Directory of Open Access Journals (Sweden)
Elis P A Batista
Full Text Available Odour-baited technologies are increasingly considered for effective monitoring of mosquito populations and for the evaluation of vector control interventions. The BG-Malaria trap (BGM, which is an upside-down variant of the widely used BG-Sentinel trap (BGS, has been demonstrated to be effective to sample the Brazilian malaria vector, Anopheles darlingi. We evaluated the BGM as an improved method for sampling the African malaria vectors, Anopheles arabiensis. Experiments were conducted inside a large semi-field cage to compare trapping efficiencies of BGM and BGS traps, both baited with the synthetic attractant, Ifakara blend, supplemented with CO2. We then compared BGMs baited with either of four synthetic mosquito lures, Ifakara blend, Mbita blend, BG-lure or CO2, and an unbaited BGM. Lastly, we compared BGMs baited with the Ifakara blend dispensed via either nylon strips, BG cartridges (attractant-infused microcapsules encased in cylindrical plastic cartridge or BG sachets (attractant-infused microcapsules encased in plastic sachets. All tests were conducted between 6P.M. and 7A.M., with 200-600 laboratory-reared An. arabiensis released nightly in the test chamber. The median number of An. arabiensis caught by the BGM per night was 83, IQR:(73.5-97.75, demonstrating clear superiority over BGS (median catch = 32.5 (25.25-37.5. Compared to unbaited controls, BGMs baited with Mbita blend caught most mosquitoes (45 (29.5-70.25, followed by BGMs baited with CO2 (42.5 (27.5-64, Ifakara blend (31 (9.25-41.25 and BG lure (16 (4-22. BGM caught 51 (29.5-72.25 mosquitoes/night, when the attractants were dispensed using BG-Cartridges, compared to BG-Sachet (29.5 (24.75-40.5, and nylon strips (27 (19.25-38.25, in all cases being significantly superior to unbaited controls (p < 000.1. The findings demonstrate potential of the BGM as a sampling tool for African malaria vectors over the standard BGS trap. Its efficacy can be optimized by selecting
Comparison of lancing devices for self-monitoring of blood glucose regarding lancing pain.
Kocher, Serge; Tshiananga, J K Tshiang; Koubek, Richard
2009-09-01
Self-monitoring of blood glucose empowers diabetes patients to effectively control their blood glucose (BG) levels. A potential barrier to frequent BG controls is lancing pain, intrinsically linked to pricking the finger several times a day. In this study, we compared different state-of-the-art lancing devices from leading manufacturers regarding lancing pain, and we intended to identify lancing devices that are less painful. First, 165 subjects compared 6 different BG monitoring systems-consisting of a lancing device and a BG meter-at home for 36 days and at least 3 BG tests per day. Second, the subjects directly compared 6 different lancing devices-independent from a BG meter-in a laboratory setting. The test results were collected in questionnaires, and lancing pain was rated on a numerical rating scale. One hundred fifty-seven subjects were included in the analysis. Accu-Chek BG monitoring systems were significantly (p competitor BG monitoring systems and were rated by >50% of the subjects as "less painful" than competitor BG monitoring systems. Accu-Chek lancing devices were significantly (p competitor lancing devices and were rated by >60% of the subjects as "less painful" than competitor lancing devices. We found significant differences in lancing pain between lancing devices. Diabetes patients clearly preferred lancing devices that cause less lancing pain. In order to improve patient compliance with respect to an adequate glycemic control, the medical staff should preferentially prescribe lancing devices that cause less lancing pain. 2009 Diabetes Technology Society.
McGarraugh, Geoffrey; Bergenstal, Richard
2009-03-01
The objective of the analysis was to compare detection of hypoglycemic episodes (glucose 15 min) with the FreeStyle Navigator Continuous Glucose Monitoring System (FSN-CGM) (Abbott Diabetes Care, Alameda, CA) alarms to detection with traditional finger stick testing at an average frequency of eight tests per day. The performance of FSN-CGM alarms was evaluated in a clinic setting using 58 subjects with type 1 diabetes mellitus (T1DM) monitoring interstitial glucose concentration over a 5-day period compared to reference YSI measurements (instrument manufactured by YSI, Yellow Springs, OH) at 15-min intervals. Finger stick glucose testing was evaluated in the home environment with 91 subjects with TIDM monitoring with the blood glucose meter integrated into the FreeStyle Navigator (FSN-BG) over a 20-day period. The reference was FSN-CGM with results masked from the subjects. Blood glucose values glucose was <= 85 mg/dL 77.2% of the time. In the home environment, the average FSN-BG testing frequency was 7.9 tests per day. Hypoglycemia was verified within +/- 30 min by FSN-BG measurements <= 85 mg/dL at a rate of 27.5%. Even with a high rate of FSN-BG testing, hypoglycemia detected by FSN-CGM was verified by patients with T1DM very infrequently. A high rate of hypoglycemia detection with a moderate rate of unnecessary alarms can be attained using FSN-CGM.
BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data
Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel
2012-01-01
BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310
BG7: a new approach for bacterial genome annotation designed for next generation sequencing data.
Directory of Open Access Journals (Sweden)
Pablo Pareja-Tobes
Full Text Available BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version - which is developed in Java, takes advantage of Amazon Web Services (AWS cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future.
BgTEP: An Antiprotease Involved in Innate Immune Sensing in Biomphalaria glabrata
Directory of Open Access Journals (Sweden)
Anaïs Portet
2018-05-01
Full Text Available Insect thioester-containing protein (iTEP is the most recently defined group among the thioester-containing protein (TEP superfamily. TEPs are key components of the immune system, and iTEPs from flies and mosquitoes were shown to be major immune weapons. Initially characterized from insects, TEP genes homologous to iTEP were further described from several other invertebrates including arthropods, cniderians, and mollusks albeit with few functional characterizations. In the freshwater snail Biomphalaria glabrata, a vector of the schistosomiasis disease, the presence of a TEP protein (BgTEP was previously described in a well-defined immune complex involving snail lectins (fibrinogen-related proteins and schistosome parasite mucins (SmPoMuc. To investigate the potential role of BgTEP in the immune response of the snail, we first characterized its genomic organization and its predicted protein structure. A phylogenetic analysis clustered BgTEP in a well-conserved subgroup of mollusk TEP. We then investigated the BgTEP expression profile in different snail tissues and followed immune challenges using different kinds of intruders during infection kinetics. Results revealed that BgTEP is particularly expressed in hemocytes, the immune-specialized cells in invertebrates, and is secreted into the hemolymph. Transcriptomic results further evidenced an intruder-dependent differential expression pattern of BgTEP, while interactome experiments showed that BgTEP is capable of binding to the surface of different microbes and parasite either in its full length form or in processed forms. An immunolocalization approach during snail infection by the Schistosoma mansoni parasite revealed that BgTEP is solely expressed by a subtype of hemocytes, the blast-like cells. This hemocyte subtype is present in the hemocytic capsule surrounding the parasite, suggesting a potential role in the parasite clearance by encapsulation. Through this work, we report the first
The Performance and Usability of a Factory-Calibrated Flash Glucose Monitoring System.
Bailey, Timothy; Bode, Bruce W; Christiansen, Mark P; Klaff, Leslie J; Alva, Shridhara
2015-11-01
The purpose of the study was to evaluate the performance and usability of the FreeStyle(®) Libre™ Flash glucose monitoring system (Abbott Diabetes Care, Alameda, CA) for interstitial glucose results compared with capillary blood glucose results. Seventy-two study participants with type 1 or type 2 diabetes were enrolled by four U.S. clinical sites. A sensor was inserted on the back of each upper arm for up to 14 days. Three factory-only calibrated sensor lots were used in the study. Sensor glucose measurements were compared with capillary blood glucose (BG) results (approximately eight per day) obtained using the BG meter built into the reader (BG reference) and with the YSI analyzer (Yellow Springs Instrument, Yellow Springs, OH) reference tests at three clinic visits (32 samples per visit). Sensor readings were masked to the participants. The accuracy of the results was demonstrated against capillary BG reference values, with 86.7% of sensor results within Consensus Error Grid Zone A. The percentage of readings within Consensus Error Grid Zone A on Days 2, 7, and 14 was 88.4%, 89.2%, and 85.2%, respectively. The overall mean absolute relative difference was 11.4%. The mean lag time between sensor and YSI reference values was 4.5±4.8 min. Sensor accuracy was not affected by factors such as body mass index, age, type of diabetes, clinical site, insulin administration, or hemoglobin A1c. Interstitial glucose measurements with the FreeStyle Libre system were found to be accurate compared with capillary BG reference values, with accuracy remaining stable over 14 days of wear and unaffected by patient characteristics.
bg/sup J//bg/sup J/:W/W/sup v/ bone marrow chimera. A model for studying stem cell regulation
Energy Technology Data Exchange (ETDEWEB)
Patt, H M; Maloney, M A
1978-01-01
In studies with bg/sup J//bg/sup J/:W/W/sup v/ chimeric mice, we used the beige neutrophil marker as a criterion of W/W/sup v/ marrow replacement by implanted bg/sup J//bg/sup J/ stem cells. Data from a 50-fold range of inoculum doses and a 2 y period of observation indicate a hyperbolic pattern of replacement expressed as a log dose-response relationship. The saturating effect with increasing inoculum dose was interpreted as reflecting random initial stem cell seeding in bone marrow coupled with a decreasing efficiency of colonization by migration. From the statistics of random sampling and the exponential decrease of the 63% replacement dose with time, we estimate that W/W/sup v/ marrow contains about 2600 stem cell regulatory volumes of about 10/sup 8/ ..mu../sup 3/ (50 cell diameters) each, a dimension consistent with concepts of short-range cell-cell interactions. Our observations suggest that each regulatory volume is essentially self-contained and that stem cell migration is generally restricted to contiguous volumes.
Yuan, Hong; Frank, Jonathan E; Merrill, Joseph R; Hillesheim, Daniel A; Khachaturian, Mark H; Anzellotti, Atilio I
2016-01-01
The hypoxia PET tracer, 1-[18F]fluoro-3-(2-nitro-1Himidazol- 1-yl)-propan-2-ol ([18F]FMISO) is the first radiotracer developed for hypoxia PET imaging and has shown promising for cancer diagnosis and prognosis. However, access to [18F]FMISO radiotracer is limited due to the needed cyclotron and radiochemistry expertise. The study aimed to develop the automated production method on the [18F]FMISO radiotracer with the novel fully automated platform of the BG75 system and validate its usage on animal tumor models. [18F]FMISO was produced with the dose synthesis cartridge automatically on the BG75 system. Validation of [18F]FMISO hypoxia imaging functionality was conducted on two tumor mouse models (FaDu/U87 tumor). The distribution of [18F]FMISO within tumor was further validated by the standard hypoxia marker EF5. The average radiochemical purity was (99±1) % and the average pH was 5.5±0.2 with other quality attributes passing standard criteria (n=12). Overall biodistribution for [18F]FMISO in both tumor models was consistent with reported studies where bladder and large intestines presented highest activity at 90 min post injection. High spatial correlation was found between [18F]FMISO autoradiography and EF5 hypoxia staining, indicating high hypoxia specificity of [18MF]FMISO. This study shows that qualified [18F]FMISO can be efficiently produced on the BG75 system in an automated "dose-on-demand" mode using single dose disposable cards. The possibilities of having a low-cost, automated system manufacturing ([18F]Fluoride production + synthesis + QC) different radiotracers will greatly enhance the potential for PET technology to reach new geographical areas and underserved patient populations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Characterization of BG28 and KG3 filter glass for Drive Diagnostic Attenuators
Energy Technology Data Exchange (ETDEWEB)
Page, R H; Weiland, T; Folta, J
2007-11-30
BG28 and KG3 filter glasses were tested for use as attenuators in the NIF drive diagnostic (DrD) systems. Tests were performed in the Optical Sciences Laser facility with a 351 nm, 2-step, 3-nsec pulse at fluences ranging up to {approx} 1 J/cm{sup 2}. Single-shot measurements showed no solarization when the samples were allowed to relax for a week after exposure. KG3 filters exhibited no luminescence and no transient pulse distortion. BG28 filters luminesced appreciably and imposed a 'droop' (similar to 'square-pulse distortion') on the signals. The droop parameter is estimated at 0.50 {+-} 0.11 cm{sup 2}/J. Droop is explained in terms of known copper-doped-glass spectroscopy and kinetics (buildup of triplet-state populations, with excited-state absorption). Simulation of the distortion ({approx}1.6%) expected on a 1.8 MJ Haan pulse led to a minor redesign of the Drive Diagnostic with reduced fluence on the BG28 filters to reduce the droop distortion to 0.5%.
Pustozerov, Evgenii; Popova, Polina; Tkachuk, Aleksandra; Bolotko, Yana; Yuldashev, Zafar; Grineva, Elena
2018-01-09
Personalized blood glucose (BG) prediction for diabetes patients is an important goal that is pursued by many researchers worldwide. Despite many proposals, only a few projects are dedicated to the development of complete recommender system infrastructures that incorporate BG prediction algorithms for diabetes patients. The development and implementation of such a system aided by mobile technology is of particular interest to patients with gestational diabetes mellitus (GDM), especially considering the significant importance of quickly achieving adequate BG control for these patients in a short period (ie, during pregnancy) and a typically higher acceptance rate for mobile health (mHealth) solutions for short- to midterm usage. This study was conducted with the objective of developing infrastructure comprising data processing algorithms, BG prediction models, and an appropriate mobile app for patients' electronic record management to guide BG prediction-based personalized recommendations for patients with GDM. A mobile app for electronic diary management was developed along with data exchange and continuous BG signal processing software. Both components were coupled to obtain the necessary data for use in the personalized BG prediction system. Necessary data on meals, BG measurements, and other events were collected via the implemented mobile app and continuous glucose monitoring (CGM) system processing software. These data were used to tune and evaluate the BG prediction model, which included an algorithm for dynamic coefficients tuning. In the clinical study, 62 participants (GDM: n=49; control: n=13) took part in a 1-week monitoring trial during which they used the mobile app to track their meals and self-measurements of BG and CGM system for continuous BG monitoring. The data on 909 food intakes and corresponding postprandial BG curves as well as the set of patients' characteristics (eg, glycated hemoglobin, body mass index [BMI], age, and lifestyle parameters
Sato, Toshiyuki; Okada, Seiki; Hagino, Kei; Asakura, Yoshihiro; Kikkawa, Yasuo; Kojima, Junko; Watanabe, Toshihiro; Maekawa, Yasunori; Isobe, Kazuki; Koike, Reona; Nakajima, Hiromu; Asano, Kaoru
2011-12-01
Monitoring postprandial hyperglycemia is crucial in treating diabetes, although its dynamics make accurate monitoring difficult. We developed a new technology for monitoring postprandial hyperglycemia using interstitial fluid (ISF) extraction technology without blood sampling. The glucose area under the curve (AUC) using this system was measured as accumulated ISF glucose (IG) with simultaneous calibration with sodium ions. The objective of this study was to evaluate this technological concept in healthy individuals. Minimally invasive ISF extraction technology (MIET) comprises two steps: pretreatment with microneedles and ISF accumulation over a specific time by contact with a solvent. The correlation between glucose and sodium ion levels using MIET was evaluated in 12 subjects with stable blood glucose (BG) levels during fasting. BG and IG time courses were evaluated in three subjects to confirm their relationship while BG was fluctuating. Furthermore, the accuracy of glucose AUC measurements by MIET was evaluated several hours after a meal in 30 subjects. A high correlation was observed between glucose and sodium ion levels when BG levels were stable (R=0.87), indicating that sodium ion is a good internal standard for calibration. The variation in IG and BG with MIET was similar, indicating that IG is an adequate substitute for BG. Finally, we showed a strong correlation (R=0.92) between IG-AUC and BG-AUC after a meal. These findings validate the adequacy of glucose AUC measurements using MIET. Monitoring glucose using MIET without blood sampling may be beneficial to patients with diabetes.
The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.
Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping
2013-10-01
In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Sean T. Doherty
2015-01-01
Full Text Available Type 2 diabetes is known to be associated with environmental, behavioral, and lifestyle factors. However, the actual impacts of these factors on blood glucose (BG variation throughout the day have remained relatively unexplored. Continuous blood glucose monitors combined with human activity tracking technologies afford new opportunities for exploration in a naturalistic setting. Data from a study of 40 patients with diabetes is utilized in this paper, including continuously monitored BG, food/medicine intake, and patient activity/location tracked using global positioning systems over a 4-day period. Standard linear regression and more disaggregated time-series analysis using autoregressive integrated moving average (ARIMA are used to explore patient BG variation throughout the day and over space. The ARIMA models revealed a wide variety of BG correlating factors related to specific activity types, locations (especially those far from home, and travel modes, although the impacts were highly personal. Traditional variables related to food intake and medications were less often significant. Overall, the time-series analysis revealed considerable patient-by-patient variation in the effects of geographic and daily lifestyle factors. We would suggest that maps of BG spatial variation or an interactive messaging system could provide new tools to engage patients and highlight potential risk factors.
Hiramatsu, Ryo; Furuse, Motomasa; Yagi, Ryokichi; Ohmura, Tomohisa; Ohnishi, Hiroyuki; Ikeda, Naokado; Nonoguchi, Naosuke; Kawabata, Shinji; Miyachi, Shigeru; Kuroiwa, Toshihiko
2018-02-05
The frequency of the occurrence of adverse events associated with carotid artery stenting (CAS) is usually low, but serious adverse events such as cerebral hyperperfusion syndrome (CHS) may occur. Real-time monitoring is ideal for the early detection of adverse events during the surgical procedure. This study aimed to evaluate continuous blood glucose (BG) monitoring for the detection of adverse events during CAS. Forty patients undergoing scheduled CAS were prospectively enrolled. An artificial pancreas was used for continuous BG monitoring (once per minute), using venous blood extracted at a rate of 2 mL/hr during CAS. The primary endpoint was a correlation between BG change and adverse events. CAS was discontinued in 1 patient, and BG was not measured in 5 patients (12.5%) because of the inability to extract blood. Among 34 evaluable patients, no patient developed CHS, but 3 patients (9%) experienced carotid occlusion intolerance. During CAS, BG was significantly higher in patients with carotid occlusion intolerance (median: 5 mg/dL) than in patients without carotid occlusion intolerance (median: 0 mg/dL) (P = 0.0221). A cutoff BG value ≥4 mg/dL during CAS showed 50% sensitivity and 100% specificity for the detection of carotid occlusion intolerance. There was no significant correlation between BG change and other adverse events. BG elevation may help detect carotid occlusion intolerance although it is still unknown whether BG monitoring can detect CHS. Further studies should validate that a cutoff BG elevation value of ≥4 mg/dL during CAS indicates carotid occlusion intolerance. Copyright © 2018 Elsevier Inc. All rights reserved.
Early diagnostic value of plasma PCT and BG assay for CRBSI after OLT.
Chen, J; Wang, Y; Shen, Z; Zhu, Z; Song, Y; Han, R
2011-06-01
The aim was to evaluate the role of procalcitonin (PCT) and (1-3)-β-D-glucan (BG) tests for early detection or exclusion of central venous catheter-related bloodstream infections (CRBSI) in patients after orthotopic liver transplantation (OLT). Fifty-five patients with clinically suspected CRBSI were assessed after OLT in this prospective study. On the day of clinical suspicion of CRBSI, blood samples were obtained from central venous catheters and a peripheral vein for blood cultures and from a peripheral vein for PCT and BG tests. Plasma PCT and BG values were measured by using an immunoluminometric assay and Fungitell BG assay, respectively. No prisoners or organs from prisoners were used in this study. Twenty-five patients (45%) were diagnosed with CRBIS. Among them, 13 (52%) displayed gram-positive bacteriemia, 11 (44%) gram-negative bacteriemia, and 1 (4%) fungemia. The PCT values were higher in CRBSI than in non-CRBSI patients (P = .003). CRBSI patients did not show significant increases in plasma BG values compared with non-CRBSI subjects (P = .051). PCT and BG area under receiver operating characteristic curves were 0.840 and 0.486, respectively. Sensitivity, specificity, and positive and negative predictive values of a PCT of ≥ 3.1 ng/mL for the diagnosis of CRBSI were 0.72, 0.87, 0.82, and 0.79, respectively. The figures for a BG of ≥ 83 pg/mL were 0.32, 0.90, 0.73, and 0.61, respectively. Among the 24 patients with bacteria infections, PCT was higher in patients with gram-negative than those with gram-positive bacterial infections (P = .022). We concluded that the PCT assay may be a useful rapid diagnostic adjunct for the diagnosis of suspected CRBSI in OLT patients. Copyright © 2011 Elsevier Inc. All rights reserved.
Schrangl, Patrick; Reiterer, Florian; Heinemann, Lutz; Freckmann, Guido; Del Re, Luigi
2018-05-18
Systems for continuous glucose monitoring (CGM) are evolving quickly, and the data obtained are expected to become the basis for clinical decisions for many patients with diabetes in the near future. However, this requires that their analytical accuracy is sufficient. This accuracy is usually determined with clinical studies by comparing the data obtained by the given CGM system with blood glucose (BG) point measurements made with a so-called reference method. The latter is assumed to indicate the correct value of the target quantity. Unfortunately, due to the nature of the clinical trials and the approach used, such a comparison is subject to several effects which may lead to misleading results. While some reasons for the differences between the values obtained with CGM and BG point measurements are relatively well-known (e.g., measurement in different body compartments), others related to the clinical study protocols are less visible, but also quite important. In this review, we present a general picture of the topic as well as tools which allow to correct or at least to estimate the uncertainty of measures of CGM system performance.
