimation in barley albina and xantha mutants.

    Science.gov (United States)

    Svensson, Jan T; Crosatti, Cristina; Campoli, Chiara; Bassi, Roberto; Stanca, Antonio Michele; Close, Timothy J; Cattivelli, Luigi

    2006-05-01

    Previously, we have shown that barley (Hordeum vulgare) plants carrying a mutation preventing chloroplast development are completely frost susceptible as well as impaired in the expression of several cold-regulated genes. Here we investigated the transcriptome of barley albina and xantha mutants and the corresponding wild type to assess the effect of the chloroplast on expression of cold-regulated genes. First, by comparing control wild type against cold-hardened wild-type plants 2,735 probe sets with statistically significant changes (P = 0.05; > or = 2-fold change) were identified. Expression of these wild-type cold-regulated genes was then analyzed in control and cold-hardened mutants. Only about 11% of the genes cold regulated in wild type were regulated to a similar extent in all genotypes (chloroplast-independent cold-regulated genes); this class includes many genes known to be under C-repeat binding factor control. C-repeat binding factor genes were also equally induced in mutants and wild-type plants. About 67% of wild-type cold-regulated genes were not regulated by cold in any mutant (chloroplast-dependent cold-regulated genes). We found that the lack of cold regulation in the mutants is due to the presence of signaling pathway(s) normally cold activated in wild type but constitutively active in the mutants, as well as to the disruption of low-temperature signaling pathway(s) due to the absence of active chloroplasts. We also found that photooxidative stress signaling pathway is constitutively active in the mutants. These results demonstrate the major role of the chloroplast in the control of the molecular adaptation to cold.

  19. Characterization and protective property of Brucella abortus cydC and looP mutants.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Barate, Abhijit Kashinath; Kim, Suk; Hahn, Tae-Wook

    2014-11-01

    Brucella abortus readily multiplies in professional or nonprofessional phagocytes in vitro and is highly virulent in mice. Isogenic mutants of B. abortus biovar 1 strain IVKB9007 lacking the ATP/GDP-binding protein motif A (P-loop) (named looP; designated here the IVKB9007 looP::Tn5 mutant) and the ATP-binding/permease protein (cydC; designated here the IVKB9007 cydC::Tn5 mutant) were identified and characterized by transposon mutagenesis using the mini-Tn5Km2 transposon. Both mutants were found to be virtually incapable of intracellular replication in both murine macrophages (RAW264.7) and the HeLa cell line, and their virulence was significantly impaired in BALB/c mice. Respective complementation of the IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants restored their ability to survive in vitro and in vivo to a level comparable with that of the wild type. These findings indicate that the cydC and looP genes play important roles in the virulence of B. abortus. In addition, intraperitoneal immunization of mice with a dose of the live IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants provided a high degree of protection against challenge with pathogenic B. abortus strain 544. Both mutants should be evaluated further as a live attenuated vaccine against bovine brucellosis for their ability to stimulate a protective immune response. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Willson Richard C

    2010-12-01

    Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

  1. High- and low-affinity binding of S-citalopram to the human serotonin transporter mutated at 20 putatively important amino acid positions

    DEFF Research Database (Denmark)

    Plenge, Per; Wiborg, Ove

    2005-01-01

    of presumed importance. Binding of S-citalopram, both to the high-affinity-binding site and to the allosteric binding site, was measured in these mutants with the purpose of investigating the connection between the two binding sites. The amino acid substitutions did not introduce large changes in the two...

  2. Analysis of crystal structure of Arabidopsis MPK6 and generation of its mutants with higher activity.

    Science.gov (United States)

    Wang, Bo; Qin, Xinghua; Wu, Juan; Deng, Hongying; Li, Yuan; Yang, Hailian; Chen, Zhongzhou; Liu, Guoqin; Ren, Dongtao

    2016-05-10

    Mitogen-activated protein kinase (MAPK) cascades, which are the highly conserved signalling modules in eukaryotic organisms, have been shown to play important roles in regulating growth, development, and stress responses. The structures of various MAPKs from yeast and animal have been solved, and structure-based mutants were generated for their function analyses, however, the structures of plant MAPKs remain unsolved. Here, we report the crystal structure of Arabidopsis MPK6 at a 3.0 Å resolution. Although MPK6 is topologically similar to ERK2 and p38, the structures of the glycine-rich loop, MAPK insert, substrate binding sites, and L16 loop in MPK6 show notable differences from those of ERK2 and p38. Based on the structural comparison, we constructed MPK6 mutants and analyzed their kinase activity both in vitro and in planta. MPK6(F364L) and MPK6(F368L) mutants, in which Phe364 and Phe368 in the L16 loop were changed to Leu, respectively, acquired higher intrinsic kinase activity and retained the normal MAPKK activation property. The expression of MPK6 mutants with basal activity is sufficient to induce camalexin biosynthesis; however, to induce ethylene and leaf senescence, the expression of MPK6 mutants with higher activity is required. The results suggest that these mutants can be used to analyze the specific biological functions of MPK6.

  3. Tissue specificity of endothelin binding sites

    Energy Technology Data Exchange (ETDEWEB)

    Bolger, G.T.; Liard, F.; Krogsrud, R.; Thibeault, D.; Jaramillo, J. (BioMega, Inc., Laval, Quebec (Canada))

    1990-09-01

    A measurement was made of the binding of 125I-labeled endothelin (125I-ET) to crude membrane fractions prepared from rat aorta, atrium, ventricle, portal vein, trachea, lung parenchyma, vas deferens, ileum, bladder, and guinea-pig taenia coli and lung parenchyma. Scatchard analysis of 125I-ET binding in all tissues indicated binding to a single class of saturable sites. The affinity and density of 125I-ET binding sites varied between tissues. The Kd of 125I-ET binding was approximately 0.5 nM for rat aorta, trachea, lung parenchyma, ventricle, bladder, and vas deferens, and guinea-pig taenia coli and lung parenchyma, 1.8 nM for rat portal vein and atrium, and 3.3 nM for ileum. The Bmax of 125I-ET binding had the following rank order of density in rat tissues: trachea greater than lung parenchyma = vas deferens much greater than aorta = portal vein = atrium greater than bladder greater than ventricle = ileum. The properties of 125I-ET endothelin binding were characterized in rat ventricular membranes. 125I-ET binding was time dependent, reaching a maximum within 45-60 min at 25 degrees C. The calculated microassociation constant was 9.67 x 10(5) s-1 M-1. Only 15-20% of 125I-ET dissociated from its binding site even when dissociation was studied as long as 3 h. Preincubation of ventricular membranes with ET prevented binding of 125I-ET. 125I-ET binding was destroyed by boiling of ventricular membranes and was temperature, pH, and cation (Ca2+, Mg2+, and Na+) dependent.

  4. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  5. Ligand and proton exchange dynamics in recombinant human myoglobin mutants.

    Science.gov (United States)

    Lambright, D G; Balasubramanian, S; Boxer, S G

    1989-05-05

    Site-specific mutants of human myoglobin have been prepared in which lysine 45 is replaced by arginine (K45R) and aspartate 60 by glutamate (D60E), in order to examine the influence of these residues and their interaction on the dynamics of the protein. These proteins were studied by a variety of methods, including one and two-dimensional proton nuclear magnetic resonance spectroscopy, exchange kinetics for the distal and proximal histidine NH protons as a function of pH in the met cyano forms, flash photolysis of the CO forms, and ligand replacement kinetics. The electronic absorption and proton nuclear magnetic resonance spectra of the CO forms of these proteins are virtually identical, indicating that the structure of the heme pocket is unaltered by these mutations. There are, however, substantial changes in the dynamics of both CO binding and proton exchange for the mutant K45R, whereas the mutant D60E exhibits behavior indistinguishable from the reference human myoglobin. K45R has a faster CO bimolecular recombination rate and slower CO off-rate relative to the reference. The kinetics for CO binding are independent of pH (6.5 to 10) as well as ionic strength (0 to 1 M-NaCl). The exchange rate for the distal histidine NH is substantially lower for K45R than the reference, whereas the proximal histidine NH exchange rate is unaltered. The exchange behavior of the human proteins is similar to that reported for a comparison of the exchange rates for myoglobins having lysine at position 45 with sperm whale myoglobin, which has arginine at this position. This indicates that the differences in exchange rates reflects largely the Lys----Arg substitution. The lack of a simple correlation for the CO kinetics with this substitution means that these are sensitive to other factors as well. Specific kinetic models, whereby substitution of arginine for lysine at position 45 can affect ligand binding dynamics, are outlined. These experiments demonstrate that a relatively

  6. The Adenovirus Type 3 Dodecahedron's RGD Loop Comprises an HSPG Binding Site That Influences Integrin Binding

    Directory of Open Access Journals (Sweden)

    E. Gout

    2010-01-01

    Full Text Available Human type 3 adenovirus dodecahedron (a virus like particle made of twelve penton bases features the ability to enter cells through Heparan Sulphate Proteoglycans (HSPGs and integrins interaction and is used as a versatile vector to deliver DNA or proteins. Cryo-EM reconstruction of the pseudoviral particle with Heparan Sulphate (HS oligosaccharide shows an extradensity on the RGD loop. A set of mutants was designed to study the respective roles of the RGD sequence (RGE mutant and of a basic sequence located just downstream. Results showed that the RGE mutant binding to the HS deficient CHO-2241 cells was abolished and unexpectedly, mutation of the basic sequence (KQKR to AQAS dramatically decreased integrin recognition by the viral pseudoparticle. This basic sequence is thus involved in integrin docking, showing a close interplay between HSPGs and integrin receptors.

  7. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  8. [Nucleotide sequences of 5S rRNA genes of polyploid species of wheat and Aegilops species].

    Science.gov (United States)

    Vakhitov, V A; Gimalov, F R; Shumiatskiĭ, G P

    1989-01-01

    Primary structures of 5S rRNA genes and of non-transcribed spacers between them were determined in families of 5S DNA repeats 420 and 500 b.p. long in 8 wheat and Aegilops species. The high conservatism of sequences coding for 5S rRNA, 3'- and 5'-ends of non-transcribed spacers was shown not to depend on the evolutional position, ploidy level and genomic composition of species. The activity of transcription of 5S rRNA cloned genes was determined in vitro. The functional heterogeneity was revealed in each family of repeats due to the existence of exchanges of separate nucleotides within the internal transcription control region. A greater deficiency of CpG dinucleotide was revealed in 5S rRNA genes than in non-transcribed spacers.

  9. A titratable two-step transcriptional amplification strategy for targeted gene therapy based on ligand-induced intramolecular folding of a mutant human estrogen receptor

    DEFF Research Database (Denmark)

    Chen, Ian Y; Paulmurugan, Ramasamy; Nielsen, Carsten Haagen

    2014-01-01

    firefly luciferase reporter gene (fluc) depends on the binding of its mutant estrogen receptor (ER(G521T)) ligand binding domain (LBD) to an ER ligand such as raloxifene. Mice underwent either intramyocardial or hydrodynamic tail vein (HTV) injection of pcTnT-tTSTA-fluc, followed by differential...

  10. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  11. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  12. X-rays sensitive mammalian cell mutant

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1982-01-01

    A phenomenon that in x-ray-sensitive mammalian-cell mutants, cellular death due to x-ray radiation was not increased by caffeine, but on the contrary, the dead cells were resuscitated by it was discussed. The survival rate of mutant cells increased by caffein in a low concentration. This suggested that caffeine may have induced some mechanism to produce x-ray resistant mutant cells. Postirradiation treatment with caffeine increased considerably the survival rate of the mutant cells, and this suggested the existence of latent caffeine-sensitive potentially lethal damage repair system. This system, after a few hours, is thought to be substituted by caffeine-resistant repair system which is induced by caffeine, and this may be further substituted by x-ray-resistant repair system. The repair system was also induced by adenine. (Ueda, J.)

  13. Semi-dwarf mutants for rice improvement

    International Nuclear Information System (INIS)

    Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli

    1990-01-01

    Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)

  14. Structure-Based Redesign of Cofactor Binding in Putrescine Oxidase

    NARCIS (Netherlands)

    Kopacz, Malgorzata M.; Rovida, Stefano; van Duijn, Esther; Fraaije, Marco W.; Mattevi, Andrea

    2011-01-01

    Putrescine oxidase (PuO) from Rhodococcus erythropolis is a soluble homodimeric Flavoprotein, which oxidizes small aliphatic diamines. In this study, we report the crystal structures and cofactor binding properties of wild-type and mutant enzymes. From a structural viewpoint, PuO closely resembles

  15. Robust mutant strain design by pessimistic optimization.

    Science.gov (United States)

    Apaydin, Meltem; Xu, Liang; Zeng, Bo; Qian, Xiaoning

    2017-10-03

    Flux Balance Analysis (FBA) based mathematical modeling enables in silico prediction of systems behavior for genome-scale metabolic networks. Computational methods have been derived in the FBA framework to solve bi-level optimization for deriving "optimal" mutant microbial strains with targeted biochemical overproduction. The common inherent assumption of these methods is that the surviving mutants will always cooperate with the engineering objective by overproducing the maximum desired biochemicals. However, it has been shown that this optimistic assumption may not be valid in practice. We study the validity and robustness of existing bi-level methods for strain optimization under uncertainty and non-cooperative environment. More importantly, we propose new pessimistic optimization formulations: P-ROOM and P-OptKnock, aiming to derive robust mutants with the desired overproduction under two different mutant cell survival models: (1) ROOM assuming mutants have the minimum changes in reaction fluxes from wild-type flux values, and (2) the one considered by OptKnock maximizing the biomass production yield. When optimizing for desired overproduction, our pessimistic formulations derive more robust mutant strains by considering the uncertainty of the cell survival models at the inner level and the cooperation between the outer- and inner-level decision makers. For both P-ROOM and P-OptKnock, by converting multi-level formulations into single-level Mixed Integer Programming (MIP) problems based on the strong duality theorem, we can derive exact optimal solutions that are highly scalable with large networks. Our robust formulations P-ROOM and P-OptKnock are tested with a small E. coli core metabolic network and a large-scale E. coli iAF1260 network. We demonstrate that the original bi-level formulations (ROOM and OptKnock) derive mutants that may not achieve the predicted overproduction under uncertainty and non-cooperative environment. The knockouts obtained by the

  16. Postdural disc herniation at L5/S1 level mimicking an extradural spinal tumor.

    Science.gov (United States)

    Li, Kunpeng; Li, Zhong; Geng, Wei; Wang, Chenghu; Ma, Jinzhu

    2016-05-01

    Postdural disc herniation has been documented rarely and the pathogenesis is still unknown. The average age of postdural disc herniations is between 50 and 60 years, and the sites most frequently affected by postdural lumbar disc herniations are L3-L4 and L4-L5, only less than 10 % in L5-S1. Although magnetic resonance imaging (MRI) is a useful tool in the diagnosis of this disease, the postdural disc herniation is usually misdiagnosed as extradural spine tumor preoperatively. The definitive diagnosis is made during operation or according to the postoperative pathology. In this article, we described here a 48-year-old male patient who presented with intermittent pain in the low back and frequent urination for 4 years as well as hypesthesia and pain of the left lower extremity for 1 month. A standard total laminectomy was performed and the histopathological diagnosis was consistent with a degenerated intervertebral disc. The patient presented significant relief of the pain and of the neurological symptoms, but no improvement of frequent urination, in the postoperative period. The diagnosis of postdural disc herniations is very difficult and mainly based on intraoperative and histopathological results. Early surgical intervention is important to relieve symptoms and prevent severe neurological deficits.

  17. Secondary structure and domain architecture of the 23S and 5S rRNAs.

    Science.gov (United States)

    Petrov, Anton S; Bernier, Chad R; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C; Hsiao, Chiaolong; Stepanov, Victor G; Gaucher, Eric A; Grover, Martha A; Harvey, Stephen C; Hud, Nicholas V; Wartell, Roger M; Fox, George E; Williams, Loren Dean

    2013-08-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery).

  18. Secondary structure and domain architecture of the 23S and 5S rRNAs

    Science.gov (United States)

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  19. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  20. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  1. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. 5S rDNA characterization in twelve Sciaenidae fish species (Teleostei, Perciformes: depicting gene diversity and molecular markers

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2008-01-01

    Full Text Available In order to extend the genetic data on the Sciaenidae fish family, the present study had the purpose to characterize PCR-generated 5S rDNA repeats of twelve species of this group through PAGE (Polyacrylamide Gel Electrophoresis analysis. The results showed the occurrence of at least two different 5S rDNA size classes in all the species. Moreover, 5S rDNA repeats of one of the studied species - Isopisthus parvipinnis - were cloned and subjected to nucleotide sequencing and Southern blot membrane hybridization analyses, which permitted to confirm the existence of two major 5S rDNA classes. Phylogenetic analysis based on the nucleotide sequences of different 5S rDNA repeats of I. parvipinnis lead to their separation into two major clusters. These results may reflect the high dynamism that rules the evolution rate of 5S rDNA repeats. The obtained data suggest that 5S rDNA can be useful in genetic analyses to identify species-specific markers and determine relationships among species of the Sciaenidae group.

  3. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  4. Mutant ribosomes can generate dominant kirromycin resistance.

    Science.gov (United States)

    Tubulekas, I; Buckingham, R H; Hughes, D

    1991-01-01

    Mutations in the two genes for EF-Tu in Salmonella typhimurium and Escherichia coli, tufA and tufB, can confer resistance to the antibiotic kirromycin. Kirromycin resistance is a recessive phenotype expressed when both tuf genes are mutant. We describe a new kirromycin-resistant phenotype dominant to the effect of wild-type EF-Tu. Strains carrying a single kirromycin-resistant tuf mutation and an error-restrictive, streptomycin-resistant rpsL mutation are resistant to high levels of kirromycin, even when the other tuf gene is wild type. This phenotype is dependent on error-restrictive mutations and is not expressed with nonrestrictive streptomycin-resistant mutations. Kirromycin resistance is also expressed at a low level in the absence of any mutant EF-Tu. These novel phenotypes exist as a result of differences in the interactions of mutant and wild-type EF-Tu with the mutant ribosomes. The restrictive ribosomes have a relatively poor interaction with wild-type EF-Tu and are thus more easily saturated with mutant kirromycin-resistant EF-Tu. In addition, the mutant ribosomes are inherently kirromycin resistant and support a significantly faster EF-Tu cycle time in the presence of the antibiotic than do wild-type ribosomes. A second phenotype associated with combinations of rpsL and error-prone tuf mutations is a reduction in the level of resistance to streptomycin. PMID:2050625

  5. Commercialization Of Orchid Mutants For Floriculture Industry

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Zaiton Ahmad

    2014-01-01

    Orchids are the main contributors to cut flower industry in Malaysia with an existing good market and a huge business potential. Orchid industry has been established in Malaysia since 1960s but only started to develop and expand since 1980s. Continuous development of new orchid varieties is essential to meet customers' demands. Orchid mutagenesis research using gamma irradiation at Malaysian Nuclear Agency has successfully generated a number of new orchid varieties with commercial potentials. Therefore, Nuclear Malaysia has collaborated with an industrial partner, Hexagon Green Sdn Bhd (HGSB), to carry out commercialization research on these mutants under a Technofund project entitled 'Pre-Commercialization of Mutant Orchids for Cut Flowers Industry' from July 2011 to July 2014. Through this collaboration, Dendrobium orchid mutant plants developed by Nuclear Malaysia were transferred to HGSB's commercial orchid nursery at Bukit Changgang Agrotechnology Park, Banting, Selangor, for mass-propagation. The activities include evaluations on plant growth performance, flower quality, post harvest and market potential of these mutants. Mutants with good field performance have been identified and filed for Plant Variety Protection (PVP) with Department of Agriculture Malaysia. This paper describes outputs from this collaboration and activities undertaken in commercializing these mutants. (author)

  6. Structural features and activity of Brazzein and its mutants upon substitution of a surfaced exposed alanine.

    Science.gov (United States)

    Ghanavatian, Parisa; Khalifeh, Khosrow; Jafarian, Vahab

    2016-12-01

    Brazzein (Brz) is a member of sweet-tasting protein containing four disulfide bonds. It was reported as a compact and heat-resistant protein. Here, we have used site-directed mutagenesis and replaced a surface-exposed alanine with aspartic acid (A19D mutant), lysine (A19K mutant) and glycine (A19G mutant). Activity comparisons of wild-type (WT) and mutants using taste panel test procedure showed that A19G variant has the same activity as WT protein. However, introduction of a positive charge in A19K mutant led to significant increase in Brz's sweetness, while A19D has reduced sweetness compared to WT protein. Docking studies showed that mutation at position 19 results in slight chain mobility of protein at the binding surface and changing the patterns of interactions toward more effective binding of E9K variant in the concave surface of sweet taste receptor. Far-UV CD data spectra have a characteristic shape of beta structure for all variants, however different magnitudes of spectra suggest that beta-sheet structure in WT and A19G is more stable than that of A19D and A19K. Equilibrium unfolding studies with fluorescence spectroscopy and using urea and dithiothritol (DTT) as chemical denaturants indicates that A19G mutant gains more stability against urea denaturation; while conformational stability of A19D and A19K decreases when compared with WT and A19G variants. We concluded that the positive charge at the surface of protein is important factor responsible for the interaction of protein with the human sweet receptor and Ala 19 can be considered as a key region for investigating the mechanism of the interaction of Brz with corresponding receptor. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  7. Crystallization and preliminary X-ray analysis of Ebola VP35 interferon inhibitory domain mutant proteins

    International Nuclear Information System (INIS)

    Leung, Daisy W.; Borek, Dominika; Farahbakhsh, Mina; Ramanan, Parameshwaran; Nix, Jay C.; Wang, Tianjiao; Prins, Kathleen C.; Otwinowski, Zbyszek; Honzatko, Richard B.; Helgeson, Luke A.; Basler, Christopher F.; Amarasinghe, Gaya K.

    2010-01-01

    Three mutant forms of Ebola VP35 interferon inhibitory domain were crystallized in three different space groups. VP35 is one of seven structural proteins encoded by the Ebola viral genome and mediates viral replication, nucleocapsid formation and host immune suppression. The C-terminal interferon inhibitory domain (IID) of VP35 is critical for dsRNA binding and interferon inhibition. The wild-type VP35 IID structure revealed several conserved residues that are important for dsRNA binding and interferon antagonism. Here, the expression, purification and crystallization of recombinant Zaire Ebola VP35 IID mutants R312A, K319A/R322A and K339A in space groups P6 1 22, P2 1 2 1 2 1 and P2 1 , respectively, are described. Diffraction data were collected using synchrotron sources at the Advanced Light Source and the Advanced Photon Source

  8. Exploring the Oxidation of Lignin-Derived Phenols by a Library of Laccase Mutants

    Directory of Open Access Journals (Sweden)

    Isabel Pardo

    2015-09-01

    Full Text Available Saturation mutagenesis was performed over six residues delimiting the substrate binding pocket of a fungal laccase previously engineered in the lab. Mutant libraries were screened using sinapic acid as a model substrate, and those mutants presenting increased activity were selected for exploring the oxidation of lignin-derived phenols. The latter comprised a battery of phenolic compounds of interest due to their use as redox mediators or precursors of added-value products and their biological activity. The new laccase variants were investigated in a multi-screening assay and the structural determinants, at both the substrate and the protein level, for the oxidation of the different phenols are discussed. Laccase activity greatly varied only by changing one or two residues of the enzyme pocket. Our results suggest that once the redox potential threshold is surpassed, the contribution of the residues of the enzymatic pocket for substrate recognition and binding strongly influence the overall rate of the catalytic reaction.

  9. Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast.

    Science.gov (United States)

    Miki, Risa; Saiki, Ryoichi; Ozoe, Yoshihisa; Kawamukai, Makoto

    2008-11-01

    Among the steps in ubiquinone biosynthesis, that catalyzed by the product of the clk-1/coq7 gene has received considerable attention because of its relevance to life span in Caenorhabditis elegans. We analyzed the coq7 ortholog (denoted coq7) in Schizosaccharomyces pombe, to determine whether coq7 has specific roles that differ from those of other coq genes. We first confirmed that coq7 is necessary for the penultimate step in ubiquinone biosynthesis, from the observation that the deletion mutant accumulated the ubiquinone precursor demethoxyubiquinone-10 instead of ubiquinone-10. The coq7 mutant displayed phenotypes characteristic of other ubiquinone-deficient Sc. pombe mutants, namely, hypersensitivity to hydrogen peroxide, a requirement for antioxidants for growth on minimal medium, and an elevated production of sulfide. To compare these phenotypes with those of other respiration-deficient mutants, we constructed cytochrome c (cyc1) and coq3 deletion mutants. We also assessed accumulation of oxidative stress in various ubiquinone-deficient strains and in the cyc1 mutant by measuring mRNA levels of stress-inducible genes and the phosphorylation level of the Spc1 MAP kinase. Induction of ctt1, encoding catalase, and apt1, encoding a 25 kDa protein, but not that of gpx1, encoding glutathione peroxidase, was indistinguishable in four ubiquinone-deficient mutants, indicating that the oxidative stress response operates at similar levels in the tested strains. One new phenotype was observed, namely, loss of viability in stationary phase (chronological life span) in both the ubiquinone-deficient mutant and in the cyc1 mutant. Finally, Coq7 was found to localize in mitochondria, consistent with the possibility that ubiquinone biosynthesis occurs in mitochondria in yeasts. In summary, our results indicate that coq7 is required for ubiquinone biosynthesis and the coq7 mutant is not distinguishable from other ubiquinone-deficient mutants, except that its phenotypes are more

  10. Electrostatically biased binding of kinesin to microtubules.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2011-11-01

    Full Text Available The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules.

  11. A recombinant hypoallergenic parvalbumin mutant for immunotherapy of IgE-mediated fish allergy.

    Science.gov (United States)

    Swoboda, Ines; Bugajska-Schretter, Agnes; Linhart, Birgit; Verdino, Petra; Keller, Walter; Schulmeister, Ulrike; Sperr, Wolfgang R; Valent, Peter; Peltre, Gabriel; Quirce, Santiago; Douladiris, Nikolaos; Papadopoulos, Nikolaos G; Valenta, Rudolf; Spitzauer, Susanne

    2007-05-15

    IgE-mediated allergy to fish is a frequent cause of severe anaphylactic reactions. Parvalbumin, a small calcium-binding protein, is the major fish allergen. We have recently isolated a cDNA coding for carp parvalbumin, Cyp c 1, and expressed in Escherichia coli a recombinant Cyp c 1 molecule, which contained most IgE epitopes of saltwater and freshwater fish. In this study, we introduced mutations into the calcium-binding domains of carp parvalbumin by site-directed mutagenesis and produced in E. coli three parvalbumin mutants containing amino acid exchanges either in one (single mutants; Mut-CD and Mut-EF) or in both of the calcium-binding sites (double mutant; Mut-CD/EF). Circular dichroism analyses of the purified derivatives and the wild-type allergen showed that Mut-CD/EF exhibited the greatest reduction of overall protein fold. Dot blot assays and immunoblot inhibition experiments performed with sera from 21 fish-allergic patients showed that Mut-CD/EF had a 95% reduced IgE reactivity and represented the derivative with the least allergenic activity. The latter was confirmed by in vitro basophil histamine release assays and in vivo skin prick testing. The potential applicability for immunotherapy of Mut-CD/EF was demonstrated by the fact that mouse IgG Abs could be raised by immunization with the mutated molecule, which cross-reacted with parvalbumins from various fish species and inhibited the binding of fish-allergic patients' IgE to the wild-type allergen. Using the hypoallergenic carp parvalbumin mutant Mut-CD/EF, it may be possible to treat fish allergy by immunotherapy.

  12. Molecular determinants of receptor binding and signaling by the CX3C chemokine fractalkine

    DEFF Research Database (Denmark)

    Mizoue, L S; Sullivan, S K; King, D S

    2001-01-01

    , but not all, pathways required for migration. Fractalkine also binds the human cytomegalovirus receptor US28, and analysis of the mutants indicates that US28 recognizes many of the same epitopes of fractalkine as CX3CR1. Comparison of the binding surfaces of fractalkine and the CC chemokine MCP-1 reveals...

  13. Discussion on the method to increase the successful rate of L5/S1 intervertebral disc puncture

    International Nuclear Information System (INIS)

    Zhong Xianyi; Li Liangjun; Yu Chengxin

    2007-01-01

    Objective: To study the effective methods of L 5 /S 1 intervertebral disc puncture without drilling to solve the barriers from iliaca. Methods: (1) puncturing with belly-buttock sticking out: to enlarge waist sacro-iliaca angle to move the puncture point up; (2) puncturing through intervertebral edge: puncturing through L 5 to 1/3 intervertebral disc to make the puncture point move Up; (3) puncturing through L 5 /S 1 intervertebral disc with the self-made puncture location instrument. Results with the methods, 280 cases with L 5 /S 1 intervertebral disc protrusion have been successfully punctured, with successful rate 100%. Conclusion: These methods are ideal and easy to use to treat L 5 /S 1 intervertebral disc protrusion puncture, and worth popularizing. (authors)

  14. Analysis of genes for 5S rRNA from the cricket, Acheta domesticus: two classes of repeating units.

    Science.gov (United States)

    Benes, H; Ware, J; Cave, M D

    1985-01-01

    To examine the modulation of 5S rRNA gene activity during development in the cricket, Acheta domesticus, 5S X DNA was isolated from a lambda Charon 4 genomic library and characterized. Southern blot analysis of cloned A. domesticus genomic DNA revealed that restriction fragments of 3.0 and 2.1 kb represent two size classes of 5S X DNA repeating units; over 90% of the repeats measure 3.0 kb. Restriction analysis of two 5S X DNA clones suggests that the 2.1-kb repeats are not randomly interspersed within clusters of the larger 3.0-kb repeating units. Heteroduplex and restriction mapping of several clones indicate that the spacers of both repeating units account for their unusual length. The major difference between the two classes of repeats may lie in 0.9-kb spacer sequences to the 3.0-kb repeats.

  15. FUS Mutant Human Motoneurons Display Altered Transcriptome and microRNA Pathways with Implications for ALS Pathogenesis

    Directory of Open Access Journals (Sweden)

    Riccardo De Santis

    2017-11-01

    Full Text Available The FUS gene has been linked to amyotrophic lateral sclerosis (ALS. FUS is a ubiquitous RNA-binding protein, and the mechanisms leading to selective motoneuron loss downstream of ALS-linked mutations are largely unknown. We report the transcriptome analysis of human purified motoneurons, obtained from FUS wild-type or mutant isogenic induced pluripotent stem cells (iPSCs. Gene ontology analysis of differentially expressed genes identified significant enrichment of pathways previously associated to sporadic ALS and other neurological diseases. Several microRNAs (miRNAs were also deregulated in FUS mutant motoneurons, including miR-375, involved in motoneuron survival. We report that relevant targets of miR-375, including the neural RNA-binding protein ELAVL4 and apoptotic factors, are aberrantly increased in FUS mutant motoneurons. Characterization of transcriptome changes in the cell type primarily affected by the disease contributes to the definition of the pathogenic mechanisms of FUS-linked ALS.

  16. Atomic resolution structure of the double mutant (K53,56M) of bovine pancreatic phospholipase A2

    International Nuclear Information System (INIS)

    Sekar, K.; Yogavel, M.; Gayathri, D.; Velmurugan, D.; Krishna, R.; Poi, M.-J.; Dauter, Z.; Dauter, M.; Tsai, M.-D.

    2005-01-01

    The atomic resolution crystal structure of the double mutant (K53,56M) of bovine pancreatic phospholipase A 2 is reported. The structure of the double mutant K53,56M has previously been refined at 1.9 Å resolution using room-temperature data. The present paper reports the crystal structure of the same mutant K53,56M refined against 1.1 Å data collected using synchrotron radiation. A total of 116 main-chain atoms from 29 residues and 44 side chains are modelled in alternate conformations. Most of the interfacial binding residues are found to be disordered and alternate conformations could be recognized. The second calcium ion-binding site residue Glu92 adopts two alternate conformations. The minor and major conformations of Glu92 correspond to the second calcium ion bound and unbound states

  17. Uncoupling in Secondary Transport Proteins. A Mechanistic Explanation for Mutants of lac Permease with an Uncoupled Phenotype

    NARCIS (Netherlands)

    Lolkema, J.S.; Poolman, B.

    1995-01-01

    The kinetic behavior of a H+-substrate symporter has been studied in which in addition to the unloaded (E) and fully loaded states (E.S.H) of the carrier also one of the binary complexes (E.S or E.H) may reorient its binding sites. This results in two types of uncoupled mutants, the ES leak and the

  18. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  19. Development of high yielding mutants in lentil

    International Nuclear Information System (INIS)

    Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.

    2001-01-01

    Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)

  20. Officially released mutant varieties in China

    International Nuclear Information System (INIS)

    Liu, L.; Van Zanten, L.; Shu, Q.Y.; Maluszynski, M.

    2004-01-01

    The use of mutation techniques for crop improvement in China has a long and well-established tradition of more than 50 years. As the result of intensive research in many institutes dealing with application of nuclear technologies more than 620 cultivars of 44 crop species have been released. Numerous mutant varieties have been grown on a large scale bringing significant economic impact, sustaining crop production and greatly contributing to increase of food production also in stress prone areas of the country. However, there is still missing information not only on the number of mutant varieties released in particular crop species but also on mutagens applied, selection approaches and on the use of mutants in cross breeding. Numerous Chinese scientists collected and systematized this information. Results of their work were often published in local scientific journals in the Chinese language and as such were unavailable to breeders from other countries. Having this in mind, we requested Dr. Liu Luxiang, the Director of the Department of Plant Mutation Breeding and Genetics, Institute for Application of Atomic Energy, Chinese Academy of Agricultural Sciences in Beijing to help us in finding as much information as possible on mutant varieties officially released in China. The data has been collected in close collaboration with his colleagues from various institutions all over the country and then evaluated, edited and prepared for publication by our team responsible for the FAO/IAEA Database of Officially Released Mutant Varieties. We would like to thank all Chinese colleagues who contributed to this list of Chinese mutant varieties. We hope that this publication will stimulate plant breeders in China to collect more information on released mutant varieties and especially on the use of mutated genes in cross breeding. (author)

  1. Genetic variation at minisatellite loci D1S7, D4S139, D5S110 and ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 80; Issue 1 ... RFLP; D1S7; D4S139; D5S110; D17S79; genetic variation; minisatellite; Indian populations. Abstract. Genetic variation at four minisatellite loci D1S7, D4S139, D5S110 and D17S79 in three predominant population groups of eastern India, namely Brahmin, ...

  2. Characterization of a Saccharomyces cerevisiae mutant defective in inositol sphingolipid synthesis

    International Nuclear Information System (INIS)

    Pinto, W.J.; Wells, G.B.; Williams, A.C.; Anderson, K.A.; Teater, E.C.; Lester, R.L.

    1986-01-01

    A mutant of S. cerevisiae, auxotrophic for the sphingolipid long chain bases sphinganine or 4-hydroxysphinganine has been further characterized. The mutant is defective in the first step in the synthesis of sphingolipid long chain bases, the formation of 3-keto-sphinganine from palmitoyl CoA and L-serine. Crude membranes from wild type cells exhibit a palmitoyl CoA dependent conversion of [ 3 H]serine to a labeled product with the properties of 3-ketosphinganine, whereas membranes from the mutant exhibit negligible activity. As expected from this result, they authors find that 3-ketosphinganine supports growth of the mutant as effectively as erythro-sphinganine. To study the sequelae of long chain base deprivation in the mutant required a method to effectively remove lipophilic long chain bases from the cultured cells. They have found that addition of α-cyclodextrin to the culture medium evidently binds sphinganine tightly enough such that within an hour they observe inhibition of growth (turbidity, cell count) and incorporation of [ 3 H]inositol into sphingolipids. Such treatment also results in a loss of cell viability, a long chain base less death possibly similar to the inositol-less death observed in inositol auxotrophs of yeast

  3. Three cases of L4-5 Baastrup's disease due to L5-S1 spondylolytic spondylolisthesis.

    Science.gov (United States)

    Seo, Jin-Suk; Lee, Sang-Ho; Keum, Han Joong; Eun, Sang Soo

    2017-05-01

    Baastrup's disease is characterized by degeneration of spinous processes and interspinous soft tissue, which may cause spinal stenosis. Purpose of this article is to report the possible new cause of Baastrup's disease and result of surgical treatments. Authors treated three cases of Baastrup's disease on L4-L5 with L5-S1 spondylolytic listhesis. Conservative treatment did not relieve the pain; therefore, surgical treatments were planned according to each specific disease condition. In one case, anterior lumbar interbody fusion of L5-S1 was performed, and after surgery, the size of epidural cyst on L4-L5 was decreased. L4-L5 bilateral laminectomy was performed to directly decompress posterior epidural cyst in a case with stable L5-S1 spondylolytic listhesis. In last case, facet joints and spinous process were removed by L5-S1 posterior lumbar interbody fusion (PLIF) surgery. After the surgery, patients' back and leg pain was improved and postoperative MRI revealed successful decompression of the spinal canal. Improvement in back and leg symptoms was noted at 12-month follow-up. Baastrup's disease at the L4-L5 level may have developed from the instability caused by L5-S1 spondylolytic spondylolisthesis. Viable treatment options include the fusion of L5-S1 or a laminectomy at the L4-L5 level.

  4. Non-DNA binding, dominant-negative, human PPARγ mutations cause lipodystrophic insulin resistance

    Science.gov (United States)

    Agostini, Maura; Schoenmakers, Erik; Mitchell, Catherine; Szatmari, Istvan; Savage, David; Smith, Aaron; Rajanayagam, Odelia; Semple, Robert; Luan, Jian'an; Bath, Louise; Zalin, Anthony; Labib, Mourad; Kumar, Sudhesh; Simpson, Helen; Blom, Dirk; Marais, David; Schwabe, John; Barroso, Inês; Trembath, Richard; Wareham, Nicholas; Nagy, Laszlo; Gurnell, Mark; O'Rahilly, Stephen; Chatterjee, Krishna

    2006-01-01

    Summary PPARγ is essential for adipogenesis and metabolic homeostasis. We describe mutations in the DNA and ligand binding domains of human PPARγ in lipodystrophic, severe insulin resistance. These receptor mutants lack DNA binding and transcriptional activity but can translocate to the nucleus, interact with PPARγ coactivators and inhibit coexpressed wild-type receptor. Expression of PPARγ target genes is markedly attenuated in mutation-containing versus receptor haploinsufficent primary cells, indicating that such dominant-negative inhibition operates in vivo. Our observations suggest that these mutants restrict wild-type PPARγ action via a non-DNA binding, transcriptional interference mechanism, which may involve sequestration of functionally limiting coactivators. PMID:17011503

  5. Biochemical and structural characterization of HDAC8 mutants associated with Cornelia de Lange syndrome spectrum disorders.

    Science.gov (United States)

    Decroos, Christophe; Christianson, Nicolas H; Gullett, Laura E; Bowman, Christine M; Christianson, Karen E; Deardorff, Matthew A; Christianson, David W

    2015-10-27

    Cornelia de Lange Syndrome (CdLS) spectrum disorders are characterized by multiple organ system congenital anomalies that result from mutations in genes encoding core cohesin proteins SMC1A, SMC3, and RAD21, or proteins that regulate cohesin function such as NIPBL and HDAC8. HDAC8 is the Zn(2+)-dependent SMC3 deacetylase required for cohesin recycling during the cell cycle, and 17 different HDAC8 mutants have been identified to date in children diagnosed with CdLS. As part of our continuing studies focusing on aberrant HDAC8 function in CdLS, we now report the preparation and biophysical evaluation of five human HDAC8 mutants: P91L, G117E, H180R, D233G, and G304R. Additionally, the double mutants D233G-Y306F and P91L-Y306F were prepared to enable cocrystallization of intact enzyme-substrate complexes. X-ray crystal structures of G117E, P91L-Y306F, and D233G-Y306F HDAC8 mutants reveal that each CdLS mutation causes structural changes that compromise catalysis and/or thermostability. For example, the D233G mutation disrupts the D233-K202-S276 hydrogen bond network, which stabilizes key tertiary structure interactions, thereby significantly compromising thermostability. Molecular dynamics simulations of H180R and G304R HDAC8 mutants suggest that the bulky arginine side chain of each mutant protrudes into the substrate binding site and also causes active site residue Y306 to fluctuate away from the position required for substrate activation and catalysis. Significantly, the catalytic activities of most mutants can be partially or fully rescued by the activator N-(phenylcarbamothioyl)-benzamide, suggesting that HDAC8 activators may serve as possible leads in the therapeutic management of CdLS.

  6. Rescue of glaucoma-causing mutant myocilin thermal stability by chemical chaperones

    Science.gov (United States)

    Burns, J. Nicole; Orwig, Susan D.; Harris, Julia L.; Watkins, J. Derrick; Vollrath, Douglas; Lieberman, Raquel L.

    2010-01-01

    Mutations in myocilin cause an inherited form of open angle glaucoma, a prevalent neurodegenerative disorder associated with increased intraocular pressure. Myocilin forms part of the trabecular meshwork extracellular matrix presumed to regulate intraocular pressure. Missense mutations, clustered in the olfactomedin (OLF) domain of myocilin, render the protein prone to aggregation in the endoplasmic reticulum of trabecular meshwork cells, causing cell dysfunction and death. Cellular studies have demonstrated temperature-sensitive secretion of myocilin mutants, but difficulties in expression and purification have precluded biophysical characterization of wild-type (wt) myocilin and disease-causing mutants in vitro. We have overcome these limitations by purifying wt and select glaucoma-causing mutant (D380A, I477N, I477S, K423E) forms of the OLF domain (228–504) fused to maltose binding protein (MBP) from E. coli. Monomeric fusion proteins can be isolated in solution. To determine the relative stability of wt and mutant OLF domains, we developed a fluorescence thermal stability assay without removal of MBP, and provide the first direct evidence that mutated OLF is folded but less thermally stable than wt. We tested the ability of seven chemical chaperones to stabilize mutant myocilin. Only sarcosine and trimethylamine N-oxide were capable of shifting the melting temperature of all mutants tested to near that of wt OLF. Our work lays the foundation for the identification of tailored small molecules capable of stabilizing mutant myocilin and promoting secretion to the extracellular matrix, to better control intraocular pressure and ultimately delay the onset of myocilin glaucoma. PMID:20334347

  7. Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori.

    Science.gov (United States)

    Urano, Kei; Daimon, Takaaki; Banno, Yutaka; Mita, Kazuei; Terada, Tohru; Shimizu, Kentaro; Katsuma, Susumu; Shimada, Toru

    2010-11-01

    The isovaleric acid-emanating silkworm mutant skunk (sku) was first studied over 30 years ago because of its unusual odour and prepupal lethality. Here, we report the identification and characterization of the gene responsible for the sku mutant. Because of its specific features and symptoms similar to human isovaleryl-CoA dehydrogenase (IVD) deficiency, also known as isovaleric acidaemia, IVD dysfunction in silkworms was predicted to be responsible for the phenotype of the sku mutant. Linkage analysis revealed that the silkworm IVD gene (BmIVD) was closely linked to the odorous phenotype as expected, and a single amino acid substitution (G376V) was found in BmIVD of the sku mutant. To investigate the effect of the G376V substitution on BmIVD function, wild-type and sku-type recombinants were constructed with a baculovirus expression system and the subsequent enzyme activity of sku-type BmIVD was shown to be significantly reduced compared with that of wild-type BmIVD. Molecular modelling suggested that this reduction in the enzyme activity may be due to negative effects of G376V mutation on FAD-binding or on monomer-monomer interactions. These observations strongly suggest that BmIVD is responsible for the sku locus and that the molecular defect in BmIVD causes the characteristic smell and prepupal lethality of the sku mutant. To our knowledge, this is, aside from humans, the first characterization of IVD deficiency in metazoa. Considering that IVD acts in the third step of leucine degradation and the sku mutant accumulates branched-chain amino acids in haemolymph, this mutant may be useful in the investigation of unique branched-chain amino acid catabolism in insects. © 2010 The Authors Journal compilation © 2010 FEBS.

  8. Agronomically valuable mutant lines of castor

    International Nuclear Information System (INIS)

    Bokhan, I.K.

    1990-01-01

    Dry seeds of four castor varieties (VNIIMK 165-improved, VNIIMK 18, Chervonnaya and Antika) were treated with six chemical mutagens, N-nitroso-N-methyl urea (NMU), N-nitroso-N-ethyl urea (NEU), dimethyl sulphate (DMS), diethyl sulphate (DES), ethylenimine (EI) and 1,4-bis-diazoacetyl-butane (DAB) in various doses during 18 hours. About 40,000 plants were studied in M 2 and 80 types of mutations were found, including a number of valuable mutants: short-stemmed, semi-dwarf, dwarf, early maturing, with female and interspersed types of racemes, highly productive etc. Based on trials in M 3 -M 4 , on small plots with two or three replications, the superior mutant lines were identified. The best mutants are presented in the table. Early maturation is very important for growing castor in the USSR, as it is the predecessor of winter wheat in crop rotation. The mutants M2-323 and Ml-83 are of great value as they show early maturation and high yield. Their productivity is mainly conditioned by a high percentage of interspersed plants. The reduction of plant height is of great importance for the successful combine harvesting of castor. Mutant lines M2-119 and Ml-284 characterised by low plant height and high yield are very interesting in this respect. The obtained initial material will be used in further breeding work

  9. Plasmodium berghei: in vivo generation and selection of karyotype mutants and non-gametocyte producer mutants

    NARCIS (Netherlands)

    Janse, C. J.; Ramesar, J.; van den Berg, F. M.; Mons, B.

    1992-01-01

    We previously reported that karyotype and gametocyte-producer mutants spontaneously arose during in vivo asexual multiplication of Plasmodium berghei. Here we studied the rate of selection of these mutants in vivo. Gametocyte production and karyotype pattern were established at regular intervals

  10. Isolation and characterization of Candida albicans morphological mutants derepressed for the formation of filamentous hypha-type structures

    International Nuclear Information System (INIS)

    Gil, C.; Pomes, R.; Nombela, C.

    1990-01-01

    Several Candida albicans morphological mutants were obtained by a procedure based on a combined treatment with nitrous acid plus UV irradiation and a double-enrichment step to increase the proportion of mutants growing as long filamentous structures. Altered cell morphogenesis in these mutants correlated with an altered colonial phenotype. Two of these mutants, C. albicans NEL102 and NEL103, were selected and characterized. Mutant blastoconidia initiated budding but eventually gave rise to filamentous hypha-type formations. These filaments were long and septate, and they branched very regularly at positions near septa. Calcofluor white (which is known to bind chitin-rich areas) stained septa, branching zones, and filament tips very intensely, as observed under the fluorescence microscope. Wild-type hybrids were obtained by fusing protoplasts of strain NEL102 with B14, another morphological mutant previously described as being permanently pseudomycelial, indicating that genetic determinants responsible for the two altered phenotypes are different. The mutants characterized in this work seemed to sequentially express the morphogenic characteristics of C. albicans, from blastoconidia to hyphae, in the absence of any inducer. Further characterization of these strains could be relevant to gain understanding of the genetic control of dimorphism in this species

  11. The research progress on plant mutant germplasm resources in China

    International Nuclear Information System (INIS)

    He Cexi; Ji Linzhen; Zhao Shirong

    1991-07-01

    Mutants induced by nuclear radiation or other mutagens are new artificial germplasm resources. Some mutants have been applied in plant breeding and great achievements have been reached. The status and progress on the collection, identification and utilization of mutants in China are introduced. A proposal for developing mutant germplasm resources with good agronomic characters is suggested

  12. Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori

    Science.gov (United States)

    Xia, Dingguo; Tang, Shunming; Shen, Xingjia

    2017-01-01

    A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant. PMID:28414820

  13. Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori.

    Science.gov (United States)

    Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling

    2017-01-01

    A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.

  14. Transcriptional dysregulation in NIPBL and cohesin mutant human cells.

    Directory of Open Access Journals (Sweden)

    Jinglan Liu

    2009-05-01

    Full Text Available Cohesin regulates sister chromatid cohesion during the mitotic cell cycle with Nipped-B-Like (NIPBL facilitating its loading and unloading. In addition to this canonical role, cohesin has also been demonstrated to play a critical role in regulation of gene expression in nondividing cells. Heterozygous mutations in the cohesin regulator NIPBL or cohesin structural components SMC1A and SMC3 result in the multisystem developmental disorder Cornelia de Lange Syndrome (CdLS. Genome-wide assessment of transcription in 16 mutant cell lines from severely affected CdLS probands has identified a unique profile of dysregulated gene expression that was validated in an additional 101 samples and correlates with phenotypic severity. This profile could serve as a diagnostic and classification tool. Cohesin binding analysis demonstrates a preference for intergenic regions suggesting a cis-regulatory function mimicking that of a boundary/insulator interacting protein. However, the binding sites are enriched within the promoter regions of the dysregulated genes and are significantly decreased in CdLS proband, indicating an alternative role of cohesin as a transcription factor.

  15. High Persister Mutants in Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Heather L Torrey

    Full Text Available Mycobacterium tuberculosis forms drug-tolerant persister cells that are the probable cause of its recalcitrance to antibiotic therapy. While genetically identical to the rest of the population, persisters are dormant, which protects them from killing by bactericidal antibiotics. The mechanism of persister formation in M. tuberculosis is not well understood. In this study, we selected for high persister (hip mutants and characterized them by whole genome sequencing and transcriptome analysis. In parallel, we identified and characterized clinical isolates that naturally produce high levels of persisters. We compared the hip mutants obtained in vitro with clinical isolates to identify candidate persister genes. Genes involved in lipid biosynthesis, carbon metabolism, toxin-antitoxin systems, and transcriptional regulators were among those identified. We also found that clinical hip isolates exhibited greater ex vivo survival than the low persister isolates. Our data suggest that M. tuberculosis persister formation involves multiple pathways, and hip mutants may contribute to the recalcitrance of the infection.

  16. Characterization of vanadium-binding sites of the vanadium-binding protein Vanabin2 by site-directed mutagenesis.

    Science.gov (United States)

    Ueki, Tatsuya; Kawakami, Norifumi; Toshishige, Masaaki; Matsuo, Koichi; Gekko, Kunihiko; Michibata, Hitoshi

    2009-10-01

    Vanabins are a unique protein family of vanadium-binding proteins with nine disulfide bonds. Possible binding sites for VO2+ in Vanabin2 from a vanadium-rich ascidian Ascidia sydneiensis samea have been detected by nuclear magnetic resonance study, but the metal selectivity and metal-binding ability of each site was not examined. In order to reveal functional contribution of each binding site, we prepared several mutants of Vanabin2 by in vitro site-directed mutagenesis and analyzed their metal selectivity and affinity by immobilized metal-ion affinity chromatography and Hummel Dreyer method. Mutation at K10/R60 (site 1) markedly reduced the affinity for VO2+. Mutation at K24/K38/R41/R42 (site 2) decreased the maximum binding number, but only slightly increased the overall affinity for VO2+. Secondary structure of both mutants was the same as that of the wild type as assessed by circular dichroism spectroscopy. Mutation in disulfide bonds near the site 1 did not affect its high affinity binding capacity, while those near the site 2 decreased the overall affinity for VO2+. These results suggested that the site 1 is a high affinity binding site for VO2+, while the site 2 composes a moderate affinity site for multiple VO2+.

  17. Seasonal Dynamics of Bacterioplankton Community Structure in a Eutrophic Lake as Determined by 5S rRNA Analysis

    Science.gov (United States)

    Höfle, Manfred G.; Haas, Heike; Dominik, Katja

    1999-01-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plußsee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (β-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments. PMID:10388718

  18. Native Mutant Huntingtin in Human Brain

    Science.gov (United States)

    Sapp, Ellen; Valencia, Antonio; Li, Xueyi; Aronin, Neil; Kegel, Kimberly B.; Vonsattel, Jean-Paul; Young, Anne B.; Wexler, Nancy; DiFiglia, Marian

    2012-01-01

    Huntington disease (HD) is caused by polyglutamine expansion in the N terminus of huntingtin (htt). Analysis of human postmortem brain lysates by SDS-PAGE and Western blot reveals htt as full-length and fragmented. Here we used Blue Native PAGE (BNP) and Western blots to study native htt in human postmortem brain. Antisera against htt detected a single band broadly migrating at 575–850 kDa in control brain and at 650–885 kDa in heterozygous and Venezuelan homozygous HD brains. Anti-polyglutamine antisera detected full-length mutant htt in HD brain. There was little htt cleavage even if lysates were pretreated with trypsin, indicating a property of native htt to resist protease cleavage. A soluble mutant htt fragment of about 180 kDa was detected with anti-htt antibody Ab1 (htt-(1–17)) and increased when lysates were treated with denaturants (SDS, 8 m urea, DTT, or trypsin) before BNP. Wild-type htt was more resistant to denaturants. Based on migration of in vitro translated htt fragments, the 180-kDa segment terminated ≈htt 670–880 amino acids. If second dimension SDS-PAGE followed BNP, the 180-kDa mutant htt was absent, and 43–50 kDa htt fragments appeared. Brain lysates from two HD mouse models expressed native full-length htt; a mutant fragment formed if lysates were pretreated with 8 m urea + DTT. Native full-length mutant htt in embryonic HD140Q/140Q mouse primary neurons was intact during cell death and when cell lysates were exposed to denaturants before BNP. Thus, native mutant htt occurs in brain and primary neurons as a soluble full-length monomer. PMID:22375012

  19. Rilpivirine and Doravirine Have Complementary Efficacies Against NNRTI-Resistant HIV-1 Mutants.

    Science.gov (United States)

    Smith, Steven J; Pauly, Gary T; Akram, Aamir; Melody, Kevin; Ambrose, Zandrea; Schneider, Joel P; Hughes, Stephen H

    2016-08-15

    Rilpivirine (RPV) is the latest non-nucleoside reverse transcriptase inhibitor (NNRTI) to be approved by Food and Drug Administration to combat HIV-1 infections. NNRTIs inhibit the chemical step in viral DNA synthesis by binding to an allosteric site located about 10 Å from the polymerase active site of reverse transcriptase (RT). Although NNRTIs potently inhibit the replication of wild-type HIV-1, the binding site is not conserved, and mutations arise in the binding pocket. Doravirine (DOR) is a new NNRTI in phase III clinical trials. Using a single round HIV-1 infection assay, we tested RPV and DOR against a broad panel of NNRTI-resistant mutants to determine their respective activities. We also used molecular modeling to determine if the susceptibility profile of each compound was related to how they bind RT. Several mutants displayed decreased susceptibility to DOR. However, with the exception of E138K, our data suggest that the mutations that reduce the potency of DOR and RPV are non-overlapping. Thus, these 2 NNRTIs have the potential to be used together in combination therapy. We also show that the location at which DOR and RPV bind with the NNRTI binding pocket of RT correlates with the differences in their respective susceptibility to the panel of NNRTI-resistance mutations. This shows that (1) DOR is susceptible to a number of well-known NNRTI resistance mutations and (2) an understanding of the mutational susceptibilities and binding interactions of NNRTIs with RT could be used to develop pairs of compounds with non-overlapping mutational susceptibilities.

  20. Altered nucleotide-microtubule coupling and increased mechanical output by a kinesin mutant.

    Directory of Open Access Journals (Sweden)

    Hong-Lei Liu

    Full Text Available Kinesin motors hydrolyze ATP to produce force and do work in the cell--how the motors do this is not fully understood, but is thought to depend on the coupling of ATP hydrolysis to microtubule binding by the motor. Transmittal of conformational changes from the microtubule- to the nucleotide-binding site has been proposed to involve the central β-sheet, which could undergo large structural changes important for force production. We show here that mutation of an invariant residue in loop L7 of the central β-sheet of the Drosophila kinesin-14 Ncd motor alters both nucleotide and microtubule binding, although the mutated residue is not present in either site. Mutants show weak-ADP/tight-microtubule binding, instead of tight-ADP/weak-microtubule binding like wild type--they hydrolyze ATP faster than wild type, move faster in motility assays, and assemble long spindles with greatly elongated poles, which are also produced by simulations of assembly with tighter microtubule binding and faster sliding. The mutated residue acts like a mechanochemical coupling element--it transmits changes between the microtubule-binding and active sites, and can switch the state of the motor, increasing mechanical output by the motor. One possibility, based on our findings, is that movements by the residue and the loop that contains it could bend or distort the central β-sheet, mediating free energy changes that lead to force production.

  1. The cation-deficient Ruddlesden-Popper oxysulfide Y2Ti2O5S2 as a layered sulfide: topotactic potassium intercalation to form KY2Ti2O5S2.

    Science.gov (United States)

    Rutt, Oliver J; Hill, Timothy L; Gál, Zoltán A; Hayward, Michael A; Clarke, Simon J

    2003-12-01

    Potassium intercalation into the cation-deficient n = 2 Ruddlesden-Popper oxysulfide Y(2)Ti(2)O(5)S(2) to form KY(2)Ti(2)O(5)S(2) has been carried out by reaction of the oxysulfide with potassium vapor in sealed metal tubes at 400 degrees C, potassium naphthalide in THF at 50 degrees C, or potassium in liquid ammonia at temperatures as low as -78 degrees C. Insertion of potassium is topotactic, and although a site 12-coordinate by oxide ions is vacant in the perovskite-type oxide slabs of the structure, potassium is too large to enter this site via the 4-coordinate window, and instead enters the rock-salt-type sulfide layers of the structure which necessitates a 30% increase in the lattice parameter c normal to the layers. In contrast with one of the sodium intercalates of Y(2)Ti(2)O(5)S(2) (beta-NaY(2)Ti(2)O(5)S(2)) in which sodium occupies a tetrahedral site in the sulfide layers, potassium favors an 8-coordinate site which necessitates a relative translation of adjacent oxide slabs. KY(2)Ti(2)O(5)S(2) is tetragonal: P4/mmm, a = 3.71563(4) A, c = 14.8682(2) A (at 298 K), Z = 1. Although the resistivity (3.4(1) x 10(3) Omega cm) is larger than would be expected for a metal, temperature independent paramagnetism dominates the magnetic susceptibility, and the material is electronically very similar to the analogous sodium intercalate beta-NaY(2)Ti(2)O(5)S(2) which features reduced-titanium-containing oxide layers of very similar geometry and electron count.

  2. Control of estrogen receptor ligand binding by Hsp90.

    Science.gov (United States)

    Fliss, A E; Benzeno, S; Rao, J; Caplan, A J

    2000-04-01

    The molecular chaperone Hsp90 interacts with unliganded steroid hormone receptors and regulates their activity. We have analyzed the function of yeast and mammalian Hsp90 in regulating the ability of the human estrogen receptor (ER) to bind ligands in vivo and in vitro. Using the yeast system, we show that the ER expressed in several different hsp82 mutant strains binds reduced amounts of the synthetic estrogen diethylstilbestrol compared to the wild type. This defect in hormone binding occurs without any significant change in the steady state levels of ER protein. To analyze the role of mammalian Hsp90, we synthesized the human ER in rabbit reticulocyte lysates containing geldanamycin, an Hsp90 inhibitor. At low concentrations of geldanamycin we observed reduced levels of hormone binding by the ER. At higher concentrations, we found reduced synthesis of the receptor. These data indicate that Hsp90 functions to maintain the ER in a high affinity hormone-binding conformation.

  3. Applicability of the 5S management method for quality improvement in health-care facilities: a review.

    Science.gov (United States)

    Kanamori, Shogo; Shibanuma, Akira; Jimba, Masamine

    2016-01-01

    The 5S management method (where 5S stands for sort, set in order, shine, standardize, and sustain) was originally implemented by manufacturing enterprises in Japan. It was then introduced to the manufacturing sector in the West and eventually applied to the health sector for organizing and standardizing the workplace. 5S has recently received attention as a potential solution for improving government health-care services in low- and middle-income countries. We conducted a narrative literature review to explore its applicability to health-care facilities globally, with a focus on three aspects: (a) the context of its application, (b) its impacts, and (c) its adoption as part of government initiatives. To identify relevant research articles, we researched public health databases in English, including CINAHL, PubMed, ScienceDirect, and Web of Science. We found 15 of the 114 articles obtained from the search results to be relevant for full-text analysis of the context and impacts of the 5S application. To identify additional information particularly on its adoption as part of government initiatives, we also examined other types of resources including reference books, reports, didactic materials, government documents, and websites. The 15 empirical studies highlighted its application in primary health-care facilities and a wide range of hospital areas in Brazil, India, Jordan, Senegal, Sri Lanka, Tanzania, the UK, and the USA. The review also found that 5S was considered to be the starting point for health-care quality improvement. Ten studies presented its impacts on quality improvements; the changes resulting from the 5S application were classified into the three dimensions of safety, efficiency, and patient-centeredness. Furthermore, 5S was adopted as part of government quality improvement strategies in India, Senegal, Sri Lanka, and Tanzania. 5S could be applied to health-care facilities regardless of locations. It could be not only a tool for health workers and

  4. Comparative study on the evolution of chloroplast ribosomal 5S RNA of a living fossil plant, Cycas revoluta Thumb.

    Science.gov (United States)

    Zhou, X Q; Liu, W Y; Wang, M Q

    1988-08-01

    The complete nucleotide sequence of Cycas revoluta Thunb chloroplast 5 S rRNA was determined. It consists of 122 nucleotides. This is the only known 5 S rRNA sequence in Gymnospermae. It is highly homologous with chloroplast 5 S rRNA of higher plants (92-97%), but less homologous (about 54%) with those of lower plants. There is however 67% homology between Cycas and a procaryote a. nidulans. The chloroplast 5 S rRNAs of Angiospermae are nearly identical with each other (95-97%). S. oligorhize and L. minor have 100% homology among themselves. We have constructed a phylogenic tree of 5 S rRNA sequences from fifteen plant chloroplasts. The result suggests that the emergence of algae occurred at an early stage of plant chloroplast evolution and that green plants originated from green algae. This is in agreement with the classical view and other theories of molecular evolution. However there is no common ancestor in the case of Bryophyta and ferns. Among the Angiospermae, a precise evolutionary process cannot be deduced because the Knuc values among the species are very close to each other.

  5. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  6. Nicotinamide ribosyl uptake mutants in Haemophilus influenzae.

    Science.gov (United States)

    Herbert, Mark; Sauer, Elizabeta; Smethurst, Graeme; Kraiss, Anita; Hilpert, Anna-Karina; Reidl, Joachim

    2003-09-01

    The gene for the nicotinamide riboside (NR) transporter (pnuC) was identified in Haemophilus influenzae. A pnuC mutant had only residual NR uptake and could survive in vitro with high concentrations of NR, but could not survive in vivo. PnuC may represent a target for the development of inhibitors for preventing H. influenzae disease.

  7. Ethanol production using engineered mutant E. coli

    Science.gov (United States)

    Ingram, Lonnie O.; Clark, David P.

    1991-01-01

    The subject invention concerns novel means and materials for producing ethanol as a fermentation product. Mutant E. coli are transformed with a gene coding for pyruvate decarboxylase activity. The resulting system is capable of producing relatively large amounts of ethanol from a variety of biomass sources.

  8. Avirulent mutants of Macrophomina phaseolina and Aspergillus ...

    Indian Academy of Sciences (India)

    albino colonies out of the above ten were moderately viru- lent compared to wild type strain. They were sclerotia forming and produced phaseolinone in culture. A brown variant, designated Muv 21, and two other albino mutants, designated Muv 19 and Muv 20, were avirulent and pro- duced no phaseolinone in culture.

  9. Induced mutants for cereal grain protein improvement

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 17 papers and one summary presented, six dealing with the genetic improvement of seed protein using ionizing radiations fall within the INIS subject scope. Other topics discussed were non-radiation induced mutants used for cereal grain protein improvement

  10. Mutant PTEN in Cancer : Worse Than Nothing

    NARCIS (Netherlands)

    Leslie, Nick R; den Hertog, Jeroen

    2014-01-01

    Tumor suppressors block the development of cancer and are often lost during tumor development. Papa et al. show that partial loss of normal PTEN tumor suppressor function can be compounded by additional disruption caused by the expression of inactive mutant PTEN protein. This has significant

  11. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    The result of bio-test, using the resulting pigment mutant of C. reinhardtii 124y-1 showed that mutagenic activity was observed significantly in both Tekeli River and Pavlodar Oil Refinery in Kazakhstan; the waste water of the Pavlodar Oil Refinery had high-toxicity while the water of the Tekeli River had medium-toxicity.