Directory of Open Access Journals (Sweden)
Ciampolini M
2011-05-01
Full Text Available Mario Ciampolini1, Massimiliano Sifone21Preventive Gastroenterology Unit, Department of Paediatrics, Università di Firenze, Florence, Italy; 2Department of Statistics, Università di Firenze, Florence, ItalyBackground: Meals begin and end subjectively. We trained healthy subjects to recognize initial hunger as a preprandial target for meal consumption, and to create a “recognizing hunger” or initial hunger meal pattern.Objective: Training subjects to “recognize hunger” lowers blood glucose (BG and improves energy balance, and lowers metabolic risks and bodyweight. A minority may have low BG and low metabolic risks at recruitment, but the others may recover this favorable condition by training.Methods: In a 7-day food diary, subjects reported their preprandial BG measurements; BG and energy availability by blood were assessed at the lowest BG during the day, and diary-mean BG thus characterized the individual meal pattern (daily energy intake. We analyzed the same diaries of a recent paper on a global, randomized comparison of subjects trained in “recognizing hunger” with control subjects. This time, we checked whether subjects who had maintained low BG (LBG subgroup at recruitment were able to decrease mean BG and metabolic risk factors during “hunger recognition” like those who presented high BG (HBG subgroup.Results: At recruitment, the BG means of 120 investigated subjects were within mean confidence limits of ± 3.84 mg/dL, and we could stratify subjects in ten small strata of which each significantly differed by mean BG. Mean BG was stable in each control subject over five months; the mean absolute change being 6.0 ± 4.6 mg/dL. Only three out of 34 trained subjects who had lower mean BG than 81.8 mg/dL significantly decreased mean BG, whereas 41 out of 55 subjects whose mean BG was greater than 81.8 mg/dL significantly decreased mean BG after training (P < 0.0001. At recruitment, the LBG subgroup showed significantly lower
Prabhudesai, Sumant; Kanjani, Amruta; Bhagat, Isha; Ravikumar, Karnam G.; Ramachandran, Bala
2015-01-01
Aims: The aim of this prospective, observational study was to determine the accuracy of a real-time continuous glucose monitoring system (CGMS) in children with septic shock. Subjects and Methods: Children aged 30 days to 18 years admitted to the Pediatric Intensive Care Unit with septic shock were included. A real-time CGMS sensor was used to obtain interstitial glucose readings. CGMS readings were compared statistically with simultaneous laboratory blood glucose (BG). Results: Nineteen chil...
Pizarro, María Dolores; Mediavilla, María Gabriela; Berardi, Florencia; Tiribelli, Claudio; Rodríguez, Joaquín V; Mamprin, María Eugenia
2014-01-01
This work focuses on ammonia metabolism of Liver Microorgans (LMOs) after cold preservation in a normothermic reoxygenation system (NRS). We have previously reported the development of a novel preservation solution, Bes-Gluconate-PEG 35 kDa (BG35) that showed the same efficacy as ViaSpan to protect LMOs against cold preservation injury. The objective of this work was to study mRNA levels and activities of two key Urea Cycle enzymes, Carbamyl Phosphate Synthetase I (CPSI) and Ornithine Transcarbamylase (OTC), after preservation of LMOs in BG35 and ViaSpan and the ability of these tissue slices to detoxify an ammonia overload in a NRS model. After 48 h of cold storage (0°C in BG35 or ViaSpan) LMOs were rewarmed in KHR containing an ammonium chloride overload (1 mM). We determined ammonium detoxification capacity (ADC), urea synthesis and enzyme activities and relative mRNA levels for CPSI and OTC. At the end of reoxygenation LMOs cold preserved in BG35 have ADC and urea synthesis similar to controls. ViaSpan group demonstrated a lower capacity to detoxify ammonia and to synthesize urea than fresh LMOs during the whole reoxygenation period which correlated with the lower mRNA levels and activities for CPSI and OTC observed for this group. We demonstrate that our preservation conditions (48 hours, BG35 solution, anoxia, 0ºC) did not affect ammonia metabolism of cold preserved LMOs maintaining the physiological and biochemical liver functions tested, which allows their future use as biological component of a BAL system.
Gene calling and bacterial genome annotation with BG7.
Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo
2015-01-01
New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).
Ansari, Meenhaz; Ashraf, S. S. Z.
2017-10-01
We investigate the energy dependent electron-phonon relaxation rate, energy loss rate, and phonon drag thermopower in single layer graphene (SLG) and bilayer graphene (BLG) under the Bloch-Gruneisen (BG) regime through coupling to acoustic phonons interacting via the Deformation potential in the Boltzmann transport equation approach. We find that the consideration of the chiral nature of electrons alters the temperature dependencies in two-dimensional structures of SLG and BLG from that shown by other conventional 2DEG system. Our investigations indicate that the BG analytical results are valid for temperatures far below the BG limit (˜TBG/4) which is in conformity with a recent experimental investigation for SLG [C. B. McKitterick et al., Phys. Rev. B 93, 075410 (2016)]. For temperatures above this renewed limit (˜TBG/4), there is observed a suppression in energy loss rate and thermo power in SLG, but enhancement is observed in relaxation rate and thermopower in BLG, while a suppression in the energy loss rate is observed in BLG. This strong nonmonotonic temperature dependence in SLG has also been experimentally observed within the BG limit [Q. Ma et al., Phys. Rev. Lett. 112, 247401 (2014)].
Directory of Open Access Journals (Sweden)
Ying Chen
2016-04-01
Full Text Available Abstract Background Regular and timely monitoring of blood glucose (BG levels in hospitalized patients with diabetes mellitus is crucial to optimizing inpatient glycaemic control. However, methods to quantify timeliness as a measurement of quality of care are lacking. We propose an analytical approach that utilizes BG measurements from electronic records to assess adherence to an inpatient BG monitoring protocol in hospital wards. Methods We applied our proposed analytical approach to electronic records obtained from 24 non-critical care wards in November and December 2013 from a tertiary care hospital in Singapore. We applied distributional analytics to evaluate daily adherence to BG monitoring timings. A one-sample Kolmogorov-Smirnov (1S-KS test was performed to test daily BG timings against non-adherence represented by the uniform distribution. This test was performed among wards with high power, determined through simulation. The 1S-KS test was coupled with visualization via the cumulative distribution function (cdf plot and a two-sample Kolmogorov-Smirnov (2S-KS test, enabling comparison of the BG timing distributions between two consecutive days. We also applied mixture modelling to identify the key features in daily BG timings. Results We found that 11 out of the 24 wards had high power. Among these wards, 1S-KS test with cdf plots indicated adherence to BG monitoring protocols. Integrating both 1S-KS and 2S-KS information within a moving window consisting of two consecutive days did not suggest frequent potential change from or towards non-adherence to protocol. From mixture modelling among wards with high power, we consistently identified four components with high concentration of BG measurements taken before mealtimes and around bedtime. This agnostic analysis provided additional evidence that the wards were adherent to BG monitoring protocols. Conclusions We demonstrated the utility of our proposed analytical approach as a monitoring
Energy Technology Data Exchange (ETDEWEB)
Ma Yanxuan; Zheng Yudong; Huang Xiaoshan; Xi Tingfei; Han Dongfei [School of Materials Science and Engineering, Beijing University of Science and Technology, Beijing 100083 (China); Lin Xiaodan [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510640 (China); Song Wenhui, E-mail: zhengyudong@mater.ustb.edu.c, E-mail: wenhui.song@brunel.ac.u [Wolfson Center for Materials Processing, School of Engineering and Design, Brunel University, West London, UB8 3PH (United Kingdom)
2010-04-15
Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.
Ma, Yanxuan; Zheng, Yudong; Huang, Xiaoshan; Xi, Tingfei; Lin, Xiaodan; Han, Dongfei; Song, Wenhui
2010-04-01
Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.
Bailey, Kaitlyn J; Little, Jonathan P; Jung, Mary E
2016-03-01
Exercise helps individuals with prediabetes or type 2 diabetes (T2D) manage their blood glucose (BG); however, exercise adherence in this population is dismal. In this pilot study we tested the efficacy of a self-monitoring group-based intervention using continuous glucose monitors (CGMs) at increasing exercise adherence in individuals with impaired BG. Thirteen participants with prediabetes or T2D were randomized to an 8-week standard care exercise program (CON condition) (n = 7) or self-monitoring exercise intervention (SM condition) (n = 6). Participants in the SM condition were taught how to self-monitor their exercise and BG, to goal set, and to use CGM to observe how exercise influences BG. We hypothesized that compared with the CON condition, using a real-time CGM would facilitate self-monitoring behavior, resulting in increased exercise adherence. Repeated-measures analysis of variance revealed significant Condition × Time interactions for self-monitoring (P goal setting (P = 0.01), and self-efficacy to self-monitor (P = 0.01), such that the SM condition showed greater increases in these outcomes immediately after the program and at the 1-month follow-up compared with the CON condition. The SM condition had higher program attendance rates (P = 0.03), and a greater proportion of participants reregistered for additional exercise programs (P = 0.048) compared with the CON condition. Participants in both conditions experienced improvements in health-related quality of life, waist circumference, and fitness (P values exercise behavior in individuals living with prediabetes or T2D.
Thomas, Felicity Louise; Signal, Mathew; Harris, Deborah L.; Weston, Philip J.; Harding, Jane E.; Shaw, Geoffrey M.; Chase, J. Geoffrey
2014-01-01
Neonatal hypoglycemia is common and can cause serious brain injury. Continuous glucose monitoring (CGM) could improve hypoglycemia detection, while reducing blood glucose (BG) measurements. Calibration algorithms use BG measurements to convert sensor signals into CGM data. Thus, inaccuracies in calibration BG measurements directly affect CGM values and any metrics calculated from them. The aim was to quantify the effect of timing delays and calibration BG measurement errors on hypoglycemia me...
Bullard, Kristen M; Gullberg, Rebekah C; Soltani, Elnaz; Steel, J Jordan; Geiss, Brian J; Keenan, Susan M
2015-01-01
Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323's antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99) and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin) in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450) isoforms thus suggesting this molecule may be less
Directory of Open Access Journals (Sweden)
Kristen M Bullard
Full Text Available Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323's antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99 and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450 isoforms thus suggesting this molecule
High-voltage monitoring with a solenoid retarding spectrometer at the KATRIN experiment
Czech Academy of Sciences Publication Activity Database
Erhard, M.; Bauer, S.; Beglarian, A.; Bergmann, T.; Bonn, J.; Drexlin, G.; Goullon, J.; Groh, S.; Gluck, F.; Kleesiek, M.; Haussmann, N.; Höhn, T.; Johnston, K.; Kraus, M.; Reich, J.; Rest, O.; Schlosser, K.; Schupp, M.; Slezák, Martin; Thummler, T.; Vénos, Drahoslav; Weinheimer, C.; Wüstling, S.; Zbořil, M.
2014-01-01
Roč. 9, JUN (2014), P06022 ISSN 1748-0221 R&D Projects: GA ČR(CZ) GAP203/12/1896 Institutional support: RVO:61389005 Keywords : real-time monitoring * spectrometers * control systems Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.399, year: 2014
Synthesis and degradation properties of β-TCP/BG porous ...
Indian Academy of Sciences (India)
-TCP/BG porous composite materials were successfully fabricated by foaming technology. X-ray diffraction was used to determine the crystal structure of powders. The pore size and distribution of the resulting materials were characterized using scanning electron microscopy. The porosity and degradation performance of ...
Olamoyegun, M A; Oloyede, T; Adewoye, O G; Abdulkarim, S O; Adeleke, A A
2016-01-01
Self-monitoring of blood glucose (SMBG) is an important component of management for diabetes mellitus (DM), especially in T1DM and T2DM patients who are on insulin therapy. Adequate blood glucose monitoring and prompt intervention are necessary to prevent blood glucose (BG) fluctuation and delay long-term diabetes complications. People with DM are advised to clean their hands before SMBG to remove any dirt or food residue that might affect the reading. The study tested the hypothesis that falsely elevated BG levels from fingertip occur after peeling or handling fruits in an unwashed hand. Fifty apparently healthy nondiabetes volunteers were enrolled. Capillary BG samples were collected from the fingertips after peeling or handling apple, orange, banana, watermelon, and pawpaw, followed by no hand washing for 1 h, cleaning the fingertip with alcohol swab once, five times, and washing hand thoroughly with tap water and drying. These samples were then analyzed with two different glucose meters. The mean BG values, measured from fingertip blood samples after peeling, and handling any of the fruits followed by no hand washing were significantly high, even after cleaning fingertip with a swab of alcohol once. However, there were no significant difference in BG levels measured after peeling and handling fruits followed by hand washing and the level of BG before peeling and handling fruits. Handling of peeled fruits with no hand washing with tap water is associated with overestimation of capillary BG (Pseudohyperglycemia) monitored with glucose meters.
First Symmetry Tests in Polarized Z0 Decays to b anti-bg
International Nuclear Information System (INIS)
Burrows, Phil
2000-01-01
The authors have made the first direct symmetry tests in the decays of polarized Z 0 bosons into fully-identified b anti-bg states, collected in the SLD experiment at SLAC. The authors searched for evidence of parity violation at the b anti-bg vertex by studying the asymmetries in the b-quark polar- and azimuthal-angle distributions, and for evidence of T-odd, CP-even or odd, final-state interactions by measuring angular correlations between the three-jet plane and the Z 0 polarization. They found results consistent with Standard Model expectations and set 95% C.L. limits on anomalous contributions
Dia, Vermont P; Krishnan, Hari B
2016-09-15
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity of BG-4 may be responsible for its capability to cause cytotoxicity to HCT-116 and HT-29 human colon cancer cells with ED50 values of 134.4 and 217.0 μg/mL after 48 h of treatment, respectively. The mechanism involved in the cytotoxic effect may be associated with induction of apoptosis as evidenced by increased percentage of HCT-116 and HT-29 colon cancer cells undergoing apoptosis from 5.4% (untreated) to 24.8% (BG-4 treated, 125 μg/mL for 16 h) and 8.5% (untreated) to 31.9% (BG-4 treated, 125 μg/mL for 16 h), respectively. The molecular mechanistic explanation in the apoptosis inducing property of BG-4 is due to reduced expression of Bcl-2 and increased expression of Bax leading to increased expression of caspase-3 and affecting the expression of cell cycle proteins p21 and CDK2. This is the first report on the anti-cancer potential of a novel bioactive peptide isolated from Momordica charantia in vitro supporting the potential therapeutic property of BG-4 against colon cancer that must be addressed using in vivo models of colon carcinogenesis.
Kovatchev, Boris P; Clarke, William L; Breton, Marc; Brayman, Kenneth; McCall, Anthony
2005-12-01
Continuous glucose monitors (CGMs) collect detailed blood glucose (BG) time series, which carry significant information about the dynamics of BG fluctuations. In contrast, the methods for analysis of CGM data remain those developed for infrequent BG self-monitoring. As a result, important information about the temporal structure of the data is lost during the translation of raw sensor readings into clinically interpretable statistics and images. The following mathematical methods are introduced into the field of CGM data interpretation: (1) analysis of BG rate of change; (2) risk analysis using previously reported Low/High BG Indices and Poincare (lag) plot of risk associated with temporal BG variability; and (3) spatial aggregation of the process of BG fluctuations and its Markov chain visualization. The clinical application of these methods is illustrated by analysis of data of a patient with Type 1 diabetes mellitus who underwent islet transplantation and with data from clinical trials. Normative data [12,025 reference (YSI device, Yellow Springs Instruments, Yellow Springs, OH) BG determinations] in patients with Type 1 diabetes mellitus who underwent insulin and glucose challenges suggest that the 90%, 95%, and 99% confidence intervals of BG rate of change that could be maximally sustained over 15-30 min are [-2,2], [-3,3], and [-4,4] mg/dL/min, respectively. BG dynamics and risk parameters clearly differentiated the stages of transplantation and the effects of medication. Aspects of treatment were clearly visualized by graphs of BG rate of change and Low/High BG Indices, by a Poincare plot of risk for rapid BG fluctuations, and by a plot of the aggregated Markov process. Advanced analysis and visualization of CGM data allow for evaluation of dynamical characteristics of diabetes and reveal clinical information that is inaccessible via standard statistics, which do not take into account the temporal structure of the data. The use of such methods improves the
Implementation of DoS attack and mitigation strategies in IEEE 802.11b/g WLAN
Deng, Julia; Meng, Ke; Xiao, Yang; Xu, Roger
2010-04-01
IEEE 802.11 wireless Local Area Network (WLAN) becomes very prevalent nowadays. Either as a simple range extender for a home wired Ethernet interface, or as a wireless deployment throughout an enterprise, WLAN provides mobility, convenience, and low cost. However, an IEEE 802.11b/g wireless network uses the frequency of unlicensed 2.4GHz, which makes the network unsafe and more vulnerable than traditional Ethernet networks. As a result, anyone who is familiar with wireless network may initiate a Denial of Service (DoS) attack to influence the common communication of the network or even make it crash. In this paper, we present our studies on the DoS attacks and mitigation strategies for IEEE 802.11b/g WLANs and describe some initial implementations using IEEE 802.11b/g wireless devices.
DEFF Research Database (Denmark)
Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.
2014-01-01
complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...
Tack, C.J.; Pohlmeier, H.; Behnke, T.; Schmid, V.; Grenningloh, M.; Forst, T.; Pfutzner, A.
2012-01-01
BACKGROUND: This multicenter study was conducted to evaluate the performance of five recently introduced blood glucose (BG) monitoring (BGM) devices under daily routine conditions in comparison with the YSI (Yellow Springs, OH) 2300 Stat Plus glucose analyzer. METHODS: Five hundred one diabetes
B-G cDNA clones have multiple small repeats and hybridize to both chicken MHC regions
DEFF Research Database (Denmark)
Kaufman, J; Salomonsen, J; Skjødt, K
1989-01-01
We used rabbit antisera to the chicken MHC erythrocyte molecule B-G and to the class I alpha chain (B-F) to screen lambda gt11 cDNA expression libraries made with RNA selected by oligo-dT from bone marrow cells of anemic B19 homozygous chickens. Eight clones were found to encode B-G molecules which...
DEFF Research Database (Denmark)
Salomonsen, J; Eriksson, H; Skjødt, K
1991-01-01
The polymorphic B-G region of the chicken major histocompatibility complex has previously been shown to mediate an "adjuvant effect" on the humoral response to other erythrocyte alloantigens. We demonstrate here that B-G molecules purified with monoclonal antibodies exert this adjuvant effect...... on the production of alloantibodies to chicken class I (B-F) molecules, when the two are in the same liposome. The adjuvant effect may in part be mediated by antibodies, since the antibody response to B-G molecules occurs much faster than the response to B-F molecules, and conditions in which antibodies to B......-G are present increase the speed of the response to B-F molecules. We also found that the presence of B-G molecules in separate liposomes results in a lack of response to B-F molecules. In the light of this and other data, we consider the possible roles for the polymorphic B-G molecules, particularly...
The SLD Vertex Detector Upgrade (VXD3) and a study of b anti bg events
International Nuclear Information System (INIS)
Dervan, P.J.
1998-04-01
This thesis presents a variety of work concerning the design, construction and use of the SLD's vertex detector. SLD's pioneering 120 Mpixel vertex detector, VXD2, was replaced by VXD3, a 307Mpixel CCD vertex detector in january 1996. The motivation for the up-grade detector and its subsequent construction and testing are described in some detail. This work represents the collaborative work of a large number of people. The authors' work was mainly carried out at EEV on the testing of the CCDs and subsequent ladders. VXD3 was commissioned during the 1996 SLD run and performed very close to design specifications. Monitoring the position of VXD3 is crucial for reconstructing the data in the detector for physics analysis. This was carried out using a capacitive wire position monitoring system. The system indicated that VXD3 was very stable during the whole of the 1996 run, except for known controlled movements. VXD3 was aligned globally for each period in-between these known movements using the tracks from e + e - → Z 0 → hadrons. The structure of three-jet b anti bg events has been studied using hadronic Z 0 decays from the 1993--1995 SLD data. Three-jet final states were selected and the CCD-based vertex detector was used to identify two of the jets as a b or anti b. The distributions of the gluon energy and polar angle with respect to the electron beam direction were examined and were compared with perturbative QCD predictions. It was found that the QCD Parton Shower prediction was needed to describe the data well
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity ...
Moser, Othmar; Mader, Julia K; Tschakert, Gerhard; Mueller, Alexander; Groeschl, Werner; Pieber, Thomas R; Koehler, Gerd; Messerschmidt, Janin; Hofmann, Peter
2016-08-10
Continuous exercise (CON) and high-intensity interval exercise (HIIE) can be safely performed with type 1 diabetes mellitus (T1DM). Additionally, continuous glucose monitoring (CGM) systems may serve as a tool to reduce the risk of exercise-induced hypoglycemia. It is unclear if CGM is accurate during CON and HIIE at different mean workloads. Seven T1DM patients performed CON and HIIE at 5% below (L) and above (M) the first lactate turn point (LTP₁), and 5% below the second lactate turn point (LTP₂) (H) on a cycle ergometer. Glucose was measured via CGM and in capillary blood (BG). Differences were found in comparison of CGM vs. BG in three out of the six tests (p exercise-induced hypoglycemia, but usual BG control should be performed during intense exercise.
LENUS (Irish Health Repository)
Hutchinson, Michael
2013-09-01
In the phase 3, randomized, placebo-controlled and active reference (glatiramer acetate) comparator CONFIRM study in patients with relapsing-remitting multiple sclerosis, oral BG-12 (dimethyl fumarate) reduced the annualized relapse rate (ARR; primary endpoint), as well as the proportion of patients relapsed, magnetic resonance imaging lesion activity, and confirmed disability progression, compared with placebo. We investigated the clinical efficacy of BG-12 240 mg twice daily (BID) and three times daily (TID) in patient subgroups stratified according to baseline demographic and disease characteristics including gender, age, relapse history, McDonald criteria, treatment history, Expanded Disability Status Scale score, T2 lesion volume, and gadolinium-enhancing lesions. BG-12 treatment demonstrated generally consistent benefits on relapse-related outcomes across patient subgroups, reflecting the positive findings in the overall CONFIRM study population. Treatment with BG-12 BID and TID reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in all subgroups analyzed. Reductions in ARR with BG-12 BID versus placebo ranged from 34% [rate ratio 0.664 (95% confidence interval 0.422-1.043)] to 53% [0.466 (0.313-0.694)] and from 13% [0.870 (0.551-1.373)] to 67% [0.334 (0.226-0.493)] with BG-12 TID versus placebo. Treatment with glatiramer acetate reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in most patient subgroups. The results of these analyses indicate that treatment with BG-12 is effective on relapses across a broad range of patients with relapsing-remitting multiple sclerosis with varied demographic and disease characteristics.
DEFF Research Database (Denmark)
Salomonsen, J; Dunon, D; Skjødt, K
1991-01-01
B-G antigens are a polymorphic multigene family of cell surface molecules encoded by the chicken major histocompatibility complex (MHC). They have previously been described only on cells of the erythroid lineage. By using flow cytometry, section staining, and immunoprecipitation with monoclonal a...
Directory of Open Access Journals (Sweden)
Chih-Chun Yang
2015-11-01
Full Text Available The photosynthetic cyanobacterium Synechococcus elongatus PCC7942 has recently gained great attention for its ability to directly convert CO2 into renewable chemicals upon genetic engineering. Thus, it is of great interest to increase the growth speed and lower the medium requirement for cultivating this cyanobacterium. The cultivation medium of Synechococcus elongatus PCC7942 has been developed, which consists of many inorganic and metal ingredients with a specific composition, known as the BG-11 medium. In this work, we analyzed the concentration effect of each ingredient and identified the absolutely essential components in BG-11 medium for cyanobacteria growth using the concentration gradient generator chip (CGGC fabricated by MEMS technology. As shown by our results, removal of the individual component sodium nitrate, potassium phosphate, or magnesium sulfate from the BG-11 medium led to severe growth inhibition of Synechococcus elongatus PCC7942. Contrary to our expectation, increasing concentration of the crucial ingredients showed either insignificant or negative impact on cell growth. Overall, standard growth could be achieved without supplementation of ethylenediaminetetraacetic acid (EDTA disodium, sodium carbonate, or sodium citrate to the culture medium. Further improvement of the CGGC-based microfluidic system based on this preliminary study may broaden its application range to analyze more complicated correlations.
Symmetry tests in polarized Z0 decays to b anti bg
International Nuclear Information System (INIS)
Abe, K.; Abe, K.; Akagi, T.
1997-06-01
Angular asymmetries have been measured in polarized Z 0 decays to b anti bg collected by the SLD experiment at the SLC. A high purity b anti bg event sample is selected utilizing lifetime information given by the SLD CCD pixel vertex detector and the stable micron-size SLC beams, and the b- and anti b-jets are identified using lifetime information and momentum-weighted track charge. The forward-backward asymmetry is observed in the b-jet polar angle distribution, and the parity-violation parameter is measured to test the Standard Model. Two angular correlations between the three-jet plane and the Z 0 polarization are studied. The CP-even and T-odd angular asymmetry, and the CP-odd and T-odd angular asymmetry are sensitive to physics beyond the Standard Model. The authors measure the expectation values of these quantities to be consistent with zero and set limits on the correlations
BG1 has a major role in MHC-linked resistance to malignant lymphoma in the chicken.
Goto, Ronald M; Wang, Yujun; Taylor, Robert L; Wakenell, Patricia S; Hosomichi, Kazuyoshi; Shiina, Takashi; Blackmore, Craig S; Briles, W Elwood; Miller, Marcia M
2009-09-29
Pathogen selection is postulated to drive MHC allelic diversity at loci for antigen presentation. However, readily apparent MHC infectious disease associations are rare in most species. The strong link between MHC-B haplotype and the occurrence of virally induced tumors in the chicken provides a means for defining the relationship between pathogen selection and MHC polymorphism. Here, we verified a significant difference in resistance to gallid herpesvirus-2 (GaHV-2)-induced lymphomas (Marek's disease) conferred by two closely-related recombinant MHC-B haplotypes. We mapped the crossover breakpoints that distinguish these haplotypes to the highly polymorphic BG1 locus. BG1 encodes an Ig-superfamily type I transmembrane receptor-like protein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM), which undergoes phosphorylation and is recognized by Src homology 2 domain-containing protein tyrosine phosphatase (SHP-2). The recombinant haplotypes are identical, except for differences within the BG1 3'-untranslated region (3'-UTR). The 3'-UTR of the BG1 allele associated with increased lymphoma contains a 225-bp insert of retroviral origin and showed greater inhibition of luciferase reporter gene translation compared to the other allele. These findings suggest that BG1 could affect the outcome of GaHV-2 infection through modulation of the lymphoid cell responsiveness to infection, a condition that is critical for GaHV-2 replication and in which the MHC-B haplotype has been previously implicated. This work provides a mechanism by which MHC-B region genetics contributes to the incidence of GaHV-2-induced malignant lymphoma in the chicken and invites consideration of the possibility that similar mechanisms might affect the incidence of lymphomas associated with other oncogenic viral infections.
Okkerse, Pieter; Hay, Justin L; Versage, Eve; Tang, Yongqiang; Galluppi, Gerald; Ravina, Bernard; Verma, Ajay; Williams, Leslie; Aycardi, Ernesto; Groeneveld, Geert Jan
2016-07-01
BG00010 is a protein in the glial cell line-derived neurotrophic factor (GDNF) family. It is a selective ligand for the GDNF family receptor alpha-3 (GFRα3) co-receptor that normalizes cellular changes resulting from damage or disease, and potentially alleviates neuropathic pain. The main objectives of this study were to evaluate the pharmacokinetic and safety profiles and to determine the effects on pain of ascending doses of intravenous injections of BG00010 in patients with sciatica. This was a randomized, blinded, placebo-controlled multiple-dose study in subjects with sciatica. In Part I (16 patients), four IV dose levels were examined (50, 150, 400, 800 μg kg(-1) ) and in Part II (12 patients), three dose levels were examined (400, 600 and 1200 μg kg(-1) ). Safety and efficacy assessments were used as endpoints. The BG00010 concentration-time data indicated relatively low inter-patient variability and there was a dose-dependent (not dose-proportional) increase in serum exposure from 150 to 1200 μg kg(-1) . The effective half-life was between 40 and 60 h. The most frequently occurring adverse events (AEs) reported by patients receiving BG00010 were headache (67-83%), feeling hot (50-100%), and pruritus (42-67%). Most AEs were mild; no serious AEs or AEs leading to discontinuation occurred. Higher dose regimens of BG00010 resulted in greater pain reduction than placebo or lower dose regimens, although a clear dose-response relationship was not seen. The pharmacokinetic profile of BG00010 was characterized by low intra-patient variability. These data from a small sample suggest that BG00010 may have a benefit for patients with sciatica. © 2016 The British Pharmacological Society.
Continuous Glucose Monitoring in Newborn Infants
Thomas, Felicity; Signal, Mathew; Harris, Deborah L.; Weston, Philip J.; Harding, Jane E.; Shaw, Geoffrey M.
2014-01-01
Neonatal hypoglycemia is common and can cause serious brain injury. Continuous glucose monitoring (CGM) could improve hypoglycemia detection, while reducing blood glucose (BG) measurements. Calibration algorithms use BG measurements to convert sensor signals into CGM data. Thus, inaccuracies in calibration BG measurements directly affect CGM values and any metrics calculated from them. The aim was to quantify the effect of timing delays and calibration BG measurement errors on hypoglycemia metrics in newborn infants. Data from 155 babies were used. Two timing and 3 BG meter error models (Abbott Optium Xceed, Roche Accu-Chek Inform II, Nova Statstrip) were created using empirical data. Monte-Carlo methods were employed, and each simulation was run 1000 times. Each set of patient data in each simulation had randomly selected timing and/or measurement error added to BG measurements before CGM data were calibrated. The number of hypoglycemic events, duration of hypoglycemia, and hypoglycemic index were then calculated using the CGM data and compared to baseline values. Timing error alone had little effect on hypoglycemia metrics, but measurement error caused substantial variation. Abbott results underreported the number of hypoglycemic events by up to 8 and Roche overreported by up to 4 where the original number reported was 2. Nova results were closest to baseline. Similar trends were observed in the other hypoglycemia metrics. Errors in blood glucose concentration measurements used for calibration of CGM devices can have a clinically important impact on detection of hypoglycemia. If CGM devices are going to be used for assessing hypoglycemia it is important to understand of the impact of these errors on CGM data. PMID:24876618
Assessing sensor accuracy for non-adjunct use of continuous glucose monitoring.
Kovatchev, Boris P; Patek, Stephen D; Ortiz, Edward Andrew; Breton, Marc D
2015-03-01
The level of continuous glucose monitoring (CGM) accuracy needed for insulin dosing using sensor values (i.e., the level of accuracy permitting non-adjunct CGM use) is a topic of ongoing debate. Assessment of this level in clinical experiments is virtually impossible because the magnitude of CGM errors cannot be manipulated and related prospectively to clinical outcomes. A combination of archival data (parallel CGM, insulin pump, self-monitoring of blood glucose [SMBG] records, and meals for 56 pump users with type 1 diabetes) and in silico experiments was used to "replay" real-life treatment scenarios and relate sensor error to glycemic outcomes. Nominal blood glucose (BG) traces were extracted using a mathematical model, yielding 2,082 BG segments each initiated by insulin bolus and confirmed by SMBG. These segments were replayed at seven sensor accuracy levels (mean absolute relative differences [MARDs] of 3-22%) testing six scenarios: insulin dosing using sensor values, threshold, and predictive alarms, each without or with considering CGM trend arrows. In all six scenarios, the occurrence of hypoglycemia (frequency of BG levels ≤50 mg/dL and BG levels ≤39 mg/dL) increased with sensor error, displaying an abrupt slope change at MARD =10%. Similarly, hyperglycemia (frequency of BG levels ≥250 mg/dL and BG levels ≥400 mg/dL) increased and displayed an abrupt slope change at MARD=10%. When added to insulin dosing decisions, information from CGM trend arrows, threshold, and predictive alarms resulted in improvement in average glycemia by 1.86, 8.17, and 8.88 mg/dL, respectively. Using CGM for insulin dosing decisions is feasible below a certain level of sensor error, estimated in silico at MARD=10%. In our experiments, further accuracy improvement did not contribute substantively to better glycemic outcomes.
Salleh, Noor Shafryna; Murad, Abdul Munir Abdul
2016-11-01
In this work, the ability of commercial Trichoderma reesei cellulases preparation, Celluclast® or in combination with Accellerase®BG β-glucosidase to hydrolyse pretreated oil palm empty fruit bunch (OPEFB) was evaluated. Celluclast® alone hydrolyzed OPEFB to produce 2.41±0.44 mg glucose per gram OPEFB. However, the production of glucose was significantly improved with supplementation of Accellerase®BG (8.12±0.93 mg/g). This result suggested that the endoglucanases and exoglucanases in Celluclast® and β-glucosidase in Accellerase®BG able to work synergistically to increase the production of glucose from OPEFB. In addition, the production of xylose was also improved by 30% when the enzyme mixture was used. The result suggested that the mixture of Celluclast® with Accellerase®BG work synergistically to improve the production of sugars by removing the inhibition by cellobiose for complete cellulose hydrolysis. The production of glucose and xylose from OPEFB wastes showed the potential of this biomass as the source of renewable energy and fine chemicals production in Malaysia.
Updated BG Prasad socioeconomic classification, 2014: a commentary.
Mangal, Abha; Kumar, Varun; Panesar, Sanjeet; Talwar, Richa; Raut, Deepak; Singh, Saudan
2015-01-01
Modified BG Prasad socioeconomic scale is widely used to determine the socioeconomic status of study subjects in health studies in India. It is an income-based scale and, therefore, has to be constantly updated to take inflation and depreciation of rupee into account. The Consumer Price Index (CPI) for industrial workers (IW) is used to calculate updated income categories for January 2014. Details of the calculations involved will enable young researchers to calculate specific income categories for their research work. State-specific CPI values are also available on the Department of Labour website and should be used to determine more accurate income categories for the study area.
Directory of Open Access Journals (Sweden)
Ashraf T Soliman
2013-01-01
Full Text Available Background: Both insulin deficiency and resistance are reported in patients with β-thalassemia major (BTM. The use of continuous blood glucose monitoring (CGM, among the different methods for early detection of glycemic abnormalities, has not been studied thoroughly in these adolescents. Materials and Methods: To assess the oralglucose tolerance (OGT and 72-h continuous glucose concentration by the continuous glucose monitoring system (CGMS and calculate homeostatic model assessment (HOMA, and the quantitative insulin sensitivity check index (QUICKI was conducted in 16 adolescents with BTM who were receiving regular blood transfusions every 2-4 weeks and iron-chelation therapy since early childhood. Results: Sixteen adolescents with BTM (age: 19.75 ± 3 years were investigated. Using OGTT, (25% had impaired fasting blood (plasma glucose concentration (BG (>5.6 mmol/L. 2-h after the glucose load, one of them had BG = 16.2 mmol/L (diabetic and two had impaired glucose tolerance (IGT (BG > 7.8 and 11.1 mmol/L and 9 with IGT (56%. HOMA and QUICKI revealed levels 0.33 (0.36 ± 0.03, respectively, ruling out significant insulin resistance in these adolescents. There was a significant negative correlation between the β-cell function (B% on one hand and the fasting and the 2-h BG (r=−0.6, and − 0.48, P < 0.01, respectively on the other hand. Neither fasting serum insulin nor c-peptide concentrations were correlated with fasting BG or ferritin levels. The average and maximum blood glucose levels during CGM were significantly correlated with the fasting BG (r = 0.68 and 0.39, respectively, with P < 0.01 and with the BG at 2-hour after oral glucose intake (r = 0.87 and 0.86 respectively, with P < 0.001. Ferritin concentrations were correlated with the fasting BG and the 2-h blood glucose levels in the OGTT (r = 0.52, and r = 0.43, respectively, P < 0.01 as well as with the average BG recorded by CGM (r = 0.75, P < 0.01. Conclusion: CGM has proven to
Tritium monitoring in the GCFR sweep gas fuel irradiation capsule BG-10
International Nuclear Information System (INIS)
Gat, U.; Pruitt, M.E.; Longest, A.W.; Epstein, B.D.
1980-01-01
The release of tritium and its transport pathways were studied in a vented, pressure-equalized fuel rod which simulated a fuel rod in a Gas-Cooled Fast Reactor (GCFR). The purpose was to determine the fraction of total tritium production transported via the various pathways and to determine its chemical form (tritiated hydrogen or water). It was concluded that the fuel rod and its effluent venting lines retained low concentrations of HT (or T 2 ) and any HTO (or T 2 O) present. However, the addition of 1% hydrogen to the helium carrier gas quantitatively eluted the tritium from the charcoal trap integral to the fuel rod and from the effluent lines. The chemical composition of the tritium arriving at the monitoring system could be determined by means of converters which convert HT to HTO and vice versa. Ht was the dominant species in the samples measured
Schmid, Christina; Baumstark, Annette; Pleus, Stefan; Haug, Cornelia; Tesar, Martina; Freckmann, Guido
2014-03-01
The partial pressure of oxygen (pO2) in blood samples can affect glucose measurements with oxygen-sensitive systems. In this study, we assessed the influence of different pO2 levels on blood glucose (BG) measurements with five glucose oxidase (GOD) systems and one glucose dehydrogenase (GDH) system. All selected GOD systems were indicated by the manufacturers to be sensitive to increased oxygen content of the blood sample. Venous blood samples of 16 subjects (eight women, eight men; mean age, 52 years; three with type 1 diabetes, four with type 2 diabetes, and nine without diabetes) were collected. Aliquots of each sample were adjusted to the following pO2 values: ≤45 mm Hg, approximately 70 mm Hg, and ≥150 mm Hg. For each system, five consecutive measurements on each sample were performed using the same test strip lot. Relative differences between the mean BG value at a pO2 level of approximately 70 mm Hg, which was considered to be similar to pO2 values in capillary blood samples, and the mean BG value at pO2 levels ≤45 mm Hg and ≥150 mm Hg were calculated. The GOD systems showed mean relative differences between 11.8% and 44.5% at pO2 values ≤45 mm Hg and between -14.6% and -21.2% at pO2 values ≥150 mm Hg. For the GDH system, the mean relative differences were -0.3% and -0.2% at pO2 values ≤45 mm Hg and ≥150 mm Hg, respectively. The magnitude of the pO2 impact on BG measurements seems to vary among the tested oxygen-sensitive GOD systems. The pO2 range in which oxygen-sensitive systems operate well should be provided in the product information.
Li, Xiuxia; Li, Ran; Zhu, Bin; Gao, Xiwu; Liang, Pei
2018-06-01
The diamondback moth Plutella xylostella (L.) is the most widely distributed pest of cruciferous crops and has developed resistance to most commonly used insecticides, including chlorantraniliprole. Resistance to chlorantraniliprole is likely caused by mutations of the target, the ryanodine receptor, and/or mediated by an increase in detoxification enzyme activities. Although target-site resistance is documented in detail, resistance mediated by increased metabolism has rarely been reported. The activity of cytochrome P450 was significantly higher in two resistant P. xylostella populations than in a susceptible one. Among ten detected cytochrome P450 genes, CYP6BG1 was significantly overexpressed (over 80-fold) in a field-resistant population compared with expression in a susceptible one. Knockdown of CYP6BG1 by RNA interference dramatically reduced the 7-ethoxycoumarin-O-deethylase (7-ECOD) activity of P450 by 45.5% and increased the toxicity of chlorantraniliprole toward P. xylostella by 26.8% at 48 h postinjection of double-stranded RNA. By contrast, overexpression of CYP6BG1 in a transgenic Drosophila melanogaster line significantly decreased the toxicity of the insecticide to the transgenic flies. Overexpression of CYP6BG1 may contribute to chlorantraniliprole resistance in P. xylostella. Our findings will provide new insights into the mechanisms of resistance to diamide insecticides in other insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
International Nuclear Information System (INIS)
Romallosa, Kristine Marie D.; Caseria, Estrella S.; Piquero, Ronald E.; Agustin, Jan Aldrich A.
2011-01-01
During the Fukushima Nuclear Power Plant accident in Japan, one of the Philippines' measures to protect the public from radiological hazards of the accident is by monitoring agricultural and food imports for radioactive contamination. In this study, the sensitivity of the mobile Radiation Monitoring System (RM) in Manila Ports in detecting contamination in incoming foodstuff shipments was determined. Large volume synthetic 137 Cs reference sources were used to determine the minimum detectable concentration (MDC) of the RMS. The reference sources have radioactivity concentrations that are comparable to the PNRI guidance level of 1000 Bg/kg for 137 Cs that is destined for general consumption. Results of the MDC measurements show that the RMS units are sensitive enough to detect radioactivity levels that are within the guidance levels provided that a) the minimum package lot is approximately 200 kg, b) the package is positioned at the detector side, and c) the alarm setting of RMS is as calibrated. It was therefore established that the RMS can be used to initially screen incoming foodstuff shipments of possible contamination and thereby help minimize potential radiation exposures to the public. (author)
Clinical application of l-123 MlBG cardiac imaging
International Nuclear Information System (INIS)
Kang, Do Young
2004-01-01
Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy
Clinical application of l-123 MlBG cardiac imaging
Energy Technology Data Exchange (ETDEWEB)
Kang, Do Young [College of Medicine, Donga Univ., Busan (Korea, Republic of)
2004-10-01
Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy.
Holzgreve, Adrien; Brendel, Matthias; Gu, Song; Carlsen, Janette; Mille, Erik; Böning, Guido; Mastrella, Giorgia; Unterrainer, Marcus; Gildehaus, Franz J; Rominger, Axel; Bartenstein, Peter; Kälin, Roland E; Glass, Rainer; Albert, Nathalie L
2016-01-01
Noninvasive tumor growth monitoring is of particular interest for the evaluation of experimental glioma therapies. This study investigates the potential of positron emission tomography (PET) using O-(2-(18)F-fluoroethyl)-L-tyrosine ([(18)F]-FET) to determine tumor growth in a murine glioblastoma (GBM) model-including estimation of the biological tumor volume (BTV), which has hitherto not been investigated in the pre-clinical context. Fifteen GBM-bearing mice (GL261) and six control mice (shams) were investigated during 5 weeks by PET followed by autoradiographic and histological assessments. [(18)F]-FET PET was quantitated by calculation of maximum and mean standardized uptake values within a universal volume-of-interest (VOI) corrected for healthy background (SUVmax/BG, SUVmean/BG). A partial volume effect correction (PVEC) was applied in comparison to ex vivo autoradiography. BTVs obtained by predefined thresholds for VOI definition (SUV/BG: ≥1.4; ≥1.6; ≥1.8; ≥2.0) were compared to the histologically assessed tumor volume (n = 8). Finally, individual "optimal" thresholds for BTV definition best reflecting the histology were determined. In GBM mice SUVmax/BG and SUVmean/BG clearly increased with time, however at high inter-animal variability. No relevant [(18)F]-FET uptake was observed in shams. PVEC recovered signal loss of SUVmean/BG assessment in relation to autoradiography. BTV as estimated by predefined thresholds strongly differed from the histology volume. Strikingly, the individual "optimal" thresholds for BTV assessment correlated highly with SUVmax/BG (ρ = 0.97, p GBM mouse model. PVEC is beneficial to improve accuracy of [(18)F]-FET PET SUV quantification. Although SUVmax/BG and SUVmean/BG increase during the disease course, these parameters do not correlate with the respective tumor size. For the first time, we propose a histology-verified method allowing appropriate individual BTV estimation for volumetric in vivo monitoring of tumor growth
Baumstark, Annette; Schmid, Christina; Pleus, Stefan; Haug, Cornelia; Freckmann, Guido
2013-01-01
Background Partial pressure of oxygen (pO2) in blood samples can affect blood glucose (BG) measurements, particularly in systems that employ the glucose oxidase (GOx) enzyme reaction on test strips. In this study, we assessed the impact of different pO2 values on the performance of five GOx systems and one glucose dehydrogenase (GDH) system. Two of the GOx systems are labeled by the manufacturers to be sensitive to increased blood oxygen content, while the other three GOx systems are not. Methods Aliquots of 20 venous samples were adjusted to the following pO2 values: pO2 ~70 mmHg, which is considered to be similar to pO2 in capillary blood samples, and the mean BG result at pO2 pO2 pO2 ≥150 mmHg. For both pO2 levels, relative differences of all tested GOx systems were significant (p pO2 values pO2 variations lead to clinically relevant BG measurement deviations in GOx systems, even in GOx systems that are not labeled as being oxygen sensitive. PMID:24351177
International Nuclear Information System (INIS)
Mandic, D.; Zilavy, M. J.