  12. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Directory of Open Access Journals (Sweden)

    Shogo Kanamori

    2016-11-01

    Full Text Available Background: The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective: To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers who visited the health centers. Design: A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities. A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83. Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results: Backward stepwise linear regression (n=1,928 indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014. Additional regression analyses showed significant score increases of 0.44 (p=0.002, 0.14 (p=0.002, 0.06 (p=0.019, and 0.17 (p=0.044 points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions: The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective

  13. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C.; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    Background The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. Design A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results Backward stepwise linear regression (n=1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014). Additional regression analyses showed significant score increases of 0.44 (p=0.002), 0.14 (p=0.002), 0.06 (p=0.019), and 0.17 (p=0.044) points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities

  14. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  15. Mutant HSP70 Reverses Autoimmune Depigmentation in Vitiligo

    Science.gov (United States)

    Mosenson, Jeffrey A.; Zloza, Andrew; Nieland, John D.; Garrett-Mayer, Elizabeth; Eby, Jonathan M.; Huelsmann, Erica J.; Kumar, Previn; Denman, Cecele J.; Lacek, Andrew T.; Kohlhapp, Frederick J.; Alamiri, Ahmad; Hughes, Tasha; Bines, Steven D.; Kaufman, Howard L.; Overbeck, Andreas; Mehrotra, Shikhar; Hernandez, Claudia; Nishimura, Michael I.; Guevara-Patino, Jose A.; Le Poole, I. Caroline

    2013-01-01

    Vitiligo is an autoimmune disease characterized by destruction of melanocytes, leaving 0.5% of the population with progressive depigmentation. Current treatments offer limited efficacy. We report that modified inducible heat shock protein 70 (HSP70i) prevents T cell–mediated depigmentation. HSP70i is the molecular link between stress and the resultant immune response. We previously showed that HSP70i induces an inflammatory dendritic cell (DC) phenotype and is necessary for depigmentation in vitiligo mouse models. Here, we observed a similar DC inflammatory phenotype in vitiligo patients. In a mouse model of depigmentation, DNA vaccination with a melanocyte antigen and the carboxyl terminus of HSP70i was sufficient to drive autoimmunity. Mutational analysis of the HSP70i substrate-binding domain established the peptide QPGVLIQVYEG as invaluable for DC activation, and mutant HSP70i could not induce depigmentation. Moreover, mutant HSP70iQ435A bound human DCs and reduced their activation, as well as induced a shift from inflammatory to tolerogenic DCs in mice. HSP70iQ435A-encoding DNA applied months before spontaneous depigmentation prevented vitiligo in mice expressing a transgenic, melanocyte-reactive T cell receptor. Furthermore, use of HSP70iQ435A therapeutically in a different, rapidly depigmenting model after loss of differentiated melanocytes resulted in 76% recovery of pigmentation. Treatment also prevented relevant T cells from populating mouse skin. In addition, ex vivo treatment of human skin averted the disease-related shift from quiescent to effector T cell phenotype. Thus, HSP70iQ435A DNA delivery may offer potent treatment opportunities for vitiligo. PMID:23447019

  16. A Yersinia pestis tat mutant is attenuated in bubonic and small-aerosol pneumonic challenge models of infection but not as attenuated by intranasal challenge.

    Directory of Open Access Journals (Sweden)

    Joel Bozue

    Full Text Available Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge.

  17. Re-establishing ataxin-2 downregulates translation of mutant ataxin-3 and alleviates Machado-Joseph disease.

    Science.gov (United States)

    Nóbrega, Clévio; Carmo-Silva, Sara; Albuquerque, David; Vasconcelos-Ferreira, Ana; Vijayakumar, Udaya-Geetha; Mendonça, Liliana; Hirai, Hirokazu; de Almeida, Luís Pereira

    2015-12-01

    Machado-Joseph disease is a progressive neurodegenerative disorder associated with the polyQ-expanded ataxin-3 (encoded by ATXN3), for which no therapy is available. With the aim of clarifying the mechanism of neurodegeneration, we hypothesized that the abnormally long polyQ tract would interact aberrantly with ataxin-2 (encoded by ATXN2), another polyQ protein whose function has recently been linked to translational regulation. Using patient's samples and cellular and animal's models we found that in Machado-Joseph disease: (i) ataxin-2 levels are reduced; and (ii) its subcellular localization is changed towards the nucleus. Restoring ataxin-2 levels by lentiviral-mediated overexpression: (i) reduced mutant ataxin-3 levels; and (ii) rescued behaviour defects and neuropathology in a transgenic mouse model of Machado-Joseph disease. Conversely (i) mutating the ataxin-2 motif that enables binding to its natural interactor and translation activator poly(A)-binding protein; or (ii) overexpressing poly(A)-binding protein, had opposite effects, increasing mutant ataxin-3 translation and aggregation. This work suggests that in Machado-Joseph disease, mutant ataxin-3 drives an abnormal reduction of ataxin-2 levels, which overactivates poly(A)-binding protein, increases translation of mutant ataxin-3 and other proteins and aggravates Machado-Joseph disease. Re-establishment of ataxin-2 levels reduces mutant ataxin-3 and alleviates Machado-Joseph disease pathogenesis opening a new avenue for therapeutic intervention in this and potentially other polyQ disorders. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Modulation of protein A binding allows single-step purification of mouse bispecific antibodies that retain FcRn binding

    Science.gov (United States)

    Armstrong, Anthony A.; Pardinas, Jose R.; Zheng, Songmao; Brosnan, Kerry; Emmell, Eva; Luo, Jeffrey; Chiu, Mark L.

    2017-01-01

    ABSTRACT The increased number of bispecific antibodies (BsAb) under therapeutic development has resulted in a need for mouse surrogate BsAbs. Here, we describe a one-step method for generating highly pure mouse BsAbs suitable for in vitro and in vivo studies. We identify two mutations in the mouse IgG2a and IgG2b Fc region: one that eliminates protein A binding and one that enhances protein A binding by 8-fold. We show that BsAbs harboring these mutations can be purified from the residual parental monoclonal antibodies in one step using protein A affinity chromatography. The structural basis for the effects of these mutations was analyzed by X-ray crystallography. While the mutation that disrupted protein A binding also inhibited FcRn interaction, a bispecific mutant in which one subunit retained the ability to bind protein A could still interact with FcRn. Pharmacokinetic analysis of the serum half-lives of the mutants showed that the mutant BsAb had a serum half-life comparable to a wild-type Ab. The results describe a rapid method for generating panels of mouse BsAbs that could be used in mouse studies. PMID:28898162

  19. Molecular differentiation of three loach species (Pisces, Cobitidae) based on the nuclear 5S rDNA marker

    Czech Academy of Sciences Publication Activity Database

    Kirtiklis, L.; Boron, A.; Ptasznik, P.; Lusková, Věra; Lusk, Stanislav

    2011-01-01

    Roč. 59, 3-4 (2011), s. 141-145 ISSN 0015-5497 Institutional research plan: CEZ:AV0Z60930519 Keywords : Cobitis * PCR-RFLP * Sabanejewia * species identification * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.657, year: 2011

  20. Adaptation of the S-5-S Pendulím Seismometer for Measurement of Rotational Ground Motion

    Czech Academy of Sciences Publication Activity Database

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-01-01

    Roč. 16, č. 4 (2012), s. 649-656 ISSN 1383-4649 Institutional support: RVO:68145535 Keywords : rotation al ground motion * experimental measurement * mining induced seismicity * S-5-S seismometer Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.388, year: 2012 http://link.springer.com/article/10.1007%2Fs10950-012-9279-6

  1. Genetic variation at minisatellite loci D1S7, D4S139, D5S110 and ...

    Indian Academy of Sciences (India)

    Unknown

    Genetic variation at four minisatellite loci D1S7, D4S139, D5S110 and D17S79 in three predominant population groups of eastern India, namely Brahmin, Kayastha and Garo, are reported in this study. The Brahmin and Kayastha are of Indo-Caucasoid origin while the Garo community represents the Indo-Mongoloid ethnic ...

  2. Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice.

    Science.gov (United States)

    Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T

    2013-11-04

    Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Mutant TDP-43 and FUS Cause Age-Dependent Paralysis and Neurodegeneration in C. elegans

    Science.gov (United States)

    Vaccaro, Alexandra; Tauffenberger, Arnaud; Aggad, Dina; Rouleau, Guy; Drapeau, Pierre; Parker, J. Alex

    2012-01-01

    Mutations in the DNA/RNA binding proteins TDP-43 and FUS are associated with Amyotrophic Lateral Sclerosis and Frontotemporal Lobar Degeneration. Intracellular accumulations of wild type TDP-43 and FUS are observed in a growing number of late-onset diseases suggesting that TDP-43 and FUS proteinopathies may contribute to multiple neurodegenerative diseases. To better understand the mechanisms of TDP-43 and FUS toxicity we have created transgenic Caenorhabditis elegans strains that express full-length, untagged human TDP-43 and FUS in the worm's GABAergic motor neurons. Transgenic worms expressing mutant TDP-43 and FUS display adult-onset, age-dependent loss of motility, progressive paralysis and neuronal degeneration that is distinct from wild type alleles. Additionally, mutant TDP-43 and FUS proteins are highly insoluble while wild type proteins remain soluble suggesting that protein misfolding may contribute to toxicity. Populations of mutant TDP-43 and FUS transgenics grown on solid media become paralyzed over 7 to 12 days. We have developed a liquid culture assay where the paralysis phenotype evolves over several hours. We introduce C. elegans transgenics for mutant TDP-43 and FUS motor neuron toxicity that may be used for rapid genetic and pharmacological suppressor screening. PMID:22363618

  4. Hair defects in Hoxc13 mutant mice.

    Science.gov (United States)

    Godwin, A R; Capecchi, M R

    1999-12-01

    Hox genes encode transcription factors that are important during normal embryonic development of diverse organisms including vertebrates. In mammals, Hox genes are responsible for conferring regional identity in embryonic tissues, including the limb bud, the neural tube, the presomitic mesoderm and the intestinal tract. Recent studies have demonstrated expression of Hox genes in skin and hair follicles, suggesting potential functions for these genes in epidermal appendages. These studies are reviewed here with emphasis on Hoxc13, as Hoxc13 mutants are the first Hox mutants to demonstrate overt hair defects. In addition, because Hoxc13 does not show regionally restricted expression in the skin, as demonstrated for other Hox genes, the potentially different roles of Hoxc13 versus other Hox genes in the skin are discussed.

  5. PNRI mutant variety: sansevieria 'Sword of Ibe'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2011-01-01

    Sansevieria 'Sword of Ibe,' registered by the Philippine Nuclear Research Institute as NSIC 2008 Or-66, is a chlorophyll mutant of Sansevieria trifasciata 'Moonshine' developed by treating its suckers or shoots arising from a rhizome with acute gamma radiation from a Cobalt-60 source. The new mutant is identical in growth habit and vigor to Sansevieria 'Moonshine,' also known as Moonglow. Results of this mutation breeding experiment showed that leaf color and flowering were altered by gamma irradiation without changing the other characteristics of the plant. Propagation is true-to-type by separation of sucker and top cutting. The plant is recommended for use as landscaping material and as pot plant for indoor and outdoor use. The leaves may be harvested as cut foliage for Japanese flower arrangements. (author)

  6. Recombination-deficient mutant of Streptococcus faecalis

    International Nuclear Information System (INIS)

    Yagi, Y.; Clewell, D.B.

    1980-01-01

    An ultraviolet radiation-sensitive derivative of Streptococcus faecalis strain JH2-2 was isolated and found to be deficient in recombination, using a plasmid-plasmid recombination system. The strain was sensitive to chemical agents which interact with deoxyribonucleic acid and also underwent deoxyribonucleic acid degradation after ultraviolet irradiation. Thus, the mutant has properties similar to those of recA strains of Escherichia coli

  7. Characterization of a Legionella micdadei mip mutant

    DEFF Research Database (Denmark)

    O'Connell, W A; Bangsborg, Jette Marie; Cianciotto, N P

    1995-01-01

    The pathogenesis of Legionella micdadei is dependent upon its ability to infect alveolar phagocytes. To better understand the basis of intracellular infection by this organism, we examined the importance of its Mip surface protein. In Legionella pneumophila, Mip promotes infection of both human m...... into the phagocyte. Similarly, the mutant was less able to parasitize Hartmannella amoebae. Taken together, these data argue that Mip specifically potentiates intracellular growth by L. micdadei....

  8. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  9. Structural Determinants of the Gain-of-Function Phenotype of Human Leukemia-associated Mutant CBL Oncogene.

    Science.gov (United States)

    Nadeau, Scott A; An, Wei; Mohapatra, Bhopal C; Mushtaq, Insha; Bielecki, Timothy A; Luan, Haitao; Zutshi, Neha; Ahmad, Gulzar; Storck, Matthew D; Sanada, Masashi; Ogawa, Seishi; Band, Vimla; Band, Hamid

    2017-03-03

    Mutations of the tyrosine kinase-directed ubiquitin ligase CBL cause myeloid leukemias, but the molecular determinants of the dominant leukemogenic activity of mutant CBL oncogenes are unclear. Here, we first define a gain-of-function attribute of the most common leukemia-associated CBL mutant, Y371H, by demonstrating its ability to increase proliferation of hematopoietic stem/progenitor cells (HSPCs) derived from CBL-null and CBL/CBL-B-null mice. Next, we express second-site point/deletion mutants of CBL-Y371H in CBL/CBL-B-null HSPCs or the cytokine-dependent human leukemic cell line TF-1 to show that individual or combined Tyr → Phe mutations of established phosphotyrosine residues (Tyr-700, Tyr-731, and Tyr-774) had little impact on the activity of the CBL-Y371H mutant in HSPCs, and the triple Tyr → Phe mutant was only modestly impaired in TF-1 cells. In contrast, intact tyrosine kinase-binding (TKB) domain and proline-rich region (PRR) were critical in both cell models. PRR deletion reduced the stem cell factor (SCF)-induced hyper-phosphorylation of the CBL-Y371H mutant and the c-KIT receptor and eliminated the sustained p-ERK1/2 and p-AKT induction by SCF. GST fusion protein pulldowns followed by phospho-specific antibody array analysis identified distinct CBL TKB domains or PRR-binding proteins that are phosphorylated in CBL-Y371H-expressing TF-1 cells. Our results support a model of mutant CBL gain-of-function in which mutant CBL proteins effectively compete with the remaining wild type CBL-B and juxtapose TKB domain-associated PTKs with PRR-associated signaling proteins to hyper-activate signaling downstream of hematopoietic growth factor receptors. Elucidation of mutant CBL domains required for leukemogenesis should facilitate targeted therapy approaches for patients with mutant CBL-driven leukemias. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Selection of hyperadherent mutants in Pseudomonas putida biofilms

    DEFF Research Database (Denmark)

    Yousef-Coronado, Fatima; Soriano, María Isabel; Yang, Liang

    2011-01-01

    transposon Pseudomonas putida KT2440 mutants showing increased biofilm formation, and the detailed characterization of one of them. This mutant exhibits a complex phenotype, including altered colony morphology, increased production of extracellular polymeric substances and enhanced swarming motility, along...

  11. Multivariate analysis for selecting apple mutants

    International Nuclear Information System (INIS)

    Faedi, W.; Bagnara, G.L.; Rosati, P.; Cecchini, M.

    1992-01-01

    The mutlivariate analysis of four year records on several vegetative and productive traits of twenty-one apple mutants (3 of 'Jonathan', 3 of 'Ozark Gold', 14 of 'Mollie's Delicious', 1 of 'Neipling's Early Stayman)' induced by gamma radiations showed that observation of some traits of one-year-old shoots is the most efficient way to reveal compact growing apple mutants. In particular, basal cross-section area, total length and leaf area resulted the most appropriate parameters, while internode length together with conopy height and width are less appropriate. The most interesting mutants we found are: one of 'Mollie's Delicious for the best balance among tree and fruit traits and for high skin color; one of 'Neipling's Early Stayman' with an earlier and more extensively red colored apple than the original clone. (author)

  12. Probiotic features of Lactobacillus plantarum mutant strains.

    Science.gov (United States)

    Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela

    2012-10-01

    In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.

  13. Grain product of 34 soya mutant lines

    International Nuclear Information System (INIS)

    Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A.

    2009-01-01

    This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R 4 M 18 ) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co 60 gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L 25 and L 32 produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

  14. Distinctive Klf4 mutants determine preference for DNA methylation status

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.; Jin, Peng; Blumenthal, Robert M.; Zhang, Xing; Cheng, Xiaodong

    2016-09-04

    Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resulted in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.

  15. RNA-binding region of Macrobrachium rosenbergii nodavirus capsid protein.

    Science.gov (United States)

    Goh, Zee Hong; Mohd, Nur Azmina Syakirin; Tan, Soon Guan; Bhassu, Subha; Tan, Wen Siang

    2014-09-01

    White tail disease (WTD) kills prawn larvae and causes drastic losses to the freshwater prawn (Macrobrachium rosenbergii) industry. The main causative agent of WTD is Macrobrachium rosenbergii nodavirus (MrNV). The N-terminal end of the MrNV capsid protein is very rich in positively charged amino acids and is postulated to interact with RNA molecules. N-terminal and internal deletion mutagenesis revealed that the RNA-binding region is located at positions 20-29, where 80 % of amino acids are positively charged. Substitution of all these positively charged residues with alanine abolished the RNA binding. Mutants without the RNA-binding region still assembled into virus-like particles, suggesting that this region is not a part of the capsid assembly domain. This paper is, to the best of our knowledge, the first to report the specific RNA-binding region of MrNV capsid protein. © 2014 The Authors.

  16. Amphitrite ornata Dehaloperoxidase (DHP): Investigations of Structural Factors That Influence the Mechanism of Halophenol Dehalogenation Using ;Peroxidase-like; Myoglobin Mutants and ;Myoglobin-like; DHP Mutants

    Energy Technology Data Exchange (ETDEWEB)

    Du, Jing; Huang, Xiao; Sun, Shengfang; Wang, Chunxue; Lebioda, Lukasz; Dawson, John H. (SC)

    2012-05-14

    Dehaloperoxidase (DHP), discovered in the marine terebellid polychaete Amphitrite ornata, is the first heme-containing globin with a peroxidase activity. The sequence and crystal structure of DHP argue that it evolved from an ancient O{sub 2} transport and storage globin. Thus, DHP retains an oxygen carrier function but also has the ability to degrade halophenol toxicants in its living environment. Sperm whale myoglobin (Mb) in the ferric state has a peroxidase activity {approx}10 times lower than that of DHP. The catalytic activity enhancement observed in DHP appears to have been generated mainly by subtle changes in the positions of the proximal and distal histidine residues that appeared during DHP evolution. Herein, we report investigations into the mechanism of action of DHP derived from examination of 'peroxidase-like' Mb mutants and 'Mb-like' DHP mutants. The dehalogenation ability of wild-type Mb is augmented in the peroxidase-like Mb mutants (F43H/H64L, G65T, and G65I Mb) but attenuated in the Mb-like T56G DHP variant. X-ray crystallographic data show that the distal His residues in G65T Mb and G65I are positioned {approx}0.3 and {approx}0.8 {angstrom}, respectively, farther from the heme iron compared to that in the wild-type protein. The H93K/T95H double mutant Mb with the proximal His shifted to the 'DHP-like' position has an increased peroxidase activity. In addition, a better dehaloperoxidase (M86E DHP) was generated by introducing a negative charge near His89 to enhance the imidazolate character of the proximal His. Finally, only minimal differences in dehalogenation activities are seen among the exogenous ligand-free DHP, the acetate-bound DHP, and the distal site blocker L100F DHP mutant. Thus, we conclude that binding of halophenols in the internal binding site (i.e., distal cavity) is not essential for catalysis. This work provides a foundation for a new structure-function paradigm for peroxidases and for the

  17. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  18. Evaluation of soybean mutants evolved from gamma irradiation

    International Nuclear Information System (INIS)

    Naseri Tafti, M.; Yousefi, F.; Rezazadeh, M.; Sabzi, H.; Ojani, R.

    2003-01-01

    Pure early soybean mutants evolved through mutagenesis (Co-60) from cultivar Clark irradiated with doses 100 Gy, 150 Gy and 250 Gy (absorbed dose) were evaluated for agronomic al traits and compared with two commercial cultivars; Clark and Williams in two regions, Karaj and Alishtar. Experimental design was conducted in a simple lattice (7 m x 7 m) with two replications. A significant statistical difference in yield existed at 1 and 5 percent level among mutants lines and between mutants - Williams and mutants - Clark, respectively in Karaj. The mutant line number 47 placed itself at the top of the list with yield of 4782 Kg/hect., followed by mutant line number 38 with 4722 Kg/hect. A number of mutant lines matured between 10 to 12 days earlier than the commercial soybean cultivars used as checks in the experiment. In Alishtar seed yield of mutant lines compared to the cultivar Williams showed a significant difference at 5% level. The highest seed yield of 3147 Kg/hect. belonged to the mutant line 47 which also matured two weeks earlier compared to the cultivar Clark. The compound analysis of seed yield in Karaj and Alishtar showed superiority of 15 mutant lines over the cultivar Clark and 36 mutant lines over the cultivar Williams. The mutant line number 18 producing seed yield of 3643 Kg/hect. ranks first in the list while, it matured earlier than both check cultivars, Clark and Williams

  19. Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants

    NARCIS (Netherlands)

    García-Contreras, R; Lira-Silva, E; Jasso-Chávez, R; Hernández-González, I.L.; Maeda, T.; Hashimoto, T.; Boogerd, F.C.; Sheng, L; Wood, TK; Moreno-Sánchez, R

    2013-01-01

    Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed

  20. Biological changes in Barley mutants resistant to powdery mildew disease

    International Nuclear Information System (INIS)

    Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

    2012-12-01

    physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

  1. L5 nerve root duplication in the setting of MRI-depicted L5-S1 disk herniation

    Directory of Open Access Journals (Sweden)

    Desmond A. Brown

    2015-09-01

    Full Text Available Lumbosacral nerve root anomalies are rare anatomic variations with a predilection for the lumbosacral spine. Among these, conjoined nerve roots are the most common with other rare variants such as nerve root duplication occurring far less frequently. While these anatomic variations are exceedingly rare, their presence has significant clinical ramifications. Undiagnosed lumbosacral nerve root anomalies are at risk for iatrogenic injury, may contribute to wrong-site surgery and contribute to continued postoperative symptoms. Herein, we present a case of a 74 year-old female with diskogenic back pain and L5 radiculopathy found to have a duplicated L5 nerve root intraoperatively. Interestingly, the L5-S1 disk was found to be normal and unlikely to contribute to her presentation. She underwent L5-S1 laminectomy and L5 foraminotomy with resolution of her L5 radicular symptoms postoperatively.

  2. DNS & Bind Cookbook

    CERN Document Server

    Liu, Cricket

    2011-01-01

    The DNS & BIND Cookbook presents solutions to the many problems faced by network administrators responsible for a name server. Following O'Reilly's popular problem-and-solution cookbook format, this title is an indispensable companion to DNS & BIND, 4th Edition, the definitive guide to the critical task of name server administration. The cookbook contains dozens of code recipes showing solutions to everyday problems, ranging from simple questions, like, "How do I get BIND?" to more advanced topics like providing name service for IPv6 addresses. It's full of BIND configuration files that yo

  3. Human GLTP and mutant forms of ACD11 suppress cell death in the Arabidopsis acd11 mutant

    DEFF Research Database (Denmark)

    Petersen, Nikolaj H T; McKinney, Lea V; Pike, Helen

    2008-01-01

    The Arabidopsis acd11 mutant exhibits runaway, programmed cell death due to the loss of a putative sphingosine transfer protein (ACD11) with homology to mammalian GLTP. We demonstrate that transgenic expression in Arabidopsis thaliana of human GLTP partially suppressed the phenotype of the acd11...... null mutant, resulting in delayed programmed cell death development and plant survival. Surprisingly, a GLTP mutant form impaired in glycolipid transfer activity also complemented the acd11 mutants. To understand the relationship between functional complementarity and transfer activity, we generated...... site-specific mutants in ACD11 based on homologous GLTP residues required for glycolipid transfer. We show that these ACD11 mutant forms are impaired in their in vitro transfer activity of sphingolipids. However, transgenic expression of these mutant forms fully complemented acd11 mutant cell death...

  4. The engine maintenance scheduling by using reliability centered maintenance method and the identification of 5S application in PT. XYZ

    Science.gov (United States)

    Sembiring, N.; Panjaitan, N.; Saragih, A. F.

    2018-02-01

    PT. XYZ is a manufacturing company that produces fresh fruit bunches (FFB) to Crude Palm Oil (CPO) and Palm Kernel Oil (PKO). PT. XYZ consists of six work stations: receipt station, sterilizing station, thressing station, pressing station, clarification station, and kernelery station. So far, the company is still implementing corrective maintenance maintenance system for production machines where the machine repair is done after damage occurs. Problems at PT. XYZ is the absence of scheduling engine maintenance in a planned manner resulting in the engine often damaged which can disrupt the smooth production. Another factor that is the problem in this research is the kernel station environment that becomes less convenient for operators such as there are machines and equipment not used in the production area, slippery, muddy, scattered fibers, incomplete use of PPE, and lack of employee discipline. The most commonly damaged machine is in the seed processing station (kernel station) which is cake breaker conveyor machine. The solution of this problem is to propose a schedule plan for maintenance of the machine by using the method of reliability centered maintenance and also the application of 5S. The result of the application of Reliability Centered maintenance method is obtained four components that must be treated scheduled (time directed), namely: for bearing component is 37 days, gearbox component is 97 days, CBC pen component is 35 days and conveyor pedal component is 32 days While after identification the application of 5S obtained the proposed corporate environmental improvement measures in accordance with the principles of 5S where unused goods will be moved from the production area, grouping goods based on their use, determining the procedure of cleaning the production area, conducting inspection in the use of PPE, and making 5S slogans.

  5. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    Directory of Open Access Journals (Sweden)

    Nezih Akca

    2014-01-01

    Full Text Available Context: Little seems to be known about the sexual dysfunction (SD in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois. The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was

  6. Intramolecular Binding of the Rad9 C Terminus in the Checkpoint Clamp Rad9-Hus1-Rad1 Is Closely Linked with Its DNA Binding.

    Science.gov (United States)

    Takeishi, Yukimasa; Iwaya-Omi, Rie; Ohashi, Eiji; Tsurimoto, Toshiki

    2015-08-07

    The human checkpoint clamp Rad9-Hus1-Rad1 (9-1-1) is loaded onto chromatin by its loader complex, Rad17-RFC, following DNA damage. The 120-amino acid (aa) stretch of the Rad9 C terminus (C-tail) is unstructured and projects from the core ring structure (CRS). Recent studies showed that 9-1-1 and CRS bind DNA independently of Rad17-RFC. The DNA-binding affinity of mutant 9(ΔC)-1-1, which lacked the Rad9 C-tail, was much higher than that of wild-type 9-1-1, suggesting that 9-1-1 has intrinsic DNA binding activity that manifests in the absence of the C-tail. C-tail added in trans interacted with CRS and prevented it from binding to DNA. We narrowed down the amino acid sequence in the C-tail necessary for CRS binding to a 15-aa stretch harboring two conserved consecutive phenylalanine residues. We prepared 9-1-1 mutants containing the variant C-tail deficient for CRS binding, and we demonstrated that the mutant form restored DNA binding as efficiently as 9(ΔC)-1-1. Furthermore, we mapped the sequence necessary for TopBP1 binding within the same 15-aa stretch, demonstrating that TopBP1 and CRS share the same binding region in the C-tail. Indeed, we observed their competitive binding to the C-tail with purified proteins. The importance of interaction between 9-1-1 and TopBP1 for DNA damage signaling suggests that the competitive interactions of TopBP1 and CRS with the C-tail will be crucial for the activation mechanism. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. [Work organisation improvement methods applied to activities of Blood Transfusion Establishments (BTE): Lean Manufacturing, VSM, 5S].

    Science.gov (United States)

    Bertholey, F; Bourniquel, P; Rivery, E; Coudurier, N; Follea, G

    2009-05-01

    Continuous improvement of efficiency as well as new expectations from customers (quality and safety of blood products) and employees (working conditions) imply constant efforts in Blood Transfusion Establishments (BTE) to improve work organisations. The Lean method (from "Lean" meaning "thin") aims at identifying wastages in the process (overproduction, waiting, over-processing, inventory, transport, motion) and then reducing them in establishing a mapping of value chain (Value Stream Mapping). It consists in determining the added value of each step of the process from a customer perspective. Lean also consists in standardizing operations while implicating and responsabilizing all collaborators. The name 5S comes from the first letter of five operations of a Japanese management technique: to clear, rank, keep clean, standardize, make durable. The 5S method leads to develop the team working inducing an evolution of the way in the management is performed. The Lean VSM method has been applied to blood processing (component laboratory) in the Pays de la Loire BTE. The Lean 5S method has been applied to blood processing, quality control, purchasing, warehouse, human resources and quality assurance in the Rhône-Alpes BTE. The experience returns from both BTE shows that these methods allowed improving: (1) the processes and working conditions from a quality perspective, (2) the staff satisfaction, (3) the efficiency. These experiences, implemented in two BTE for different processes, confirm the applicability and usefulness of these methods to improve working organisations in BTE.

  8. Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

    Science.gov (United States)

    Zhang, Yawei; Li, Gang

    2018-01-01

    Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

  9. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    Directory of Open Access Journals (Sweden)

    Won-Suh Choi

    2016-01-01

    Full Text Available Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH, disc angle (DA, disc slope angle, segmental lordotic angle (SLA, lumbar lordotic angle (LLA, and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS, Oswestry disability index (ODI, and patient satisfaction rate (PSR were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21 at 12 months’ follow-up. The most common cage position was anteromedial (15/21. The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21. Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable.

  10. Mutants of Agrobacterium tumefaciens with elevated vir gene expression

    International Nuclear Information System (INIS)

    Pazour, G.J.; Ta, C.N.; Das, A.

    1991-01-01

    Expression of Agrobacterium tumefaciens virulence (vir) genes requires virA, virG, and a plant-derived inducing compound such as acetosyringone. To identify the critical functional domains of virA and virG, a mutational approach was used. Agrobacterium A136 harboring plasmid pGP159, which contains virA, virG, and a reporter virB:lacZ gene fusion, was mutagenized with UV light or nitrosoguanidine. Survivors that formed blue colonies on a plate containing 5-bromo-4-chloro-3-indolyl beta-D-galactoside were isolated and analyzed. Quantification of beta-galactosidase activity in liquid assays identified nine mutant strains. By plasmid reconstruction and other procedures, all mutations mapped to the virA locus. These mutations caused an 11- to 560-fold increase in the vegetative level of virB:lacZ reporter gene expression. DNA sequence analysis showed that the mutations are located in four regions of VirA: transmembrane domain one, the active site, a glycine-rich region with homology to ATP-binding sites, and a region at the C terminus that has homology to the N terminus of VirG

  11. Relationship between intracellular Na+ concentration and reduced Na+ affinity in Na+,K+-ATPase mutants causing neurological disease

    DEFF Research Database (Denmark)

    Toustrup-Jensen, Mads Schak; Einholm, Anja P.; Schack, Vivien

    2014-01-01

    The neurological disorders familial hemiplegic migraine type 2 (FHM2), alternating hemiplegia of childhood (AHC), and rapid-onset dystonia parkinsonism (RDP) are caused by mutations of Na+,K+-ATPase α2- and α3-isoforms, expressed in glial and neuronal cells, respectively. Although these disorders......, addressing the question to what extent they cause a change of the intracellular Na+ and K+ concentrations ([Na+]i and [K+]i) in COS cells. C-terminal extension mutants generally showed dramatically reduced Na+ affinity without disturbance of K+ binding, as did other RDP mutants. No phosphorylation from ATP...... was observed for the +28 mutation of α2, despite a high expression level. A significant rise of [Na+]i and reduction of [K+]i was detected in cells expressing mutants with reduced Na+ affinity, and did not require a concomitant reduction of the maximal catalytic turnover rate or expression level. Moreover, two...

  12. Host factor I, Hfq, binds to Escherichia coli ompA mRNA in a growth rate-dependent fashion and regulates its stability

    DEFF Research Database (Denmark)

    Vytvytska, O; Jakobsen, J S; Balcunaite, G

    1998-01-01

    RNA. In hfq mutant cells with a deficient Hfq gene product, the RNA-binding activity is missing, and analysis of the ompA mRNA showed that the growth-rate dependence of degradation is lost. Furthermore, the half-life of the ompA mRNA is prolonged in the mutant cells, irrespective of growth rate. Hfq has...

  13. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  14. Progranulin is neurotrophic in vivo and protects against a mutant TDP-43 induced axonopathy.

    Directory of Open Access Journals (Sweden)

    Angela S Laird

    Full Text Available Mislocalization, aberrant processing and aggregation of TAR DNA-binding protein 43 (TDP-43 is found in the neurons affected by two related diseases, amyotrophic lateral sclerosis (ALS and frontotemporal lobe dementia (FTLD. These TDP-43 abnormalities are seen when TDP-43 is mutated, such as in familial ALS, but also in FTLD, caused by null mutations in the progranulin gene. They are also found in many patients with sporadic ALS and FTLD, conditions in which only wild type TDP-43 is present. The common pathological hallmarks and symptomatic cross over between the two diseases suggest that TDP-43 and progranulin may be mechanistically linked. In this study we aimed to address this link by establishing whether overexpression of mutant TDP-43 or knock-down of progranulin in zebrafish embryos results in motor neuron phenotypes and whether human progranulin is neuroprotective against such phenotypes. Mutant TDP-43 (A315T mutation induced a motor axonopathy characterized by short axonal outgrowth and aberrant branching, similar, but more severe, than that induced by mutant SOD1. Knockdown of the two zebrafish progranulin genes, grna and grnb, produced a substantial decrease in axonal length, with knockdown of grna alone producing a greater decrease in axonal length than grnb. Progranulin overexpression rescued the axonopathy induced by progranulin knockdown. Interestingly, progranulin also rescued the mutant TDP-43 induced axonopathy, whilst it failed to affect the mutant SOD1-induced phenotype. TDP-43 was found to be nuclear in all conditions described. The findings described here demonstrate that progranulin is neuroprotective in vivo and may have therapeutic potential for at least some forms of motor neuron degeneration.