2010-01-01
The main intention of this paper is to present feedback from the implementation of the new Turbine Control System (TCS) replacement project at Nuclear Power Plant (NPP) NEK - Krsko. From the plant construction time and the first plant start-up in 1981, the NPP NEK TG (Turbine-Generator) set was controlled and monitored by DEH (Digital Electro Hydraulic) Mod II Control System designed in 70's based on P2500 CPU and number of I/O controllers and modules. The P2500 CPU and associated controllers were built with discrete TTL components (TTL logic chips) and the P2500 CPU had 64k of 16 bit words of ferrite core memory. For that time, DEH Mod II had sophisticated MCR (Main Control Room) HMI (Human Machine Interface) based on digital functional keyboards, one alphanumeric black and white CRT monitor and printer. After twenty eight years of operation and because of several other reasons that are explained in the paper, NEK decided to replace the old DEH Mod II Control system with the new Emerson Ovation based DCS (Distributed Control System) on redundant platform for the control and monitoring of secondary plant systems in the NPP Krsko (NEK), and the new system was named PDEH (Programmable Digital Electro Hydraulic) TCS. In May 2007, NEK signed the turn-key contract with Westinghouse Electric Company (WEC) for the project of replacement of the TCS, Turbine Emergency Trip System (ETS), Moisture Separator Reheater (MSR) control and some other control and monitoring functions. WEC subcontracted a number of other companies for equipment delivery, AE (Architect Engineering Design) activities, specific software development tasks (changes of KFSS - Krsko Full Scope Simulator and PIS - Process Information System interface) and field installation activities. The subject project enveloped implementation of PDEH system on three application platforms: BG KFSS (Background KFSS), FG KFSS (Foreground KFSS) and PDEH system installed in the plant. The HMI for the BG KFSS platform
Symmetry Tests in Polarized Z{sup 0} Decays to b{bar b}g
Energy Technology Data Exchange (ETDEWEB)
Muller, David
1999-07-09
Angular asymmetries have been measured in polarized Z{sup 0} decays to b{bar b}g collected by the SLD experiment at the SLC. A high purity b{bar b}g event sample is selected by utilizing B lifetime information given by the SLD CCD pixel vertex detector and the stable micron-size SLC beams, and the b- and {bar b}-jets are identified using lifetime information and momentum- weighted track charge. The forward-backward asymmetry is observed in the b-quark polar angle distribution, and the parity-violation parameter is measured to test the Standard Model. Two angular correlations between the three-jet plane and the Z{sup 0} polarization are studied. The CP-even and T-odd, and the CP-odd and T-odd, angular asymmetries are sensitive to physics beyond the Standard Model. The latter requires tagging both the b- and {bar b}-jet. We measure the expectation values of these quantities to be consistent with zero and set limits on the correlations at the 5% level.
Obermaier, Karin; Schmelzeisen-Redeker, Günther; Schoemaker, Michael; Klötzer, Hans-Martin; Kirchsteiger, Harald; Eikmeier, Heino; del Re, Luigi
2013-07-01
Even though a Clinical and Laboratory Standards Institute proposal exists on the design of studies and performance criteria for continuous glucose monitoring (CGM) systems, it has not yet led to a consistent evaluation of different systems, as no consensus has been reached on the reference method to evaluate them or on acceptance levels. As a consequence, performance assessment of CGM systems tends to be inconclusive, and a comparison of the outcome of different studies is difficult. Published information and available data (as presented in this issue of Journal of Diabetes Science and Technology by Freckmann and coauthors) are used to assess the suitability of several frequently used methods [International Organization for Standardization, continuous glucose error grid analysis, mean absolute relative deviation (MARD), precision absolute relative deviation (PARD)] when assessing performance of CGM systems in terms of accuracy and precision. The combined use of MARD and PARD seems to allow for better characterization of sensor performance. The use of different quantities for calibration and evaluation, e.g., capillary blood using a blood glucose (BG) meter versus venous blood using a laboratory measurement, introduces an additional error source. Using BG values measured in more or less large intervals as the only reference leads to a significant loss of information in comparison with the continuous sensor signal and possibly to an erroneous estimation of sensor performance during swings. Both can be improved using data from two identical CGM sensors worn by the same patient in parallel. Evaluation of CGM performance studies should follow an identical study design, including sufficient swings in glycemia. At least a part of the study participants should wear two identical CGM sensors in parallel. All data available should be used for evaluation, both by MARD and PARD, a good PARD value being a precondition to trust a good MARD value. Results should be analyzed and
Freckmann, Guido; Baumstark, Annette; Schmid, Christina; Pleus, Stefan; Link, Manuela; Haug, Cornelia
2014-02-01
Systems for self-monitoring of blood glucose (SMBG) have to provide accurate and reproducible blood glucose (BG) values in order to ensure adequate therapeutic decisions by people with diabetes. Twelve SMBG systems were compared in a standardized manner under controlled laboratory conditions: nine systems were available on the German market and were purchased from a local pharmacy, and three systems were obtained from the manufacturer (two systems were available on the U.S. market, and one system was not yet introduced to the German market). System accuracy was evaluated following DIN EN ISO (International Organization for Standardization) 15197:2003. In addition, measurement reproducibility was assessed following a modified TNO (Netherlands Organization for Applied Scientific Research) procedure. Comparison measurements were performed with either the glucose oxidase method (YSI 2300 STAT Plus™ glucose analyzer; YSI Life Sciences, Yellow Springs, OH) or the hexokinase method (cobas(®) c111; Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's measurement procedure. The 12 evaluated systems showed between 71.5% and 100% of the measurement results within the required system accuracy limits. Ten systems fulfilled with the evaluated test strip lot minimum accuracy requirements specified by DIN EN ISO 15197:2003. In addition, accuracy limits of the recently published revision ISO 15197:2013 were applied and showed between 54.5% and 100% of the systems' measurement results within the required accuracy limits. Regarding measurement reproducibility, each of the 12 tested systems met the applied performance criteria. In summary, 83% of the systems fulfilled with the evaluated test strip lot minimum system accuracy requirements of DIN EN ISO 15197:2003. Each of the tested systems showed acceptable measurement reproducibility. In order to ensure sufficient measurement quality of each distributed test strip lot, regular evaluations are required.
Data acquisition system for segmented reactor antineutrino detector
Czech Academy of Sciences Publication Activity Database
Hons, Zdeněk; Vlášek, J.
2017-01-01
Roč. 12, č. 1 (2017), č. článku P01022. ISSN 1748-0221 R&D Projects: GA MŠk LG14004 Institutional support: RVO:61389005 Keywords : Data acquisition concepts * Detector control systems (detector and experiment monitoring and slow-control system, architecture , hardware, algorithms, databases) * Neutrino detectors Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders OBOR OECD: Nuclear physics Impact factor: 1.220, year: 2016
Directory of Open Access Journals (Sweden)
Aiqin Liu
Full Text Available BACKGROUND: Giardia duodenalis is a common intestinal parasite that infects humans and many other mammals, mainly distributing in some areas with poor sanitation. The proportion of the human giardiasis burden attributable to G. duodenalis of animal origin differs in different geographical areas. In Mainland China, genetic data of the gdh and bg genes of G. duodenalis from animals are only limited in dogs and cats. The aim of the study was to provide information on the genetic characterizations of animal-derived G. duodenalis isolates (from rabbits, sheep and cattle at both loci in Heilongjiang Province, Northeastern China, and to assess the potential for zoonotic transmission. METHODOLOGY/PRINCIPAL FINDINGS: 61 G. duodenalis isolates from animal feces (dairy and beef cattle, sheep and rabbits in Heilongjiang Province were characterized at the gdh and bg loci in the present study. The gdh and bg gene sequences of sheep-derived G. duodenalis assemblage AI, and the gdh sequences of rabbit-derived G. duodenalis assemblage B had 100% similarity with those from humans, respectively. Novel subtypes of G. duodenalis were identified, with one and seven subtypes for assemblages A and E at the gdh locus, and two and three subtypes for assemblages B and E at the bg locus, respectively. Three pairs of the same bg sequences of assemblage E were observed in sheep and cattle. CONCLUSIONS/SIGNIFICANCE: This is the first description of genetic characterizations of the gdh and bg genes of G. duodenalis from rabbits, sheep and cattle in Mainland China. Homology analysis of assemblages AI and B implied the possibility of zoonotic transmission. The novel subtypes of assemblages of G. duodenalis may represent the endemic genetic characteristics of G. duodenalis in Heilongjiang Province, China.
Rolan, Paul E; O'Neill, Gilmore; Versage, Eve; Rana, Jitesh; Tang, Yongqiang; Galluppi, Gerald; Aycardi, Ernesto
2015-01-01
To evaluate the safety, tolerability, and pharmacokinetics of single doses of BG00010 (neublastin, artemin, enovin) in subjects with unilateral sciatica. This was a single-center, blinded, placebo-controlled, randomized Phase 1 sequential-cohort, dose-escalation study (ClinicalTrials.gov identifier NCT00961766; funded by Biogen Idec). Adults with unilateral sciatica were enrolled at The Royal Adelaide Hospital, Australia. Four subjects were assigned to each of eleven cohorts (intravenous BG00010 0.3, 1, 3, 10, 25, 50, 100, 200, 400, or 800 μg/kg, or subcutaneous BG00010 50 μg/kg) and were randomized 3:1 to receive a single dose of BG00010 or placebo. The primary safety and tolerability assessments were: adverse events; clinical laboratory parameters and vital signs; pain as measured by a Likert rating scale; intra-epidermal nerve fiber density; and longitudinal assessment of quantitative sensory test parameters. Blood, serum, and plasma samples were collected for pharmacokinetic and pharmacodynamic assessments. Subjects were blinded to treatment assignment throughout the study. The investigator was blinded to treatment assignment until the Data Safety Review Committee review of unblinded data, which occurred after day 28. Beyond the planned enrollment of 44 subjects, four additional subjects were enrolled into to the intravenous BG00010 200 μg/kg cohort after one original subject experienced mild generalized pruritus. Therefore, a total of 48 subjects were enrolled between August 2009 and December 2011; all were included in the safety analyses. BG00010 was generally well tolerated: in primary analyses, the most common treatment-emergent adverse events were changes in temperature perception, pruritus, rash, or headache; no trends were observed in clinical laboratory parameters, vital signs, intra-epidermal nerve fiber density, or quantitative sensory testing. BG00010 was not associated with any clear, dose-dependent trends in Likert pain scores. BG00010 was
Safety system status monitoring
International Nuclear Information System (INIS)
Lewis, J.R.; Morgenstern, M.H.; Rideout, T.H.; Cowley, P.J.
1984-03-01
The Pacific Northwest Laboratory has studied the safety aspects of monitoring the preoperational status of safety systems in nuclear power plants. The goals of the study were to assess for the NRC the effectiveness of current monitoring systems and procedures, to develop near-term guidelines for reducing human errors associated with monitoring safety system status, and to recommend a regulatory position on this issue. A review of safety system status monitoring practices indicated that current systems and procedures do not adequately aid control room operators in monitoring safety system status. This is true even of some systems and procedures installed to meet existing regulatory guidelines (Regulatory Guide 1.47). In consequence, this report suggests acceptance criteria for meeting the functional requirements of an adequate system for monitoring safety system status. Also suggested are near-term guidelines that could reduce the likelihood of human errors in specific, high-priority status monitoring tasks. It is recommended that (1) Regulatory Guide 1.47 be revised to address these acceptance criteria, and (2) the revised Regulatory Guide 1.47 be applied to all plants, including those built since the issuance of the original Regulatory Guide
Safety system status monitoring
Energy Technology Data Exchange (ETDEWEB)
Lewis, J.R.; Morgenstern, M.H.; Rideout, T.H.; Cowley, P.J.
1984-03-01
The Pacific Northwest Laboratory has studied the safety aspects of monitoring the preoperational status of safety systems in nuclear power plants. The goals of the study were to assess for the NRC the effectiveness of current monitoring systems and procedures, to develop near-term guidelines for reducing human errors associated with monitoring safety system status, and to recommend a regulatory position on this issue. A review of safety system status monitoring practices indicated that current systems and procedures do not adequately aid control room operators in monitoring safety system status. This is true even of some systems and procedures installed to meet existing regulatory guidelines (Regulatory Guide 1.47). In consequence, this report suggests acceptance criteria for meeting the functional requirements of an adequate system for monitoring safety system status. Also suggested are near-term guidelines that could reduce the likelihood of human errors in specific, high-priority status monitoring tasks. It is recommended that (1) Regulatory Guide 1.47 be revised to address these acceptance criteria, and (2) the revised Regulatory Guide 1.47 be applied to all plants, including those built since the issuance of the original Regulatory Guide.
Monitoring Cray Cooling Systems
Energy Technology Data Exchange (ETDEWEB)
Maxwell, Don E [ORNL; Ezell, Matthew A [ORNL; Becklehimer, Jeff [Cray, Inc.; Donovan, Matthew J [ORNL; Layton, Christopher C [ORNL
2014-01-01
While sites generally have systems in place to monitor the health of Cray computers themselves, often the cooling systems are ignored until a computer failure requires investigation into the source of the failure. The Liebert XDP units used to cool the Cray XE/XK models as well as the Cray proprietary cooling system used for the Cray XC30 models provide data useful for health monitoring. Unfortunately, this valuable information is often available only to custom solutions not accessible by a center-wide monitoring system or is simply ignored entirely. In this paper, methods and tools used to harvest the monitoring data available are discussed, and the implementation needed to integrate the data into a center-wide monitoring system at the Oak Ridge National Laboratory is provided.
Macrury, Sandra; Srinivasan, Aparna; Mahoney, John J
2013-03-01
Blood glucose (BG) meters used for assisted monitoring of blood glucose (AMBG) require different attributes compared with meters designed for home use. These include safety considerations (i.e., minimized risk of blood-borne pathogen transmission), capability for testing multiple blood sample types, and enhanced performance specifications. The OneTouch® Verio™Pro+ BG meter is designed to incorporate all of these attributes. Meter accuracy was assessed in clinical studies with arterial, venous, and capillary blood samples with a hematocrit range of 22.9-59.8%. The effect of interferents, including anticoagulants, on accuracy was evaluated. The meter disinfection protocol was validated, and instructions for use and user acceptance of the system were assessed. A total of 97% (549/566) of BG measures from all blood sample types and 95.5% (191/200) of arterial blood samples were within ±12 mg/dl or 12.5% of reference measurements. The system was unaffected by 4 anticoagulants and 57 of 59 endogenous and exogenous compounds; it was affected by 2 compounds: pralidoxime iodide and xylose. Bleach wipes were sufficient to disinfect the meter. Users felt that the meter's quality control (QC) prompts would help them to comply with regulatory requirements. The meter provided accurate measurements of different blood samples over a wide hematocrit range and was not affected by 57 physiologic and therapeutic compounds. The QC prompts and specific infection-mitigating design further aid to make this meter system practical for AMBG in care facilities. © 2013 Diabetes Technology Society.
Evaluating penetration-monitoring systems
International Nuclear Information System (INIS)
Markin, J.T.
1981-01-01
Evaluating the performance of a process monitoring system in detecting improper activities that could be related to material diversion requires a framework for addressing the complexity and statistical uncertainty of such systems. This report proposes a methodology that determines the optimal divertor strategy against a monitoring system and the system probability of detection. This method extends previous work by correctly modeling uncorrelated and correlated measurement errors for radiation monitors
Environmental radiation monitoring system
International Nuclear Information System (INIS)
Kato, Tsutomu; Shioiri, Masatoshi; Sakamaki, Tsuyoshi
2007-01-01
Environmental radiation monitoring systems are used to measure and monitoring gamma-rays at the observation boundaries of nuclear facilities and in the surrounding areas. In recent years, however, few new nuclear facilities have been constructed and the monitoring systems shift to renewal of existing systems. In addition, in order to increase public acceptance, the facilities are being equipped with communication lines to provide data to prefectural environmental centers. In this text, we introduce the latest technology incorporated in replacement of environmental radiation monitoring systems. We also introduce a replacement method that can shorten the duration during which environmental dose rate measurement is interrupted by enabling both the replacement system and the system being replaced to perform measurements in parallel immediately before and after the replacement. (author)
DEFF Research Database (Denmark)
Kaufman, J; Salomonsen, J; Skjødt, K
1990-01-01
B-G antigens are cell-surface molecules encoded by a highly polymorphic multigene family located in the chicken major histocompatibility complex (MHC). Rabbit antisera to B-G molecules immunoprecipitate 3-6 bands from iodinated erythrocytes by sodium dodecyl sulfate (SDS) gels under reducing......, which bear intrachain disulfide bonds. All 3-6 bands have different mobilities in SDS gels between different haplotypes, ranging from 30 to 55 kDa. This size polymorphism is not affected by glycosidase treatment or addition of protease inhibitors. Partial proteolysis of cell surface-iodinated B...
International Nuclear Information System (INIS)
Tian, Mei; Cui, Ya-Zhou; Song, Guan-Hua; Zong, Mei-Juan; Zhou, Xiao-Yan; Chen, Yu; Han, Jin-Xiang
2008-01-01
There is an urgent need to discover more sensitive and specific biomarkers to improve early diagnosis and screen high-risk patients for pancreatic ductal adenocarcinoma (PDAC). Pancreatic juice is an ideal specimen for PDAC biomarkers discovery, because it is an exceptionally rich source of proteins released from pancreatic cancer cells. To identify novel potential biomarkers for PDAC from pancreatic juice, we carried out difference gel electrophoresis (DIGE) and tandem mass spectrometry (MS/MS) to compare the pancreatic juice profiling from 9 PDAC patients and 9 cancer-free controls. Of the identified differently expressed proteins, three up-regulated proteins in pancreatic cancer juice, matrix metalloproteinase-9 (MMP-9), oncogene DJ1 (DJ-1) and alpha-1B-glycoprotein precursor (A1BG), were selected for validation by Western blot and immunohistochemistry. Serum MMP-9 levels were also detected by enzyme linked immunosorbent assay (ELISA). Fourteen proteins were up-regulated and ten proteins were down-regulated in cancerous pancreatic juice compared with cancer-free controls. Increased MMP-9, DJ-1 and A1BG expression in cancerous pancreatic juice were confirmed by Western blot. Immunohistochemical study showed MMP-9, DJ-1 and A1BG positively expressed in 82.4%, 72.5% and 86.3% of pancreatic cancer tissues, significantly higher than that in normal pancreas tissues. Up-regulation of DJ-1 was associated with better differentiation (p < 0.05). Serum MMP-9 levels were significantly higher in PDAC (255.14 ng/ml) than those in chronic pancreatitis (210.22 ng/ml, p = 0.009) and healthy control (203.77 ng/ml, p = 0.027). The present proteome analysis revealed MMP-9, DJ-1 and A1BG proteins as elevated in pancreatic juice from PDAC, which suggest their further utility in PDAC diagnosis and screening. This is the first time A1BG was identified as a potential biomarker in pancreatic cancer associated samples. The measurement of serum MMP-9 might be clinically useful for PDAC
High ethanol tolerance of the thermophilic anaerobic ethanol producer Thermoanaerobacter BG1L1
DEFF Research Database (Denmark)
Georgieva, Tania I.; Mikkelsen, Marie Just; Ahring, Birgitte Kiær
2007-01-01
The low ethanol tolerance of thermophilic anaerobic bacteria, generally less than 2% (v/v) ethanol, is one of the main limiting factors for their potential use for second generation fuel ethanol production. In this work, the tolerance of thermophilic anaerobic bacterium Thermoanaerobacter BG 1L1...... to exogenously added ethanol was studied in a continuous immobilized reactor system at a growth temperature of 70 degrees C. Ethanol tolerance was evaluated based on inhibition of fermentative performance e.g.. inhibition of substrate conversion. At the highest ethanol concentration tested (8.3% v/v), the strain...... was able to convert 42% of the xylose initially present, indicating that this ethanol concentration is not the upper limit tolerated by the strain. Long-term strain adaptation to high ethanol concentrations (6 - 8.3%) resulted in an improvement of xylose conversion by 25% at an ethanol concentration of 5...
Energy Technology Data Exchange (ETDEWEB)
Shokri, S. [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Movahedi, B., E-mail: b.movahedi@ast.ui.ac.ir [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Rafieinia, M. [Biosensor Research Center, Department of Advanced Medical Technology, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of); Salehi, H. [Department of Anatomical Sciences, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of)
2015-12-01
Graphical abstract: - Highlights: • Nanocomposite scaffold was produced using a novel technique. • Bioactive glass, carbon nanotube and chitosan were used for fabrication of nanocomposite scaffold. • The compressive strength of the scaffold was near to the cancellous bone. • Biodegradability of the scaffolds in PBS shows the slow destruction. - Abstract: In the present study, bioactive glass (BG), carbon nanotube (CNT), and chitosan (Cs) were used with different ratios for the fabrication of nanocomposite scaffold for bone tissue engineering. BG was synthesized by sol–gel process and CNT was functionalized by immersing in sulfuric acid as well as nitric acid. Nanocomposite scaffold was produced using a novel technique, hot press, and salt leaching process and cross-linked by Hexamethylene diisocyanate (HDI). The optimum porosity of the scaffold with respect to the ratio of salt and precursor was kept around 70%. Mechanical properties of the scaffolds were increased by the addition of CNT and hence, the compressive strength of them with 4 wt% CNT was increased up to 5.95 ± 0.5 MPa. The nanocomposite scaffolds were characterized by FT-IR, SEM, XRD, and electrochemical analysis. Furthermore, scaffolds were immersed in PBS for evaluating the biodegradability, water absorption, and CNT release. The results indicated that water absorption of the scaffolds was increased by adding CNT to the scaffold. The amount of released CNT after 30 days was measured within 6 × 10{sup −4} and 1 × 10{sup −3} mg/ml. Attachment and proliferation of MG63 osteoblast cell line on Cs/BG/CNT scaffolds were investigated by MTT assay indicating no toxicity for this nanocomposite scaffolds. According to the results of the experiments, the nanocomposite scaffold with modified composition (Cs/BG/CNT, 80:20:2 wt%) was the best one in matters of mechanical, chemical, and cellular properties and also the most appropriate for trabecular bone tissue.