  15. Mutant TDP-43 deregulates AMPK activation by PP2A in ALS models.

    Directory of Open Access Journals (Sweden)

    Nirma D Perera

    Full Text Available Bioenergetic abnormalities and metabolic dysfunctionoccur in amyotrophic lateral sclerosis (ALS patients and genetic mouse models. However, whether metabolic dysfunction occurs earlyin ALS pathophysiology linked to different ALS genes remains unclear.Here, we investigatedAMP-activated protein kinase (AMPK activation, which is a key enzyme induced by energy depletion and metabolic stress, inneuronal cells and mouse models expressing mutantsuperoxide dismutase 1 (SOD1or TAR DNA binding protein 43 (TDP-43 linked to ALS.AMPKphosphorylation was sharply increased in spinal cords of transgenic SOD1G93A mice at disease onset and accumulated incytoplasmic granules in motor neurons, but not in pre-symptomatic mice. AMPK phosphorylation also occurred in peripheraltissues, liver and kidney, in SOD1G93A mice at disease onset, demonstrating that AMPK activation occurs late and is not restricted to motor neurons. Conversely, AMPK activity was drastically diminished in spinal cords and brains of presymptomatic and symptomatictransgenic TDP-43A315T mice and motor neuronal cells expressing different TDP-43 mutants. We show that mutant TDP-43 induction of the AMPK phosphatase,protein phosphatase 2A (PP2A, is associated with AMPK inactivation in these ALS models. Furthermore, PP2A inhibition by okadaic acid reversed AMPK inactivation by mutant TDP-43 in neuronal cells. Our results suggest that mutant SOD1 and TDP-43 exert contrasting effects on AMPK activation which may reflect key differences in energy metabolism and neurodegeneration in spinal cords of SOD1G93A and TDP-43A315T mice. While AMPK activation in motor neurons correlateswith progressionin mutant SOD1-mediated disease, AMPK inactivation mediated by PP2Ais associated withmutant TDP-43-linked ALS.

  16. Large-scale RNA interference screening in mammalian cells identifies novel regulators of mutant huntingtin aggregation.

    Directory of Open Access Journals (Sweden)

    Tomoyuki Yamanaka

    Full Text Available In polyglutamine (polyQ diseases including Huntington's disease (HD, mutant proteins containing expanded polyQ stretch form aggregates in neurons. Genetic or RNAi screenings in yeast, C. elegans or Drosophila have identified multiple genes modifying polyQ aggregation, a few of which are confirmed effective in mammals. However, the overall molecular mechanism underlying polyQ protein aggregation in mammalian cells still remains obscure. We here perform RNAi screening in mouse neuro2a cells to identify mammalian modifiers for aggregation of mutant huntingtin, a causative protein of HD. By systematic cell transfection and automated cell image analysis, we screen ∼ 12000 shRNA clones and identify 111 shRNAs that either suppress or enhance mutant huntingtin aggregation, without altering its gene expression. Classification of the shRNA-targets suggests that genes with various cellular functions such as gene transcription and protein phosphorylation are involved in modifying the aggregation. Subsequent analysis suggests that, in addition to the aggregation-modifiers sensitive to proteasome inhibition, some of them, such as a transcription factor Tcf20, and kinases Csnk1d and Pik3c2a, are insensitive to it. As for Tcf20, which contains polyQ stretches at N-terminus, its binding to mutant huntingtin aggregates is observed in neuro2a cells and in HD model mouse neurons. Notably, except Pik3c2a, the rest of the modifiers identified here are novel. Thus, our first large-scale RNAi screening in mammalian system identifies previously undescribed genetic players that regulate mutant huntingtin aggregation by several, possibly mammalian-specific mechanisms.

  17. Specificity of anion-binding in the substrate-pocket ofbacteriorhodopsin

    Energy Technology Data Exchange (ETDEWEB)

    Facciotti, Marc T.; Cheung, Vincent S.; Lunde, Christopher S.; Rouhani, Shahab; Baliga, Nitin S.; Glaeser, Robert M.

    2003-08-30

    The structure of the D85S mutant of bacteriorhodopsin with a nitrate anion bound in the Schiff-base binding site, and the structure of the anion-free protein have been obtained in the same crystal form. Together with the previously solved structures of this anion pump, in both the anion-free state and bromide-bound state, these new structures provide insight into how this mutant of bacteriorhodopsin is able to bind a variety of different anions in the same binding pocket. The structural analysis reveals that the main structural change that accommodates different anions is the repositioning of the polar side-chain of S85. On the basis of these x-ray crystal structures, the prediction is then made that the D85S/D212N double mutant might bind similar anions and do so over a broader pH range than does the single mutant. Experimental comparison of the dissociation constants, K{sub d}, for a variety of anions confirms this prediction and demonstrates, in addition, that the binding affinity is dramatically improved by the D212N substitution.

  18. DNS BIND Server Configuration

    Directory of Open Access Journals (Sweden)

    Radu MARSANU

    2011-01-01

    Full Text Available After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  19. DNS BIND Server Configuratio

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  20. DNS BIND Server Configuration

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  1. Melanin-binding radiopharmaceuticals

    Energy Technology Data Exchange (ETDEWEB)

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  2. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  3. Molecular dynamic simulation of wild type and mutants of the polymorphic amyloid NNQNTF segments of elk prion: structural stability and thermodynamic of association.

    Science.gov (United States)

    Berhanu, Workalemahu M; Masunov, Artëm E

    2011-09-01

    A hexapeptide with amino acid sequence NNQNTF from the elk prion protein forms amyloid fibrils. Here we use molecular dynamic simulations of the oligomers and their single point glycine mutants to study their stability. In an effort to probe the structural stability and association thermodynamic in a realistic environment, all wildtype of NNQNTF polymorphic forms with different size and their corresponding double layer 5 strands single point glycine mutants were subjected to a total of 500 ns of explicit-solvent molecular dynamics (MD) simulation. Our results show that the structural stability of the NNQNTF oligomers increases with increasing the number of β-strands for double layers. Our results also demonstrated that hydrophobic interaction is the principle driving force to stabilize the adjacent β-strands while the steric zipper is responsible for holding the neighboring β-sheet layers together. We used MM-PBSA approach free energy calculations to determine the role of nonpolar effects, electrostatics and entropy in binding. Nonpolar effects remained consistently more favorable in wild type and mutants reinforcing the importance of hydrophobic effects in protein-protein binding. While entropy systematically opposed binding in all cases, there was no observed trend in the entropy difference between wildtype and glycine mutant. Free energy decomposition shows residues situated at the interface were found to make favorable contributions to the peptide-peptide association. The study of the wild type and mutants in an explicit solvent may provide valuable insight for amyloid aggregation inhibitor design efforts. Copyright © 2011 Wiley Periodicals, Inc.

  4. Using of AFLP to evaluate gamma-irradiated amaranth mutants

    Directory of Open Access Journals (Sweden)

    Labajová Mária

    2013-01-01

    Full Text Available To determine which of several gamma-irradiated mutants of amaranth Ficha cultivar and K-433 hybrid are most genetically similar to their non-irradiated control genotypes, we performed amplified fragment length polymorphism (AFLP based analysis. A total of 40 selective primer combinations were used in reported analyses. First analyses of gamma-irradiated amaranth mutant lines were done used the AFLP. In the study, primers with the differentiation ability for all analysed mutant lines are reported. The very specific changes in the mutant lines´ non-coding regions based on AFLP length polymorphism were analysed. Mutant lines of the Ficha cultivar (C15, C26, C27, C82, C236 shared a genetic dissimilarity of 0,11 and their ISSR profiles are more similar to the Ficha than those of K-433 hybrid mutant lines. The K-433 mutant lines (D54, D279, D282 shared genetic dissimilarity of 0,534 but are more distinct to their control plant as a whole, as those of the Ficha mutant lines. Different AFLP fingerprints patters of the mutant lines when compared to the Ficha cultivar and K-433 hybrid AFLP profiles may be a consequence of the complex response of the intergenic space of mutant lines to the gamma-radiance. Although a genetic polymorphism was detected within accessions, the AFLP markers successfully identified all the accessions. The AFLP results are discussed by a combination of biochemical characteristics of mutant lines and their control genotypes.

  5. Distribution of soluble amino acids in maize endosperm mutants

    Directory of Open Access Journals (Sweden)

    Toro Alejandro Alberto

    2003-01-01

    Full Text Available For human nutrition the main source of vegetable proteins are cereal and legume seeds. The content of total soluble amino acids in mature endosperm of wild-type, opaque and floury maize (Zea mays L. mutants were determined by HPLC. The total absolute concentration of soluble amino acids among the mutants varied depending on the mutant. The o11 and o13 mutants exhibited the highest average content, whereas o10, fl3 and fl1 exhibited the lowest average content. In general, the mutants exhibited similar concentrations of total soluble amino acids when compared to the wild-type lines, with the clear exception of mutants o11 and fl1, with the o11 mutant exhibiting a higher concentration of total soluble amino acids when compared to its wild-type counterpart W22 and the fl1 mutant a lower concentration when compared to its wild-type counterpart Oh43. For methionine, the mutants o2 and o11 and wild-type Oh43 exhibited the highest concentrations of this amino acid. Significant differences were not observed between mutants for other amino acids such as lysine and threonine. The high lysine concentrations obtained originally for these mutants may be due to the amino acids incorporated into storage proteins, but not those present in the soluble form.

  6. Defining the Ail Ligand-Binding Surface: Hydrophobic Residues in Two Extracellular Loops Mediate Cell and Extracellular Matrix Binding To Facilitate Yop Delivery.

    Science.gov (United States)

    Tsang, Tiffany M; Wiese, Jeffrey S; Alhabeil, Jamal A; Usselman, Lisa D; Thomson, Joshua J; Matti, Rafla; Kronshage, Malte; Maricic, Natalie; Williams, Shanedah; Sleiman, Naama H; Felek, Suleyman; Krukonis, Eric S

    2017-04-01

    Yersinia pestis , the causative agent of plague, binds host cells to deliver cytotoxic Yop proteins into the cytoplasm that prevent phagocytosis and generation of proinflammatory cytokines. Ail is an eight-stranded β-barrel outer membrane protein with four extracellular loops that mediates cell binding and resistance to human serum. Following the deletion of each of the four extracellular loops that potentially interact with host cells, the Ail-Δloop 2 and Ail-Δloop 3 mutant proteins had no cell-binding activity while Ail-Δloop 4 maintained cell binding (the Ail-Δloop 1 protein was unstable). Using the codon mutagenesis scheme SWIM (selection without isolation of mutants), we identified individual residues in loops 1, 2, and 3 that contribute to host cell binding. While several residues contributed to the binding of host cells and purified fibronectin and laminin, as well as Yop delivery, three mutations, F80A (loop 2), S128A (loop 3), and F130A (loop 3), produced particularly severe defects in cell binding. Combining these mutations led to an even greater reduction in cell binding and severely impaired Yop delivery with only a slight defect in serum resistance. These findings demonstrate that Y. pestis Ail uses multiple extracellular loops to interact with substrates important for adhesion via polyvalent hydrophobic interactions. Copyright © 2017 American Society for Microbiology.

  7. Mutant ribosomes can generate dominant kirromycin resistance.

    OpenAIRE

    Tubulekas, I; Buckingham, R H; Hughes, D

    1991-01-01

    Mutations in the two genes for EF-Tu in Salmonella typhimurium and Escherichia coli, tufA and tufB, can confer resistance to the antibiotic kirromycin. Kirromycin resistance is a recessive phenotype expressed when both tuf genes are mutant. We describe a new kirromycin-resistant phenotype dominant to the effect of wild-type EF-Tu. Strains carrying a single kirromycin-resistant tuf mutation and an error-restrictive, streptomycin-resistant rpsL mutation are resistant to high levels of kirromyci...

  8. Structural Characterization of Heme Environmental Mutants of CgHmuT that Shuttles Heme Molecules to Heme Transporters

    Directory of Open Access Journals (Sweden)

    Norifumi Muraki

    2016-05-01

    Full Text Available Corynebacteria contain a heme uptake system encoded in hmuTUV genes, in which HmuT protein acts as a heme binding protein to transport heme to the cognate transporter HmuUV. The crystal structure of HmuT from Corynebacterium glutamicum (CgHmuT reveals that heme is accommodated in the central cleft with His141 and Tyr240 as the axial ligands and that Tyr240 forms a hydrogen bond with Arg242. In this work, the crystal structures of H141A, Y240A, and R242A mutants were determined to understand the role of these residues for the heme binding of CgHmuT. Overall and heme environmental structures of these mutants were similar to those of the wild type, suggesting that there is little conformational change in the heme-binding cleft during heme transport reaction with binding and the dissociation of heme. A loss of one axial ligand or the hydrogen bonding interaction with Tyr240 resulted in an increase in the redox potential of the heme for CgHmuT to be reduced by dithionite, though the wild type was not reduced under physiological conditions. These results suggest that the heme environmental structure stabilizes the ferric heme binding in CgHmuT, which will be responsible for efficient heme uptake under aerobic conditions where Corynebacteria grow.

  9. Tumor suppressor PTEN affects tau phosphorylation: deficiency in the phosphatase activity of PTEN increases aggregation of an FTDP-17 mutant Tau

    Directory of Open Access Journals (Sweden)

    Zhang Xue

    2006-07-01

    Full Text Available Abstract Background Aberrant hyperphosphorylation of tau protein has been implicated in a variety of neurodegenerative disorders. Although a number of protein kinases have been shown to phosphorylate tau in vitro and in vivo, the molecular mechanisms by which tau phosphorylation is regulated pathophysiologically are largely unknown. Recently, a growing body of evidence suggests a link between tau phosphorylation and PI3K signaling. In this study, phosphorylation, aggregation and binding to the microtubule of a mutant frontal temporal dementia and parkinsonism linked to chromosome 17 (FTDP-17 tau in the presence of tumor suppressor PTEN, a major regulatory component in PI3K signaling, were investigated. Results Phosphorylation of the human mutant FTDP-17 tau, T40RW, was evaluated using different phospho-tau specific antibodies in the presence of human wild-type or phosphatase activity null mutant PTEN. Among the evaluated phosphorylation sites, the levels of Ser214 and Thr212 phospho-tau proteins were significantly decreased in the presence of wild-type PTEN, and significantly increased when the phosphatase activity null mutant PTEN was ectopically expressed. Fractionation of the mutant tau transfected cells revealed a significantly increased level of soluble tau in cytosol when wild-type PTEN was expressed, and an elevated level of SDS-soluble tau aggregates in the presence of the mutant PTEN. In addition, the filter/trap assays detected more SDS-insoluble mutant tau aggregates in the cells overexpressing the mutant PTEN compared to those in the cells overexpressing wild-type PTEN and control DNA. This notion was confirmed by the immunocytochemical experiment which demonstrated that the overexpression of the phosphatase activity null mutant PTEN caused the mutant tau to form aggregates in the COS-7 cells. Conclusion Tumor suppressor PTEN can alleviate the phosporylation of the mutant FTDP-17 tau at specific sites, and the phosphatase activity

  10. Harnessing Fluorine-Sulfur Contacts and Multipolar Interactions for the Design of p53 Mutant Y220C Rescue Drugs.

    Science.gov (United States)

    Bauer, Matthias R; Jones, Rhiannon N; Baud, Matthias G J; Wilcken, Rainer; Boeckler, Frank M; Fersht, Alan R; Joerger, Andreas C; Spencer, John

    2016-08-19

    Many oncogenic mutants of the tumor suppressor p53 are conformationally unstable, including the frequently occurring Y220C mutant. We have previously developed several small-molecule stabilizers of this mutant. One of these molecules, PhiKan083, 1-(9-ethyl-9H-carbazole-3-yl)-N-methylmethanamine, binds to a mutation-induced surface crevice with a KD = 150 μM, thereby increasing the melting temperature of the protein and slowing its rate of aggregation. Incorporation of fluorine atoms into small molecule ligands can substantially improve binding affinity to their protein targets. We have, therefore, harnessed fluorine-protein interactions to improve the affinity of this ligand. Step-wise introduction of fluorines at the carbazole ethyl anchor, which is deeply buried within the binding site in the Y220C-PhiKan083 complex, led to a 5-fold increase in affinity for a 2,2,2-trifluoroethyl anchor (ligand efficiency of 0.3 kcal mol(-1) atom(-1)). High-resolution crystal structures of the Y220C-ligand complexes combined with quantum chemical calculations revealed favorable interactions of the fluorines with protein backbone carbonyl groups (Leu145 and Trp146) and the sulfur of Cys220 at the mutation site. Affinity gains were, however, only achieved upon trifluorination, despite favorable interactions of the mono- and difluorinated anchors with the binding pocket, indicating a trade-off between energetically favorable protein-fluorine interactions and increased desolvation penalties. Taken together, the optimized carbazole scaffold provides a promising starting point for the development of high-affinity ligands to reactivate the tumor suppressor function of the p53 mutant Y220C in cancer cells.

  11. Evolution of inhibitor-resistant natural mutant forms of HIV-1 protease probed by pre-steady state kinetic analysis.

    Science.gov (United States)

    Zakharova, Maria Yu; Kuznetsova, Alexandra A; Kaliberda, Elena N; Dronina, Maria A; Kolesnikov, Alexander V; Kozyr, Arina V; Smirnov, Ivan V; Rumsh, Lev D; Fedorova, Olga S; Knorre, Dmitry G; Gabibov, Alexander G; Kuznetsov, Nikita A

    2017-11-01

    Pre-steady state kinetic analysis of mechanistic features of substrate binding and processing is crucial for insight into the evolution of inhibitor-resistant forms of HIV-1 protease. These data may provide a correct vector for rational drug design assuming possible intrinsic dynamic effects. These data should also give some clues to the molecular mechanism of protease action and resistance to inhibitors. Here we report pre-steady state kinetics of the interaction of wild type or mutant forms of HIV-1 protease with a FRET-labeled peptide. The three-stage "minimal" kinetic scheme with first and second reversible steps of substrate binding and with following irreversible peptide cleavage step adequately described experimental data. For the first time, a set of "elementary" kinetic parameters of wild type HIV-1 protease and its natural mutant inhibitor-resistant forms MDR-HM, ANAM-11 and prDRV4 were compared. Inhibitors of the first and second generation were used to estimate the inhibitory effects on HIV-1 protease activity. The resulting set of kinetic data supported that the mutant forms are kinetically unaffected by inhibitors of the first generation, proving their functional resistance to these compounds. The second generation inhibitor darunavir inhibited mutant forms MDR-HM and ANAM-11, but was ineffective against prDRV4. Our kinetic data revealed that these inhibitors induced different conformational changes in the enzyme and, thereby they have different mode of binding in the enzyme active site. These data confirmed hypothesis that the driving force of the inhibitor-resistance evolution is disruption of enzyme-inhibitor complex by changing of the contact network in the inhibitor binding site. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  12. Ubiquinone accumulates in the mitochondria of yeast mutated in the ubiquinone binding protein, Qcr8p

    International Nuclear Information System (INIS)

    Hagerman, Ruth A.; Waring, Natashya J.; Willis, Richard A.; Hagerman, Ann E.

    2006-01-01

    In Saccharomyces cerevisiae, the trans-membrane helix of Qcr8p, the ubiquinone binding protein of complex III, contributes to the Q binding site. In wild-type cells, residue 62 of the helix is non-polar (proline). Substitution of proline 62 with a polar, uncharged residue does not impair the ability of the cells to respire, complex III assembly is unaffected, ubiquinone occupancy of the Q binding site is unchanged, and mitochondrial ubiquinone levels are in the wild-type range. Substitution with a +1 charged residue is associated with partial respiratory competence, impaired complex III assembly, and loss of cytochrome b. Although ubiquinone occupancy of the Q binding site is similar to wild-type, total mitochondrial ubiquinone doubled in these mutants. Mutants with a +2 charged substitution at position 62 are unable to respire. These results suggest that the accumulation of ubiquinone in the mitochondria may be a compensatory mechanism for impaired electron transport at cytochrome b

  13. Programa 5S's adaptado ao gerenciamento da alimentação escolar no contexto da descentralização The 5S's program adapted to school meals in the context of decentralization

    Directory of Open Access Journals (Sweden)

    Ana Iris Mendes Coelho

    1999-12-01

    Full Text Available O processo de descentralização da alimentação escolar desencadeou um aumento da demanda por assessoria técnica, principalmente no que se refere ao seu planejamento e execução. Este trabalho relata a experiência da utilização do programa 5S's no município de Viçosa, MG, durante o período de fevereiro de 1995 a dezembro de 1997, para auxiliar no gerenciamento da alimentação escolar, atuando em pontos críticos detectados nos estabelecimentos de ensino, bem como apresenta a adaptação do Programa idealizada para este fim. Os resultados evidenciaram que a metodologia utilizada foi eficaz neste processo.The school meals decentralization has broken out an increasing demand for technical assistance, particularly because of the faults in its planning and execution. The present paper gives an account of the experience from 5S's Program used in the city of Viçosa, MG during the period of 1995 February until 1997 December, acting in critical points to help with school meals management, as well as to present the Program adaptation idealized for this purpose. The results showed that the methodology used in this process was effective for this case.

  14. Analysis of Yellow Striped Mutants of Zea mays Reveals Novel Loci Contributing to Iron Deficiency Chlorosis

    Directory of Open Access Journals (Sweden)

    David Chan-Rodriguez

    2018-02-01

    Full Text Available The micronutrient iron (Fe is essential for photosynthesis, respiration, and many other processes, but it is only sparingly soluble in aqueous solution, making adequate acquisition by plants a serious challenge. Fe is a limiting factor for plant growth on approximately 30% of the world’s arable lands. Moreover, Fe deficiency in humans is a global health issue, affecting 1.62 billion people, or about 25% of the world’s population. It is imperative that we gain a better understanding of the mechanisms that plants use to regulate iron homeostasis, since these will be important targets for future biofortification and crop improvement strategies. Grasses and non-grasses have evolved independent mechanisms for primary iron uptake from the soil. The grasses, which include most of the world’s staple grains, have evolved a distinct ‘chelation’ mechanism to acquire iron from the soil. Strong iron chelators called phytosiderophores (PSs are synthesized by grasses and secreted into the rhizosphere where they bind and solubilize Fe(III. The Fe(III-PS complex is then taken up into root cells via transporters specific for the Fe(III-PS complex. In this study, 31 novel, uncharacterized striped maize mutants available through the Maize Genetics Cooperation Stock Center (MGCSC were analyzed to determine whether their mutant phenotypes are caused by decreased iron. Many of these proved to be either pale yellow or white striped mutants. Complementation tests were performed by crossing the MGCSC mutants to ys1 and ys3 reference mutants. This allowed assignment of 10 ys1 alleles and 4 ys3 alleles among the novel mutants. In addition, four ys∗ mutant lines were identified that are not allelic to either ys1 or ys3. Three of these were characterized as being non-allelic to each other and as having low iron in leaves. These represent new genes involved in iron acquisition by maize, and future cloning of these genes may reveal novel aspects of the grass iron

  15. Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    Science.gov (United States)

    Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

    2017-01-01

    Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either

  16. Induction of drought tolerant mutants of rice

    International Nuclear Information System (INIS)

    El-Hissewy, A.A.; Abd Allah, A.

    2001-01-01

    The ultimate goal of crop breeding is to develop varieties with a high yield potential and desirable agronomic characteristics. In Egypt, the most important qualities sought by breeders have been high yield potential, resistance to major diseases and insects, and improved grain and eating quality. However, breeding efforts should concentrate on varieties with the potential to minimize yield losses under unfavorable conditions such as drought, and to maximize yields when conditions are favorable. Rice (Oryza sativa L.) in Egypt is completely irrigated and a significant portion of the rice cultivated area is subject to water deficit resulting from an inadequate or insufficient irrigation supply. Drought tolerance is a complex trait in that it results from the interaction of histological and physiological characters of plant with environmental factors, both above-ground and under-ground. Accordingly, root characters are closely related to drought tolerance. Little attention has been paid in Egyptian breeding programs to root characters and their relation to shoot characters. Furthermore, induced mutations are considered as one of the most important methods to induce useful mutants, especially with improved root characters, to overcome the drought problem. The present investigation aimed to study the effect of different doses of gamma rays on several characters of three Egyptian rice varieties, i.e. 'Giza 171', 'Giza 175' and 'Giza 176' and to induce one or more mutants possessing drought tolerance

  17. Flower morphology of Dendrobium Sonia mutants

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Azhar Mohamad; Affrida Abu Hassan; Zaiton Ahmad; Mohd Nazir Basiran

    2010-01-01

    Dendrobium Sonia is a commercial hybrid which is popular as cut flower and potted plant in Malaysia. Variability in flower is important for new variety to generate more demands and choices in selection. Mutation induction is a tool in creating variability for new flower color and shape. In vitro cultures of protocorm-like bodies (PLBs) were exposed to gamma ray at dose 35 Gy. Phenotypic characteristics of the flower were observed at fully bloomed flower with emphasis on shape and color. Approximately 2000 regenerated irradiated plants were observed and after subsequent flowering, 100 plants were finally selected for further evaluation. Most of the color and shape changes are expressed in different combinations of petal, sepal and lip of the flower. In this work, 11 stable mutants were found different at flower phenotype as compared to control. Amongst these, four mutant varieties with commercial potential has been named as Dendrobium 'SoniaKeenaOval', Dendrobium 'SoniaKeenaRadiant', Dendrobium 'SoniaKeenaHiengDing' and Dendrobium 'Sonia KeenaAhmadSobri'. In this paper, variations in flower morphology and flower color were discussed, giving emphasis on variations in flower petal shape. (author)

  18. Indy mutants: live long and prosper

    Directory of Open Access Journals (Sweden)

    Stewart eFrankel

    2012-02-01

    Full Text Available Indy encodes the fly homologue of a mammalian transporter of di and tricarboxylatecomponents of the Krebs cycle. Reduced expression of fly Indy or two of the C. elegansIndy homologs leads to an increase in life span. Fly and worm tissues that play key roles inintermediary metabolism are also the places where Indy genes are expressed. One of themouse homologs of Indy (mIndy is mainly expressed in the liver. It has been hypothesizedthat decreased INDY activity creates a state similar to caloric restriction (CR. Thishypothesis is supported by the physiological similarities between Indy mutant flies on highcalorie food and control flies on CR, such as increased physical activity and decreases inweight, egg production, triglyceride levels, starvation resistance, and insulin signaling. Inaddition, Indy mutant flies undergo changes in mitochondrial biogenesis also observed inCR animals. Recent findings with mIndy knockout mice support and extend the findingsfrom flies. mIndy-/- mice display an increase in hepatic mitochondrial biogenesis, lipidoxidation and decreased hepatic lipogenesis. When mIndy-/- mice are fed high calorie foodthey are protected from adiposity and insulin resistance. These findings point to INDY as apotential drug target for the treatment of metabolic syndrome, type 2 diabetes and obesity.

  19. Dynamic conformational changes in munc18 prevent syntaxin binding.

    Directory of Open Access Journals (Sweden)

    Dana Bar-On

    2011-03-01

    Full Text Available The Sec1/munc18 protein family is essential for vesicle fusion in eukaryotic cells via binding to SNARE proteins. Protein kinase C modulates these interactions by phosphorylating munc18a thereby reducing its affinity to one of the central SNARE members, syntaxin-1a. The established hypothesis is that the reduced affinity of the phosphorylated munc18a to syntaxin-1a is a result of local electrostatic repulsion between the two proteins, which interferes with their compatibility. The current study challenges this paradigm and offers a novel mechanistic explanation by revealing a syntaxin-non-binding conformation of munc18a that is induced by the phosphomimetic mutations. In the present study, using molecular dynamics simulations, we explored the dynamics of the wild-type munc18a versus phosphomimetic mutant munc18a. We focused on the structural changes that occur in the cavity between domains 3a and 1, which serves as the main syntaxin-binding site. The results of the simulations suggest that the free wild-type munc18a exhibits a dynamic equilibrium between several conformations differing in the size of its cavity (the main syntaxin-binding site. The flexibility of the cavity's size might facilitate the binding or unbinding of syntaxin. In silico insertion of phosphomimetic mutations into the munc18a structure induces the formation of a conformation where the syntaxin-binding area is rigid and blocked as a result of interactions between residues located on both sides of the cavity. Therefore, we suggest that the reduced affinity of the phosphomimetic mutant/phosphorylated munc18a is a result of the closed-cavity conformation, which makes syntaxin binding energetically and sterically unfavorable. The current study demonstrates the potential of phosphorylation, an essential biological process, to serve as a driving force for dramatic conformational changes of proteins modulating their affinity to target proteins.

  20. Peramivir analogues bearing hydrophilic side chains exhibit higher activities against H275Y mutant than wild-type influenza virus.

    Science.gov (United States)

    Chiu, Din-Chi; Lin, Tzu-Chen; Huang, Wen-I; Cheng, Ting-Jen; Tsai, Keng-Chang; Fang, Jim-Min

    2017-11-29

    Peramivir is an effective anti-influenza drug in the clinical treatment of influenza, but its efficacy toward the H275Y mutant is reduced. The previously reported cocrystal structures of inhibitors in the mutant neuraminidase (NA) suggest that the hydrophobic side chain should be at the origin of reduced binding affinity. In contrast, zanamivir having a hydrophilic glycerol side chain still possesses high affinity toward the H275Y NA. We thus designed five peramivir analogues (5-9) carrying hydrophilic glycol or glycerol side chains, and evaluated their roles in anti-influenza activity, especially for the H275Y mutant. The synthetic sequence involves a key step of (3 + 2) cycloaddition reactions between alkenes and nitrile oxides to construct the scaffold of peramivir carrying the desired hydrophilic side chains and other appropriate functional groups. The molecular docking experiments reveal that the hydrophilic side chain can provide extra hydrogen bonding with the translocated Glu-276 residue in the H275Y NA active site. Thus, the H275Y mutant may be even more sensitive than wild-type virus toward the peramivir analogues bearing hydrophilic side chains. Notably, the peramivir analogue bearing a glycerol side chain inhibits the H275Y mutant with an IC 50 value of 35 nM, which is better than the WSN virus by 9 fold.

  1. Determinants of nucleotide-binding selectivity of malic enzyme.

    Directory of Open Access Journals (Sweden)

    Ju-Yi Hsieh

    Full Text Available Malic enzymes have high cofactor selectivity. An isoform-specific distribution of residues 314, 346, 347 and 362 implies that they may play key roles in determining the cofactor specificity. Currently, Glu314, Ser346, Lys347 and Lys362 in human c-NADP-ME were changed to the corresponding residues of human m-NAD(P-ME (Glu, Lys, Tyr and Gln, respectively or Ascaris suum m-NAD-ME (Ala, Ile, Asp and His, respectively. Kinetic data demonstrated that the S346K/K347Y/K362Q c-NADP-ME was transformed into a debilitated NAD⁺-utilizing enzyme, as shown by a severe decrease in catalytic efficiency using NADP⁺ as the cofactor without a significant increase in catalysis using NAD⁺ as the cofactor. However, the S346K/K347Y/K362H enzyme displayed an enhanced value for k(cat,NAD, suggesting that His at residue 362 may be more beneficial than Gln for NAD⁺ binding. Furthermore, the S346I/K347D/K362H mutant had a very large K(m,NADP value compared to other mutants, suggesting that this mutant exclusively utilizes NAD⁺ as its cofactor. Since the S346K/K347Y/K362Q, S346K/K347Y/K362H and S346I/K347D/K362H c-NADP-ME mutants did not show significant reductions in their K(m,NAD values, the E314A mutation was then introduced into these triple mutants. Comparison of the kinetic parameters of each triple-quadruple mutant pair (for example, S346K/K347Y/K362Q versus E314A/S346K/K347Y/K362Q revealed that all of the K(m values for NAD⁺ and NADP(+ of the quadruple mutants were significantly decreased, while either k(cat,NAD or k(cat,NADP was substantially increased. By adding the E314A mutation to these triple mutant enzymes, the E314A/S346K/K347Y/K362Q, E314A/S346K/K347Y/K362H and E314A/S346I/K347D/K362H c-NADP-ME variants are no longer debilitated but become mainly NAD⁺-utilizing enzymes by a considerable increase in catalysis using NAD⁺ as the cofactor. These results suggest that abolishing the repulsive effect of Glu314 in these quadruple mutants increases

  2. Determinants of nucleotide-binding selectivity of malic enzyme.

    Science.gov (United States)

    Hsieh, Ju-Yi; Chen, Meng-Chun; Hung, Hui-Chih

    2011-01-01

    Malic enzymes have high cofactor selectivity. An isoform-specific distribution of residues 314, 346, 347 and 362 implies that they may play key roles in determining the cofactor specificity. Currently, Glu314, Ser346, Lys347 and Lys362 in human c-NADP-ME were changed to the corresponding residues of human m-NAD(P)-ME (Glu, Lys, Tyr and Gln, respectively) or Ascaris suum m-NAD-ME (Ala, Ile, Asp and His, respectively). Kinetic data demonstrated that the S346K/K347Y/K362Q c-NADP-ME was transformed into a debilitated NAD⁺-utilizing enzyme, as shown by a severe decrease in catalytic efficiency using NADP⁺ as the cofactor without a significant increase in catalysis using NAD⁺ as the cofactor. However, the S346K/K347Y/K362H enzyme displayed an enhanced value for k(cat,NAD), suggesting that His at residue 362 may be more beneficial than Gln for NAD⁺ binding. Furthermore, the S346I/K347D/K362H mutant had a very large K(m,NADP) value compared to other mutants, suggesting that this mutant exclusively utilizes NAD⁺ as its cofactor. Since the S346K/K347Y/K362Q, S346K/K347Y/K362H and S346I/K347D/K362H c-NADP-ME mutants did not show significant reductions in their K(m,NAD) values, the E314A mutation was then introduced into these triple mutants. Comparison of the kinetic parameters of each triple-quadruple mutant pair (for example, S346K/K347Y/K362Q versus E314A/S346K/K347Y/K362Q) revealed that all of the K(m) values for NAD⁺ and NADP(+) of the quadruple mutants were significantly decreased, while either k(cat,NAD) or k(cat,NADP) was substantially increased. By adding the E314A mutation to these triple mutant enzymes, the E314A/S346K/K347Y/K362Q, E314A/S346K/K347Y/K362H and E314A/S346I/K347D/K362H c-NADP-ME variants are no longer debilitated but become mainly NAD⁺-utilizing enzymes by a considerable increase in catalysis using NAD⁺ as the cofactor. These results suggest that abolishing the repulsive effect of Glu314 in these quadruple mutants increases the binding

  3. Loss of Catalytic Activity in the E134D, H67A, and H349A Mutants of DapE: Mechanistic Analysis with QM/MM Investigation.

    Science.gov (United States)

    Dutta, Debodyuti; Mishra, Sabyashachi

    2016-11-17

    In the fight against bacterial infections and antibiotic resistance, the dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) is a potentially safe target enzyme. The role of the Glu134, His67, and His349 residues in the binding and hydrolysis of N-succinyl-l,l-diaminopimelic acid (SDAP) is investigated by employing molecular dynamics simulation and hybrid quantum mechanical-molecular mechanical (MM) calculations of the E134D, H67A, and H349A mutants of DapE. The free energy of substrate binding obtained from the MM-Poisson-Boltzmann surface area approach correctly reproduced the experimentally observed ordering of substrate affinity, that is, E134D > wt > H67A > H349A. The mechanism of catalytic action by the E134D mutant is elucidated by structurally and energetically characterizing the intermediates and the transition states along the reaction pathway. The rate-determining step in the general acid-base hydrolysis reaction by the E134D mutant is found to be the nucleophilic attack step, which involves an activation energy barrier 10 kcal/mol greater than that in the wild-type (wt)-DapE. This explains the 3 orders of magnitude decrease in the experimentally determined k cat value for the E134D mutant compared to that of wt-DapE. In the H67A and H349A mutants, the Glu134 residue undergoes a conformational change and exhibits a strong coordination with the metal centers. This not only results in a weaker substrate binding in the two histidine mutants but also hinders the activation of the catalytic water molecule, which constitutes the first step of the substrate hydrolysis by DapE. This leads to an effective quenching of the catalytic activity in the H67A and H349A mutants.

  4. Isolation of reovirus T3D mutants capable of infecting human tumor cells independent of junction adhesion molecule-A.

    Directory of Open Access Journals (Sweden)

    Diana J M van den Wollenberg

    Full Text Available Mammalian Reovirus is a double-stranded RNA virus with a distinctive preference to replicate in and lyse transformed cells. On that account, Reovirus type 3 Dearing (T3D is clinically evaluated as oncolytic agent. The therapeutic efficacy of this approach depends in part on the accessibility of the reovirus receptor Junction Adhesion Molecule-A (JAM-A on the target cells. Here, we describe the isolation and characterization of reovirus T3D mutants that can infect human tumor cells independent of JAM-A. The JAM-A-independent (jin mutants were isolated on human U118MG glioblastoma cells, which do not express JAM-A. All jin mutants harbour mutations in the S1 segments close to the region that encodes the sialic acid-binding pocket in the shaft of the spike protein. In addition, two of the jin mutants encode spike proteins with a Q336R substitution in their head domain. The jin mutants can productively infect a wide range of cell lines that resist wt reovirus T3D infection, including chicken LMH cells, hamster CHO cells, murine endothelioma cells, human U2OS and STA-ET2.1 cells, but not primary human fibroblasts. The jin-mutants rely on the presence of sialic-acid residues on the cell surface for productive infection, as is evident from wheat germ agglutinin (WGA inhibition experiments, and from the jin-reovirus resistance of CHO-Lec2 cells, which have a deficiency of sialic-acids on their glycoproteins. The jin mutants may be useful as oncolytic agents for use in tumors in which JAM-A is absent or inaccessible.

  5. Non-DNA binding, dominant-negative, human PPARγ mutations cause lipodystrophic insulin resistance

    OpenAIRE

    Agostini, Maura; Schoenmakers, Erik; Mitchell, Catherine; Szatmari, Istvan; Savage, David; Smith, Aaron; Rajanayagam, Odelia; Semple, Robert; Luan, Jian'an; Bath, Louise; Zalin, Anthony; Labib, Mourad; Kumar, Sudhesh; Simpson, Helen; Blom, Dirk

    2006-01-01

    PPARgamma is essential for adipogenesis and metabolic homeostasis. We describe mutations in the DNA and ligand binding domains of human PPARgamma in lipodystrophic, severe insulin resistance. These receptor mutants lack DNA binding and transcriptional activity but can translocate to the nucleus, interact with PPARgamma coactivators and inhibit coexpressed wild-type receptor. Expression of PPARgamma target genes is markedly attenuated in mutation-containing versus receptor haploinsufficent pri...

  6. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  7. Forward genetic screen for auxin-deficient mutants by cytokinin.

    Science.gov (United States)

    Wu, Lei; Luo, Pan; Di, Dong-Wei; Wang, Li; Wang, Ming; Lu, Cheng-Kai; Wei, Shao-Dong; Zhang, Li; Zhang, Tian-Zi; Amakorová, Petra; Strnad, Miroslav; Novák, Ondřej; Guo, Guang-Qin

    2015-07-06

    Identification of mutants with impairments in auxin biosynthesis and dynamics by forward genetic screening is hindered by the complexity, redundancy and necessity of the pathways involved. Furthermore, although a few auxin-deficient mutants have been recently identified by screening for altered responses to shade, ethylene, N-1-naphthylphthalamic acid (NPA) or cytokinin (CK), there is still a lack of robust markers for systematically isolating such mutants. We hypothesized that a potentially suitable phenotypic marker is root curling induced by CK, as observed in the auxin biosynthesis mutant CK-induced root curling 1 / tryptophan aminotransferase of Arabidopsis 1 (ckrc1/taa1). Phenotypic observations, genetic analyses and biochemical complementation tests of Arabidopsis seedlings displaying the trait in large-scale genetic screens showed that it can facilitate isolation of mutants with perturbations in auxin biosynthesis, transport and signaling. However, unlike transport/signaling mutants, the curled (or wavy) root phenotypes of auxin-deficient mutants were significantly induced by CKs and could be rescued by exogenous auxins. Mutants allelic to several known auxin biosynthesis mutants were re-isolated, but several new classes of auxin-deficient mutants were also isolated. The findings show that CK-induced root curling provides an effective marker for discovering genes involved in auxin biosynthesis or homeostasis.

  8. Neurobehavioral Mutants Identified in an ENU Mutagenesis Project

    Energy Technology Data Exchange (ETDEWEB)

    Cook, Melloni N. [University of Memphis; Dunning, Jonathan P [University of Memphis; Wiley, Ronald G [Vanderbilt University and Veterans Administration, Nashville, TN; Chesler, Elissa J [ORNL; Johnson, Dabney K [ORNL; Goldowitz, Daniel [University of Tennessee Health Science Center, Memphis

    2007-01-01

    We report on a behavioral screening test battery that successfully identified several neurobehavioral mutants among a large-scale ENU-mutagenized mouse population. Large numbers of ENU mutagenized mice were screened for abnormalities in central nervous system function based on abnormal performance in a series of behavior tasks. We developed and employed a high-throughput screen of behavioral tasks to detect behavioral outliers. Twelve mutant pedigrees, representing a broad range of behavioral phenotypes, have been identified. Specifically, we have identified two open field mutants (one displaying hyper-locomotion, the other hypo-locomotion), four tail suspension mutants (all displaying increased immobility), one nociception mutant (displaying abnormal responsiveness to thermal pain), two prepulse inhibition mutants (displaying poor inhibition of the startle response), one anxiety-related mutant (displaying decreased anxiety in the light/dark test), and one learning and memory mutant (displaying reduced response to the conditioned stimulus) These findings highlight the utility of a set of behavioral tasks used in a high throughput screen to identify neurobehavioral mutants. Further analysis (i.e., behavioral and genetic mapping studies) of mutants is in progress with the ultimate goal of identification of novel genes and mouse models relevant to human disorders as well as the identification of novel therapeutic targets.

  9. N1421K mutation in the glycoprotein Ib binding domain impairs ristocetin- and botrocetin-mediated binding of von Willebrand factor to platelets

    DEFF Research Database (Denmark)

    Lanke, E.; Kristoffersson, A.C.; Isaksson, C.

    2008-01-01

    von Willebrand disease (VWD) is a common inheritable bleeding disorder caused by deficiency of von Willebrand Factor (VWF), which is involved in platelet adhesion and aggregation. We report a family consisting of three patients with VWD characterized by an apparently normal multimeric pattern......-mediated binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...

  10. N1421K mutation in the glycoprotein Ib binding domain impairs ristocetin- and botrocetin-mediated binding of von Willebrand factor to platelets

    DEFF Research Database (Denmark)

    Lanke, E.; Kristoffersson, A.C.; Isaksson, C.

    2008-01-01

    , moderately decreased plasma factor VIII (FVIII) and VWF levels, and disproportionately low-plasma VWF:RCo levels. The patients were found to be heterozygous for the novel N1421K mutation, caused by a 4263C > G transversion in exon 28 of the VWF gene coding for the A1 domain. Botrocetin- and ristocetin-mediated...... binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...

  11. Distinct neurobehavioural effects of cannabidiol in transmembrane domain neuregulin 1 mutant mice.

    Directory of Open Access Journals (Sweden)

    Leonora E Long

    Full Text Available The cannabis constituent cannabidiol (CBD possesses anxiolytic and antipsychotic properties. We have previously shown that transmembrane domain neuregulin 1 mutant (Nrg1 TM HET mice display altered neurobehavioural responses to the main psychoactive constituent of cannabis, Δ(9-tetrahydrocannabinol. Here we investigated whether Nrg1 TM HET mice respond differently to CBD and whether CBD reverses schizophrenia-related phenotypes expressed by these mice. Adult male Nrg1 TM HET and wild type-like littermates (WT received vehicle or CBD (1, 50 or 100 mg/kg i.p. for 21 days. During treatment and 48 h after withdrawal we measured behaviour, whole blood CBD concentrations and autoradiographic receptor binding. Nrg1 HET mice displayed locomotor hyperactivity, PPI deficits and reduced 5-HT(2A receptor binding density in the substantia nigra, but these phenotypes were not reversed by CBD. However, long-term CBD (50 and 100 mg/kg selectively enhanced social interaction in Nrg1 TM HET mice. Furthermore, acute CBD (100 mg/kg selectively increased PPI in Nrg1 TM HET mice, although tolerance to this effect was manifest upon repeated CBD administration. Long-term CBD (50 mg/kg also selectively increased GABA(A receptor binding in the granular retrosplenial cortex in Nrg1 TM HET mice and reduced 5-HT(2A binding in the substantia nigra in WT mice. Nrg1 appears necessary for CBD-induced anxiolysis since only WT mice developed decreased anxiety-related behaviour with repeated CBD treatment. Altered pharmacokinetics in mutant mice could not explain our findings since no genotype differences existed in CBD blood concentrations. Here we demonstrate that Nrg1 modulates acute and long-term neurobehavioural effects of CBD, which does not reverse the schizophrenia-relevant phenotypes.

  12. Insight into the molecular mechanism of yeast acetyl-coenzyme A carboxylase mutants F510I, N485G, I69E, E477R, and K73R resistant to soraphen A

    Science.gov (United States)

    Gao, Jian; Liang, Li; Chen, Qingqing; Zhang, Ling; Huang, Tonghui

    2018-02-01

    Acetyl-coenzyme A carboxylases (ACCs) is the first committed enzyme of fatty acid synthesis pathway. The inhibition of ACC is thought to be beneficial not only for diseases related to metabolism, such as type-2 diabetes, but also for infectious disease like bacterial infection disease. Soraphen A, a potent allosteric inhibitor of BC domain of yeast ACC, exhibit lower binding affinities to several yeast ACC mutants and the corresponding drug resistance mechanisms are still unknown. We report here a theoretical study of binding of soraphen A to wild type and yeast ACC mutants (including F510I, N485G, I69E, E477R, and K73R) via molecular dynamic simulation and molecular mechanics/generalized Born surface area free energy calculations methods. The calculated binding free energies of soraphen A to yeast ACC mutants are weaker than to wild type, which is highly consistent with the experimental results. The mutant F510I weakens the binding affinity of soraphen A to yeast ACC mainly by decreasing the van der Waals contributions, while the weaker binding affinities of Soraphen A to other yeast ACC mutants including N485G, I69E, E477R, and K73R are largely attributed to the decreased net electrostatic (ΔE ele + ΔG GB) interactions. Our simulation results could provide important insights for the development of more potent ACC inhibitors.

  13. Metal binding is critical for the folding and function of laminin binding protein, Lmb of Streptococcus agalactiae.

    Directory of Open Access Journals (Sweden)

    Preethi Ragunathan

    Full Text Available Lmb is a 34 kDa laminin binding surface adhesin of Streptococcus agalactiae. The structure of Lmb reported by us recently has shown that it consists of a metal binding crevice, in which a zinc ion is coordinated to three highly conserved histidines. To elucidate the structural and functional significance of the metal ion in Lmb, these histidines have been mutated to alanine and single, double and triple mutants were generated. These mutations resulted in insolubility of the protein and revealed altered secondary and tertiary structures, as evidenced by circular dichroism and fluorescence spectroscopy studies. The mutations also significantly decreased the binding affinity of Lmb to laminin, implicating the role played by the metal binding residues in maintaining the correct conformation of the protein for its binding to laminin. A highly disordered loop, proposed to be crucial for metal acquisition in homologous structures, was deleted in Lmb by mutation (ΔLmb and its crystal structure was solved at 2.6 Å. The ΔLmb structure was identical to the native Lmb structure with a bound zinc ion and exhibited laminin binding activity similar to wild type protein, suggesting that the loop might not have an important role in metal acquisition or adhesion in Lmb. Targeted mutations of histidine residues confirmed the importance of the zinc binding crevice for the structure and function of the Lmb adhesin.

  14. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  15. Microdiscectomy with and without insertion of interspinous device for herniated disc at the L5-S1 level.

    Science.gov (United States)

    Galarza, Marcelo; Gazzeri, Roberto; De la Rosa, Pedro; Martínez-Lage, Juan F

    2014-11-01

    The role of interspinous devices (ISD) after lumbar herniated disc surgery for the prevention of postoperative back pain is controversial. The aim of this comparative prospective study was to determine outcomes in a selective cohort with L5-S1 disc herniation and degenerative disc changes after microdiscectomy with or without insertion of an ISD. One hundred and two consecutive patients underwent an L5-S1 microdiscectomy with or without implantation of an ISD. Group 1 consisted of 47 patients, with mild (n=22), moderate (n=14) or severe (n=11) degenerative disc changes who had microdiscectomy alone. Group 2 comprised 45 patients with similar types of disc changes who underwent microdiscectomy with an ISD implant. The Visual Analogue Scale (VAS) was used to grade low-back pain and postoperative clinical status was rated according to the modified MacNab criteria. Mean VAS score for low-back pain improved significantly at 1 year follow-up from 7.3 at baseline to 2.75 (pdisc changes were more likely to achieve improvement of their low-back pain when treated with both microdiscectomy and ISD insertion. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    Science.gov (United States)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  17. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  18. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    International Nuclear Information System (INIS)

    Dewi, Septika Rosiana; Setiawan, Budi; Susatyo Nugroho W P

    2013-01-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  19. Distinct cytoplasmic domains of the growth hormone receptor are required for glucocorticoid- and phorbol ester-induced decreases in growth hormone (GH) binding. These domains are different from that reported for GH-induced receptor internalization

    DEFF Research Database (Denmark)

    King, A P; Tseng, M J; Logsdon, C D

    1996-01-01

    to be required for maximal DEX-induced inhibition of GH binding. DEX decreased GH binding to a GHR mutant F346A, which is reported to be deficient in ligand-induced internalization, suggesting that DEX decreases GH binding by a mechanism distinct from that of ligand-induced GHR internalization. PMA reduced GH...

  20. Hyperproduction of Alpha-Hemolysin in a sigB Mutant Is Associated with Elevated SarA Expression in Staphylococcus aureus

    Science.gov (United States)

    Cheung, Ambrose L.; Chien, Yueh-tyng; Bayer, Arnold S.

    1999-01-01

    To evaluate the role of SigB in modulating the expression of virulence determinants in Staphylococcus aureus, we constructed a sigB mutant of RN6390, a prototypic S. aureus strain. The mutation in the sigB gene was confirmed by the absence of the SigB protein in the mutant on an immunoblot as well as the failure of the mutant to activate ςB-dependent promoters (e.g., the sarC promoter) of S. aureus. Phenotypic analysis indicated that both alpha-hemolysin level and fibrinogen-binding capacity were up-regulated in the mutant strain compared with the parental strain. The increase in fibrinogen-binding capacity correlated with enhanced expression of clumping factor and coagulase on immunoblots. The effect of the sigB mutation on the enhanced expression of the alpha-hemolysin gene (hla) was primarily transcriptional. Upon complementation with a plasmid containing the sigB gene, hla expression returned to near parental levels in the mutant. Detailed immunoblot analysis as well as a competitive enzyme-linked immunosorbent assay of the cell extract of the sigB mutant with anti-SarA monoclonal antibody 1D1 revealed that the expression of SarA was higher in the mutant than in the parental control. Despite an elevated SarA level, the transcription of RNAII and RNAIII of the agr locus remained unaltered in the sigB mutant. Because of a lack of perturbation in agr, we hypothesize that inactivation of sigB leads to increased expression of SarA which, in turn, modulates target genes via an agr-independent but SarA-dependent pathway. PMID:10024579

  1. An Efficient and Economical Assay to Screen for Triclosan Binding to FabI.

    Science.gov (United States)

    Demissie, Robel D; Kabre, Pauline; Tuntland, Micheal L; Fung, Leslie W-M

    2016-04-01

    Triclosan is an effective inhibitor for enoyl acyl carrier protein reductase (ENR) in fatty acid biosynthesis. Triclosan-resistant mutants of ENR have emerged. Thus, it is important to detect these triclosan-resistant mutations in ENR. Generally, enzyme activity assays on the mutants are used to determine the effect of triclosan on ENR activity. Since the substrates are linked to acyl carrier protein (ACP), the assays are challenging due to the need to prepare the ACP and link it to the substrates. Non-ACP-linked (coenzyme A [CoA]-linked) substrates can be used in some ENR, but not in all. Consequently, screening for triclosan-resistant mutants is also challenging. We have developed a simple thermal shift assay, which does not use ACP-linked substrates, to determine the binding ability of triclosan to the ENR active site, and thus it can be used for screening for triclosan-resistant mutants. Staphylococcus aureus FabI enzyme and its mutants were used to demonstrate the binding ability of triclosan with NADP(+) to FabI. The direct correlation between the binding ability and enzyme activity was demonstrated with Francisella tularensis FabI. This method may also be applied to select effective triclosan analogues that inhibit ENR activity. © 2015 Society for Laboratory Automation and Screening.

  2. Glycan masking of Plasmodium vivax Duffy Binding Protein for probing protein binding function and vaccine development.

    Directory of Open Access Journals (Sweden)

    Sowmya Sampath

    Full Text Available Glycan masking is an emerging vaccine design strategy to focus antibody responses to specific epitopes, but it has mostly been evaluated on the already heavily glycosylated HIV gp120 envelope glycoprotein. Here this approach was used to investigate the binding interaction of Plasmodium vivax Duffy Binding Protein (PvDBP and the Duffy Antigen Receptor for Chemokines (DARC and to evaluate if glycan-masked PvDBPII immunogens would focus the antibody response on key interaction surfaces. Four variants of PVDBPII were generated and probed for function and immunogenicity. Whereas two PvDBPII glycosylation variants with increased glycan surface coverage distant from predicted interaction sites had equivalent binding activity to wild-type protein, one of them elicited slightly better DARC-binding-inhibitory activity than wild-type immunogen. Conversely, the addition of an N-glycosylation site adjacent to a predicted PvDBP interaction site both abolished its interaction with DARC and resulted in weaker inhibitory antibody responses. PvDBP is composed of three subdomains and is thought to function as a dimer; a meta-analysis of published PvDBP mutants and the new DBPII glycosylation variants indicates that critical DARC binding residues are concentrated at the dimer interface and along a relatively flat surface spanning portions of two subdomains. Our findings suggest that DARC-binding-inhibitory antibody epitope(s lie close to the predicted DARC interaction site, and that addition of N-glycan sites distant from this site may augment inhibitory antibodies. Thus, glycan resurfacing is an attractive and feasible tool to investigate protein structure-function, and glycan-masked PvDBPII immunogens might contribute to P. vivax vaccine development.

  3. Characterization of the growth and auxin physiology of roots of the tomato mutant, diageotropica

    Science.gov (United States)

    Muday, G. K.; Lomax, T. L.; Rayle, D. L.

    1995-01-01

    Roots of the tomato (Lycopersicon esculentum, Mill.) mutant (diageotropica (dgt) exhibit an altered phenotype. These roots are agravitropic and lack lateral roots. Relative to wild-type (VFN8) roots, dgt roots are less sensitive to growth inhibition by exogenously applied IAA and auxin transport inhibitors (phytotropins), and the roots exhibit a reduction in maximal growth inhibition in response to ethylene. However, IAA transport through roots, binding of the phytotropin, tritiated naphthylphthalamic acid ([3H]NPA), to root microsomal membranes, NPA-sensitive IAA uptake by root segments, and uptake of [3H]NPA into root segments are all similar in mutant and wild-type roots. We speculate that the reduced sensitivity of dgt root growth to auxin-transport inhibitors and ethylene is an indirect result of the reduction in sensitivity to auxin in this single gene, recessive mutant. We conclude that dgt roots, like dgt shoots, exhibit abnormalities indicating they have a defect associated with or affecting a primary site of auxin perception or action.

  4. 4p-5s transitions in YVII, VIII, ZrVIII, IX, NbIX, X and MoX, XI

    International Nuclear Information System (INIS)

    Rahimullah, K.; Chaghtai, M.S.Z.; Khatoon, S.

    1976-01-01

    The spectra of Y VII, VIII, Zr VIII, IX, Nb X and Mo X, XI are studied for the first time and the 1971 analysis of Nb IX is improved. By analyses of the transitions 4s 2 4psup(k)-4s 2 4psup(k-1)5s all the levels of the configurations 4p 3 , 4p 2 5s, 4p 2 and 4p5s are established in the spectra concerned. (Auth.)

  5. Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard

    International Nuclear Information System (INIS)

    Mitra, J.; Chaudhari, K.L.

    1974-01-01

    Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)

  6. Mutants of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity

    Energy Technology Data Exchange (ETDEWEB)

    Upchurch, R.G.; Walker, D.C.; Rollins, J.A.; Ehrenshaft, M.; Daub, M.E. (North Carolina State Univ., Raleigh (United States))

    1991-10-01

    The authors have obtained spontaneous and UV-induced stable mutants, altered in the synthesis of cercosporin, of the fungal soybean pathogen Cercospora kikuchii. The mutants were isolated on the basis of colony color on minimal medium. The UV-induced mutants accumulated, at most, 2% of wild-type cercosporin levels on all media tested. In contrast, cercosporin accumulation by the spontaneous mutants was strongly medium regulated, occurring only on potato dextrose medium but at concentrations comparable to those produced by the wild-type strain. UV-induced mutants unable to synthesize cercosporin on any medium were unable to incite lesions when inoculated onto the soybean host. Cercosporin was reproducibly isolated from all inoculated leaves showing lesions. Although cercosporin involvement in disease has been indirectly suggested by many previous studies, this is the first report in which mutants blocked in cercosporin synthesis have been used to demonstrate that cercosporin is a crucial pathogenicity factor for this fungal genus.

  7. Altered Regulation of Escherichia coli Biotin Biosynthesis in BirA Superrepressor Mutant Strains

    Science.gov (United States)

    Chakravartty, Vandana

    2012-01-01

    Transcription of the Escherichia coli biotin (bio) operon is directly regulated by the biotin protein ligase BirA, the enzyme that covalently attaches biotin to its cognate acceptor proteins. Binding of BirA to the bio operator requires dimerization of the protein, which is triggered by BirA-catalyzed synthesis of biotinoyl-adenylate (biotinoyl-5′-AMP), the obligatory intermediate of the ligation reaction. Although several aspects of this regulatory system are well understood, no BirA superrepressor mutant strains had been isolated. Such superrepressor BirA proteins would repress the biotin operon transcription in vivo at biotin concentrations well below those needed for repression by wild-type BirA. We isolated mutant strains having this phenotype by a combined selection-screening approach and resolved multiple mutations to give several birA superrepressor alleles, each having a single mutation, all of which showed repression dominant over that of the wild-type allele. All of these mutant strains repressed bio operon transcription in vivo at biotin concentrations that gave derepression of the wild-type strain and retained sufficient ligation activity for growth when overexpressed. All of the strains except that encoding G154D BirA showed derepression of bio operon transcription upon overproduction of a biotin-accepting protein. In BirA, G154D was a lethal mutation in single copy, and the purified protein was unable to transfer biotin from enzyme-bound biotinoyl-adenylate either to the natural acceptor protein or to a biotin-accepting peptide sequence. Consistent with the transcriptional repression data, each of the purified mutant proteins showed increased affinity for the biotin operator DNA in electrophoretic mobility shift assays. Surprisingly, although most of the mutations were located in the catalytic domain, all of those tested, except G154D BirA, had normal ligase activity. Most of the mutations that gave superrepressor phenotypes altered residues

  8. The fibrinogen-binding protein (FgBP) of Streptococcus equi subsp. equi additionally binds IgG and contributes to virulence in a mouse model.

    Science.gov (United States)

    Meehan, M; Lynagh, Y; Woods, C; Owen, P

    2001-12-01

    The major cell-wall-associated protein of the equine pathogen Streptococcus equi subsp. equi is an M-like fibrinogen-binding protein (FgBP) which binds equine fibrinogen (Fg) avidly, through residues located at the extreme N-terminus of the molecule. In this study, it is shown that FgBP additionally binds equine IgG-Fc. When tested against polyclonal IgG from ten other animal species, it was found that FgBP binds human, rabbit, pig and cat IgG, but does not bind mouse, rat, goat, sheep, cow or chicken IgG. Through the use of a panel of recombinant FgBP truncates containing defined deletions of sequence, it was shown that residues in the central regions of FgBP are important in IgG binding. An fbp knockout mutant which does not express FgBP on the cell surface was also constructed. Mutant cells failed to autoaggregate, bound no detectable equine Fg or IgG-Fc, were rapidly killed in horse blood, and showed greatly decreased virulence in a mouse model. Results suggest that FgBP is the major surface structure responsible for binding either Fg or IgG, that the molecule has pronounced antiphagocytic properties, and that it is a likely factor contributing to the virulence of wild-type S. equi subsp. equi.

  9. Hoxc13 mutant mice lack external hair.

    Science.gov (United States)

    Godwin, A R; Capecchi, M R

    1998-01-01

    Hox genes are usually expressed temporally and spatially in a colinear manner with respect to their positions in the Hox complex. Consistent with the expected pattern for a paralogous group 13 member, early embryonic Hoxc13 expression is found in the nails and tail. Hoxc13 is also expressed in vibrissae, in the filiform papillae of the tongue, and in hair follicles throughout the body; a pattern that apparently violates spatial colinearity. Mice carrying mutant alleles of Hoxc13 have been generated by gene targeting. Homozygotes have defects in every region in which gene expression is seen. The most striking defect is brittle hair resulting in alopecia (hairless mice). One explanation for this novel role is that Hoxc13 has been recruited for a function common to hair, nail, and filiform papilla development.

  10. Google: a narrativa de uma marca mutante

    Directory of Open Access Journals (Sweden)

    Elizete de Azevedo Kreutz

    2010-01-01

    Full Text Available As marcas mutantes já fazem parte de nossa realidade, embora ainda não totalmente percebidas e/ou aceitas como tal. O presente artigo busca refletir sobre a relevância dessas novas estratégias de comunicação e branding, identificando suas principais características. Para isso, utilizamos o método de estudo de caso, o Google, ancorado nos métodos de pesquisa bibliográfica e de internet. A escolha foi intencional, posto que a organização é referência em sua categoria, mecanismo de busca, e reflete essa estratégia comunicacional contemporânea. Como resultado, as informações obtidas nos possibilitam compreender essa tendência de comportamento de marca que busca a interação com seus públicos.

  11. Studies on mutant breeding of Hibiscus syriacus

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hi Sup; Kim, Jin Kyu; Lee, Ki Un; Kim, Young Taik

    1997-01-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has such a characteristic of self-incompatibility that all the plant exist as natural hybrids and have heterogeneous genes. Many domestic 91 varieties of Hibiscus syriacus were collected. Radiosensitivity of H. Syriacus irradiated with {gamma}-ray was investigated in plant cuttings. The plant height was reduced by 45% in 5KR irradiated group, compared to control group. The radiation dose of 5KR could be recommended for mutation breeding of Hibiscus cuttings. Radiosensitivity of {gamma}-ray irradiated Hibiscus seed were investigated. The germination rate, survival rate and plant height was better in the 4KR irradiation plot than control. The radiation dose of 10{approx}12KR are recommended for mutation breeding of Hibiscus. Promising mutant lines were selected form the varieties of Hwarang, Wolsan no. 176, Ilpyondansim, Emille, Hanol, Yongkwang, Saeyongkwang, Chungmu, Imjinhong, Arang, Hungdansim-1 and Hongdansim-2. (author). 66 refs., 16 tabs., 13 figs.

  12. Studies on mutant breeding of Hibiscus syriacus

    International Nuclear Information System (INIS)

    Song, Hi Sup; Kim, Jin Kyu; Lee, Ki Un; Kim, Young Taik.

    1997-01-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has such a characteristic of self-incompatibility that all the plant exist as natural hybrids and have heterogeneous genes. Many domestic 91 varieties of Hibiscus syriacus were collected. Radiosensitivity of H. Syriacus irradiated with γ-ray was investigated in plant cuttings. The plant height was reduced by 45% in 5KR irradiated group, compared to control group. The radiation dose of 5KR could be recommended for mutation breeding of Hibiscus cuttings. Radiosensitivity of γ-ray irradiated Hibiscus seed were investigated. The germination rate, survival rate and plant height was better in the 4KR irradiation plot than control. The radiation dose of 10∼12KR are recommended for mutation breeding of Hibiscus. Promising mutant lines were selected form the varieties of Hwarang, Wolsan no. 176, Ilpyondansim, Emille, Hanol, Yongkwang, Saeyongkwang, Chungmu, Imjinhong, Arang, Hungdansim-1 and Hongdansim-2. (author). 66 refs., 16 tabs., 13 figs

  13. Identification of a mutant α1 Na/K-ATPase that pumps but is defective in signal transduction.

    Science.gov (United States)

    Lai, Fangfang; Madan, Namrata; Ye, Qiqi; Duan, Qiming; Li, Zhichuan; Wang, Shaomeng; Si, Shuyi; Xie, Zijian

    2013-05-10

    It has not been possible to study the pumping and signaling functions of Na/K-ATPase independently in live cells. Both cell-free and cell-based assays indicate that the A420P mutation abolishes the Src regulatory function of Na/K-ATPase. A420P mutant has normal pumping but not signaling function. Identification of Src regulation-null mutants is crucial for addressing physiological role of Na/K-ATPase. The α1 Na/K-ATPase possesses both pumping and signaling functions. However, it has not been possible to study these functions independently in live cells. We have identified a 20-amino acid peptide (Ser-415 to Gln-434) (NaKtide) from the nucleotide binding domain of α1 Na/K-ATPase that binds and inhibits Src in vitro. The N terminus of NaKtide adapts a helical structure. In vitro kinase assays showed that replacement of residues that contain a bulky side chain in the helical structure of NaKtide by alanine abolished the inhibitory effect of the peptide on Src. Similarly, disruption of helical structure by proline replacement, either single or in combination, reduced the inhibitory potency of NaKtide on Src. To identify mutant α1 that retains normal pumping function but is defective in Src regulation, we transfected Na/K-ATPase α1 knockdown PY-17 cells with expression vectors of wild type or mutant α1 carrying Ala to Pro mutations in the region of NaKtide helical structure and generated several stable cell lines. We found that expression of either A416P or A420P or A425P mutant fully restored the α1 content and consequently the pumping capacity of cells. However, in contrast to A416P, either A420P or A425P mutant was incapable of interacting and regulating cellular Src. Consequently, expression of these two mutants caused significant inhibition of ouabain-activated signal transduction and cell growth. Thus we have identified α1 mutant that has normal pumping function but is defective in signal transduction.