Integrated photovoltaic (PV) monitoring system
Mahinder Singh, Balbir Singh; Husain, NurSyahidah; Mohamed, Norani Muti
2012-09-01
The main aim of this research work is to design an accurate and reliable monitoring system to be integrated with solar electricity generating system. The performance monitoring system is required to ensure that the PVEGS is operating at an optimum level. The PV monitoring system is able to measure all the important parameters that determine an optimum performance. The measured values are recorded continuously, as the data acquisition system is connected to a computer, and data is stored at fixed intervals. The data can be locally used and can also be transmitted via internet. The data that appears directly on the local monitoring system is displayed via graphical user interface that was created by using Visual basic and Apache software was used for data transmission The accuracy and reliability of the developed monitoring system was tested against the data that captured simultaneously by using a standard power quality analyzer device. The high correlation which is 97% values indicates the level of accuracy of the monitoring system. The aim of leveraging on a system for continuous monitoring system is achieved, both locally, and can be viewed simultaneously at a remote system.
Thomas, Felicity; Signal, Mathew; Harris, Deborah L; Weston, Philip J; Harding, Jane E; Shaw, Geoffrey M; Chase, J Geoffrey
2014-05-01
Neonatal hypoglycemia is common and can cause serious brain injury. Continuous glucose monitoring (CGM) could improve hypoglycemia detection, while reducing blood glucose (BG) measurements. Calibration algorithms use BG measurements to convert sensor signals into CGM data. Thus, inaccuracies in calibration BG measurements directly affect CGM values and any metrics calculated from them. The aim was to quantify the effect of timing delays and calibration BG measurement errors on hypoglycemia metrics in newborn infants. Data from 155 babies were used. Two timing and 3 BG meter error models (Abbott Optium Xceed, Roche Accu-Chek Inform II, Nova Statstrip) were created using empirical data. Monte-Carlo methods were employed, and each simulation was run 1000 times. Each set of patient data in each simulation had randomly selected timing and/or measurement error added to BG measurements before CGM data were calibrated. The number of hypoglycemic events, duration of hypoglycemia, and hypoglycemic index were then calculated using the CGM data and compared to baseline values. Timing error alone had little effect on hypoglycemia metrics, but measurement error caused substantial variation. Abbott results underreported the number of hypoglycemic events by up to 8 and Roche overreported by up to 4 where the original number reported was 2. Nova results were closest to baseline. Similar trends were observed in the other hypoglycemia metrics. Errors in blood glucose concentration measurements used for calibration of CGM devices can have a clinically important impact on detection of hypoglycemia. If CGM devices are going to be used for assessing hypoglycemia it is important to understand of the impact of these errors on CGM data. © 2014 Diabetes Technology Society.
Directory of Open Access Journals (Sweden)
Rafael Maciel-de-Freitas
2006-05-01
Full Text Available In recent years, the development of new tools to gather field information about vector ecological parameters has increased. This report evaluated the BG-Sentinel Trap (BGS-Trap, a promising new attempt to improve collection of the dengue vector, Aedes aegypti. The efficacy of the BGS-Trap was compared with the CDC backpack aspirator, one of the commonest used methods for capturing adult mosquitoes. BGS-Traps captured significantly more Ae. aegypti males (chi2 = 21.774, df = 1, P < 0.05 and females (chi2 = 56.007, df = 1, P < 0.05 than CDC aspirator during all days of field collection. However, CDC aspirator was significantly more efficient to capture Culex quinquefasciatus males (chi2 = 5.681, df = 1, P < 0.05 and females (chi2 = 6.553, df = 1, P < 0.05. BGS-Traps captured host-seeking females (varying between 68.75 to 89.8% in detriment of females in other behavioral and physiological stages. BGS-Traps proved to be efficient and can be used for monitoring adult mosquito populations.
DEFF Research Database (Denmark)
Salomonsen, J; Skjødt, K; Crone, M
1987-01-01
and affinity-purified once more. Finally, reverse-phase chromatography resulted in a pure product. The B-G antigen was identified in the various fractions by rocket immunoelectrophoresis. The final product was more than 99% pure, as estimated by SDS-PAGE analysis followed by silver stain of proteins. The yield...
Directory of Open Access Journals (Sweden)
Othmar Moser
2016-08-01
Full Text Available Continuous exercise (CON and high-intensity interval exercise (HIIE can be safely performed with type 1 diabetes mellitus (T1DM. Additionally, continuous glucose monitoring (CGM systems may serve as a tool to reduce the risk of exercise-induced hypoglycemia. It is unclear if CGM is accurate during CON and HIIE at different mean workloads. Seven T1DM patients performed CON and HIIE at 5% below (L and above (M the first lactate turn point (LTP1, and 5% below the second lactate turn point (LTP2 (H on a cycle ergometer. Glucose was measured via CGM and in capillary blood (BG. Differences were found in comparison of CGM vs. BG in three out of the six tests (p < 0.05. In CON, bias and levels of agreement for L, M, and H were found at: 0.85 (−3.44, 5.15 mmol·L−1, −0.45 (−3.95, 3.05 mmol·L−1, −0.31 (−8.83, 8.20 mmol·L−1 and at 1.17 (−2.06, 4.40 mmol·L−1, 0.11 (−5.79, 6.01 mmol·L−1, 1.48 (−2.60, 5.57 mmol·L−1 in HIIE for the same intensities. Clinically-acceptable results (except for CON H were found. CGM estimated BG to be clinically acceptable, except for CON H. Additionally, using CGM may increase avoidance of exercise-induced hypoglycemia, but usual BG control should be performed during intense exercise.
Inductive Monitoring System (IMS)
National Aeronautics and Space Administration — IMS: Inductive Monitoring System The Inductive Monitoring System (IMS) is a tool that uses a data mining technique called clustering to extract models of normal...
CERN safety system monitoring - SSM
International Nuclear Information System (INIS)
Hakulinen, T.; Ninin, P.; Valentini, F.; Gonzalez, J.; Salatko-Petryszcze, C.
2012-01-01
CERN SSM (Safety System Monitoring) is a system for monitoring state-of-health of the various access and safety systems of the CERN site and accelerator infrastructure. The emphasis of SSM is on the needs of maintenance and system operation with the aim of providing an independent and reliable verification path of the basic operational parameters of each system. Included are all network-connected devices, such as PLCs (local purpose control unit), servers, panel displays, operator posts, etc. The basic monitoring engine of SSM is a freely available system-monitoring framework Zabbix, on top of which a simplified traffic-light-type web-interface has been built. The web-interface of SSM is designed to be ultra-light to facilitate access from hand-held devices over slow connections. The underlying Zabbix system offers history and notification mechanisms typical of advanced monitoring systems. (authors)
El Awwa, A; Soliman, A; Al-Ali, M; Yassin, M; De Sanctis, V
2012-09-01
In obese adolescents pancreatic beta-cells may not be able to cope with insulin resistance leading to hyperglycemia and type2 diabetes (T2DM To assess oral glucose tolerance, 72-h continuous blood glucose concentrations (CGM) and calculate homeostatic model assessment (HOMA), and the quantitative insulin sensitivity check index (QUICKI) in 13 adolescents with simple obesity (BMI SDS=4 ± 1.06). OGTT performed in 13 obese adolescents (13.47 ± 3 years) revealed 3 cases (23%) with impaired fasting glucose (IFG: fasting glucose >5.6 mmol/L), 4 cases (30%) with impaired glucose tolerance (IGT: 2h blood glucose >7.8 continuous glucose monitoring system ( CGMS), IFG was detected in 4 cases, the maximum serum blood glucose (BG : 2h or more after meal) was >7.8 and 11.1 mmol/L (diabetes) in one case (7.6%). Five cases had a minimum BG recorded of 2.6 and QUICKI values obese adolescents, CGMS is superior to OGTT and HbA1C in detecting glycemic abnormalities, which appears to be secondary to insulin resistance.
Copilot: Monitoring Embedded Systems
Pike, Lee; Wegmann, Nis; Niller, Sebastian; Goodloe, Alwyn
2012-01-01
Runtime verification (RV) is a natural fit for ultra-critical systems, where correctness is imperative. In ultra-critical systems, even if the software is fault-free, because of the inherent unreliability of commodity hardware and the adversity of operational environments, processing units (and their hosted software) are replicated, and fault-tolerant algorithms are used to compare the outputs. We investigate both software monitoring in distributed fault-tolerant systems, as well as implementing fault-tolerance mechanisms using RV techniques. We describe the Copilot language and compiler, specifically designed for generating monitors for distributed, hard real-time systems. We also describe two case-studies in which we generated Copilot monitors in avionics systems.
Waste monitoring system for effluents
International Nuclear Information System (INIS)
Macdonald, J.M.; Gomez, B.; Trujillo, L.; Malcom, J.E.; Nekimken, H.; Pope, N.; Bibeau, R.
1995-07-01
The waste monitoring system in use at Los Alamos National Laboratory's Plutonium Facility, TA-55, is a computer-based system that proves real-time information on industrial effluents. Remote computers monitor discharge events and data moves from one system to another via a local area network. This report describes the history, system design, summary, instrumentation list, displays, trending screens, and layout of the waste monitoring system
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Background: Bitter melon (Momordica charantia) is a commonly used food crop for management of a variety of diseases most notably for control of diabetes, a disease associated with aberrant inflammation. Purpose: To evaluate the anti-inflammatory property of BG-4, a novel bioactive peptide isolated f...
Energy Technology Data Exchange (ETDEWEB)
NONE
1996-02-01
Much of the machinery throughout the APS will be controlled by VME based computers. In order to increase the reliability of the system, it is necessary to be able to monitor the status of each VME crate. In order to do this, a VME System Monitor was created. In addition to being able to monitor and report the status (watchdog timer, temperature, CPU (Motorola MVME 167) state (status, run, fail), and the power supply), it includes provisions to remotely reset the CPU and VME crate, digital I/O, and parts of the transition module (serial port and ethernet connector) so that the Motorla MVME 712 is not needed. The standard VME interface was modified on the System Monitor so that in conjunction with the Motorola MVME 167 a message based VXI interrupt handler could is implemented. The System Monitor is a single VME card (6U). It utilizes both the front panel and the P2 connector for I/O. The front panel contains a temperature monitor, watchdog status LED, 4 general status LEDs, input for a TTL interrupt, 8 binary inputs (24 volt, 5 volt, and dry contact sense), 4 binary outputs (dry contact, TTL, and 100 mA), serial port (electrical RS-232 or fiber optic), ethernet transceiver (10 BASE-FO or AUI), and a status link to neighbor crates. The P2 connector is used to provide the serial port and ethernet to the processor. In order to abort and read the status of the CPU, a jumper cable must be connected between the CPU and the System Monitor.
Directory of Open Access Journals (Sweden)
Hanna Mazur
2001-09-01
Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.
Environmental monitoring and information systems
International Nuclear Information System (INIS)
Gibbert, R.
1998-01-01
Environmental monitoring and information systems installed by Dornier are summarized. A broad spectrum of environmental areas from air quality and water to radioactivity is covered. Nuclear power plant monitoring systems, either as remote or plant-internal monitoring systems, form an important element of the work undertaken. The systems delivered covered local, regional or national areas. The range of services provided, and hardware and software platforms are listed. (R.P.)
Data monitoring system of technical diagnosis system for EAST
International Nuclear Information System (INIS)
Qian Jing; Weng Peide; Chen Zhuomin; Wu Yu; Xi Weibin; Luo Jiarong
2010-01-01
Technical diagnosis system (TDS) is an important subsystem to monitor status parameters of EAST (experimental advanced superconducting tokamak). The upgraded TDS data monitoring system is comprised of management floor, monitoring floor and field floor.. Security protection, malfunction record and analysis are designed to make the system stable, robust and friendly. During the past EAST campaigns, the data monitoring system has been operated reliably and stably. The signal conditioning system and software architecture are described. (authors)
The JOYO remote monitoring system
International Nuclear Information System (INIS)
Damico, Joseph P.; Hashimoto, Yu
2000-01-01
The evolution of the personal computer, operating systems and applications software and the Internet has brought drastic change and many benefits worldwide. Remote monitoring systems benefit from computer network and other modern software technologies. The availability of fast, inexpensive and secure communications enables new solutions for monitoring system applications. The JOYO Remote Monitoring System (RMS) utilizes computer network communications and modular software design to provide a distributed integrated solution for monitoring multiple storage locations. This paper describes the remote monitoring system installed at the JOYO Fast Reactor. The system combines sensors, software, and computer network technologies to create a powerful data collection, storage and dissemination capability. The RMS provides a flexible, scalable solution for a variety of applications. The RMS integrates a variety of state of the art technologies from several sources and serves as a test bed for cutting edge technologies that can be shared with outside users. This paper describes the system components and their operation and discusses system benefits. Current activities and future plants for the JOYO RMS will be discussed. (author)
Unattended Monitoring System Design Methodology
International Nuclear Information System (INIS)
Drayer, D.D.; DeLand, S.M.; Harmon, C.D.; Matter, J.C.; Martinez, R.L.; Smith, J.D.
1999-01-01
A methodology for designing Unattended Monitoring Systems starting at a systems level has been developed at Sandia National Laboratories. This proven methodology provides a template that describes the process for selecting and applying appropriate technologies to meet unattended system requirements, as well as providing a framework for development of both training courses and workshops associated with unattended monitoring. The design and implementation of unattended monitoring systems is generally intended to respond to some form of policy based requirements resulting from international agreements or domestic regulations. Once the monitoring requirements are established, a review of the associated process and its related facilities enables identification of strategic monitoring locations and development of a conceptual system design. The detailed design effort results in the definition of detection components as well as the supporting communications network and data management scheme. The data analyses then enables a coherent display of the knowledge generated during the monitoring effort. The resultant knowledge is then compared to the original system objectives to ensure that the design adequately addresses the fundamental principles stated in the policy agreements. Implementation of this design methodology will ensure that comprehensive unattended monitoring system designs provide appropriate answers to those critical questions imposed by specific agreements or regulations. This paper describes the main features of the methodology and discusses how it can be applied in real world situations
Savannah River Plant remote environmental monitoring system
International Nuclear Information System (INIS)
Schubert, J.F.
1987-01-01
The SRP remote environmental monitoring system consists of separations facilities stack monitors, production reactor stack monitors, twelve site perimeter monitors, river and stream monitors, a geostationary operational environmental satellite (GOES) data link, reactor cooling lake thermal monitors, meteorological tower system, Weather Information and Display (WIND) system computer, and the VANTAGE data base management system. The remote environmental monitoring system when fully implemented will provide automatic monitoring of key stack releases and automatic inclusion of these source terms in the emergency response codes
Directory of Open Access Journals (Sweden)
Laura Mejía-Teniente
2015-11-01
Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Arduino Based Infant Monitoring System
Farhanah Mohamad Ishak, Daing Noor; Jamil, Muhammad Mahadi Abdul; Ambar, Radzi
2017-08-01
This paper proposes a system for monitoring infant in an incubator and records the relevant data into a computer. The data recorded by the system can be further referred by the neonatal intensive care unit (NICU) personnel for diagnostic or research purposes. The study focuses on designing the monitoring system that consists of an incubator equipped with humidity sensor to measure the humidity level, and a pulse sensor that can be attached on an infant placed inside the incubator to monitor infant’s heart pulse. The measurement results which are the pulse rate and humidity level are sent to the PC via Arduino microcontroller. The advantage of this system will be that in the future, it may also enable doctors to closely monitor the infant condition through local area network and internet. This work is aimed as an example of an application that contributes towards remote tele-health monitoring system.
International Nuclear Information System (INIS)
Reneke, J.A.; Fryer, M.O.
1995-01-01
Well designed large systems include many instrument taking data. These data are used in a variety of ways. They are used to control the system and its components, to monitor system and component health, and often for historical or financial purposes. This paper discusses a new method of using data from low level instrumentation to monitor system and component health. The method uses the covariance of instrument outputs to calculate a measure of system change. The method involves no complicated modeling since it is not a parameter estimation algorithm. The method is iterative and can be implemented on a computer in real time. Examples are presented for a metal lathe and a high efficiency particulate air (HEPA) filter. It is shown that the proposed method is quite sensitive to system changes such as wear out and failure. The method is useful for low level system diagnostics and fault detection
Integrated Monitoring System of Production Processes
Directory of Open Access Journals (Sweden)
Oborski Przemysław
2016-12-01
Full Text Available Integrated monitoring system for discrete manufacturing processes is presented in the paper. The multilayer hardware and software reference model was developed. Original research are an answer for industry needs of the integration of information flow in production process. Reference model corresponds with proposed data model based on multilayer data tree allowing to describe orders, products, processes and save monitoring data. Elaborated models were implemented in the integrated monitoring system demonstrator developed in the project. It was built on the base of multiagent technology to assure high flexibility and openness on applying intelligent algorithms for data processing. Currently on the base of achieved experience an application integrated monitoring system for real production system is developed. In the article the main problems of monitoring integration are presented, including specificity of discrete production, data processing and future application of Cyber-Physical-Systems. Development of manufacturing systems is based more and more on taking an advantage of applying intelligent solutions into machine and production process control and monitoring. Connection of technical systems, machine tools and manufacturing processes monitoring with advanced information processing seems to be one of the most important areas of near future development. It will play important role in efficient operation and competitiveness of the whole production system. It is also important area of applying in the future Cyber-Physical-Systems that can radically improve functionally of monitoring systems and reduce the cost of its implementation.
Maintenance of radiation monitoring systems
International Nuclear Information System (INIS)
Aoyama, Kei
2001-01-01
As the safety and quality of atomic power facilities are more strongly required, the reliability improvement and preventive maintenance of radiation monitoring systems are important. This paper describes the maintenance of radiation monitoring systems delivered by Fuji Electric and the present status of preventive maintenance technology. Also it introduces the case that we developed a fault diagnosis function adopting a statistics technique and artificial intelligence (AI) and delivered a radiation monitoring system including this function. This system can output a fault analysis result and a countermeasure from the computer in real time. (author)
Signal, Matthew; Le Compte, Aaron; Harris, Deborah L; Weston, Philip J; Harding, Jane E; Chase, J Geoffrey
2012-10-01
Neonatal hypoglycemia is common and may cause serious brain injury. Diagnosis is by blood glucose (BG) measurements, often taken several hours apart. Continuous glucose monitoring (CGM) could improve hypoglycemia detection, while reducing the number of BG measurements. Calibration algorithms convert sensor signals into CGM output. Thus, these algorithms directly affect measures used to quantify hypoglycemia. This study was designed to quantify the effects of recalibration and filtering of CGM data on measures of hypoglycemia (BG neonates. CGM data from 50 infants were recalibrated using an algorithm that explicitly recognized the high-accuracy BG measurements available in this study. CGM data were analyzed as (1) original CGM output, (2) recalibrated CGM output, (3) recalibrated CGM output with postcalibration median filtering, and (4) recalibrated CGM output with precalibration median filtering. Hypoglycemia was classified by number of episodes, duration, severity, and hypoglycemic index. Recalibration increased the number of hypoglycemic events (from 161 to 193), hypoglycemia duration (from 2.2% to 2.6%), and hypoglycemic index (from 4.9 to 7.1 μmol/L). Median filtering postrecalibration reduced hypoglycemic events from 193 to 131, with little change in duration (from 2.6% to 2.5%) and hypoglycemic index (from 7.1 to 6.9 μmol/L). Median filtering prerecalibration resulted in 146 hypoglycemic events, a total duration of hypoglycemia of 2.6%, and a hypoglycemic index of 6.8 μmol/L. Hypoglycemia metrics, especially counting events, are heavily dependent on CGM calibration BG error, and the calibration algorithm. CGM devices tended to read high at lower levels, so when high accuracy calibration measurements are available it may be more appropriate to recalibrate the data.
Configuration of Risk Monitor System by PLant Defense-In.Depth Monitor and Relability Monitor
DEFF Research Database (Denmark)
Yoshikawa, Hidekazu; Lind, Morten; Yang, Ming
2012-01-01
A new method of risk monitor system of a nuclear power plant has been proposed from the aspect by what degree of safety functions incorporated in the plant system is maintained by multiple barriers of defense-in-depth (DiD). Wherein, the central idea is plant DiD risk monitor and reliability...... monitor derived from the four aspects of (i) design principle of nuclear safety to realize DiD concept, (ii) definition of risk and risk to be monitored, (iii) severe accident phenomena as major risk, (iv) scheme of risk ranking, and (v) dynamic risk display. In this paper, the overall frame...... of the proposed frame on risk monitor system is summarized and the detailed discussion is made on the definitions of major terminologies of risk, risk ranking, anatomy of fault occurrence, two-layer configuration of risk monitor, how to configure individual elements of plant DiD risk monitor and its example...