  14. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Zayats, O.M.

    2001-01-01

    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

  15. Temperature-sensitive glutamate dehydrogenase mutants of Salmonella typhimurium.

    OpenAIRE

    Dendinger, S M; Brenchley, J E

    1980-01-01

    Mutants of Salmonella typhimurium defective in glutamate dehydrogenase activity were isolated in parent strains lacking glutamate synthase activity by localizcd mutagenesis or by a general mutagenesis combined with a cycloserine enrichment for glutamate auxotrophs. Two mutants with temperature-sensitive phenotypes had glutamate dehydrogenase activities that were more thermolabile than that of an isogenic control strain. Eight other mutants had less than 10% of the wild-type glutamate dehydrog...

  16. Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

    International Nuclear Information System (INIS)

    Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

    2006-01-01

    The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

  17. Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants

    OpenAIRE

    Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.

    2010-01-01

    Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic ...

  18. Argos mutants define an affinity threshold for spitz inhibition in vivo.

    Science.gov (United States)

    Alvarado, Diego; Evans, Timothy A; Sharma, Raghav; Lemmon, Mark A; Duffy, Joseph B

    2006-09-29

    Argos, a secreted antagonist of Drosophila epidermal growth factor receptor (dEGFR) signaling, acts by sequestering the activating ligand Spitz. To understand how different domains in Argos contribute to efficient Spitz sequestration, we performed a genetic screen aimed at uncovering modifiers of an Argos misexpression phenotype in the developing eye. We identified a series of suppressors mapping to the Argos transgene that affect its activity in multiple developmental contexts. These point mutations map to both the N- and C-terminal cysteine-rich regions, implicating both domains in Argos function. We show by surface plasmon resonance that these Argos mutants are deficient in their ability to bind Spitz in vitro. Our data indicate that a mere approximately 2-fold decrease in K(D) is sufficient to compromise Argos activity in vivo. This effect could be recapitulated in a cell-based assay, where a higher molar concentration of mutant Argos was needed to inhibit Spitz-dependent dEGFR phosphorylation. In contrast, a approximately 37-fold decrease in the binding constant nearly abolishes Argos activity in vivo and in cellular assays. In agreement with previously reported computational studies, our results define an affinity threshold for optimal Argos inhibition of dEGFR signaling during development.

  19. How to orient the functional GroEL-SR1 mutant for atomic force microscopy investigations

    International Nuclear Information System (INIS)

    Schiener, Jens; Witt, Susanne; Hayer-Hartl, Manajit; Guckenberger, Reinhard

    2005-01-01

    We present high-resolution atomic force microscopy (AFM) imaging of the single-ring mutant of the chaperonin GroEL (SR-EL) from Escherichia coli in buffer solution. The native GroEL is generally unsuitable for AFM scanning as it is easily being bisected by forces exerted by the AFM tip. The single-ring mutant of GroEL with its simplified composition, but unaltered capability of binding substrates and the co-chaperone GroES, is a more suited system for AFM studies. We worked out a scheme to systematically investigate both the apical and the equatorial faces of SR-EL, as it binds in a preferred orientation to hydrophilic mica and hydrophobic highly ordered pyrolytic graphite. High-resolution topographical imaging and the interaction of the co-chaperone GroES were used to assign the orientations of SR-EL in comparison with the physically bisected GroEL. The usage of SR-EL facilitates single molecule studies on the folding cycle of the GroE system using AFM

  20. Syntheses, structure, and a Mössbauer and magnetic study of Ba(4)Fe(2)I(5)S(4).

    Science.gov (United States)

    Gray, Danielle L; Long, Gary J; Grandjean, Fernande; Hermann, Raphaël P; Ibers, James A

    2008-01-07

    The compound Ba4Fe2I5S4 has been prepared at 1223-1123 K by the "U-assisted" reaction of FeS, BaS, S, and U with BaI2 as a flux. A more rational synthesis was also found; however, the presence of U appears to be essential for the formation of single crystals suitable for X-ray diffraction studies. Ba4Fe2I5S4 crystallizes in a new structure type with two formula units in space group I4/m of the tetragonal system. The structure consists of a Ba-I network penetrated by (1)infinity[Fe2S4] chains. Each Fe atom, which is located on a site with 4 symmetry, is tetrahedrally coordinated to four S atoms. The FeS4 tetrahedra edge-share to form linear (1)infinity[Fe2S4] chains in the [001] direction. The Fe-Fe interatomic distance in these chains is 2.5630(4) A, only about 3% longer than the shortest Fe-Fe distance in -Fe metal. Charge balance dictates that the average formal oxidation state of Fe in these chains is +2.5. The Mössbauer spectra obtained at 85 and 270 K comprise a single quadrupole doublet that has hyperfine parameters consistent with an average Fe oxidation state of +2.5. The Mössbauer spectrum obtained at 4.2 K consists of a single magnetic sextet with a small hyperfine field of -15.5 T. This spectrum is also consistent with rapid electron delocalization and an average Fe oxidation state of +2.5. The molar magnetic susceptibility of Ba4Fe2I5S4, obtained between 3.4 and 300 K, qualitatively indicates the presence of weak pseudo-one-dimensional ferromagnetic exchange within a linear chain above 100 K and weak three-dimensional ordering between the chains at lower temperatures.

  1. The chitin-binding capability of Cy-AMP1 from cycad is essential to antifungal activity.

    Science.gov (United States)

    Yokoyama, Seiya; Iida, Yuto; Kawasaki, Yousuke; Minami, Yuji; Watanabe, Keiichi; Yagi, Fumio

    2009-07-01

    Antimicrobial peptides are important components of the host innate immune responses by exerting broad-spectrum microbicidal activity against pathogenic microbes. Cy-AMP1 found in the cycad (Cycas revoluta) seeds has chitin-binding ability, and the chitin-binding domain was conserved in knottin-type and hevein-type antimicrobial peptides. The recombinant Cy-AMP1 was expressed in Escherichia coli and purified to study the role of chitin-binding domain. The mutants of Cy-AMP1 lost chitin-binding ability completely, and its antifungal activity was markedly decreased in comparison with native Cy-AMP1. However, the antimicrobial activities of the mutant peptides are nearly identical to that of native one. It was suggested that the chitin-binding domain plays an essential role in antifungal, but not antimicrobial, activity of Cy-AMP1.

  2. Induction and selection of citrus mutant by gamma-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Jung; Oh, Seung Kyu; Lee, Hyo Yeon [Jeju National University, Jeju (Korea, Republic of)

    2010-09-15

    We have subjected to gamma-irradiation to citrus buds and then grafted onto mature citrus tree. Mutant citrus branch lines have been induced. As a result of first selection, we found the several mutant lines showing interesting phenotypes such as higher sugar content. We have selected several branches showing good qualities such as higher sweetness and/or lower acidity. Some branch lines showed over 13 .deg. Brix sugar content and below 0.9% acidity. Other mutant branch lines showed the changes of shape, size, peel thickness, and fiber contents or distribution of fruits. The results suggest that gamma-irradiation is an effective tool for induction of citrus mutant lines.

  3. Seed protein and nitrogen fixation in chickpea mutant variety Hyprosola

    International Nuclear Information System (INIS)

    Schroeder, H.E.; Gibson, A.H.; Oram, R.N.; Shaikh, M.A.Q.

    1989-01-01

    Full text: 'Hyprosola' is a high yielding, high protein mutant cultivar obtained after gamma irradiation from the variety 'Faridpur-1'. The mutant yields 45 % more protein per unit area. The essential amino acid index is unchanged. It is likely that the high nutritional value in 'Hyprosola' seed protein arises from an increase in the albumin:globulin ratio. Nitrogen fixation rates of the mutant during the first 7 weeks of growth were found to be similar to 'Faridpur-1'. Under field conditions, the mutant may be able to nodulate more rapidly and more extensively than the parent variety. (author)

  4. Sphingolipid synthesis deficiency in a mutant of Bacteroides levii

    Energy Technology Data Exchange (ETDEWEB)

    Brumleve, B.; Lev, M.

    1986-05-01

    Bacteroides levii, an anaerobic bacterium, synthesizes two sphingolipids; the sphingomyelin analogue, ceramide phosphorylethanolamine (CPE), and also ceramide phosphorylglycerol (CPG). The first enzyme in the sphingolipid pathway, 3-ketodihydro-sphingosine (3KDS) synthase, has been partially purified previously. To study subsequent steps in the pathways, mutants defective in sphingolipid synthesis were derived by ethyl methanesulfonate and nitrosoguanidine mutagenesis. Extracts of the mutant, 1075BB, show synthase activity although the cells do not synthesize CPE or CPG. The mutant differs from the wild type in that: (1) synthase activity was much diminished in the mutant, (2) sphingolipid synthesis does not occur in the mutant as evidenced by the absence of spots at sites where CPE and CPG migrate following two-dimensional thin layer chromatography, (3) incorporation of uniformly-labelled (/sup 14/C)serine carbon or (/sup 14/C)3KDS into sphingolipids was not observed in the mutant, (4) following incubation with (/sup 14/C)3KDS, radioactivity corresponding to dihydrosphingosine (DHS) and ceramide were observed in the mutant; no (/sup 14/C)DHS was detected in the wild type, and (5) enhanced incorporation of (/sup 14/C)serine carbon into two lipids not containing phosphorus was found in the mutant. The authors conclude, therefore, that this mutant, 1075BB, has a metabolic block at the terminal biosynthetic steps of sphingolipid synthesis.

  5. Isoenzymes performance of some rice varieties and their mutants

    International Nuclear Information System (INIS)

    Winarno, Ermin; Suliwarno, Ambyah; Ismachin, M.

    1992-01-01

    Isoenzymes performance of some rice varieties and their mutants. Genetics studies on alcohol dehydrogenase, malic enzyme, peroxidase, acid phosphase, and aminopeptidase isoenzymes were carried out on several groups of rice varieties and their mutant lines. The first groups consisted of Atomita I, Pelita I/1, A227/5, Mudgo, TN-1, and IR-26. The second group was Cisadane variety and its five mutants, namely OBS 18, OBS 208, OBS 297, OBS 306, and OBS 330. The third group was mutants line 627-10-3 and its mutants, namely 1063, 1066, 1067, 1076, and 1090. Isoenzymes extracts of the rice leaves were fractionated using polyacrylamide gel disc electrophoresis. The pattern of acid phosphate isoenzyme shows the specific character of rice mutants susceptible to brown plant hopper biotype 1. The gene(s) controlling malic enzyme in Cisadane's mutants is (are) estimated more resistant toward gamma irradiation than gene(s) responsible for controlling the other enzymes. Generally, the isoenzymes zymograms show that gene(s) controlling the mutants enzyme have undergone mutation. This case is shown by the changes of Rm value, as well as the amount and intensity of mutants bands. (authors). 7 refs., 7 figs

  6. Mapping Escherichia coli elongation factor Tu residues involved in binding of aminoacyl-tRNA

    DEFF Research Database (Denmark)

    Wiborg, Ove; Andersen, C; Knudsen, Charlotte Rohde

    1996-01-01

    Two residues of Escherichia coli elongation factor Tu involved in binding of aminoacyl-tRNA were identified and subjected to mutational analysis. Lys-89 and Asn-90 were each replaced by either Ala or Glu. The four single mutants were denoted K89A, K89E, N90A, and N90E, respectively. The mutants......-tRNA, which suggested an important role of Lys-89 and Asn-90 in tRNA binding. Furthermore, our results indicate helix B to be an important target site for nucleotide exchange factor EF-Ts. Also the mutants His-66 to Ala and His-118 to either Ala or Glu were characterized in an in vitro translation assay...

  7. Surface binding sites in amylase have distinct roles in recognition of starch structure motifs and degradation

    DEFF Research Database (Denmark)

    Cockburn, Darrell; Nielsen, Morten M.; Christiansen, Camilla

    2015-01-01

    degrading enzymes and critically important for their function. The affinity towards a variety of starch granules as well as soluble poly- and oligosaccharides of barley alpha-amylase 1 (AMY1) wild-type and mutants of two SBSs (SBS1 and SBS2) was investigated using Langmuir binding analysis, confocal laser...

  8. Binding of phage displayed Bacillus subtilis lipase A to a phosphonate suicide inhibitor

    NARCIS (Netherlands)

    Dröge, M.J; Ruggeberg, C.J.; van der Sloot, Almer Martinus; Schimmel, J.; Dijkstra, Durk; Verhaert, R.M D; Reetz, M.T.; Quax, Wim; Droge, MJ; Dijkstra, DS

    2003-01-01

    Phage display can be used as a protein engineering tool to select proteins with desirable binding properties from a library of randomly constructed mutants. Here, we describe the development of this method for the directed evolution of Bacillus subtilis lipase A, an enzyme that has marked properties

  9. Mechanism of DNA–binding loss upon single-point mutation in p53

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Despite our current understanding of protein−DNA recognition, the mechanism(s) underlying the loss in protein−DNA binding affinity/ ... Keywords. p53 mutants; protein-DNA interactions; molecular dynamics simulations; free energy decomposition. Abbreviations ... of the salt–bridge with Asp 281, resulting in the loss of DNA.

  10. Insights into regioselective metabolism of mefenamic acid by cytochrome P450 BM3 mutants through crystallography, docking, molecular dynamics, and free energy calculations

    DEFF Research Database (Denmark)

    Capoferri, Luigi; Leth, Rasmus; Ter Haar, Ernst

    2016-01-01

    of the protein mutant M11 was expressed, purified, and crystallized, and its X-ray structure was used as template for modeling. A multistep approach was used that combines molecular docking, molecular dynamics (MD) simulation, and binding free-energy calculations to address protein flexibility. In this way...... of mefenamic acid by M11 and its mutants by including protein flexibility and dynamics in free-energy computation. In addition, we could obtain structural insights into the change in regioselectivity of mefenamic acid hydroxylation due to single active-site mutations. Our findings confirm that use of MD...... and binding free-energy calculation is useful for studying biocatalysis in those cases in which enzyme binding is a critical event in determining the selective metabolism of a substrate. Proteins 2016; 84:383-396. © 2016 Wiley Periodicals, Inc....

  11. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    International Nuclear Information System (INIS)

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S.

    1991-01-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state

  12. [Value of computerized tomography in the diagnosis of discopathy in the L4-L5-S1 segment].

    Science.gov (United States)

    Twarkowski, P; Lachowski, M; Podgórski, J K; Delimat, L

    1992-01-01

    The aim of this analysis was demonstration of the usefulness of CT in the diagnosis of lumbar discopathy. In 110 patients with backache, CT of the L4-L5-S1 part of the spine was done. The observed abnormalities were analysed, including presence of nucleus pulposus herniation, pathological changes of osseous structures of the spine, width of the vertebral canal and lateral recesses, and presence of other lesions there. Comparing the results of (CT) and myelography with intraoperative observations it was possible to confirm the high usefulness and value of CT in such cases. CT may be an important diagnostic method preoperatively in patients with iodine hypersensitivity and those with vertebral canal stenosis.

  13. Iodide Binding in Sodium-Coupled Cotransporters.

    Science.gov (United States)

    Vergara-Jaque, Ariela; Fong, Peying; Comer, Jeffrey

    2017-12-26

    Several apical iodide translocation pathways have been proposed for iodide efflux out of thyroid follicular cells, including a pathway mediated by the sodium-coupled monocarboxylate transporter 1 (SMCT1), which remains controversial. Herein, we evaluate structural and functional similarities between SMCT1 and the well-studied sodium-iodide symporter (NIS) that mediates the first step of iodide entry into the thyroid. Free-energy calculations using a force field with electronic polarizability verify the presence of a conserved iodide-binding pocket between the TM2, TM3, and TM7 segments in hNIS, where iodide is coordinated by Phe67, Gln72, Cys91, and Gln94. We demonstrate the mutation of residue Gly93 of hNIS to a larger amino acid expels the side chain of a critical tryptophan residue (Trp255) into the interior of the binding pocket, partially occluding the iodide binding site and reducing iodide affinity, which is consistent with previous reports associating mutation of this residue with iodide uptake deficiency and hypothyroidism. Furthermore, we find that the position of Trp255 in this hNIS mutant mirrors that of Trp253 in wild-type hSMCT1, where a threonine (Thr91) occupies the position homologous to that occupied by glycine in wild-type hNIS (Gly93). Correspondingly, mutation of Thr91 to glycine in hSMCT1 makes the pocket structure more like that of wild-type hNIS, increasing its iodide affinity. These results suggest that wild-type hSMCT1 in the inward-facing conformation may bind iodide only very weakly, which may have implications for its ability to transport iodide.

  14. Cone beam computed tomography and its image guidance technology during percutaneous nucleoplasty procedures at L5/S1 lumbar level

    Energy Technology Data Exchange (ETDEWEB)

    Ierardi, Anna Maria; Piacentino, Filippo; Giorlando, Francesca [University of Insubria, Unit of Interventional Radiology, Department of Radiology, Varese (Italy); Magenta Biasina, Alberto; Carrafiello, Gianpaolo [University of Milan, San Paolo Hospital, Department of Diagnostic and Interventional Radiology, Milan (Italy); Bacuzzi, Alessandro [University of Insubria, Anaesthesia and Palliative Care, Varese (Italy); Novario, Raffaele [University of Insubria, Medical Physics Department, Varese (Italy)

    2016-12-15

    To demonstrate the feasibility of percutaneous nucleoplasty procedures at L5/S1 level using cone beam CT (CBCT) and its associated image guidance technology for the treatment of lumbar disc herniation (LDH). We retrospectively reviewed 25 cases (20 men, 5 women) of LDH at L5/S1 levels. CBCT as guidance imaging was chosen after a first unsuccessful fluoroscopy attempt that was related to complex anatomy (n = 15), rapid pathological changes due to degenerative diseases (n = 7) or both (n = 3). Technical success, defined as correct needle positioning in the target LDH, and safety were evaluated; overall procedure time and radiation dose were registered. A visual analog scale (VAS) was used to evaluate pain and discomfort pre-intervention after 1 week and 1, 3, and 6 months after the procedure. Technical success was 100 %; using CBCT as guidance imaging the needle was correctly positioned at the first attempt in 20 out of 25 patients. Neither major nor minor complications were registered during or after the procedure. The average procedure time was 11 min and 56 s (range, 9-15 min), whereas mean procedural radiation dose was 46.25 Gy.cm{sup 2} (range 38.10-52.84 Gy.cm{sup 2}), and mean fluoroscopy time was 5 min 34 s (range 3 min 40 s to 6 min 55 s). The VAS pain score decreased significantly from 7.6 preoperatively to 3.9 at 1 week, 2.8 at 1 month, 2.1 at 3 months, and 1.6 at 6 months postoperatively. CBCT-guided percutaneous nucleoplasty is a highly effective technique for LDH with acceptable procedure time and radiation dose. (orig.)

  15. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  16. Conditional lethal mutants of bacteriophage T4 unable to grow on a streptomycin resistant mutant of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Childs, J.D.

    1977-01-01

    Sixteen conditional lethal mutants of bacteriophage T4D have been isolated which grow on Escherichia coli CR63 (a su/sup +/ streptomycin-sensitive K12 strain) but are restricted by CR/s (a streptomycin-resistant derivative of CR63). These mutants have been given the prefix str. Four of these mutants are amber and 12 appear to be missense. Eleven of the 12 missense mutants appear to be ''pseudo-amber'' (i.e., they are restricted by a su/sup -/ E. coli B strain but not by a su/sup -/ K12 strain); the other missense mutant was not restricted by either B or K12. The str mutations mapped in 12 different genes. Most were clustered in a region of early genes (gene 56 to gene 47). Fifty-eight amber and 10 ''pseudo-amber'' mutants isolated previously for their inability to grow on E. coli B were tested for restriction by CR/s. All the amber mutants grew normally on CR/s, whereas all 10 ''pseudo-amber'' mutants were restricted by CR/s. This implies that the phenotype of the ''pseudo-amber'' mutants is the result of a ribosomal difference between the permissive host CR63 and the restrictive hosts B and CR/s. These str mutants should prove to be useful alternatives to amber mutants for genetic and biochemical studies of bacteriophage T4 and for studies of the E. coli ribosome. It should be possible to isolate similar mutants in other bacteriophages provided that streptomycin resistant hosts are available.

  17. Zn2+ Uptake in Streptococcus pyogenes: Characterization of adcA and lmb Null Mutants.

    Science.gov (United States)

    Tedde, Vittorio; Rosini, Roberto; Galeotti, Cesira L

    2016-01-01

    An effective regulation of metal ion homeostasis is essential for the growth of microorganisms in any environment and in pathogenic bacteria is strongly associated with their ability to invade and colonise their hosts. To gain a better insight into zinc acquisition in Group A Streptococcus (GAS) we characterized null deletion mutants of the adcA and lmb genes of Streptococcus pyogenes strain MGAS5005 encoding the orthologues of AdcA and AdcAII, the two surface lipoproteins with partly redundant roles in zinc homeostasis in Streptococcus pneumoniae. Null adcA and lmb mutants were analysed for their capability to grow in zinc-depleted conditions and were found to be more susceptible to zinc starvation, a phenotype that could be rescued by the addition of Zn2+ ions to the growth medium. Expression of AdcA, Lmb and HtpA, the polyhistidine triad protein encoded by the gene adjacent to lmb, during growth under conditions of limited zinc availability was examined by Western blot analysis in wild type and null mutant strains. In the wild type strain, AdcA was always present with little variation in expression levels between conditions of excess or limited zinc availability. In contrast, Lmb and HtpA were expressed at detectable levels only during growth in the presence of low zinc concentrations or in the null adcA mutant, when expression of lmb is required to compensate for the lack of adcA expression. In the latter case, Lmb and HtpA were overexpressed by several fold, thus indicating that also in GAS AdcA is a zinc-specific importer and, although it shares this function with Lmb, the two substrate-binding proteins do not show fully overlapping roles in zinc homeostasis.

  18. Yersinia enterocolitica serum resistance proteins YadA and ail bind the complement regulator C4b-binding protein.

    Science.gov (United States)

    Kirjavainen, Vesa; Jarva, Hanna; Biedzka-Sarek, Marta; Blom, Anna M; Skurnik, Mikael; Meri, Seppo

    2008-08-29

    Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS) O-antigen (O-ag) and outer core (OC) do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp), an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.

  19. LRRK2 kinase activity is dependent on LRRK2 GTP binding capacity but independent of LRRK2 GTP binding.

    Directory of Open Access Journals (Sweden)

    Jean-Marc Taymans

    Full Text Available Leucine rich repeat kinase 2 (LRRK2 is a Parkinson's disease (PD gene that encodes a large multidomain protein including both a GTPase and a kinase domain. GTPases often regulate kinases within signal transduction cascades, where GTPases act as molecular switches cycling between a GTP bound "on" state and a GDP bound "off" state. It has been proposed that LRRK2 kinase activity may be increased upon GTP binding at the LRRK2 Ras of complex proteins (ROC GTPase domain. Here we extensively test this hypothesis by measuring LRRK2 phosphorylation activity under influence of GDP, GTP or non-hydrolyzable GTP analogues GTPγS or GMPPCP. We show that autophosphorylation and lrrktide phosphorylation activity of recombinant LRRK2 protein is unaltered by guanine nucleotides, when co-incubated with LRRK2 during phosphorylation reactions. Also phosphorylation activity of LRRK2 is unchanged when the LRRK2 guanine nucleotide binding pocket is previously saturated with various nucleotides, in contrast to the greatly reduced activity measured for the guanine nucleotide binding site mutant T1348N. Interestingly, when nucleotides were incubated with cell lysates prior to purification of LRRK2, kinase activity was slightly enhanced by GTPγS or GMPPCP compared to GDP, pointing to an upstream guanine nucleotide binding protein that may activate LRRK2 in a GTP-dependent manner. Using metabolic labeling, we also found that cellular phosphorylation of LRRK2 was not significantly modulated by nucleotides, although labeling is significantly reduced by guanine nucleotide binding site mutants. We conclude that while kinase activity of LRRK2 requires an intact ROC-GTPase domain, it is independent of GDP or GTP binding to ROC.

  20. Yersinia enterocolitica serum resistance proteins YadA and ail bind the complement regulator C4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Vesa Kirjavainen

    Full Text Available Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS O-antigen (O-ag and outer core (OC do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp, an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.

  1. Construction of a catalytically inactive cholesterol oxidase mutant: investigation of the interplay between active site-residues glutamate 361 and histidine 447.

    Science.gov (United States)

    Yin, Ye; Liu, Pingsheng; Anderson, Richard G W; Sampson, Nicole S

    2002-06-15

    Cholesterol oxidase catalyzes the oxidation of cholesterol to cholest-5-en-3-one and its subsequent isomerization into cholest-4-en-3-one. Two active-site residues, His447 and Glu361, are important for catalyzing the oxidation and isomerization reactions, respectively. Double-mutants were constructed to test the interplay between these residues in catalysis. We observed that the k(cat) of oxidation for the H447Q/E361Q mutant was 3-fold less than that for H447Q and that the k(cat) of oxidation for the H447E/E361Q mutant was 10-fold slower than that for H447E. Because both doubles-mutants do not have a carboxylate at position 361, they do not catalyze isomerization of the reaction intermediate cholest-5-en-3-one to cholest-4-en-3-one. These results suggest that Glu361 can compensate for the loss of histidine at position 447 by acting as a general base catalyst for oxidation of cholesterol. Importantly, the construction of the double-mutant H447E/E361Q yields an enzyme that is 31,000-fold slower than wild type in k(cat) for oxidation. The H447E/E361Q mutant is folded like native enzyme and still associates with model membranes. Thus, this mutant may be used to study the effects of membrane binding in the absence of catalytic activity. It is demonstrated that in assays with caveolae membrane fractions, the wild-type enzyme uncouples platelet-derived growth factor receptor beta (PDGFRbeta) autophosphorylation from tyrosine phosphorylation of neighboring proteins, and the H447E/E361Q mutant does not. Thus maintenance of membrane structure by cholesterol is important for PDGFRbeta-mediated signaling. The cholesterol oxidase mutant probe described will be generally useful for investigating the role of membrane structure in signal transduction pathways in addition to the PDGFRbeta-dependent pathway tested.

  2. Characterization of the β-lactam binding site of penicillin acylase of Escherichia coli by structural and site-directed mutagenesis studies

    NARCIS (Netherlands)

    Alkema, Wynand B.L.; Hensgens, Charles M.H.; Kroezinga, Els H.; de Vries, Erik; Floris, René; Laan, Jan-Metske van der; Dijkstra, Bauke W.; Janssen, Dick B.

    2000-01-01

    The binding of penicillin to penicillin acylase was studied by X-ray crystallography. The structure of the enzyme–substrate complex was determined after soaking crystals of an inactive βN241A penicillin acylase mutant with penicillin G. Binding of the substrate induces a conformational change, in

  3. Characterization of the beta-lactam binding site of penicillin acylase of Escherichia coli by structural and site-directed mutagenesis studies

    NARCIS (Netherlands)

    Alkema, WBL; Hensgens, CMH; Kroezinga, EH; de Vries, E; Floris, R; van der Laan, JM; Dijkstra, BW; Janssen, DB

    2000-01-01

    The binding of penicillin to penicillin acylase was studied by X-ray crystallography, The structure of the enzyme-substrate complex was determined after soaking crystals of an inactive beta N241A penicillin acylase mutant with penicillin G, Binding of the substrate induces a conformational change,

  4. PET imaging of HSV1-tk mutants with acquired specificity toward pyrimidine- and acycloguanosine-based radiotracers

    Energy Technology Data Exchange (ETDEWEB)

    Likar, Yury; Dobrenkov, Konstantin; Olszewska, Malgorzata; Shenker, Larissa; Hricak, Hedvig; Ponomarev, Vladimir [Memorial Sloan-Kettering Cancer Center, Molecular Imaging Laboratory, Department of Radiology, New York, NY (United States); Cai, Shangde [Memorial Sloan-Kettering Cancer Center, Radiochemistry/Cyclotron Core Facility, New York, NY (United States)

    2009-08-15

    The aim of this study was to create an alternative mutant of the herpes simplex virus type 1 thymidine kinase (HSV1-tk) reporter gene with reduced phosphorylation capacity for acycloguanosine derivatives, but not pyrimidine-based compounds that will allow for successful PET imaging. A new mutant of HSV1-tk reporter gene, suitable for PET imaging using pyrimidine-based radiotracers, was developed. The HSV1-tk mutant contains an arginine-to-glutamine substitution at position 176 (HSV1-R176Qtk) of the nucleoside binding region of the enzyme. The mutant-gene product showed favorable enzymatic characteristics toward pyrimidine-based nucleosides, while exhibiting reduced activity with acycloguanosine derivatives. In order to enhance HSV1-R176Qtk reporter activity with pyrimidine-based radiotracers, we introduced the R176Q substitution into the more active HSV1-sr39tk mutant. U87 human glioma cells transduced with the HSV1-R176Qsr39tk double mutant reporter gene showed high {sup 3}H-FEAU pyrimidine nucleoside and low {sup 3}H-penciclovir acycloguanosine analog uptake in vitro. PET imaging also demonstrated high {sup 18}F-FEAU and low {sup 18}F-FHBG accumulation in HSV1-R176Qsr39tk+ xenografts. The feasibility of imaging two independent nucleoside-specific HSV1-tk mutants in the same animal with PET was demonstrated. Two opposite xenografts expressing the HSV1-R176Qsr39tk reporter gene and the previously described acycloguanosine-specific mutant of HSV1-tk, HSV1-A167Ysr39tk reporter gene, were imaged using a short-lived pyrimidine-based {sup 18}F-FEAU and an acycloguanosine-based {sup 18}F-FHBG radiotracer, respectively, administered on 2 consecutive days. We conclude that in combination with acycloguanosine-specific HSV1-A167Ysr39tk reporter gene, a HSV1-tk mutant containing the R176Q substitution could be used for PET imaging of two different cell populations or concurrent molecular biological processes in the same living subject. (orig.)

  5. Unbiased mutagenesis of MHV68 LANA reveals a DNA-binding domain required for LANA function in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Clinton R Paden

    2012-09-01

    Full Text Available The Latency-Associated Nuclear Antigen (LANA, encoded by ORF73, is a conserved gene among the γ2-herpesviruses (rhadinoviruses. The Kaposi's Sarcoma-Associated Herpesvirus (KSHV LANA is consistently expressed in KSHV-associated malignancies. In the case of the rodent γ2-herpesvirus, murine gammaherpesvirus 68 (MHV68, the LANA homolog (mLANA is required for efficient virus replication, reactivation from latency and immortalization of murine fetal liver-derived B cells. To gain insights into mLANA function(s, knowing that KSHV LANA binds DNA and can modulate transcription of a variety of promoters, we sought out and identified a mLANA-responsive promoter which maps to the terminal repeat (TR of MHV68. Notably, mLANA strongly repressed activity from this promoter. We extended these analyses to demonstrate direct, sequence-specific binding of recombinant mLANA to TR DNA by DNase I footprinting. To assess whether the DNA-binding and/or transcription modulating function is important in the known mLANA phenotypes, we generated an unbiased library of mLANA point mutants using error-prone PCR, and screened a large panel of mutants for repression of the mLANA-responsive promoter to identify loss of function mutants. Notably, among the mutant mLANA proteins recovered, many of the mutations are in a predicted EBNA-1-like DNA-binding domain. Consistent with this prediction, those tested displayed loss of DNA binding activity. We engineered six of these mLANA mutants into the MHV68 genome and tested the resulting mutant viruses for: (i replication fitness; (ii efficiency of latency establishment; and (iii reactivation from latency. Interestingly, each of these mLANA-mutant viruses exhibited phenotypes similar to the mLANA-null mutant virus, indicating that DNA-binding is critical for mLANA function.

  6. Sequence organization and putative regulatory elements in the 5S rRNA genes of two higher plants (Vigna radiata and Matthiola incana).

    Science.gov (United States)

    Hemleben, V; Werts, D

    1988-01-01

    The tandemly arranged and clustered highly repeated 5S rRNA genes are investigated for two plants belonging to different higher plant families: Matthiola incana (Brassicaceae, Dilleniidae, Rosidae; 3600 5S rRNA genes/n) shows a homogeneous repeat size of 510 bp, whereas Vigna radiata (mung bean, former Phaseolus aureus, Fabaceae, Rosidae; approx. 4300 5S rRNA genes) has a repeat size of 215 bp. The mung-bean 5S rRNA coding region starts 5' with AGG and ends with CCT; Matthiola starts with GGG and ends with CCC. Striking is the strict occurrence of a 'TATA' box starting at nucleotide-28 similar to Neurospora crassa 5S rRNA genes. The 3' end is followed by CTTTT or GTTT stretches present in different numbers in the non-transcribed spacer suggesting a function in termination.

  7. Mutants dissecting development and behaviour in drosophila

    International Nuclear Information System (INIS)

    Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

    2005-01-01

    We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

  8. Determining Membrane Protein-Lipid Binding Thermodynamics Using Native Mass Spectrometry.

    Science.gov (United States)

    Cong, Xiao; Liu, Yang; Liu, Wen; Liang, Xiaowen; Russell, David H; Laganowsky, Arthur

    2016-04-06

    Membrane proteins are embedded in the biological membrane where the chemically diverse lipid environment can modulate their structure and function. However, the thermodynamics governing the molecular recognition and interaction of lipids with membrane proteins is poorly understood. Here, we report a method using native mass spectrometry (MS), to determine thermodynamics of individual ligand binding events to proteins. Unlike conventional methods, native MS can resolve individual ligand binding events and, coupled with an apparatus to control the temperature, determine binding thermodynamic parameters, such as for protein-lipid interactions. We validated our approach using three soluble protein-ligand systems (maltose binding protein, lysozyme, and nitrogen regulatory protein) and obtained similar results to those using isothermal titration calorimetry and surface plasmon resonance. We also determined for the first time the thermodynamics of individual lipid binding to the ammonia channel (AmtB), an integral membrane protein from Escherichia coli. Remarkably, we observed distinct thermodynamic signatures for the binding of different lipids and entropy-enthalpy compensation for binding lipids of variable chain length. Additionally, using a mutant form of AmtB that abolishes a specific phosphatidylglycerol (PG) binding site, we observed distinct changes in the thermodynamic signatures for binding PG, implying these signatures can identify key residues involved in specific lipid binding and potentially differentiate between specific lipid binding sites.

  9. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  10. Formation of IgE-binding factors by human T-cell hybridomas.

    OpenAIRE

    Huff, T F; Ishizaka, K

    1984-01-01

    Normal human T cells that proliferated in the presence of interleukin 2 (IL-2) formed IgE-binding factors when incubated with human IgE. These cells were then fused with a mutant of the human T-cell line CEM. Incubation of five hybridomas with human IgE or culture of the cells in IgE-coated wells resulted in the formation of IgE-binding factors. One hour of incubation with 10 micrograms of human IgE per ml was sufficient to induce the hybridomas to form IgE-binding factors. Polymerized IgE wa...

  11. Design and creation of a Ca2+ binding site in human lysozyme to enhance structural stability.

    OpenAIRE

    Kuroki, R; Taniyama, Y; Seko, C; Nakamura, H; Kikuchi, M; Ikehara, M

    1989-01-01

    A Ca2+ binding site like an EF-hand motif was designed and created in human lysozyme by replacing both Gln-86 and Ala-92 with aspartic acids by site-directed mutagenesis. The mutant human lysozyme (D86/92-lysozyme) was expressed and secreted by yeast. One Ca2+ was found to bind one molecule of the purified protein with the binding constant 5.0 x 10(6) M-1. The enzymatic activity of holo-D86/92-lysozyme against glycol chitin at 40 degrees C was 2-fold higher than that of the native lysozyme. M...

  12. Photosynthetic characterization of a rolled leaf mutant of rice ( Oryza ...

    African Journals Online (AJOL)

    A new rolling leaf rice mutant was identified which showed an apparently straighter longitudinal shape normal transverse rolling characters at all developing stages. The chlorophyll contents per fresh weight of this mutant leaves were lower than those of wild-type. The electron transfer rate (ETR) and photochemical ...

  13. Complementation of sweet corn mutants: a method for grouping ...

    Indian Academy of Sciences (India)

    Maize endosperm mutant genes that affect quality of sweet corn can be grouped in two classes. One group of mutants namely brittle1 (bt1), brittle2 (bt2) and shrunken2 (sh2) .... significant influence on yield improvement, efficient test- ing of hybrids, and increasing the probability of identify- ing desirable hybrids (Tracy 1990).

  14. Screening of in vitro derived mutants of banana against nematodes ...

    African Journals Online (AJOL)

    The rest of the mutants namely Ro Im V4 6-1-2 and Si Im V4 6-2-5 were found to be susceptible to nematodes. The resistant and moderately resistant mutants of banana could be further used in breeding programmes as well as being recognized as potential cultivars of commerce. Key words: Banana, nematode, resistance, ...

  15. Isolation and characterization of stable mutants of Streptomyces ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Daunorubicin and its derivative doxorubicin are antitumour anthracycline antibiotics produced by Streptomyces peucetius. In this study we report isolation of stable mutants of S. peucetius blocked in different steps of the daunorubicin biosynthesis pathway. Mutants were screened on the basis of colony ...

  16. Development of Database Software with Plant Mutant Resources

    International Nuclear Information System (INIS)

    Namgoong, Won; Lee, M. J.; Kim, J. D.; Ma, N. K.

    2007-03-01

    In this research, mutants induced by nuclear radiation are developed information computerised system. The status and progress on the collection, identification and utilization of mutants in Korea are introduced. And it was produced home page, manual, test record, construction of system

  17. Lifespan and Glucose Metabolism in Insulin Receptor Mutant Mice

    Directory of Open Access Journals (Sweden)

    Takahiko Shimizu

    2011-01-01

    Full Text Available Insulin/insulin-like growth factor type 1 signaling regulates lifespan and resistance to oxidative stress in worms, flies, and mammals. In a previous study, we revealed that insulin receptor (IR mutant mice, which carry a homologous mutation found in the long-lived daf-2 mutant of Caenorhabditis elegans, showed enhanced resistance to oxidative stress cooperatively modulated by sex hormones and dietary signals (Baba et al., (2005. We herein investigated the lifespan of IR mutant mice to evaluate the biological significance of insulin signaling in mice. Under normoxia, mutant male mice had a lifespan comparable to that of wild-type male mice. IR mutant female mice also showed a lifespan similar to that of wild-type female mice, in spite of the fact that the IR mutant female mice acquired more resistance to oxidative stress than IR mutant male mice. On the other hand, IR mutant male and female mice both showed insulin resistance with hyperinsulinemia, but they did not develop hyperglycemia throughout their entire lifespan. These data indicate that the IR mutation does not impact the lifespan in mice, thus suggesting that insulin signaling might have a limited effect on the lifespan of mice.

  18. Sorghum Brown Midrib Mutants, Tools to Improve Biomass for Biofuels

    Science.gov (United States)

    To improve sorghum for cellulosic bioenergy uses, brown midrib mutants are being investigated for their ability to increase the conversion efficiency of biomass. brown midrib 6 and 12 (bmr6 and 12) mutants affect monolignol biosynthesis resulting in reduced lignin content and altered lignin composi...

  19. Unfolding intermediates of the mutant His-107-Tyr of human ...

    Indian Academy of Sciences (India)

    Srabani Taraphder

    Abstract. The mutant His-107-Tyr of human carbonic anhydrase II (HCA II) is highly unstable and has long been linked to a misfolding disease known as carbonic anhydrase deficiency syndrome (CADS). High temperature unfolding trajectories of the mutant are obtained from classical molecular dynamics simulations.

  20. Vaccines to Breast Cancer Based on p53 Mutants

    National Research Council Canada - National Science Library

    Ertl, Hildegund

    1997-01-01

    The aim of this proposal is to test vaccines expressing mouse mutant or wild-type p53 for induction of protective immunity against challenge with tumor cell lines expressing either mutant or high levels of wild-type p53...

  1. Characterization of human glucocerebrosidase from different mutant alleles

    NARCIS (Netherlands)

    Ohashi, T.; Hong, C. M.; Weiler, S.; Tomich, J. M.; Aerts, J. M.; Tager, J. M.; Barranger, J. A.

    1991-01-01

    Human cDNA was mutagenized to duplicate six naturally occurring mutations in the gene for glucocere-brosidase. The mutant genes were expressed in NIH 3T3 cells. The abnormal human enzymes were purified by immunoaffinity chromatography and characterized. The Asn370----Ser mutant protein differed from

  2. Mutants of Pseudomonas putida affected in poly-3-hydroxyalkanoate synthesis

    NARCIS (Netherlands)

    Ren, Q; Kessler, B; van der Leij, F; Witholt, B.

    The generation and characterization of Pseudomonas putida KT2442 mutants affected in poly-3-hydroxyalkanoate (PHA) synthesis are reported. The mutants from P. putida KT2442 carrying several copies of the PHA-polymerase-encoding gene (phaC) were isolated via N-methyl-N'-nitro-N-nitrosoguanidine

  3. Viral Escape Mutant Epitope Maintains TCR Affinity for Antigen yet Curtails CD8 T Cell Responses.

    Directory of Open Access Journals (Sweden)

    Shayla K Shorter

    Full Text Available T cells have the remarkable ability to recognize antigen with great specificity and in turn mount an appropriate and robust immune response. Critical to this process is the initial T cell antigen recognition and subsequent signal transduction events. This antigen recognition can be modulated at the site of TCR interaction with peptide:major histocompatibility (pMHC or peptide interaction with the MHC molecule. Both events could have a range of effects on T cell fate. Though responses to antigens that bind sub-optimally to TCR, known as altered peptide ligands (APL, have been studied extensively, the impact of disrupting antigen binding to MHC has been highlighted to a lesser extent and is usually considered to result in complete loss of epitope recognition. Here we present a model of viral evasion from CD8 T cell immuno-surveillance by a lymphocytic choriomeningitis virus (LCMV escape mutant with an epitope for which TCR affinity for pMHC remains high but where the antigenic peptide binds sub optimally to MHC. Despite high TCR affinity for variant epitope, levels of interferon regulatory factor-4 (IRF4 are not sustained in response to the variant indicating differences in perceived TCR signal strength. The CD8+ T cell response to the variant epitope is characterized by early proliferation and up-regulation of activation markers. Interestingly, this response is not maintained and is characterized by a lack in IL-2 and IFNγ production, increased apoptosis and an abrogated glycolytic response. We show that disrupting the stability of peptide in MHC can effectively disrupt TCR signal strength despite unchanged affinity for TCR and can significantly impact the CD8+ T cell response to a viral escape mutant.

  4. Development of inducible systems to engineer conditional mutants of essential genes of Helicobacter pylori.

    Science.gov (United States)

    Boneca, Ivo G; Ecobichon, Chantal; Chaput, Catherine; Mathieu, Aurélie; Guadagnini, Stéphanie; Prévost, Marie-Christine; Colland, Frédéric; Labigne, Agnès; de Reuse, Hilde

    2008-04-01

    The Escherichia coli-Helicobacter pylori shuttle vector pHeL2 was modified to introduce the inducible LacI(q)-pTac system of E. coli, in which the promoters were engineered to be under the control of H. pylori RNA polymerase. The amiE gene promoter of H. pylori was taken to constitutively express the LacI(q) repressor. Expression of the reporter gene lacZ was driven by either pTac (pILL2150) or a modified version of the ureI gene promoter in which one or two LacI-binding sites and/or mutated nucleotides between the ribosomal binding site and the ATG start codon (pILL2153 and pILL2157) were introduced. Promoter activity was evaluated by measuring beta-galactosidase activity. pILL2150 is a tightly regulated expression system suitable for the analysis of genes with low-level expression, while pILL2157 is well adapted for the controlled expression of genes encoding recombinant proteins in H. pylori. To exemplify the usefulness of these tools, we constructed conditional mutants of the putative essential pbp1 and ftsI genes encoding penicillin-binding proteins 1 and 3 of H. pylori, respectively. Both genes were cloned into pILL2150 and introduced in the parental H. pylori strain N6. The chromosomally harbored pbp1 and ftsI genes were then inactivated by replacing them with a nonpolar kanamycin cassette. Inactivation was strictly dependent upon addition of isopropyl-beta-d-thiogalactopyranoside. Hence, we were able to construct the first conditional mutants of H. pylori. Finally, we demonstrated that following in vitro methylation of the recombinant plasmids, these could be introduced into a large variety of H. pylori isolates with different genetic backgrounds.

  5. Effects of mutagenesis of aspartic acid residues in the putative phosphoribosyl diphosphate binding site of Escherichia coli phosphoribosyl diphosphate synthetase on metal ion specificity and ribose-5-phosphate binding

    DEFF Research Database (Denmark)

    Willemoës, Martin; Nilsson, Dan; Hove-Jensen, Bjarne

    1996-01-01

    The three conserved aspartic acid residues of the 5-phospho-d-ribosyl a-1-diphosphate binding site (213-GRDCVLVDDMIDTGGT-228) of Escherichia coli phosphoribosyl diphosphate synthetase were studied by analysis of the mutant enzymes D220E, D220F, D221A, D224A, and D224S. The mutant enzymes showed...... enzymes were dependent on the metal ion present, suggesting a function of the investigated aspartic acid residues both in the binding of ribose 5-phosphate, possibly via a divalent metal ion, and in the interaction with a divalent metal ion during catalysis....

  6. Inactive enzymatic mutant proteins (phosphoglycerate mutase and enolase as sugar binders for ribulose-1,5-bisphosphate regeneration reactors

    Directory of Open Access Journals (Sweden)

    Giri Ashok

    2005-02-01

    Full Text Available Abstract Background Carbon dioxide fixation bioprocess in reactors necessitates recycling of D-ribulose1,5-bisphosphate (RuBP for continuous operation. A radically new close loop of RuBP regenerating reactor design has been proposed that will harbor enzyme-complexes instead of purified enzymes. These reactors will need binders enabling selective capture and release of sugar and intermediate metabolites enabling specific conversions during regeneration. In the current manuscript we describe properties of proteins that will act as potential binders in RuBP regeneration reactors. Results We demonstrate specific binding of 3-phosphoglycerate (3PGA and 3-phosphoglyceraldehyde (3PGAL from sugar mixtures by inactive mutant of yeast enzymes phosphoglycerate mutase and enolase. The reversibility in binding with respect to pH and EDTA has also been shown. No chemical conversion of incubated sugars or sugar intermediate metabolites were found by the inactive enzymatic proteins. The dissociation constants for sugar metabolites are in the micromolar range, both proteins showed lower dissociation constant (Kd for 3-phosphoglycerate (655–796 μM compared to 3-phosphoglyceraldehyde (822–966 μM indicating higher affinity for 3PGA. The proteins did not show binding to glucose, sucrose or fructose within the sensitivity limits of detection. Phosphoglycerate mutase showed slightly lower stability on repeated use than enolase mutants. Conclusions The sugar and their intermediate metabolite binders may have a useful role in RuBP regeneration reactors. The reversibility of binding with respect to changes in physicochemical factors and stability when subjected to repeated changes in these conditions are expected to make the mutant proteins candidates for in-situ removal of sugar intermediate metabolites for forward driving of specific reactions in enzyme-complex reactors.

  7. Characteristics of mutant lines of sweet potato flour

    International Nuclear Information System (INIS)

    Aryanti

    2012-01-01

    Research on mutation induction of sweet potato Sari variety has been conducted. Flour mutant lines were obtained from selection of M1V5 tubers irradiated by gamma rays at the dose of 10 Gy. Flour was made by peeling of tubers, then dried, blended and sieved. The quality test of flour have been done by measuring degree of whiteness, proximate, amylose contents, water content, soluble water, swelling power, and flour characteristics. The result of this work showed that flour of C6.26.13 mutant line had higher protein content than the parent plant with concentration of 3.62 % and its amylose content was also higher than the other mutant lines. The soluble water value of mutant lines were significant different compared to the parent plant from 1.82 to 2.25 % and swelling power from 4.28 to 5.55 %. The flour granule of the mutant line was different compared to the parent plant. (author)

  8. Misfolded opsin mutants display elevated β-sheet structure.

    Science.gov (United States)

    Miller, Lisa M; Gragg, Megan; Kim, Tae Gyun; Park, Paul S-H

    2015-10-07

    Mutations in rhodopsin can cause misfolding and aggregation of the receptor, which leads to retinitis pigmentosa, a progressive retinal degenerative disease. The structure adopted by misfolded opsin mutants and the associated cell toxicity is poorly understood. Förster resonance energy transfer (FRET) and Fourier transform infrared (FTIR) microspectroscopy were utilized to probe within cells the structures formed by G188R and P23H opsins, which are misfolding mutants that cause autosomal dominant retinitis pigmentosa. Both mutants formed aggregates in the endoplasmic reticulum and exhibited altered secondary structure with elevated β-sheet and reduced α-helical content. The newly formed β-sheet structure may facilitate the aggregation of misfolded opsin mutants. The effects observed for the mutants were unrelated to retention of opsin molecules in the endoplasmic reticulum itself. Copyright © 2015 Federation of European Biochemical Societies. All rights reserved.

  9. Photosynthetic and nitrogen fixation capability in several soybean mutant lines

    International Nuclear Information System (INIS)

    Gandanegara, S.; Hendratno, K.

    1987-01-01

    Photosynthetic and nitrogen fixation capability in several soybean mutant lines. A greenhouse experiment has been carried out to study photosynthetic and nitrogen fixation capability of five mutant lines and two soybean varieties. An amount of 330 uCi of 14 CO 2 was fed to the plants including of the non-fixing reference crop (Chippewa non-nodulating isoline). Nitrogen fixation measurements was carried out using 15 N isotope dilution technique according to A-value concept. Results showed that beside variety/mutant lines, plant growth also has important role in photosynthetic and N fixing capability. Better growth and a higher photosynthetic capability in Orba, mutant lines nos. 63 and 65 resulted in a greater amount of N 2 fixed (mg N/plant) than other mutant lines. (author). 12 refs.; 5 figs

  10. Induction and characterization of Arabidopsis mutants by Ion beam

    International Nuclear Information System (INIS)

    Yoon, Y. H.; Choi, J. D.; Park, J. Y.; Lee, J. R.; Sohn, H. S.

    2008-03-01

    This study was conducted to search the proper conditions and times for irradiating proton beam to seeds generally used for induction of mutant. Arabidopsis as model plants has good characters that is a short generation time, producing a lot of seeds, sequenced genome, developed maker. This points were the best materials for plant breeding for this study. The data of inducing mutants of Arabidopsis is used to be applicate to crops have more longer generation that is the final goals of this study. The goals of this project were to inducing and characterizing arabidopsis mutants by the proton ion beam and γ-ray. As well as, the purpose of this study was securing more than 10 lines of arabidopsis mutants in this project and also to know the changed DNA structure of the mutants using the basic data for applying to the more study

  11. The agronomic characters of a high protein rice mutant

    International Nuclear Information System (INIS)

    Harn, C.; Won, J.L.; Choi, K.T.

    1975-01-01

    Mutant lines (M 5 -M 9 ) of macro-phenotypic traits from several varieties were screened for the protein content. Mutant 398 (M 9 ) is one of the high protein mutants selected from Hokwang. Three years' tests revealed that it has a high protein line under any condition of cultivation. Except for early maturity and short culmness, other agronomic and yield characters were similar to the original variety. There was no difference between the mutant 398 and its mother variety in grain shape and weight, and also the size and protein content of the embryo. The high protein content of the mutant is attributable to the increase of protein in the endosperm. About 150 normal-looking or a few days-earlier-maturing selections were made from Jinheung variety in the M 3 and screened for protein. Promising lines in terms of the plant type, yield and protein were obtained. (author)

  12. Functional characterization of recombinant snake venom rhodocytin: rhodocytin mutant blocks CLEC-2/podoplanin-dependent platelet aggregation and lung metastasis.

    Science.gov (United States)

    Sasaki, T; Shirai, T; Tsukiji, N; Otake, S; Tamura, S; Ichikawa, J; Osada, M; Satoh, K; Ozaki, Y; Suzuki-Inoue, K

    2018-02-28

    Essentials We generated recombinant rhodocytin that could aggregate platelets via CLEC-2. Recombinant wild-type rhodocytin formed heterooctamer with four α- and β-subunits. Asp 4 in α-subunit of rhodocytin was required for binding to CLEC-2. Inhibitory mutant of rhodocytin blocked podoplanin-dependent hematogenous metastasis. Background Rhodocytin, a disulfide-linked heterodimeric C-type lectin from Calloselasma rhodostoma consisting of α-subunits and β-subunits, induces platelet aggregation through C-type lectin-like receptor 2 (CLEC-2). CLEC-2 is a physiological binding partner of podoplanin (PDPN), which is expressed on some tumor cell types, and is involved in tumor cell-induced platelet aggregation and tumor metastasis. Thus, modified rhodocytin may be a possible source of anti-CLEC-2 drugs for both antiplatelet and antimetastasis therapy. However, its molecular function has not been well characterized, because of the lack of recombinant rhodocytin that induces platelet aggregation. Objective To produce recombinant rhodocytin, in order to verify its function with mutagenesis, and to develop an anti-CLEC-2 drug based on the findings. Methods We used Chinese hamster ovary cells to express recombinant rhodocytin (wild-type [WT] and mutant), which was analyzed for induction/inhibition of platelet aggregation with light transmission aggregometry, the formation of multimers with blue native PAGE, and binding to CLEC-2 with flow cytometry. Finally, we investigated whether mutant rhodocytin could suppress PDPN-induced metastasis in an experimental lung metastasis mouse model. Results Functional WT] rhodocytin (αWTβWT) was obtained by coexpression of both subunits. Asp4 in α-subunits of rhodocytin was required for CLEC-2 binding. αWTβWT formed a heterooctamer similarly to native rhodocytin. Moreover, an inhibitory mutant of rhodocytin (αWTβK53A/R56A), forming a heterotetramer, bound to CLEC-2 without inducing platelet aggregation, and blocked CLEC-2-PDPN

  13. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

    Science.gov (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

    2017-07-05

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  14. Radiation induced mutants in cassava (Manihot esculenta Crantz)

    International Nuclear Information System (INIS)

    Nayar, G.G.; Rajendran, P.G.

    1987-01-01

    Full text: Stem cuttings and true seeds of three promising cultivars of cassava were exposed respectively to 1 to 5 kR and 10 to 50 kR acute gamma rays from a 60 Co source. Treatments of stem cuttings beyond 5 kR and seeds beyond 50 kR were lethal. One mutant each in the cultivars M4, H-165 and H-2304 was obtained from the stem irradiated populations. Another mutant was found in the seed irradiated progeny of H-2304. The mutant of M4 is characterised by light green (chlorina) leaves. The mutant of H-165 shows significantly shorter petiole (22,5 against 35.2 cm) and narrow leaf lobes, while the H-2304 mutant shows speckled leaves, branching and early flowering. The mutant found in the seed irradiated progeny of H-2304 is having yellow tuber flesh indicating the presence of carotene. The mutants may be useful in studies related to basic information as well as in practical breeding. The chlorina mutant in M4 showed slow growth and high HCN content in leaves. Late branching may be a useful trait in the traditionally non-branching clones of cassava to maintain the desirable leaf area index during high leaf fall period. Early flowering could be useful in a recombinant breeding programme. The tuber yield of the short petiole mutant in H-165 increased by 20% - 25% through closer planting. The narrow leaf lobes of this mutant permit better light penetration to lower leaves. (author)

  15. Functional roles of mannose-binding protein in the adhesion, cytotoxicity and phagocytosis of Acanthamoeba castellanii.

    Science.gov (United States)

    Kim, Jong-Hyun; Matin, Abdul; Shin, Ho-Joon; Park, Hyun; Yoo, Kyung-Tae; Yuan, Xi-Zhe; Kim, Kwang Sik; Jung, Suk-Yul

    2012-10-01

    Acanthamoeba castellanii is a single-celled protozoan that is widely distributed in the environment and is a well-known of causing human keratitis, a vision-threatening infection. In this study, an ethyl methane sulfonate (EMS) and a selection of saccharide were applied to A. castellanii by chemical mutagenesis. To understand the functional roles of a mannose-binding protein (MBP). A. castellanii were treated with methyl-alpha-D-mannopyranoside abbreviated Man, with and without the EMS pre-treatment, and their adhesion and cytotoxicity were analyzed, using a human brain microvascular endothelial cell (HBMEC) as the target cell. Both EMS and Man mutants exhibited significantly decreased levels of MBP expression and cytotoxicity to HBMEC, but showed similar levels of binding to HBMEC, as compared with the wild type. Of interest was that the exogenous mannose inhibited amoebae (i.e., Man mutant) binding to the HBMEC by castellanii. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma.

    Science.gov (United States)

    Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B; Wu, Chia-Chin; Akdemir, Kadir C; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T; Welch, Heidi C E; Garraway, Levi A; Chin, Lynda

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2(E824)*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57(KIP2)). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  17. Sequence requirements of the HIV-1 protease flap region determined by saturation mutagenesis and kinetic analysis of flap mutants

    Science.gov (United States)

    Shao, Wei; Everitt, Lorraine; Manchester, Marianne; Loeb, Daniel D.; Hutchison, Clyde A.; Swanstrom, Ronald

    1997-01-01

    The retroviral proteases (PRs) have a structural feature called the flap, which consists of a short antiparallel β-sheet with a turn. The flap extends over the substrate binding cleft and must be flexible to allow entry and exit of the polypeptide substrates and products. We analyzed the sequence requirements of the amino acids within the flap region (positions 46–56) of the HIV-1 PR. The phenotypes of 131 substitution mutants were determined using a bacterial expression system. Four of the mutant PRs with mutations in different regions of the flap were selected for kinetic analysis. Our phenotypic analysis, considered in the context of published structures of the HIV-1 PR with a bound substrate analogs, shows that: (i) Met-46 and Phe-53 participate in hydrophobic interactions on the solvent-exposed face of the flap; (ii) Ile-47, Ile-54, and Val-56 participate in hydrophobic interactions on the inner face of the flap; (iii) Ile-50 has hydrophobic interactions at the distance of both the δ and γ carbons; (iv) the three glycine residues in the β-turn of the flap are virtually intolerant of substitutions. Among these mutant PRs, we have identified changes in both kcat and Km. These results establish the nature of the side chain requirements at each position in the flap and document a role for the flap in both substrate binding and catalysis. PMID:9122179

  18. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma

    KAUST Repository

    Lissanu Deribe, Yonathan

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  19. RH421 binds into the ATP-binding site on the Na+/K+-ATPase.

    Science.gov (United States)

    Huličiak, Miroslav; Bazgier, Václav; Berka, Karel; Kubala, Martin

    2017-10-01

    The Na + /K + -ATPase plays a key role in ion transport across the plasma membrane of all animal cells. The voltage-sensitive styrylpyrimidium dye RH421 has been used in several laboratories for monitoring of Na + /K + -ATPase kinetics. It is known, that RH421 can interact with the enzyme and it can influence its activity at micromolar concentrations, but structural details of this interaction are only poorly understood. Experiments with isolated large cytoplasmic loop (C45) of Na + /K + -ATPase revealed that RH421 can interact with this part of the protein with dissociation constant 1μM. The Trp-to-RH421 FRET performed on six single-tryptophan mutants revealed that RH421 binds directly into the ATP-binding site. This conclusion was further supported by results from molecular docking, site-directed mutagenesis and by competitive experiments using ATP. Experiments with C45/DPPC mixture revealed that RH421 can bind to both C45 and lipids, but only the former interaction was influenced by the presence of ATP. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Gas phase noncovalent protein complexes that retain solution binding properties: Binding of xylobiose inhibitors to the beta-1, 4 exoglucanase from cellulomonas fimi.

    Science.gov (United States)

    Tesić, Milica; Wicki, Jacqueline; Poon, David K Y; Withers, Stephen G; Douglas, Donald J

    2007-01-01

    Tandem mass spectrometry has been used to compare gas-phase and solution binding of three small-molecule inhibitors to the wild type and three mutant forms of the catalytic domain of Cex, an enzyme that hydrolyses xylan and xylo-oligosaccharides. The inhibitors, xylobiosyl-deoxynojirimycin, xylobiosyl-isofagomine lactam, and xylobiosyl-isofagomine consist of a common distal xylose linked to different proximal aza-sugars. The three mutant forms of the enzyme contain the substitutions Asn44Ala, Gln87Met, and Gln87Tyr that alter the binding interactions between Cex and the distal sugar of each inhibitor. An electrospray ionization (ESI) triple quadrupole MS/MS system is used to measure the internal energies, DeltaE(int), that must be added to gas-phase ions to cause dissociation of the noncovalent enzyme-inhibitor complexes. Collision cross sections of ions of the apo-enzyme and enzyme-inhibitor complexes, which are required for the calculations of DeltaE(int), have also been measured. The results show that, in the gas phase, enzyme-inhibitor complexes have more compact, folded conformations than the corresponding apo-enzyme ions. With the mutant enzymes, the effects of substituting a single residue can be detected. The energies required to dissociate the gas-phase complexes follow the same trend as the values of DeltaG0 for dissociation of the complexes in solution. This trend is observed both with different inhibitors, which probe binding to the proximal sugar, and with mutants of Cex, which probe binding to the distal sugar. Thus the gas-phase complexes appear to retain much of their solution binding characteristics.

  1. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature. The grids were subsequently .... and inhibition by GAGs and DMA were determined on polystyrene wells of microtitre plates (Costar, ... for binding inhibition assays was carried out by mixing equal volumes of the conjugate and the inhibitor at ...

  2. Quarkeosynthesis Binding Energy

    Science.gov (United States)

    Webb, Bill

    2009-05-01

    Quarkeosynthesis shows that the binding energy of a nucleus is the difference between the relativistic kinetic energies of its threesome of Jumbo Quarks and that of its building block quarks from neutrons and protons. There is no involvement of a nuclear strong force or gluon material.

  3. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  4. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    of HA in a concentration-dependent manner, suggesting its multiligand affinity amongst carbohydrates. rHABP1 shows differential affinity ... site is seen to correspond to the carbohydrate-binding site in E-selectin, which has similarity in the ... adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature.

  5. Radiation-modified structure of Ge25Sb15S60 and Ge35Sb5S60 glasses

    Science.gov (United States)

    Kavetskyy, T.; Shpotyuk, O.; Kaban, I.; Hoyer, W.

    2008-06-01

    Atomic structures of Ge25Sb15S60 and Ge35Sb5S60 glasses are investigated in the γ-irradiated and annealed after γ-irradiation states by means of high-energy synchrotron x-ray diffraction technique. The first sharp diffraction peak (FSDP) is detected at around 1.1 A˚-1 in the structure factors of both alloys studied. The FSDP position is found to be stable for radiation/annealing treatment of the samples, while the FSDP intensity shows some changes between γ-irradiated and annealed states. The peaks in the pair distribution functions observed between 2 and 4 A˚ are related to the Ge-S, Ge-Sb, and Sb-Sb first neighbor correlations and Ge-Ge second neighbor correlations in the edge-shared GeS4/2 tetrahedra, and S-S and/or Ge-Ge second neighbor correlations in the corner-shared GeS4/2 tetrahedra. Three mechanisms of the radiation-/annealing-induced changes are discussed in the framework of coordination topological defect formation and bond-free solid angle concepts.

  6. Expression of ALS-linked TDP-43 mutant in astrocytes causes non-cell-autonomous motor neuron death in rats

    Science.gov (United States)

    Tong, Jianbin; Huang, Cao; Bi, Fangfang; Wu, Qinxue; Huang, Bo; Liu, Xionghao; Li, Fang; Zhou, Hongxia; Xia, Xu-Gang

    2013-01-01

    Mutation of Tar DNA-binding protein 43 (TDP-43) is linked to amyotrophic lateral sclerosis. Although astrocytes have important roles in neuron function and survival, their potential contribution to TDP-43 pathogenesis is unclear. Here, we created novel lines of transgenic rats that express a mutant form of human TDP-43 (M337V substitution) restricted to astrocytes. Selective expression of mutant TDP-43 in astrocytes caused a progressive loss of motor neurons and the denervation atrophy of skeletal muscles, resulting in progressive paralysis. The spinal cord of transgenic rats also exhibited a progressive depletion of the astroglial glutamate transporters GLT-1 and GLAST. Astrocytic expression of mutant TDP-43 led to activation of astrocytes and microglia, with an induction of the neurotoxic factor Lcn2 in reactive astrocytes that was independent of TDP-43 expression. These results indicate that mutant TDP-43 in astrocytes is sufficient to cause non-cell-autonomous death of motor neurons. This motor neuron death likely involves deficiency in neuroprotective genes and induction of neurotoxic genes in astrocytes. PMID:23714777

  7. Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck (Lepidoptera: Tortricidae.