Configuration of risk monitor system by plant defense-in-depth risk monitor and reliability monitor
International Nuclear Information System (INIS)
Yoshikawa, Hidekazu; Lind Morten; Yang Ming; Hashim Muhammad; Zhang Zhijian
2012-01-01
A new method of risk monitor system of a nuclear power plant has been proposed from the aspect by what degree of safety functions incorporated in the plant system is maintained by multiple barriers of defense-in-depth (DiD). Wherein, the central idea is plant DiD risk monitor and reliability monitor derived from the five aspects of (1) design principle of nuclear safety based on DiD concept, (2) definition of risk and risk to be monitored, (3) severe accident phenomena as major risk, (4) scheme of risk ranking, and (5) dynamic risk display. In this paper, the overall frame of the proposed risk monitor system is summarized and the detailed discussion is made on major items such as definition of risk and risk ranking, anatomy of fault occurrence, two-layer configuration of risk monitor, how to configure individual elements of plant DiD risk monitor, and lastly how to apply for a PWR safety system. (author)
The Danish Marine Monitoring System
DEFF Research Database (Denmark)
Ærtebjerg, G.
1997-01-01
Indeholder abstracts fra Workshop on Marine Monitoring Systems and Technology, Risø, 17-18 April 1996.......Indeholder abstracts fra Workshop on Marine Monitoring Systems and Technology, Risø, 17-18 April 1996....
Improved Marine Waters Monitoring
Palazov, Atanas; Yakushev, Evgeniy; Milkova, Tanya; Slabakova, Violeta; Hristova, Ognyana
2017-04-01
IMAMO - Improved Marine Waters Monitoring is a project under the Programme BG02: Improved monitoring of marine waters, managed by Bulgarian Ministry of environment and waters and co-financed by the Financial Mechanism of the European Economic Area (EEA FM) 2009 - 2014. Project Beneficiary is the Institute of oceanology - Bulgarian Academy of Sciences with two partners: Norwegian Institute for Water Research and Bulgarian Black Sea Basin Directorate. The Project aims to improve the monitoring capacity and expertise of the organizations responsible for marine waters monitoring in Bulgaria to meet the requirements of EU and national legislation. The main outcomes are to fill the gaps in information from the Initial assessment of the marine environment and to collect data to assess the current ecological status of marine waters including information as a base for revision of ecological targets established by the monitoring programme prepared in 2014 under Art. 11 of MSFD. Project activities are targeted to ensure data for Descriptors 5, 8 and 9. IMAMO aims to increase the institutional capacity of the Bulgarian partners related to the monitoring and assessment of the Black Sea environment. The main outputs are: establishment of real time monitoring and set up of accredited laboratory facilities for marine waters and sediments chemical analysis to ensure the ability of Bulgarian partners to monitor progress of subsequent measures undertaken.
Computer-controlled radiation monitoring system
International Nuclear Information System (INIS)
Homann, S.G.
1994-01-01
A computer-controlled radiation monitoring system was designed and installed at the Lawrence Livermore National Laboratory's Multiuser Tandem Laboratory (10 MV tandem accelerator from High Voltage Engineering Corporation). The system continuously monitors the photon and neutron radiation environment associated with the facility and automatically suspends accelerator operation if preset radiation levels are exceeded. The system has proved reliable real-time radiation monitoring over the past five years, and has been a valuable tool for maintaining personnel exposure as low as reasonably achievable
Energy Technology Data Exchange (ETDEWEB)
Dr. Russ Braunling
2004-10-31
The Corrosion Monitoring System (CMS) program developed and demonstrated a continuously on-line system that provides real-time corrosion information. The program focused on detecting pitting corrosion in its early stages. A new invention called the Intelligent Ultrasonic Probe (IUP) was patented on the program. The IUP uses ultrasonic guided waves to detect small defects and a Synthetic Aperture Focusing Technique (SAFT) algorithm to provide an image of the pits. Testing of the CMS demonstrated the capability to detect pits with dimensionality in the sub-millimeter range. The CMS was tested in both the laboratory and in a pulp and paper industrial plant. The system is capable of monitoring the plant from a remote location using the internet.
Gas House Autonomous System Monitoring
Miller, Luke; Edsall, Ashley
2015-01-01
Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.
Dobson, Rosie; Whittaker, Robyn; Jiang, Yannan; Shepherd, Matthew; Maddison, Ralph; Carter, Karen; Cutfield, Richard; McNamara, Catherine; Khanolkar, Manish; Murphy, Rinki
2016-04-02
Addressing the increasing prevalence, and associated disease burden, of diabetes is a priority of health services internationally. Interventions to support patients to effectively self-manage their condition have the potential to reduce the risk of costly and debilitating complications. The utilisation of mobile phones to deliver self-management support allows for patient-centred care at the frequency and intensity that patients desire from outside the clinic environment. Self-Management Support for Blood Glucose (SMS4BG) is a novel text message-based intervention for supporting people with diabetes to improve self-management behaviours and achieve better glycaemic control and is tailored to individual patient preferences, demographics, clinical characteristics, and culture. This study aims to assess whether SMS4BG can improve glycaemic control in adults with poorly controlled diabetes. This paper outlines the rationale and methods of the trial. A two-arm, parallel, randomised controlled trial will be conducted across New Zealand health districts. One thousand participants will be randomised at a 1:1 ratio to receive SMS4BG, a theoretically based and individually tailored automated text message-based diabetes self-management support programme (intervention) in addition to usual care, or usual care alone (control). The primary outcome is change in glycaemic control (HbA1c) at 9 months. Secondary outcomes include glycaemic control at 3 and 6 months, self-efficacy, self-care behaviours, diabetes distress, health-related quality of life, perceived social support, and illness perceptions. Cost information and healthcare utilisation will also be collected as well as intervention satisfaction and interaction. This study will provide information on the effectiveness of a text message-based self-management support tool for people with diabetes. If found to be effective it has the potential to provide individualised support to people with diabetes across New Zealand (and
Coolant monitoring systems for PWR reactors
International Nuclear Information System (INIS)
Luzhnov, A.M.; Morozov, V.V.; Tsypin, S.G.
1987-01-01
The ways of improving information capacity of existing monitoring systems and the necessity of designing new ones for coolant monitoring are reviewed. A wide research program on development of coolant monitoring systems in PWR reactors is analyzed. The possible applications of in-core and out-of-core detectors for coolant monitoring are demonstrated
Energy Technology Data Exchange (ETDEWEB)
Wolfe, Lothar PhD
2000-03-01
The DOE-Utility Nuclear Power Engineering Education Matching Grant Program has been established to support the education of students in Nuclear Engineering Programs to maintain a knowledgeable workforce in the United States in order to keep nuclear power as a viable component in a mix of energy sources for the country. The involvement of the utility industry ensures that this grant program satisfies the needs and requirements of local nuclear energy producers and at the same time establishes a strong linkage between education and day-to-day nuclear power generation. As of 1997, seventeen pairs of university-utility partners existed. UMCP was never a member of that group of universities, but applied for the first time with a proposal to Baltimore Gas and Electric Company in January 1999 [1]. This proposal was generously granted by BG&E [2,3] in the form of a gift in the amount of $25,000 from BG&E's Corporate Contribution Program. Upon the arrival of a newly appointed Director of Administration in the Department of Materials and Nuclear Engineering, the BG&E check was deposited into the University's Maryland Foundation Fund. The receipt of the letter and the check enabled UMCP to apply for DOE's matching funds in the same amount by a proposal.
Monitoring of Danish marketed solar heating systems
International Nuclear Information System (INIS)
Ellehauge, K.
1993-01-01
The paper describes the monitoring of manufactured solar heating systems for domestic hot water combined with space heating and systems for domestic hot water only. Results from the monitoring of 5 marketed combined systems for domestic hot water and space heating are presented. The systems situated at one family houses at different sites in Denmark have been monitored from January/February 1992. For the detailed monitoring of manufactured systems only for domestic hot water a test facility for simultaneous monitoring of 5 solar heating systems has been established at the Thermal Insulation Laboratory. (au)
Radiation monitor system for nuclear power plants
International Nuclear Information System (INIS)
Wu Bingzhe; Guo Shusheng
1990-12-01
The system has 8 kinds of radiation monitors and 2 stage microcomputers designed for processing the data from each monitor, storaging the information, printing out and displaying on the colour CRT. The function of the system includes high-value alarm, warm alarm and failure alarm, so called t hree-level alarms . Two functions of the alarms are the threshold alarm and the tendency alarm, so that this system is an intelligency system. This system has high reliability and very wide range when LOCA accident takes place. It is aseismic and immune to industrial interference. The system can meet IEC-761-1 standard and is of nuclear safety 3rd class. Also the following monitors were designed: 133 Xe monitor, 131 I monitor, low-level liquid monitor and high radiation γ area monitor. The system can meet the requirements of nuclear power plants
Energy Technology Data Exchange (ETDEWEB)
Fischer, P. [Servicebereich Standort- und Geodienste der Deutschen Steinkohle AG, Herne (Germany); Sackel, M.; Pektas, E. [Sackel Ingenieure, Dortmund (Germany)
2007-06-15
In accordance to the improvement to the ''New DSK'', the department KG B turns more and more into a competent service partner. This challenge will be enduringly supported by the implementation of a Qualitymanagementsystem according to DIN EN ISO 9001. The implementation of a Qualitymanagementsystem is a multiple process. The integration during the regular business process forces experienced coaching. In this article, the basics of the QM-Standards will be explained and the implementation in department BG B will be introduced by certain examples. (orig.)
Monitoring system and methods for a distributed and recoverable digital control system
Stange, Kent (Inventor); Hess, Richard (Inventor); Kelley, Gerald B (Inventor); Rogers, Randy (Inventor)
2010-01-01
A monitoring system and methods are provided for a distributed and recoverable digital control system. The monitoring system generally comprises two independent monitoring planes within the control system. The first monitoring plane is internal to the computing units in the control system, and the second monitoring plane is external to the computing units. The internal first monitoring plane includes two in-line monitors. The first internal monitor is a self-checking, lock-step-processing monitor with integrated rapid recovery capability. The second internal monitor includes one or more reasonableness monitors, which compare actual effector position with commanded effector position. The external second monitor plane includes two monitors. The first external monitor includes a pre-recovery computing monitor, and the second external monitor includes a post recovery computing monitor. Various methods for implementing the monitoring functions are also disclosed.
Energy Technology Data Exchange (ETDEWEB)
Dumitrescu, Catalin [Fermi National Accelerator Laboratory (United States); Nowack, Andreas [RWTH Aachen (Germany); Padhi, Sanjay [University of California San Diego (United States); Sarkar, Subir, E-mail: subir.sarkar@cern.c [INFN, Sezione di Pisa and Scuola Normale Superiore, Pisa (Italy)
2010-04-01
This paper presents a web-based Job Monitoring framework for individual Grid sites that allows users to follow in detail their jobs in quasi-real time. The framework consists of several independent components : (a) a set of sensors that run on the site CE and worker nodes and update a database, (b) a simple yet extensible web services framework and (c) an Ajax powered web interface having a look-and-feel and control similar to a desktop application. The monitoring framework supports LSF, Condor and PBS-like batch systems. This is one of the first monitoring systems where an X.509 authenticated web interface can be seamlessly accessed by both end-users and site administrators. While a site administrator has access to all the possible information, a user can only view the jobs for the Virtual Organizations (VO) he/she is a part of. The monitoring framework design supports several possible deployment scenarios. For a site running a supported batch system, the system may be deployed as a whole, or existing site sensors can be adapted and reused with the web services components. A site may even prefer to build the web server independently and choose to use only the Ajax powered web interface. Finally, the system is being used to monitor a glideinWMS instance. This broadens the scope significantly, allowing it to monitor jobs over multiple sites.
International Nuclear Information System (INIS)
Dumitrescu, Catalin; Nowack, Andreas; Padhi, Sanjay; Sarkar, Subir
2010-01-01
This paper presents a web-based Job Monitoring framework for individual Grid sites that allows users to follow in detail their jobs in quasi-real time. The framework consists of several independent components: (a) a set of sensors that run on the site CE and worker nodes and update a database, (b) a simple yet extensible web services framework and (c) an Ajax powered web interface having a look-and-feel and control similar to a desktop application. The monitoring framework supports LSF, Condor and PBS-like batch systems. This is one of the first monitoring systems where an X.509 authenticated web interface can be seamlessly accessed by both end-users and site administrators. While a site administrator has access to all the possible information, a user can only view the jobs for the Virtual Organizations (VO) he/she is a part of. The monitoring framework design supports several possible deployment scenarios. For a site running a supported batch system, the system may be deployed as a whole, or existing site sensors can be adapted and reused with the web services components. A site may even prefer to build the web server independently and choose to use only the Ajax powered web interface. Finally, the system is being used to monitor a glideinWMS instance. This broadens the scope significantly, allowing it to monitor jobs over multiple sites.
The CUORE slow monitoring systems
Gladstone, L.; Biare, D.; Cappelli, L.; Cushman, J. S.; Del Corso, F.; Fujikawa, B. K.; Hickerson, K. P.; Moggi, N.; Pagliarone, C. E.; Schmidt, B.; Wagaarachchi, S. L.; Welliver, B.; Winslow, L. A.
2017-09-01
CUORE is a cryogenic experiment searching primarily for neutrinoless double decay in 130Te. It will begin data-taking operations in 2016. To monitor the cryostat and detector during commissioning and data taking, we have designed and developed Slow Monitoring systems. In addition to real-time systems using LabVIEW, we have an alarm, analysis, and archiving website that uses MongoDB, AngularJS, and Bootstrap software. These modern, state of the art software packages make the monitoring system transparent, easily maintainable, and accessible on many platforms including mobile devices.
An intelligent fetal monitoring system
International Nuclear Information System (INIS)
Inaba, J.; Akatsuka, T.; Kubo, T.; Iwasaki, H.
1986-01-01
An intelligent monitoring system is constructed by a multi-micro-computer system. The monitoring signals are fetal heart rate (FHR) and uterine contraction (UC) through the conventional monitoring device for a day until the delivery. These signals are fed to a micro-computer in digital format, and evaluated by the computer in real time according to the diagnostic algorithm of the expert physician. Monitoring signals are always displayed on the CRT screen and in the case of dangerous state of the fetus, warning signal will appear on the screen and the doctor or nurse will be called. All these signals are sent to the next micro-computer with 10MB hard disk system. On this computer, the doctor and nurse can retrieve and inspect the details of the process by clock-key and/or events-key. After finishing monitoring process, summarized report is constructed and printed out on the paper
Distributed Monitoring System Based on ICINGA
Haen, C; Neufeld, N
2011-01-01
The LHCb online system relies on a large and heterogeneous I.T. infrastructure : it comprises more than 2000 servers and embedded systems and more than 200 network devices. While for the control and monitoring of detectors, PLCs, and readout boards an industry standard SCADA system PVSSII has been put in production, we use a low level monitoring system to monitor the control infrastructure itself. While our previous system was based on a single central NAGIOS server, our current system uses a distributed ICINGA infrastructure.
International Nuclear Information System (INIS)
Rose, C.R.; Fortgang, C.M.; Power, J.P.
1992-01-01
The GTA Beamless-Monitor System at Los Alamos National Laboratory has been designed to detect high-energy particle loss in the accelerator beamline and shut down the accelerator before any damage can occur. To do this, the Beamless-Monitor System measures the induced gamma radiation, from (p, γ) reactions, at 15 selected points along the beamline, converts this measured radiation to electrical signals integrates and compares them to preset limits, and, in the event of an over-limit condition causes the Fast-Protect System to shut down the entire accelerator. The system dynamic range exceeds 70 dB which will enable experimenters to use the Beamless-Monitor System to help steer the beam as well as provide signals for a Fast-Protect System. The system response time is less than 7 μs assuming a step-function, worst-case beam spill of 50 mA. The system resolution, based on the noise floor of the electronics is about 1.3 mRads/s. Production units have been built and meet the above specifications. The remainder of the system will be installed and tested later in 1992/1993 with the GTA accelerator. The ionization chamber sensitivity and response time are described in the paper
International Nuclear Information System (INIS)
Rose, C.R.; Fortgang, C.M.; Power, J.P.
1992-01-01
The GTA Beamloss-Monitor System at Los Alamos National Laboratory has been designed to detect high-energy particle loss in the accelerator beamline and shut down the accelerator before any damage can occur. To do this, the Beamloss-Monitor System measures the induced gamma radiation, from (p,γ) reactions, at 15 selected points along the beamline, converts this measured radiation to electrical signals, integrates and compares them to preset limits, and, in the event of an over-limit condition causes the Fast-Protect System to shut down the entire accelerator. The system dynamic range exceeds 70 dB which will enable experimenters to use the Beamloss-Monitor System to help steer the beam as well as provide signals for a Fast-Protect System. The system response time is less than 7 μs assuming a step-function, worst-case beam spill of 50 mA. The system resolution, based on the noise floor of the electronics, is about 1.3 mRads/s. Production units have been built and meet the above specifications. The remainder of the system will be installed and tested later in 1992/93 with the GTA accelerator. The ionization chamber sensitivity and response time are described in the paper. (Author) 4 figs., ref
Hattemer, Andrew; Wardat, Sami
2018-03-01
ISO 15197:2013 recommends testing procedures and acceptance criteria for the evaluation of influence quantities such as hematocrit on measurement results with systems for self-monitoring of blood glucose (SMBG). In this study, hematocrit influence was evaluated for a novel SMBG system (system A) and five other systems with different hematocrit ranges based on ISO 15197:2013. Test procedures were performed with one test strip lot for each system. Each system was tested within the hematocrit range indicated in the manufacturer's labeling (system A: 10-65%, B: 15-65%, C: 20-60%, D: 35-60%, E: 30-60%, F: 30-55%). According to ISO 15197:2013, clause 6.4.2, venous blood samples were used for the evaluation of hematocrit influence. The evaluation was performed for three glucose concentration categories (30-50 mg/dL, 96-144 mg/dL, and 280-420 mg/dL). For each glucose concentration category, at least five different hematocrit levels were investigated. The novel system A and systems B, E, and F complied with the tested lot with the defined criteria and showed ≤10 mg/dL and ≤10% difference between the test sample and the respective control sample with a hematocrit value of 42% ± 2% for BG concentrations 10% difference at glucose concentrations ≥100 mg/dL. Remarkable hematocrit influence within the labeled hematocrit range was obtained in two systems with the tested reagent system lot. Adequate SMBG systems should be carefully chosen by patients and their health care professionals, particularly for patients with increased and decreased hematocrit values.
Offsite emergency radiological monitoring system and technology
International Nuclear Information System (INIS)
Mao Yongze
1994-01-01
The study and advance of the offsite radiological monitoring system and technology which is an important branch in the field of nuclear monitoring technology are described. The author suggests that the predicting and measuring system should be involved in the monitoring system. The measuring system can further be divided into four sub-systems, namely plume exposure pathway, emergency worker, ingestion exposure pathway and post accident recovery measuring sub-systems. The main facilities for the monitoring system are concluded as one station, one helicopter, one laboratory and two vehicles. The instrumentation for complement of the facilities and their good performance characteristics, up-to-date technology are also introduced in brief. The offsite emergency radiation monitoring system and technology are compared in detail with those recommended by FEMA U.S.A.. Finally the paper discusses some trends in development of emergency radiation monitoring system and technology in the developed countries
System specification for the integrated monitoring and surveillance system
International Nuclear Information System (INIS)
1997-09-01
This System Specification establishes the requirements for the Plutonium Focus Area (PFA) Integrated Monitoring and Surveillance System (IMSS). In this document, ''Integrated Monitoring and Surveillance System'' is used to describe the concept of integrated sensors, computers, personnel, and systems that perform the functions of sensing conditions, acquiring data, monitoring environmental safety and health, controlling and accounting for materials, monitoring material stability, monitoring container integrity, transferring data, and analyzing, reporting, and storing data. This concept encompasses systems (e.g. sensors, personnel, databases, etc.) that are already in place at the sites but may require modifications or additions to meet all identified surveillance requirements. The purpose of this System Specification is to provide Department of Energy (DOE) sites that store plutonium materials with a consolidation of all known requirements for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides. This compilation may be used (1) as a baseline for surveillance system design specifications where 3013 packages of stabilized plutonium metals and oxides will be stored and monitored; (2) as a checklist for evaluating existing surveillance systems to ensure that all requirements are met for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides; and (3) as a baseline for preparing procurement specifications tailored for site specific storage and surveillance of 3013 packages of stabilized plutonium metals and oxides
ERMS - Environmental Radiation Monitoring System
International Nuclear Information System (INIS)
Vax, Eran; Sarusi, Benny; Sheinfeld, Mati; Levinson, Shmuel; Brandys, Irad; Sattinger, Danny; Wengrowicz, Udi; Tshuva, Avi; Tirosh, Dan
2008-01-01
A new Environmental Radiation Monitoring System (ERMS) has been developed in the NRCN as an extensive tool to be applied in case of nuclear malfunction or Nuclear Disposal Device (NDD) incident, as well as for routine radiation monitoring of the reactor's vicinity. The system collects real-time environmental data such as: gamma radiation, wind speed, wind direction, and temperature for monitoring purposes. The ERMS consists of a main Control Center and an array of monitoring stations. Fixed, environmental, gamma radiation monitoring stations are installed at the reactor's surroundings while portable stations can be posted rapidly along the wind direction, enhancing the spatial sampling of the radiation measurements and providing better hazard assessment at an emergency event. The presented ERMS, based on industrial standards for hardware and network protocols, is a reliable standalone system which upgrades the readiness to face a nuclear emergency event by supplying real-time, integrated meteorological and radiation data. (author)
Directory of Open Access Journals (Sweden)
Rao Mahendra S
2009-06-01
Full Text Available Abstract Background A unique and essential property of embryonic stem cells is the ability to self-renew and differentiate into multiple cell lineages. However, the possible differences in proliferation and differentiation capabilities among independently-derived human embryonic stem cells (hESCs are not well known because of insufficient characterization. To address this question, a side-by-side comparison of 1 the ability to maintain an undifferentiated state and to self-renew under standard conditions; 2 the ability to spontaneously differentiate into three primary embryonic germ lineages in differentiating embryoid bodies; and 3 the responses to directed neural differentiation was made between three NIH registered hES cell lines I3 (TE03, I6 (TE06 and BG01V. Lines I3 and I6 possess normal XX and a normal XY karyotype while BG01V is a variant cell line with an abnormal karyotype derived from the karyotypically normal cell line BG01. Results Using immunocytochemistry, flow cytometry, qRT-PCR and MPSS, we found that all three cell lines actively proliferated and expressed similar "stemness" markers including transcription factors POU5F1/Oct3/4 and NANOG, glycolipids SSEA4 and TRA-1-81, and alkaline phosphatase activity. All cell lines differentiated into three embryonic germ lineages in embryoid bodies and into neural cell lineages when cultured in neural differentiation medium. However, a profound variation in colony morphology, growth rate, BrdU incorporation, and relative abundance of gene expression in undifferentiated and differentiated states of the cell lines was observed. Undifferentiated I3 cells grew significantly slower but their differentiation potential was greater than I6 and BG01V. Under the same neural differentiation-promoting conditions, the ability of each cell line to differentiate into neural progenitors varied. Conclusion Our comparative analysis provides further evidence for similarities and differences between three h
Bg1II polymorphism of the epidermal growth factor receptor (EGF-R) gene
Energy Technology Data Exchange (ETDEWEB)
Biunno, I; Pozzi, M R; Radice, P; Mondini, P; Pierotti, M A; Porta, G D [Istituto Nazionale Tumori, Milan (Italy); Haley, J; Waterfield, M D [Ludwig Institute for Cancer Research, London (England)
1988-08-11
A 770 bp cDNA fragment was derived from the cytoplasmic portion of the EGF-R (ref. Libermann et al., 1985). Bg1II identifies 4 invariant bands of 7.0, 5.0, 3.5 and 1.2 kb and a two allele polymorphism with a band of either 10.6 kb (lane 1) or 9.4 kb (lane 3). An heterozygote individual is represented. The frequency was analyzed in 78 unrelated European Caucasians. Its chromosomal location was determined. Co-dominant segregation was demonstrated in three families of 12 individuals. A rare variant of 8.3 kb was seen in one chromosome out of the 144 examined. This allelic form has not yet been fully characterized.