    Directory of Open Access Journals (Sweden)

    Guangwei Li

    Full Text Available The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications.Two antennae-specific general OBPs (GOBPs of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2 for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1 exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition.Two rGmolGOBPs exhibit different binding characteristics for tested ligands. r

  8. Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae).

    Science.gov (United States)

    Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

    2016-01-01

    The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has

  9. Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae)

    Science.gov (United States)

    Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

    2016-01-01

    Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different

  10. Noncanonical DNA motifs as transactivation targets by wild type and mutant p53.

    Directory of Open Access Journals (Sweden)

    Jennifer J Jordan

    2008-06-01

    Full Text Available Sequence-specific binding by the human p53 master regulator is critical to its tumor suppressor activity in response to environmental stresses. p53 binds as a tetramer to two decameric half-sites separated by 0-13 nucleotides (nt, originally defined by the consensus RRRCWWGYYY (n = 0-13 RRRCWWGYYY. To better understand the role of sequence, organization, and level of p53 on transactivation at target response elements (REs by wild type (WT and mutant p53, we deconstructed the functional p53 canonical consensus sequence using budding yeast and human cell systems. Contrary to early reports on binding in vitro, small increases in distance between decamer half-sites greatly reduces p53 transactivation, as demonstrated for the natural TIGER RE. This was confirmed with human cell extracts using a newly developed, semi-in vitro microsphere binding assay. These results contrast with the synergistic increase in transactivation from a pair of weak, full-site REs in the MDM2 promoter that are separated by an evolutionary conserved 17 bp spacer. Surprisingly, there can be substantial transactivation at noncanonical (1/2-(a single decamer and (3/4-sites, some of which were originally classified as biologically relevant canonical consensus sequences including PIDD and Apaf-1. p53 family members p63 and p73 yielded similar results. Efficient transactivation from noncanonical elements requires tetrameric p53, and the presence of the carboxy terminal, non-specific DNA binding domain enhanced transactivation from noncanonical sequences. Our findings demonstrate that RE sequence, organization, and level of p53 can strongly impact p53-mediated transactivation, thereby changing the view of what constitutes a functional p53 target. Importantly, inclusion of (1/2- and (3/4-site REs greatly expands the p53 master regulatory network.

  11. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays.

    Science.gov (United States)

    Pinhal, Danillo; Yoshimura, Tatiana S; Araki, Carlos S; Martins, Cesar

    2011-05-31

    Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution.

  12. Radiative lifetime and Lande-factor measurements of the Se I 4p35S 5S2 level using pulsed laser spectroscopy

    International Nuclear Information System (INIS)

    Zerne, R.

    1992-01-01

    This diploma project consists of spectroscopic examinations of atomic selenium. Natural selenium was thermally dissociated in a quarts resonance cell keeping the background pressure of selenium molecules low by differential heating. The 4p 3 5S 5 S 2 level was excited by frequency-tripled pulsed dye-laser radiation at 207 nm. From time-resolved recording of the fluorescence decay at 216 nm the natural radiative lifetime of the 5 S 2 level was determined to be 493(15) ns. Quantum-beat and optical double resonance measurements in an external magnetic field yielded g j = 2.0004(10) for the Lande factor

  13. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way that....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  14. Implantación de la 5S y de la metodología de aprendizaje SACC en una empresa de embalaje

    OpenAIRE

    Rodríguez Almazán, Alejandro

    2015-01-01

    El presente proyecto trata sobre dos temas. El primero es la implantación de las 5S en una empresa de embalaje. El segundo, contribuir a la formación de esta metodología mediante el desarrollo de un seminario de aprendizaje SACC que aborde todos los aspectos necesarios para implantar las 5S. Para lograr la implantación necesitamos una visión general de las 5S y conocer los pasos previos para implantarla. Una vez hecho, el siguiente paso es evaluar el proceso de implantación. Con el seminar...

  15. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  16. Induced mutant for male sterility in niger

    International Nuclear Information System (INIS)

    Sujatha, M.

    2001-01-01

    Full text: Niger (Guizotia abyssinica Cass.), an important oilseed crop of the family Compositae is highly cross-pollinated due to the twin mechanisms of protandry and incompatibility. Studies revealed the functional nature of protandry and the breakdown of incompatibility with alteration in temperature. It has very small flowers (disc florets) arranged in a capitulum that open on 3-4 consecutive days which pose problems in emasculation for cross-breeding. To induce mutations, seeds of variety 'IGP-76' were irradiated with γ-rays 200 to 1000 Gy. All seeds of M 1 plants were sown separately in individual plant-to progeny rows. The results of screening of M 2 segregating material indicated that γ-ray treatment was effective in induction of male sterility. Frequency of visible mutations were higher in sibbed progeny as compared to open pollinated population and male sterile plants were observed only in sibbed population (1000 Gy). Male sterile plants could easily be identified at the flowering stage by their altered floral morphology (disc florets transformed into ligulate ray florets) and complete absence or presence of a rudimentary anther column. Seeds were collected following sib-mating with the fertile counterparts. Progeny segregated in a ration of 3 normal : 1 male sterile. Further work on the mechanism of sterility, maintenance and linkage relationships with associated characters is under progress. This is the first report of induction of male sterility in niger through the use of physical mutagens. The availability of this mutant will be of great value for exploitation of heterosis on commercial basis. (author)

  17. Genetics of Ustilago violacea. I. Carotenoid mutants and carotenogenesis

    International Nuclear Information System (INIS)

    Garber, E.D.; Baird, M.L.; Chapman, D.J.

    1975-01-01

    Wild-type strains of Ustilago violacea produce pink colonies on laboratory medium and yield white, orange, pumpkin, and yellow colonies after uv mutagenesis. The wild-type strains contain neurosporene and lycopene; one orange mutant, γ-carotene; and one yellow mutant, β-carotene. One white mutant had no detectable carotenoids. Diploid colonies heterozygous for wild type and orange, pumpkin, yellow, or white are phenotypically wild type. Diploid colonies heterozygous for yellow and orange are also phenotypically wild type. Diploid colonies heterozygous for white and orange; white and yellow; and white, yellow, and orange are phenotypically light orange, light yellow, and orange-yellow, respectively. The white mutants give a circular complementation map; the color mutants fit a linear complementation map. We propose a multienzyme of four identical dehydrogenases and one or two identical cyclases for carotenogenesis in this species. The white and color mutants represent structural mutations altering the conformation of the dehydrogenase or cyclase, respectively. Furthermore, cyclases may or may not aggregate in association with the dehydrogenase aggregate to form the multienzyme aggregate responsible for the color mutants

  18. Methods of producing protoporphyrin IX and bacterial mutants therefor

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming

    2016-03-01

    The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.

  19. Potential of sweet potato mutant lines for bio ethanol production

    International Nuclear Information System (INIS)

    Aryanti Amsal; Marina Yuniawati; Tri Muji Ermayanti; Ika Mulawati

    2011-01-01

    Shoots of sweet potato Sari variety were irradiated at the doses of 0, 10, 20, 30 and 40 Gy. Irradiated shoots were planted and selected to obtain better mutant lines than that of the parent plant. Ten mutant lines were from the fourth generation which better morphology and productivity than that of the parent plant. The best productivity was found at mutant line number 40-2 which was 717.50 g/plant compared to parent plant with 622.50 g/plant. The highest glucose and starch content obtained were at the dose of 20 Gy which were 8.85 and 28.56 % respectively. The mutant line of Sari sweet potato has a potential to produce bio ethanol. The bio-ethanol production from those of mutant lines at a range of 15.02 to 19.46 % compared to 13.67 % in the parent plant. The mutant line number 20 was the best line to produce bio-ethanol. The aim of this experiment was to find mutant lines having potential to produce bio-ethanol. (author)

  20. Enhanced Adsorption and Recovery of Uranyl Ions by NikR Mutant-Displaying Yeast

    Directory of Open Access Journals (Sweden)

    Kouichi Kuroda

    2014-04-01

    Full Text Available Uranium is one of the most important metal resources, and the technology for the recovery of uranyl ions (UO22+ from aqueous solutions is required to ensure a semi-permanent supply of uranium. The NikR protein is a Ni2+-dependent transcriptional repressor of the nickel-ion uptake system in Escherichia coli, but its mutant protein (NikRm is able to selectively bind uranyl ions in the interface of the two monomers. In this study, NikRm protein with ability to adsorb uranyl ions was displayed on the cell surface of Saccharomyces cerevisiae. To perform the binding of metal ions in the interface of the two monomers, two metal-binding domains (MBDs of NikRm were tandemly fused via linker peptides and displayed on the yeast cell surface by fusion with the cell wall-anchoring domain of yeast α-agglutinin. The NikRm-MBD-displaying yeast cells with particular linker lengths showed the enhanced adsorption of uranyl ions in comparison to the control strain. By treating cells with citrate buffer (pH 4.3, the uranyl ions adsorbed on the cell surface were recovered. Our results indicate that the adsorption system by yeast cells displaying tandemly fused MBDs of NikRm is effective for simple and concentrated recovery of uranyl ions, as well as adsorption of uranyl ions.

  1. Validating a two-dimensional bipolar spectrum model integrating DSM-5's mixed features specifier for Major Depressive Disorder.

    Science.gov (United States)

    Ferentinos, Panagiotis; Fountoulakis, Konstantinos N; Lewis, Cathryn M; Porichi, Evgenia; Dikeos, Dimitris; Papageorgiou, Charalambos; Douzenis, Athanassios

    2017-08-01

    The literature on DSM-5's 'Major Depressive Disorder with lifetime mixed features' (MDD-MF) is limited. This study investigated MDD-MF's potential inclusion into a bipolar spectrum. We recruited 287 patients with Bipolar I disorder (BD-I), BD-II, MDD-MF or 'MDD without lifetime mixed features' (MDD-noMF); most (N=280) were stabilized for at least one year on medication. Sixteen validators (clinical features, psychiatric family history, temperament, stabilizing treatment) were compared across groups and subjected to trend analyses. Two discriminant function analyses (DFA; primary and secondary), excluding or including, respectively, treatment-related predictors, explored latent dimensions maximizing between-group discrimination; mahalanobis distances between group 'centroids' were calculated. Eleven validators differed significantly across groups; nine varied monotonically along a bipolar diathesis gradient with significant linear trends; two peaked at MDD-MF and displayed significant quadratic trends. In the primary DFA, apart from a classic bipolarity dimension, correlating with hospitalizations, early age at onset, lifetime psychosis and lower anxious temperament scores, on which groups ranked along a bipolar propensity gradient, a second dimension was also significant, peaking at BD-II and MDD-MF (challenging the classic bipolar ranking), which correlated with lifetime psychiatric comorbidities, suicidality, lower lifetime psychosis rates, female gender, higher cyclothymic and lower depressive temperament scores; MDD-MF was equipoised amidst BD-II and MDD-noMF. After including treatment-related predictors (secondary DFA), discrimination improved overall but BD-II and MDD-MF were closest than any other pair, suggesting similar treatment patterns for these two groups at this naturalistic setting. To our knowledge, this is the first time a two-dimensional bipolar spectrum based on classic external validators is proposed, fitting the data better than a

  2. A Mutator Phenotype Promoting the Emergence of Spontaneous Oxidative Stress-Resistant Mutants in Campylobacter jejuni.

    Science.gov (United States)

    Dai, Lei; Sahin, Orhan; Tang, Yizhi; Zhang, Qijing

    2017-12-15

    Campylobacter jejuni is a leading cause of foodborne illnesses worldwide. As a microaerophilic organism, C. jejuni must be able to defend against oxidative stress encountered both in the host and in the environment. How Campylobacter utilizes a mutation-based mechanism for adaptation to oxidative stress is still unknown. Here we present a previously undescribed phenotypic and genetic mechanism that promotes the emergence of oxidative stress-resistant mutants. Specifically, we showed that a naturally occurring mutator phenotype, resulting from a loss of function mutation in the DNA repair enzyme MutY, increased oxidative stress resistance (OX R ) in C. jejuni We further demonstrated that MutY malfunction did not directly contribute to the OX R phenotype but increased the spontaneous mutation rate in the peroxide regulator gene perR , which functions as a repressor for multiple genes involved in oxidative stress resistance. Mutations in PerR resulted in loss of its DNA binding function and derepression of PerR-controlled oxidative stress defense genes, thereby conferring an OX R phenotype and facilitating Campylobacter survival under oxidative stress. These findings reveal a new mechanism that promotes the emergence of spontaneous OX R mutants in bacterial organisms. IMPORTANCE Although a mutator phenotype has been shown to promote antibiotic resistance in many bacterial species, little is known about its contribution to the emergence of OX R mutants. This work describes the link between a mutator phenotype and the enhanced emergence of OX R mutants as well as its underlying mechanism involving DNA repair and mutations in PerR. Since DNA repair systems and PerR are well conserved in many bacterial species, especially in Gram positives, the same mechanism may operate in multiple bacterial species. Additionally, we developed a novel method that allows for rapid quantification of spontaneous OX R mutants in a bacterial population. This method represents a technical

  3. Both HMG boxes in Hmo1 are essential for DNA binding in vitro and in vivo.

    Science.gov (United States)

    Higashino, Ayako; Shiwa, Yuh; Yoshikawa, Hirofumi; Kokubo, Tetsuro; Kasahara, Koji

    2015-01-01

    Hmo1, a member of the high mobility group B family proteins in Saccharomyces cerevisiae, associates with the promoters of ribosomal protein genes (RPGs) to direct accurate transcriptional initiation. Here, to identify factors involved in the binding of Hmo1 to its targets and the mechanism of Hmo1-dependent transcriptional initiation, we developed a novel reporter system using the promoter of the RPG RPS5. A genetic screen did not identify any factors that influence Hmo1 binding, but did identify a number of mutations in Hmo1 that impair its DNA binding activity in vivo and in vitro. These results suggest that Hmo1 binds to its target promoters autonomously without any aid of additional factors. Furthermore, characterization of Hmo1 mutants showed that the box A domain plays a pivotal role in DNA binding and may be required for the recognition of structural properties of target promoters that occur in native chromatin.

  4. Grb2 is regulated by foxd3 and has roles in preventing accumulation and aggregation of mutant huntingtin.

    Directory of Open Access Journals (Sweden)

    Shounak Baksi

    Full Text Available Growth factor receptor protein binding protein 2 (Grb2 is known to be associated with intracellular growth and proliferation related signaling cascades. Huntingtin (Htt, a ubiquitously expressed protein, when mutated, forms toxic intracellular aggregates - the hallmark of Huntington's disease (HD. We observed an elevated expression of Grb2 in neuronal cells in animal and cell models of HD. Grb2 overexpression was predominantly regulated by the transcription factor Forkhead Box D3 (Foxd3. Exogenous expression of Grb2 also reduced aggregation of mutant Htt in Neuro2A cells. Grb2 is also known to interact with Htt, depending on epidermal growth factor receptor (EGFR activation. Grb2- mutant Htt interaction in the contrary, took place in vesicular structures, independent of EGFR activation that eventually merged with autophagosomes and activated the autophagy machinery helping in autophagosome and lysosome fusion. Grb2, with its emerging dual role, holds promise for a survival mechanism for HD.

  5. Characterization of a New Pink-Fruited Tomato Mutant Results in the Identification of a Null Allele of the SlMYB12 Transcription Factor.

    Science.gov (United States)

    Fernandez-Moreno, Josefina-Patricia; Tzfadia, Oren; Forment, Javier; Presa, Silvia; Rogachev, Ilana; Meir, Sagit; Orzaez, Diego; Aharoni, Aspah; Granell, Antonio

    2016-07-01

    The identification and characterization of new tomato (Solanum lycopersicum) mutants affected in fruit pigmentation and nutritional content can provide valuable insights into the underlying biology, as well as a source of new alleles for breeding programs. To date, all characterized pink-pigmented tomato fruit mutants appear to result from low SlMYB12 transcript levels in the fruit skin. Two new mutant lines displaying a pink fruit phenotype (pf1 and pf2) were characterized in this study. In the pf mutants, SlMYB12 transcripts accumulated to wild-type levels but exhibited the same truncation, which resulted in the absence of the essential MYB activation domain coding region. Allelism and complementation tests revealed that both pf mutants were allelic to the y locus and showed the same recessive null allele in homozygosis: Δy A set of molecular and metabolic effects, reminiscent of those observed in the Arabidopsis (Arabidopsis thaliana) myb11 myb12 myb111 triple mutant, were found in the tomato Δy mutants. To our knowledge, these have not been described previously, and our data support the idea of their being null mutants, in contrast to previously described transcriptional hypomorphic pink fruit lines. We detected a reduction in the expression of several flavonol glycosides and some associated glycosyl transferases. Transcriptome analysis further revealed that the effects of the pf mutations extended beyond the flavonoid pathway into the interface between primary and secondary metabolism. Finally, screening for Myb-binding sites in the candidate gene promoter sequences revealed that 141 of the 152 co-down-regulated genes may be direct targets of SlMYB12 regulation. © 2016 American Society of Plant Biologists. All Rights Reserved.

  6. Crucial Roles of Single Residues in Binding Affinity, Specificity, and Promiscuity in the Cellulosomal Cohesin-Dockerin Interface*

    Science.gov (United States)

    Slutzki, Michal; Reshef, Dan; Barak, Yoav; Haimovitz, Rachel; Rotem-Bamberger, Shahar; Lamed, Raphael; Bayer, Edward A.; Schueler-Furman, Ora

    2015-01-01

    Interactions between cohesin and dockerin modules play a crucial role in the assembly of multienzyme cellulosome complexes. Although intraspecies cohesin and dockerin modules bind in general with high affinity but indiscriminately, cross-species binding is rare. Here, we combined ELISA-based experiments with Rosetta-based computational design to evaluate the contribution of distinct residues at the Clostridium thermocellum cohesin-dockerin interface to binding affinity, specificity, and promiscuity. We found that single mutations can show distinct and significant effects on binding affinity and specificity. In particular, mutations at cohesin position Asn37 show dramatic variability in their effect on dockerin binding affinity and specificity: the N37A mutant binds promiscuously both to cognate (C. thermocellum) as well as to non-cognate Clostridium cellulolyticum dockerin. N37L in turn switches binding specificity: compared with the wild-type C. thermocellum cohesin, this mutant shows significantly increased preference for C. cellulolyticum dockerin combined with strongly reduced binding to its cognate C. thermocellum dockerin. The observation that a single mutation can overcome the naturally observed specificity barrier provides insights into the evolutionary dynamics of this system that allows rapid modulation of binding specificity within a high affinity background. PMID:25833947

  7. Fibrinogen binding sites P336 and Y338 of clumping factor A are crucial for Staphylococcus aureus virulence.

    Directory of Open Access Journals (Sweden)

    Elisabet Josefsson

    Full Text Available We have earlier shown that clumping factor A (ClfA, a fibrinogen binding surface protein of Staphylococcus aureus, is an important virulence factor in septic arthritis. When two amino acids in the ClfA molecule, P(336 and Y(338, were changed to serine and alanine, respectively, the fibrinogen binding property was lost. ClfAP(336Y(338 mutants have been constructed in two virulent S. aureus strains Newman and LS-1. The aim of this study was to analyze if these two amino acids which are vital for the fibrinogen binding of ClfA are of importance for the ability of S. aureus to generate disease. Septic arthritis or sepsis were induced in mice by intravenous inoculation of bacteria. The clfAP(336Y(338 mutant induced significantly less arthritis than the wild type strain, both with respect to severity and frequency. The mutant infected mice developed also a much milder systemic inflammation, measured as lower mortality, weight loss, bacterial growth in kidneys and lower IL-6 levels. The data were verified with a second mutant where clfAP(336 and Y(338 were changed to alanine and serine respectively. When sepsis was induced by a larger bacterial inoculum, the clfAP(336Y(338 mutants induced significantly less septic death. Importantly, immunization with the recombinant A domain of ClfAP(336SY(338A mutant but not with recombinant ClfA, protected against septic death. Our data strongly suggest that the fibrinogen binding activity of ClfA is crucial for the ability of S. aureus to provoke disease manifestations, and that the vaccine potential of recombinant ClfA is improved by removing its ability to bind fibrinogen.

  8. Replication modes of Maize streak virus mutants lacking RepA or the RepA-pRBR interaction motif.

    Science.gov (United States)

    Ruschhaupt, Moritz; Martin, Darren P; Lakay, Francisco; Bezuidenhout, Marion; Rybicki, Edward P; Jeske, Holger; Shepherd, Dionne N

    2013-08-01

    The plant-infecting mastreviruses (family Geminiviridae) express two distinct replication-initiator proteins, Rep and RepA. Although RepA is essential for systemic infectivity, little is known about its precise function. We therefore investigated its role in replication using 2D-gel electrophoresis to discriminate the replicative forms of Maize streak virus (MSV) mutants that either fail to express RepA (RepA(-)), or express RepA that is unable to bind the plant retinoblastoma related protein, pRBR. Whereas amounts of viral DNA were reduced in two pRBR-binding deficient RepA mutants, their repertoires of replicative forms changed only slightly. While a complete lack of RepA expression was also associated with reduced viral DNA titres, the only traces of replicative intermediates of RepA(-) viruses were those indicative of recombination-dependent replication. We conclude that in MSV, RepA, but not RepA-pRBR binding, is necessary for single-stranded DNA production and efficient rolling circle replication. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  10. A General and Simple Diastereoselective Reduction by L-Selectride: Efficient Synthesis of Protected (4S,5S)-Dihydroxy Amides

    OpenAIRE

    Yin; Ye; Yu; Liu

    2010-01-01

    A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  11. A General and Simple Diastereoselective Reduction by L-Selectride: Efficient Synthesis of Protected (4S,5S-Dihydroxy Amides

    Directory of Open Access Journals (Sweden)

    Bo Yin

    2010-04-01

    Full Text Available A general approach to (4S,5S-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl amides 10 based on a diastereoselective reduction of (5S,6RS-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  12. A general and simple diastereoselective reduction by L-Selectride: efficient synthesis of protected (4S,5S)-dihydroxy amides.

    Science.gov (United States)

    Yin, Bo; Ye, Dong-Nai; Yu, Kai-Hui; Liu, Liang-Xian

    2010-04-16

    A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 degrees C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  13. Identification of binding sites on protein targeting to glycogen for enzymes of glycogen metabolism.

    Science.gov (United States)

    Fong, N M; Jensen, T C; Shah, A S; Parekh, N N; Saltiel, A R; Brady, M J

    2000-11-10

    The activation of protein phosphastase-1 (PP1) by insulin plays a critical role in the regulation of glycogen metabolism. PTG is a PP1 glycogen-targeting protein, which also binds the PP1 substrates glycogen synthase, glycogen phosphorylase, and phosphorylase kinase (Printen, J. A., Brady, M. J., and Saltiel, A. R. (1997) Science 275, 1475-1478). Through a combination of deletion analysis and site-directed mutagenesis, the regions on PTG responsible for binding PP1 and its substrates have been delineated. Mutagenesis of Val-62 and Phe-64 in the highly conserved (K/R)VXF PP1-binding motif to alanine was sufficient to ablate PP1 binding to PTG. Phosphorylase kinase, glycogen synthase, and phosphorylase binding all mapped to the same C-terminal region of PTG. Mutagenesis of Asp-225 and Glu-228 to alanine completely blocked the interaction between PTG and these three enzymes, without affecting PP1 binding. Disruption of either PP1 or substrate binding to PTG blocked the stimulation of PP1 activity in vitro against phosphorylase, indicating that both binding sites may be important in PTG action. Transient overexpression of wild-type PTG in Chinese hamster ovary cells overexpressing the insulin receptor caused a 50-fold increase in glycogen levels. Expression of PTG mutants that do not bind PP1 had no effect on glycogen accumulation, indicating that PP1 targeting is essential for PTG function. Likewise, expression of the PTG mutants that do not bind PP1 substrates did not increase glycogen levels, indicating that PP1 targeting glycogen is not sufficient for the metabolic effects of PTG. These results cumulatively demonstrate that PTG serves as a molecular scaffold, allowing PP1 to recognize its substrates at the glycogen particle.

  14. Blocking antibodies induced by immunization with a hypoallergenic parvalbumin mutant reduce allergic symptoms in a mouse model of fish allergy.

    Science.gov (United States)

    Freidl, Raphaela; Gstoettner, Antonia; Baranyi, Ulrike; Swoboda, Ines; Stolz, Frank; Focke-Tejkl, Margarete; Wekerle, Thomas; van Ree, Ronald; Valenta, Rudolf; Linhart, Birgit

    2017-06-01

    Fish is a frequent elicitor of severe IgE-mediated allergic reactions. Beside avoidance, there is currently no allergen-specific therapy available. Hypoallergenic variants of the major fish allergen, parvalbumin, for specific immunotherapy based on mutation of the 2 calcium-binding sites have been developed. This study sought to establish a mouse model of fish allergy resembling human disease and to investigate whether mouse and rabbit IgG antibodies induced by immunization with a hypoallergenic mutant of the major carp allergen protect against allergic symptoms in sensitized mice. C3H/HeJ mice were sensitized with recombinant wildtype Cyp c 1 or carp extract by intragastric gavage. Antibody, cellular immune responses, and epitope specificity in sensitized mice were investigated by ELISA, rat basophil leukemia assay, T-cell proliferation experiments using recombinant wildtype Cyp c 1, and overlapping peptides spanning the Cyp c 1 sequence. Anti-hypoallergenic Cyp c 1 mutant mouse and rabbit sera were tested for their ability to inhibit IgE recognition of Cyp c 1, Cyp c 1-specific basophil degranulation, and Cyp c 1-induced allergic symptoms in the mouse model. A mouse model of fish allergy mimicking human disease regarding IgE epitope recognition and symptoms as close as possible was established. Administration of antisera generated in mice and rabbits by immunization with a hypoallergenic Cyp c 1 mutant inhibited IgE binding to Cyp c 1, Cyp c 1-induced basophil degranulation, and allergic symptoms caused by allergen challenge in sensitized mice. Antibodies induced by immunization with a hypoallergenic Cyp c 1 mutant protect against allergic reactions in a murine model of fish allergy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Selective metal binding to Cys-78 within endonuclease V causes an inhibition of catalytic activities without altering nontarget and target DNA binding

    International Nuclear Information System (INIS)

    Prince, M.A.; Friedman, B.; Gruskin, E.A.; Schrock, R.D. III; Lloyd, R.S.

    1991-01-01

    T4 endonuclease V is a pyrimidine dimer-specific DNA repair enzyme which has been previously shown not to require metal ions for either of its two catalytic activities or its DNA binding function. However, we have investigated whether the single cysteine within the enzyme was able to bind metal salts and influence the various activities of this repair enzyme. A series of metals (Hg2+, Ag+, Cu+) were shown to inactivate both endonuclease Vs pyrimidine dimer-specific DNA glycosylase activity and the subsequent apurinic nicking activity. The binding of metal to endonuclease V did not interfere with nontarget DNA scanning or pyrimidine dimer-specific binding. The Cys-78 codon within the endonuclease V gene was changed by oligonucleotide site-directed mutagenesis to Thr-78 and Ser-78 in order to determine whether the native cysteine was directly involved in the enzyme's DNA catalytic activities and whether the cysteine was primarily responsible for the metal binding. The mutant enzymes were able to confer enhanced ultraviolet light (UV) resistance to DNA repair-deficient Escherichia coli at levels equal to that conferred by the wild type enzyme. The C78T mutant enzyme was purified to homogeneity and shown to be catalytically active on pyrimidine dimer-containing DNA. The catalytic activities of the C78T mutant enzyme were demonstrated to be unaffected by the addition of Hg2+ or Ag+ at concentrations 1000-fold greater than that required to inhibit the wild type enzyme. These data suggest that the cysteine is not required for enzyme activity but that the binding of certain metals to that amino acid block DNA incision by either preventing a conformational change in the enzyme after it has bound to a pyrimidine dimer or sterically interfering with the active site residue's accessibility to the pyrimidine dimer

  16. Unique dielectric features of a ceramic-semiconductor nanocomposite MgNb2O6 + 0.25Zn0.5Cd0.5S

    Science.gov (United States)

    Pukazhselvan, D.; Selvaraj, Nivas Babu; Bdikin, Igor; Saravanan, R. Sakthi Sudar; Jakka, Suresh Kumar; Soares, M. J.; Fagg, Duncan Paul

    2017-12-01

    The present communication deals with the optical/dielectric characteristics of MgNb2O6 + 0.25Zn0.5Cd0.5S nanocomposite (10-30 nm) mixture. Zn0.5Cd0.5S (size ∼10 nm) was synthesized by microwave assisted solvo-thermal method. Monophase magnesium niobate (MN) nanoparticles (10-20 nm) were synthesized in a single step by mechanochemical treatment of MgO + Nb2O5 under dry N2 atmosphere. The nanocomposite, MgNb2O6 + 0.25Zn0.5Cd0.5S, was prepared by mechanical admixing of MgNb2O6 and Zn0.5Cd0.5S taken in 4:1 molar ratio. The photoluminescence study shows violet, yellow and orange-red emissions by the MgNb2O6 + 0.25Zn0.5Cd0.5S composite. The observed dielectric constant value (ε) for MgNb2O6 + 0.25Zn0.5Cd0.5S is only 4.7, which is ∼5 times smaller than the ε value of MgNb2O6 while a dielectric loss for the composite being closer to zero ensures promising commercial applications.

  17. New and easy strategy for cloning, expression, purification, and characterization of the 5S subunit of transcarboxylase from Propionibacterium f. shermanii.

    Science.gov (United States)

    Kumar Bhat, Rakesh; Berger, Stefan

    2007-01-01

    Methylmalonyl CoA-oxalacetate transcarboxylase (EC 2. 1. 3. 1) from Propionibacterium f. shermanii is a biotin dependent enzyme which transfers CO2 from methylmalonyl-CoA (MMCoA) to pyruvate via a carboxylated biotin group to form oxalacetate. It is composed of three subunits, the central cylindrical hexameric 12S subunit, the outer six dimeric 5S subunit, and the twelve 1.3S linkers. We here report the cloning, sequencing, expression, and purification of the 5S subunit. The gene was identified by matching the amino acid sequence with that of deposited in the NCBI database. For cloned 5S subunit sequence shows regions of high homology with that of pyruvate carboxylase and oxaloacetate decarboxylase. The gene encoding the 5S subunit was cloned into the pTXB1 vector. The expressed 5S subunit was purified to apparent homogeneity by a single step process by using Intein mediated protein ligation (IPL) method. The cloned 5S gene encodes a protein of 505 amino acids and of M(r) 55,700.

  18. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    International Nuclear Information System (INIS)

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A.

    2006-01-01

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection

  19. Arabidopsis CaM binding protein CBP60g contributes to MAMP-induced SA accumulation and is involved in disease resistance against Pseudomonas syringae.

    Directory of Open Access Journals (Sweden)

    Lin Wang

    2009-02-01

    Full Text Available Salicylic acid (SA-induced defense responses are important factors during effector triggered immunity and microbe-associated molecular pattern (MAMP-induced immunity in plants. This article presents evidence that a member of the Arabidopsis CBP60 gene family, CBP60g, contributes to MAMP-triggered SA accumulation. CBP60g is inducible by both pathogen and MAMP treatments. Pseudomonas syringae growth is enhanced in cbp60g mutants. Expression profiles of a cbp60g mutant after MAMP treatment are similar to those of sid2 and pad4, suggesting a defect in SA signaling. Accordingly, cbp60g mutants accumulate less SA when treated with the MAMP flg22 or a P. syringae hrcC strain that activates MAMP signaling. MAMP-induced production of reactive oxygen species and callose deposition are unaffected in cbp60g mutants. CBP60g is a calmodulin-binding protein with a calmodulin-binding domain located near the N-terminus. Calmodulin binding is dependent on Ca(2+. Mutations in CBP60g that abolish calmodulin binding prevent complementation of the SA production and bacterial growth defects of cbp60g mutants, indicating that calmodulin binding is essential for the function of CBP60g in defense signaling. These studies show that CBP60g constitutes a Ca(2+ link between MAMP recognition and SA accumulation that is important for resistance to P. syringae.

  20. Characterization of Glutamine-Requiring Mutants of Pseudomonas aeruginosa

    NARCIS (Netherlands)

    Janssen, Dick B.; Joosten, Han M.L.J.; Herst, Patricia M.; Drift, Chris van der

    1982-01-01

    Revertants were isolated from a glutamine-requiring mutant of Pseudomonas aeruginosa PAO. One strain showed thermosensitive glutamine requirement and formed thermolabile glutamine synthetase, suggesting the presence of a mutation in the structural gene for glutamine synthetase. The mutation