The Pajarito Monitor: a high-sensitivity monitoring system for highly enriched uranium
International Nuclear Information System (INIS)
Fehlau, P.E.; Coop, K.; Garcia, C.; Martinez, J.
1984-01-01
The Pajarito Monitor for Special Nuclear Material is a high-sensitivity gamma-ray monitoring system for detecting small quantities of highly enriched uranium transported by pedestrians or motor vehicles. The monitor consists of two components: a walk-through personnel monitor and a vehicle monitor. The personnel monitor has a plastic-scintillator detector portal, a microwave occupancy monitor, and a microprocessor control unit that measures the radiation intensity during background and monitoring periods to detect transient diversion signals. The vehicle monitor examines stationary motor vehicles while the vehicle's occupants pass through the personnel portal to exchange their badges. The vehicle monitor has four groups of large plastic scintillators that scan the vehicle from above and below. Its microprocessor control unit measures separate radiation intensities in each detector group. Vehicle occupancy is sensed by a highway traffic detection system. Each monitor's controller is responsible for detecting diversion as well as serving as a calibration and trouble-shooting aid. Diversion signals are detected by a sequential probability ratio hypothesis test that minimizes the monitoring time in the vehicle monitor and adapts itself well to variations in individual passage speed in the personnel monitor. Designed to be highly sensitive to diverted enriched uranium, the monitoring system also exhibits exceptional sensitivity for plutonium
Energy Doubler cryoloop temperature monitor system
International Nuclear Information System (INIS)
Pucci, G.; Howard, D.
1981-10-01
The Cryoloop Temperature Monitor System is a fully electronic system designed to monitor temperature at key points in the Energy Doubler cryoloop system. It is used for cryoloop diagnostics, temperature studies, and cooldown valve control
Hanger-type laundry monitor system
International Nuclear Information System (INIS)
Aoyama, Kei; Kouno, Yoshio; Yanagishima, Ryouhei; Ikeda, Yasuyuki; Nakatani, Masahiro
1987-01-01
Laundry monitor is installed in nuclear power plants or other nuclear facilities in order to efficiently detect radioactive contamination remains on the surfaces of the working clothes which were used in the controlled area and washed afterward. The number of the working clothes which must be measured has been increasing in accordance with the increase of the nuclear facilities. This fact and recent intensified radiation control require automatic, high-speed and high sensitive measurement. Conveyer-type laundry monitor in which the working clothes are inserted by the metal net conveyer has been generally used, and recently new system with an automatic folder has become more popular. But, this type of system has not so big capacity because the clothes are conveyed longitudinally and also requires considerable wide space when installed. Fuji electric Co., Ltd. has been engaging in research and development for an optimum laundry monitor system used in nuclear facilities since the joint investigation with ten electric power companies in Japan in 1982. Consequently hanger-type laundry monitor system using automatic hanger conveyer was developed and 2 systems were delivered to Chubu Electric Power Co., Ltd. in 1986. This system permits to detect radioactive contamination on the working clothes, pick the contaminated clothes out and fold the uncontaminated clothes fully automatically and continuously. Moreover it allows to shorten the measurement time because the clothes are conveyed transversely and save the installation space, so that this will be regarded as considerably complete system in the world. This report describes the outline of the hanger-type laundry monitor system. (author)
Storage monitoring systems for the year 2000
International Nuclear Information System (INIS)
Nilsen, C.; Pollock, R.
1997-01-01
In September 1993, President Clinton stated the US would ensure that its fissile material meet the highest standards of safety, security, and international accountability. Frequent human inspection of the material could be used to ensure these standards. However, it may be more effective and less expensive to replace these manual inspections with virtual inspections via remote monitoring technologies. To prepare for this future, Sandia National Laboratories has developed several monitoring systems, including the Modular Integrated Monitoring System (MIMS) and Project Straight-Line. The purpose of this paper is to describe a Sandia effort that merges remote monitoring technologies into a comprehensive storage monitoring system that will meet the near-term as well as the long-term requirements for these types of systems. Topics discussed include: motivations for storage monitoring systems to include remote monitoring; an overview of the needs and challenges of providing a storage monitoring system for the year 2000; an overview of how the MIMS and Straight-Line can be enhanced so that together they create an integrated and synergistic information system by the end of 1997; and suggested milestones for 1998 and 1999 to assure steady progress in preparing for the needs of 2000
Performance Monitoring Applied to System Supervision
Directory of Open Access Journals (Sweden)
Bertille Somon
2017-07-01
Full Text Available Nowadays, automation is present in every aspect of our daily life and has some benefits. Nonetheless, empirical data suggest that traditional automation has many negative performance and safety consequences as it changed task performers into task supervisors. In this context, we propose to use recent insights into the anatomical and neurophysiological substrates of action monitoring in humans, to help further characterize performance monitoring during system supervision. Error monitoring is critical for humans to learn from the consequences of their actions. A wide variety of studies have shown that the error monitoring system is involved not only in our own errors, but also in the errors of others. We hypothesize that the neurobiological correlates of the self-performance monitoring activity can be applied to system supervision. At a larger scale, a better understanding of system supervision may allow its negative effects to be anticipated or even countered. This review is divided into three main parts. First, we assess the neurophysiological correlates of self-performance monitoring and their characteristics during error execution. Then, we extend these results to include performance monitoring and error observation of others or of systems. Finally, we provide further directions in the study of system supervision and assess the limits preventing us from studying a well-known phenomenon: the Out-Of-the-Loop (OOL performance problem.
Zhu, Peijuan; Ding, Wei; Tong, Wei; Ghosal, Anima; Alton, Kevin; Chowdhury, Swapan
2009-06-01
A retention-time-shift-tolerant background subtraction and noise reduction algorithm (BgS-NoRA) is implemented using the statistical programming language R to remove non-drug-related ion signals from accurate mass liquid chromatography/mass spectrometry (LC/MS) data. The background-subtraction part of the algorithm is similar to a previously published procedure (Zhang H and Yang Y. J. Mass Spectrom. 2008, 43: 1181-1190). The noise reduction algorithm (NoRA) is an add-on feature to help further clean up the residual matrix ion noises after background subtraction. It functions by removing ion signals that are not consistent across many adjacent scans. The effectiveness of BgS-NoRA was examined in biological matrices by spiking blank plasma extract, bile and urine with diclofenac and ibuprofen that have been pre-metabolized by microsomal incubation. Efficient removal of background ions permitted the detection of drug-related ions in in vivo samples (plasma, bile, urine and feces) obtained from rats orally dosed with (14)C-loratadine with minimal interference. Results from these experiments demonstrate that BgS-NoRA is more effective in removing analyte-unrelated ions than background subtraction alone. NoRA is shown to be particularly effective in the early retention region for urine samples and middle retention region for bile samples, where the matrix ion signals still dominate the total ion chromatograms (TICs) after background subtraction. In most cases, the TICs after BgS-NoRA are in excellent qualitative correlation to the radiochromatograms. BgS-NoRA will be a very useful tool in metabolite detection and identification work, especially in first-in-human (FIH) studies and multiple dose toxicology studies where non-radio-labeled drugs are administered. Data from these types of studies are critical to meet the latest FDA guidance on Metabolite in Safety Testing (MIST). Copyright (c) 2009 John Wiley & Sons, Ltd.
Plant-wide integrated equipment monitoring and analysis system
International Nuclear Information System (INIS)
Morimoto, C.N.; Hunter, T.A.; Chiang, S.C.
2004-01-01
A nuclear power plant equipment monitoring system monitors plant equipment and reports deteriorating equipment conditions. The more advanced equipment monitoring systems can also provide information for understanding the symptoms and diagnosing the root cause of a problem. Maximizing the equipment availability and minimizing or eliminating consequential damages are the ultimate goals of equipment monitoring systems. GE Integrated Equipment Monitoring System (GEIEMS) is designed as an integrated intelligent monitoring and analysis system for plant-wide application for BWR plants. This approach reduces system maintenance efforts and equipment monitoring costs and provides information for integrated planning. This paper describes GEIEMS and how the current system is being upgraded to meet General Electric's vision for plant-wide decision support. (author)
International Nuclear Information System (INIS)
Livingston, R.R.
1992-01-01
Two systems for monitoring benzene in aqueous streams have been designed and assembled by the Savannah River Technology Center, Analytical Development Section (ADS). These systems were used at TNX to support sampling studies of the full-scale open-quotes SRAT/SME/PRclose quotes and to provide real-time measurements of benzene in Precipitate Hydrolysis Aqueous (PHA) simulant. This report describes the two ADS Benzene Monitor System (BMS) configurations, provides data on system operation, and reviews the results of scoping tests conducted at TNX. These scoping tests will allow comparison with other benzene measurement options being considered for use in the Defense Waste Processing Facility (DWPF) laboratory. A report detailing the preferred BMS configuration statistical performance during recent tests has been issued under separate title: Statistical Analyses of the At-line Benzene Monitor Study, SCS-ASG-92-066. The current BMS design, called the At-line Benzene Monitor (ALBM), allows remote measurement of benzene in PHA solutions. The authors have demonstrated the ability to calibrate and operate this system using peanut vials from a standard Hydragard trademark sampler. The equipment and materials used to construct the ALBM are similar to those already used in other applications by the DWPF lab. The precision of this system (±0.5% Relative Standard Deviation (RSD) at 1 sigma) is better than the purge ampersand trap-gas chromatograpy reference method currently in use. Both BMSs provide a direct measurement of the benzene that can be purged from a solution with no sample pretreatment. Each analysis requires about five minutes per sample, and the system operation requires no special skills or training. The analyzer's computer software can be tailored to provide desired outputs. Use of this system produces no waste stream other than the samples themselves (i.e. no organic extractants)
On predicting monitoring system effectiveness
Cappello, Carlo; Sigurdardottir, Dorotea; Glisic, Branko; Zonta, Daniele; Pozzi, Matteo
2015-03-01
While the objective of structural design is to achieve stability with an appropriate level of reliability, the design of systems for structural health monitoring is performed to identify a configuration that enables acquisition of data with an appropriate level of accuracy in order to understand the performance of a structure or its condition state. However, a rational standardized approach for monitoring system design is not fully available. Hence, when engineers design a monitoring system, their approach is often heuristic with performance evaluation based on experience, rather than on quantitative analysis. In this contribution, we propose a probabilistic model for the estimation of monitoring system effectiveness based on information available in prior condition, i.e. before acquiring empirical data. The presented model is developed considering the analogy between structural design and monitoring system design. We assume that the effectiveness can be evaluated based on the prediction of the posterior variance or covariance matrix of the state parameters, which we assume to be defined in a continuous space. Since the empirical measurements are not available in prior condition, the estimation of the posterior variance or covariance matrix is performed considering the measurements as a stochastic variable. Moreover, the model takes into account the effects of nuisance parameters, which are stochastic parameters that affect the observations but cannot be estimated using monitoring data. Finally, we present an application of the proposed model to a real structure. The results show how the model enables engineers to predict whether a sensor configuration satisfies the required performance.
Monitoring in educational development projects : the development of a monitoring system
Plomp, T.; Huijsman, Hari; Kluyfhout, Eric
1992-01-01
Monitoring in education is usually focused on the monitoring of educational systems at different levels. Monitoring of educational projects receives only recently explicit attention. The paper discusses first the concepts of educational monitoring and evaluation. After that, the experience with
Ghabrous Larrea, C
2009-01-01
As a result of the tremendous development of GSM services over the last years, the number of related services used by organizations has drastically increased. Therefore, monitoring GSM services is becoming a business critical issue in order to be able to react appropriately in case of incident. In order to provide with GSM coverage all the CERN underground facilities, more than 50 km of leaky feeder cable have been deployed. This infrastructure is also used to propagate VHF radio signals for the CERN’s fire brigade. Even though CERN’s mobile operator monitors the network, it cannot guarantee the availability of GSM services, and for sure not VHF services, where signals are carried by the leaky feeder cable. So, a global monitoring system has become critical to CERN. In addition, monitoring this infrastructure will allow to characterize its behaviour over time, especially with LHC operation. Given that commercial solutions were not yet mature, CERN developed a system based on GSM probes and an application...
Remote supervision of GIS monitoring system
Energy Technology Data Exchange (ETDEWEB)
Pannunzio, J.; Juge, P.; Ficheux, A.; Rayon, J.L. [Areva T and D Automation Canada Inc., Monteal, PQ (Canada)
2007-07-01
Operators of gas-insulated substations (GIS) are increasingly concerned with failure prevention, scheduled maintenance, personnel safety and shortage of maintenance crews. Until recently, the density levels of the insulating gas sulfur hexafluoride (SF6) was the only parameter controlled in gas-insulated substations. Modern digital type control and monitoring equipment have been widely used in the past decade. Remote indication of gas density and status of dynamic components was made possible and shown on local control panels. Modern GIS monitoring systems offer features such as SF6 monitoring, SF6 leakage trends, internal arc localization and detection. The required information is recorded in a local computer and displaced onto a local human machine interface (HMI) or a local industrial PC mounted next to the GIS. These monitoring systems are used as decision making tools to facilitate maintenance activities and optimize the management of assets. This paper presented the latest developments in digital monitoring systems in terms of modern digital architecture; management of information flows between monitoring systems and control systems; operation of remote supervision; configuration of high voltage substations and information sharing; and, types of links between GIS room and remote supervision. This paper also demonstrated what can be achieved by moving the central HMI of a GIS monitoring system to the decision-making centres. It was shown that integrated features that allow remote on-line or automated management have reached an acceptable level of reliability and comfort for operators. 5 figs.
System of message for gamma-radiation monitor
International Nuclear Information System (INIS)
Bolic, M.D.; Koturovic, A.M.
2001-01-01
Paper describes a system of voice messages for gamma-radiation monitor based on PC. The systems reproduces recorded messages that is simpler than the process of their synthesis. Message choice is based on combination of recorded digital results and/or received reference messages or warnings. The system of generation of voice messages applies the Windows based software. The total memory array required to create independent voice system is maximum 1.7 mbyte. The monitor may be used for continuous monitoring of radioactivity level with 5-8 s period of message repetition. Another option of the system operation is based on monitor application for the environment monitoring. Period of messages in this case is equal to 5-30 min [ru
Stack Monitoring System At PUSPATI TRIGA Reactor
International Nuclear Information System (INIS)
Zamrul Faizad Omar; Mohd Sabri Minhat; Zareen Khan Abdul Jalil Khan; Ridzuan Abdul Mutalib; Khairulezwan Abdul Manan; Nurfarhana Ayuni Joha; Izhar Abu Hussin
2014-01-01
This paper describes the current Stack Monitoring System at PUSPATI TRIGA Reactor (RTP) building. A stack monitoring system is a continuous air monitor placed at the reactor top for monitoring the presence of radioactive gaseous in the effluent air from the RTP building. The system consists of four detectors that provide the reading for background, particulate, Iodine and Noble gas. There is a plan to replace the current system due to frequent fault of the system, thus thorough understanding of the current system is required. Overview of the whole system will be explained in this paper. Some current results would be displayed and moving forward brief plan would be mentioned. (author)
Digital radiation monitor system
International Nuclear Information System (INIS)
Quan Jinhu; Zhai Yongchun; Guan Junfeng; Ren Dangpei; Ma Zhiyuan
2003-01-01
The article introduced digital radiation monitor system. The contents include: how to use advanced computer net technology to establish equipment net for nuclear facility, how to control and manage measuring instruments on field equipment net by local area net, how to manage and issue radiation monitoring data by internet
Instrumentation for Power System Disturbance Monitoring, Data ...
African Journals Online (AJOL)
In this paper, the level of instrumentation for power system disturbance monitoring, data acquisition and control in Nigerian Electric Power System; National Electric Power Authority (NEPA) is presented. The need for accurate power system disturbance monitoring is highlighted. A feature of an adequate monitoring, data ...
A unique radiation area monitoring system
International Nuclear Information System (INIS)
Murphy, P.C.; Allen, G.C.
1978-01-01
The Remote Area Monitoring Systems (RAMS) monitors four radiation areas with two independent systems in each area. Each system consists of power supplies, four ionization chambers, and four analog and digital circuits. The first system controls the warning beacons, horns, annunciation panel and interlocks. The second system presents a quantitative dose rate indication at the console and in the radiation area
Remote Arrhythmia Monitoring System Developed
York, David W.; Mackin, Michael A.; Liszka, Kathy J.; Lichter, Michael J.
2004-01-01
Telemedicine is taking a step forward with the efforts of team members from the NASA Glenn Research Center, the MetroHealth campus of Case Western University, and the University of Akron. The Arrhythmia Monitoring System is a completed, working test bed developed at Glenn that collects real-time electrocardiogram (ECG) signals from a mobile or homebound patient, combines these signals with global positioning system (GPS) location data, and transmits them to a remote station for display and monitoring. Approximately 300,000 Americans die every year from sudden heart attacks, which are arrhythmia cases. However, not all patients identified at risk for arrhythmias can be monitored continuously because of technological and economical limitations. Such patients, who are at moderate risk of arrhythmias, would benefit from technology that would permit long-term continuous monitoring of electrical cardiac rhythms outside the hospital environment. Embedded Web Technology developed at Glenn to remotely command and collect data from embedded systems using Web technology is the catalyst for this new telemetry system (ref. 1). In the end-to-end system architecture, ECG signals are collected from a patient using an event recorder and are transmitted to a handheld personal digital assistant (PDA) using Bluetooth, a short-range wireless technology. The PDA concurrently tracks the patient's location via a connection to a GPS receiver. A long distance link is established via a standard Internet connection over a 2.5-generation Global System for Mobile Communications/General Packet Radio Service (GSM/GPRS)1 cellular, wireless infrastructure. Then, the digital signal is transmitted to a call center for monitoring by medical professionals.
A preliminary study of the structure of b anti bg events using Z0 decays
International Nuclear Information System (INIS)
Abe, K.; Abe, K.; Abe, T.
1998-06-01
The structure of three-jet b anti bg events has been studied using hadronic Z 0 decays recorded in the SLD experiment at SLAC. Three-jet final states were selected and the CCD-based vertex detector was used to identify two of the jets as a b or anti b. The distributions of the gluon energy and polar angle with respect to the electron beam were examined and were compared with perturbative QCD predictions. These distributions are potentially sensitive to an anomalous b chromomagnetic moment κ. The authors measure κ consistent with zero and set limits on its value
Drinking-water monitoring systems
International Nuclear Information System (INIS)
1994-01-01
A new measuring system was developed by the Austrian Research Centre Seibersdorf for monitoring the quality of drinking-water. It is based on the experience made with the installation of UWEDAT (registered trademark) environmental monitoring networks in several Austrian provinces and regions. The standard version of the drinking-water monitoring system comprises sensors for measuring chemical parameters in water, radioactivity in water and air, and meteorological values of the environment. Further measuring gauges, e.g. for air pollutants, can be connected at any time, according to customers' requirements. For integration into regional and supraregional networks, station computers take over the following tasks: Collection of data and status signals transmitted by the subsystem, object protection, intermediate storage and communication of data to the host or several subcentres via Datex-P postal service, permanent lines or radiotransmission
Surveillance systems (PWR) - loose parts monitoring - vibration monitoring - leakage detection
International Nuclear Information System (INIS)
Schuette, A.; Blaesig, H.
1982-01-01
The contribution is engaged in the task and the results of the loose parts monitoring and the vibration monitoring following from the practice at the PWR of Biblis. First a description of both systems - location and type of the sensors used, the treatment of the measurements and the indications - is given. The results of the analysis of some events picked up by the surveillance systems are presented showing applicabilty and benefit of such systems. (orig.)
Routine individual monitoring of aircraft crew exposure; Czech experience and results 1998-2008
Czech Academy of Sciences Publication Activity Database
Malušek, Alexandr; Ploc, Ondřej; Kovář, Ivan; Brabcová, Kateřina; Spurný, František
2011-01-01
Roč. 144, 1-4 (2011), s. 684-687 ISSN 0144-8420 R&D Projects: GA ČR GA205/09/0171 Grant - others:Evropské společenství ILSRA(XE) FIGM-CT2000-00068 $c; JSPS(JP) P09753 Institutional research plan: CEZ:AV0Z10480505 Keywords : aircraft * crew exposure * monitoring Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 0.822, year: 2011
Car monitoring information systems
Directory of Open Access Journals (Sweden)
Alica KALAŠOVÁ
2008-01-01
Full Text Available The objective of this contribution is to characterize alternatives of information systems used for managing, processing and evaluation of information related to company vehicles. Especially we focus on logging, transferring and processing of on-road vehicle movement information in inland and international transportation. This segment of company information system has to monitor the car movement – actively or passively – according to demand of the company and after the processing it has to evaluate and give the complex monitoring of a situation of all the company vehicles to the controller.
International Nuclear Information System (INIS)
Park, Min-Ah; Hwang, Kyung-A; Lee, Hye-Rim; Yi, Bo-Rim; Jeung, Eui-Bae; Choi, Kyung-Chul
2013-01-01
Highlights: ► BP-1 induced cell growth was reversed by an ER antagonist in BG-1 cells. ► BP-1 up-regulated the mRNA expression of cyclin D1. ► Up-regulation of cyclin D1 by BP-1 was reversed by an ER antagonist. ► BP-1 is a potential endocrine disruptor that exerts estrogenic effects. - Abstract: 2,4-Dihydroxybenzophenone (benzophenone-1; BP-1) is an UV stabilizer primarily used to prevent polymer degradation and deterioration in quality due to UV irradiation. Recently, BP-1 has been reported to bioaccumulate in human bodies by absorption through the skin and has the potential to induce health problems including endocrine disruption. In the present study, we examined the xenoestrogenic effect of BP-1 on BG-1 human ovarian cancer cells expressing estrogen receptors (ERs) and relevant xenografted animal models in comparison with 17-β estradiol (E2). In in vitro cell viability assay, BP-1 (10 −8 –10 −5 M) significantly increased BG-1 cell growth the way E2 did. The mechanism underlying the BG-1 cell proliferation was proved to be related with the up-regulation of cyclin D1, a cell cycle progressor, by E2 or BP-1. Both BP-1 and E2 induced cell growth and up-regulation of cyclin D1 were reversed by co-treatment with ICI 182,780, an ER antagonist, suggesting that BP-1 may mediate the cancer cell proliferation via an ER-dependent pathway like E2. On the other hand, the expression of p21, a regulator of cell cycle progression at G 1 phase, was not altered by BP-1 though it was down-regulated by E2. In xenograft mouse models transplanted with BG-1 cells, BP-1 or E2 treatment significantly increased the tumor mass formation compared to a vehicle (corn oil) within 8 weeks. In histopathological analysis, the tumor sections of E2 or BP-1 group displayed extensive cell formations with high density and disordered arrangement, which were supported by the increased number of BrdUrd positive nuclei and the over-expression of cyclin D1 protein. Taken together, these
Remote container monitoring and surveillance systems
International Nuclear Information System (INIS)
Resnik, W.M.; Kadner, S.P.
1995-01-01
Aquila Technologies Group is developing a monitoring and surveillance system to monitor containers of nuclear materials. The system will both visually and physically monitor the containers. The system is based on the combination of Aquila's Gemini All-Digital Surveillance System and on Aquila's AssetLAN trademark asset tracking technology. This paper discusses the Gemini Digital Surveillance system as well as AssetLAN technology. The Gemini architecture with emphasis on anti-tamper security features is also described. The importance of all-digital surveillance versus other surveillance methods is also discussed. AssetLAN trademark technology is described, emphasizing the ability to continually track containers (as assets) by location utilizing touch memory technology. Touch memory technology provides unique container identification, as well as the ability to store and retrieve digital information on the container. This information may relate to container maintenance, inspection schedules, and other information. Finally, this paper describes the combination of the Gemini system with AssetLAN technology, yielding a self contained, container monitoring and area/container surveillance system. Secure container fixture design considerations are discussed. Basic surveillance review functions are also discussed
Directory of Open Access Journals (Sweden)
Renata Antonaci Gama
2013-09-01
Full Text Available Although the human-landing catch (HLC method is the most effective for collecting anthropophilic anophelines, it has been increasingly abandoned, primarily for ethical considerations. The objective of the present study was to develop a new trap for the collection of Anopheles darlingi . The initial trials were conducted using the BG-Sentinel trap as a standard for further trap development based on colour, airflow direction and illumination. The performance of the trap was then compared with those of the CDC, Fay-Prince, counterflow geometry trap (CFG and HLC. All trials were conducted outdoors between 06:00 pm-08:00 pm. Female specimens of An. darlingi were dissected to determine their parity. A total of 8,334 anophelines were captured, of which 4,945 were identified as An. darlingi . The best trap configuration was an all-white version, with an upward airflow and no required light source. This configuration was subsequently named BG-Malaria (BGM. The BGM captured significantly more anophelines than any of the other traps tested and was similar to HLC with respect to the number and parity of anophelines. The BGM trap can be used as an alternative to HLC for collecting anophelines.
TeBG- and CBG-bound steroid hormones in rabbits are available for influx into uterus in vivo
International Nuclear Information System (INIS)
Chaudhuri, G.; Steingold, K.A.; Pardridge, W.M.; Judd, H.L.
1988-01-01
The metabolic clearance rate (MCR) of gonadal or adrenal steroid hormones in rabbits often does not bear the expected inverse relationship with hormone binding to testosterone-binding globulin (TeBG) or corticosteroid-binding globulin (CBG). This suggests TeBG or CBG may not impede steroid hormone delivery to tissues. The effects of rabbit plasma proteins on the influxes of 3 H-labeled steroids from the circulation into the rabbit uterus were measured in vivo using a tissue sampling single-injection technique. In the absence of plasma proteins, estradiol (E 2 ) and testosterone (T) were freely diffusible through the uterine microvasculature (i.e., extraction >80%). The extractions of dihydrostestosterone (DHT) and corticosterone (B) ranged from 60 to 72%, while that of cortisol (F) was reduced at 40%. Rabbit serum exerted no inhibition of the influxes of the steroids tested. The influxes of T and B greatly exceeded the rates that would be expected if only the free and albumin-bound fractions estimated in vitro were diffusible in vivo. However, the extraction of [ 3 H]corticosteroid-binding globulin or bovine [ 3 H]albumin were low, consistent with little, if any, extravascular uptake of the plasma proteins. The results indicate both albumin-bound and globulin-bound steroid hormone are available for transport into the uterus in the rabbit in vivo without significant exodus of the plasma protein, per se
Critical function monitoring system algorithm development
International Nuclear Information System (INIS)
Harmon, D.L.
1984-01-01
Accurate critical function status information is a key to operator decision-making during events threatening nuclear power plant safety. The Critical Function Monitoring System provides continuous critical function status monitoring by use of algorithms which mathematically represent the processes by which an operating staff would determine critical function status. This paper discusses in detail the systematic design methodology employed to develop adequate Critical Function Monitoring System algorithms
Centralized environmental radiation monitoring system in JAERI
International Nuclear Information System (INIS)
Katagiri, Hiroshi; Kobayashi, Hideo
1993-03-01
Japan Atomic Energy Research Institute (JAERI) has continued the radiation background survey and environmental radiation monitoring to ensure the safety of the residents around the Institute. For the monitoring of β and γ radiations and α and β radioactivities in air, the centralized automatic environmental radiation monitoring system (EMS) applying a computer with monitoring stations (MS) was established. The system has been renewed twice in 1973 and 1988. In 1962, a new concept emergency environmental γ-ray monitoring system (MP) was begun to construct and completed in 1965 independent of EMS. The first renewal of the EMS was carried out by focusing on the rapid and synthetic judgement and estimation of the environmental impacts caused by radiation and radioactive materials due to the operation of nuclear facilities by centralizing the data measured at MS, MP, a meteorological station, stack monitors and drainage monitoring stations under the control of computer. Present system renewed in 1988 was designed to prevent the interruption of monitoring due to computer troubles, communication troubles and power failures especially an instant voltage drop caused by thunder by reflecting the experiences through the operation and maintenance of the former system. Dual telemeters whose power is constantly supplied via batteries (capable of 10 min. monitoring after power failure) are equipped in the monitoring center to cope with telemeter troubles, which has operated successfully without any suspension being attributable to the power failures and telemeter troubles. (J.P.N.)
Distributed intelligent urban environment monitoring system
Du, Jinsong; Wang, Wei; Gao, Jie; Cong, Rigang
2018-02-01
The current environmental pollution and destruction have developed into a world-wide major social problem that threatens human survival and development. Environmental monitoring is the prerequisite and basis of environmental governance, but overall, the current environmental monitoring system is facing a series of problems. Based on the electrochemical sensor, this paper designs a small, low-cost, easy to layout urban environmental quality monitoring terminal, and multi-terminal constitutes a distributed network. The system has been small-scale demonstration applications and has confirmed that the system is suitable for large-scale promotion
Visualization System for Monitoring Data Management Systems
Directory of Open Access Journals (Sweden)
Emanuel Pinho
2016-11-01
Full Text Available Usually, a Big Data system has a monitoring system for performance evaluation and error prevention. There are some disadvantages in the way that these tools display the information and its targeted approach to physical components. The main goal is to study visual and interactive mechanisms that allow the representation of monitoring data in grid computing environments, providing the end-user information, which can contribute objectively to the system analysis. This paper is an extension of the paper presented at (Pinho and Carvalho 2016 and has the purpose to present the state of the art, carries out the proposed solution and present the achieved goals.
Online NPP monitoring with neuro-expert system
International Nuclear Information System (INIS)
Nabeshima, K.
2002-01-01
This study present a hybrid monitoring system for nuclear power plant utilizing neural networks and a rule-based expert system. The whole monitoring system including a data acquisition system and the advisory displays has been tested by an on-line simulator of pressurized water reactor. From the testing results, it was shown that the neural network in the monitoring system successfully modeled the plant dynamics and detected the symptoms of anomalies earlier than the conventional alarm system. The expert system also worked satisfactorily in diagnosing and displaying the system status by using the outputs of neural networks and a priori knowledge base
Area monitoring intelligent system - SIMA
International Nuclear Information System (INIS)
Bhoem, P.; Hisas, F.; Gelardi, G.
1990-01-01
The area monitoring intelligent system (SIMA) is an equipment to be used in radioprotection. SIMA has the function of monitoring the radiation levels of determined areas of the installations where radioactive materials are handled. (Author) [es
Computerized plutonium laboratory-stack monitoring system
International Nuclear Information System (INIS)
Stafford, R.G.; DeVore, R.K.
1977-01-01
The Los Alamos Scientific Laboratory has recently designed and constructed a Plutonium Research and Development Facility to meet design criteria imposed by the United States Energy Research and Development Administration. A primary objective of the design criteria is to assure environmental protection and to reliably monitor plutonium effluent via the ventilation exhaust systems. A state-of-the-art facility exhaust air monitoring system is described which establishes near ideal conditions for evaluating plutonium activity in the stack effluent. Total and static pressure sensing manifolds are incorporated to measure average velocity and integrated total discharge air volume. These data are logged at a computer which receives instrument data through a multiplex scanning system. A multipoint isokinetic sampling assembly with associated instrumentation is described. Continuous air monitors have been designed to sample from the isokinetic sampling assembly and transmit both instantaneous and integrated stack effluent concentration data to the computer and various cathode ray tube displays. The continuous air monitors also serve as room air monitors in the plutonium facility with the primary objective of timely evacuation of personnel if an above tolerance airborne plutonium concentration is detected. Several continuous air monitors are incorporated in the ventilation system to assist in identification of release problem areas
Tack, Cornelius; Pohlmeier, Harald; Behnke, Thomas; Schmid, Volkmar; Grenningloh, Marco; Forst, Thomas; Pfützner, Andreas
2012-04-01
This multicenter study was conducted to evaluate the performance of five recently introduced blood glucose (BG) monitoring (BGM) devices under daily routine conditions in comparison with the YSI (Yellow Springs, OH) 2300 Stat Plus glucose analyzer. Five hundred one diabetes patients with experience in self-monitoring of BG were randomized to use three of five different BGM devices (FreeStyle Lite® [Abbott Diabetes Care Inc., Alameda, CA], FreeStyle Freedom Lite [Abbott Diabetes Care], OneTouch® UltraEasy® [LifeScan Inc., Milpitas, CA], Accu-Chek® Aviva [Roche Diagnostics, Mannheim, Germany], and Contour® [Bayer Vital GmbH, Leverkusen, Germany]) in a daily routine setting. All devices and strips were purchased from local regular distribution sources (pharmacies, four strip lots per device). The patients performed the finger prick and the glucose measurement on their own. In parallel, a healthcare professional performed the glucose assessment with the reference method (YSI 2300 Stat Plus). The primary objective was the comparison of the mean absolute relative differences (MARD). Secondary objectives were compliance with the International Organization for Standardization (ISO) accuracy criteria under these routine conditions and Clarke and Parkes Error Grid analyses. MARD ranged from 4.9% (FreeStyle Lite) to 9.7% (OneTouch UltraEasy). The ISO 15197:2003 requirements were fulfilled by the FreeStyle Lite (98.8%), FreeStyle Freedom Lite (97.5%), and Accu-Chek Aviva (97.0%), but not by the Contour (92.4%) and OneTouch UltraEasy (91.1%). The number of values in Zone A of the Clarke Error Grid analysis was highest for the FreeStyle Lite (98.8%) and lowest for the OneTouch Ultra Easy (90.4%). FreeStyle Lite, FreeStyle Freedom Lite, and Accu-Chek Aviva performed very well in this study with devices and strips purchased through regular distribution channels, with the FreeStyle Lite achieving the lowest MARD in this investigation.
Upgrade of the LHCb ECAL monitoring system
Guz, Yu
2015-01-01
The LHCb ECAL is a shashlik calorimeter of 6016 cells, covering 7.68 x 6.24 m$^2$ area. To monitor the readout chain of each ECAL cell, the LHCb ECAL is equipped with a LED based monitoring system. During the LHC Run I (2009-2012) it was found that the precision of the monitoring suffers from the radiation degradation of transparency of polystyrene clear fibers used to transport the LED light to the ECAL photomultipliers. In order to improve the performance of the monitoring system, and especially in view of significant increase of LHCb working luminosity foreseen after 2018, the present plastic fibers have been replaced by radiation hard quartzfi bers. The performance of the old LHCb ECAL monitoring system during LHC Run I and the design of the upgraded system are discussed here.
Centralized environmental radiation monitoring system in JAERI
International Nuclear Information System (INIS)
Katagiri, H.; Kobalyashi, H.
1993-01-01
JAERI has continued the environmental radiation background survey and monitoring to ensure the safety of the peoples around the institute since one year before the first criticality of JRR-1 (Japan Research Reactor No.1) in August 1957. Air absorbed doses from β and γ radiation, α and β radioactivity in air and the radioactivities in environmental samples were the monitoring items. For the monitoring of β and γ radiation and α and β radioactivity in air, monitoring station and the centralized automatic environmental radiation monitoring system applying a computer were established as a new challenging monitoring system for nuclear facility, which was the first one not only in Japan but also in the would in 1960 and since then the system has been renewed two times (in 1973 and 1988) by introducing the latest technology in the fields of radiation detection and computer control at each stage. Present system renewed in 1988 was designed to prevent the interruption of monitoring due to computer troubles, communication troubles and power failures especially an instant voltage drop arisen from thunder by reflecting the experiences through the operation and maintenance of the former system. Dual telemeters whose power is constantly supplied via batteries (capable of 10 min monitoring after power failure) are equipped in the monitoring center to cope with telemeter troubles, which has operated successfully without any suspension being attributable to the power failures and telemeter troubles
DeBoer, Mark D; Cherñavvsky, Daniel R; Topchyan, Katarina; Kovatchev, Boris P; Francis, Gary L; Breton, Marc D
2017-11-01
To evaluate the safety and performance of using a heart rate (HR) monitor to inform an artificial pancreas (AP) system during exercise among adolescents with type 1 diabetes (T1D). In a randomized, cross-over trial, adolescents with T1D age 13 - 18 years were enrolled to receive on separate days either the unmodified UVa AP (stdAP) or an AP system connected to a portable HR monitor (AP-HR) that triggered an exercise algorithm for blood glucose (BG) control. During admissions participants underwent a structured exercise regimen. Hypoglycemic events and CGM tracings were compared between the two admissions, during exercise and for the full 24-hour period. Eighteen participants completed the trial. While number of hypoglycemic events during exercise and rest was not different between visits (0.39 AP-HR vs 0.50 stdAP), time below 70 mg dL -1 was lower on AP-HR compared to stdAP, 0.5±2.1% vs 7.4±12.5% (P = 0.028). Time with BG within 70-180 mg dL -1 was higher for the AP-HR admission vs stdAP during the exercise portion and overall (96% vs 87%, and 77% vs 74%), but these did not reach statistical significance (P = 0.075 and P = 0.366). Heart rate signals can safely and efficaciously be integrated in a wireless AP system to inform of physical activity. While exercise contributes to hypoglycemia among adolescents, even when using an AP system, informing the system of exercise via a HR monitor improved time <70 mg dL -1 . Nonetheless, it did not significantly reduce the total number of hypoglycemic events, which were low in both groups. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Life Support Systems: Environmental Monitoring
National Aeronautics and Space Administration — The Advanced Exploration Systems (AES) Life Support Systems project Environmental Monitoring (EM) systems task objectives are to develop and demonstrate onboard...
Acoustic emission leak monitoring system LMS-96
International Nuclear Information System (INIS)
Liska, J.; Cvrcek, M.; Mueller, L.
1997-01-01
On-line acoustic emission leak monitoring under industrial conditions of nuclear power plants is a problem with specific features setting specific demands on the leak monitoring system. The paper briefly reviews those problems (attenuation pattern of a real structure, acoustic background, alarm system, etc.) and the solution of some of them is discussed. Information is presented on the Acoustic Emission Leak Monitoring System LMS-96 by SKODA NUCLEAR MACHINERY and the system's function is briefly described. (author)
The BG18, a B(U)F type package used for the transport of irradiated fuel rods - return of experience
Energy Technology Data Exchange (ETDEWEB)
Juergen, S.; Herman, S. [Transnubel, Dessel (Belgium)
2004-07-01
The purpose of this presentation is to share the return of experience of Transnubel after a period of nearly 3 years operation of the BG18 package in several nuclear power plants and hot cell facilities. This package has been used mainly for the shipment of full scale as well as samples of irradiated fuel rods - UOX or MOX, PWR or BWR.
The BG18, a B(U)F type package used for the transport of irradiated fuel rods - return of experience
International Nuclear Information System (INIS)
Juergen, S.; Herman, S.
2004-01-01
The purpose of this presentation is to share the return of experience of Transnubel after a period of nearly 3 years operation of the BG18 package in several nuclear power plants and hot cell facilities. This package has been used mainly for the shipment of full scale as well as samples of irradiated fuel rods - UOX or MOX, PWR or BWR
Portable water quality monitoring system
Nizar, N. B.; Ong, N. R.; Aziz, M. H. A.; Alcain, J. B.; Haimi, W. M. W. N.; Sauli, Z.
2017-09-01
Portable water quality monitoring system was a developed system that tested varied samples of water by using different sensors and provided the specific readings to the user via short message service (SMS) based on the conditions of the water itself. In this water quality monitoring system, the processing part was based on a microcontroller instead of Lead and Copper Rule (LCR) machines to receive the results. By using four main sensors, this system obtained the readings based on the detection of the sensors, respectively. Therefore, users can receive the readings through SMS because there was a connection between Arduino Uno and GSM Module. This system was designed to be portable so that it would be convenient for users to carry it anywhere and everywhere they wanted to since the processor used is smaller in size compared to the LCR machines. It was also developed to ease the user to monitor and control the water quality. However, the ranges of the sensors' detection still a limitation in this study.
Real-time performance monitoring and management system
Budhraja, Vikram S [Los Angeles, CA; Dyer, James D [La Mirada, CA; Martinez Morales, Carlos A [Upland, CA
2007-06-19
A real-time performance monitoring system for monitoring an electric power grid. The electric power grid has a plurality of grid portions, each grid portion corresponding to one of a plurality of control areas. The real-time performance monitoring system includes a monitor computer for monitoring at least one of reliability metrics, generation metrics, transmission metrics, suppliers metrics, grid infrastructure security metrics, and markets metrics for the electric power grid. The data for metrics being monitored by the monitor computer are stored in a data base, and a visualization of the metrics is displayed on at least one display computer having a monitor. The at least one display computer in one said control area enables an operator to monitor the grid portion corresponding to a different said control area.
Uranium concentration monitor manual: 2300 system
International Nuclear Information System (INIS)
Russo, P.A.; Sprinkle, J.K. Jr.; Stephens, M.M.
1985-04-01
This manual describes the design, operation, and procedures for measurement control for the automated uranium concentration monitor on the 2300 solvent extraction system at the Oak Ridge Y-12 Plant. The nonintrusive monitor provides a near-real time readout of uranium concentration at two locations simultaneously in the solvent extraction system for process monitoring and control. Detectors installed at the top of the extraction column and at the bottom of the backwash column acquire spectra of gamma rays from the solvent extraction solutions in the columns. Pulse-height analysis of these spectra gives the concentration of uranium in the organic product of the extraction column and in the aqueous product of the solvent extraction system. The visual readouts of concentrations for process monitoring are updated every 2 min for both detection systems. Simultaneously, the concentration results are shipped to a remote computer that has been installed by Y-12 to demonstrate automatic control of the solvent extraction system based on input of near-real time process operation information. 8 refs., 13 figs., 4 tabs
2015-03-01
COMPARISON OF BG-SENTINELH TRAP AND OVIPOSITION CUPS FOR AEDES AEGYPTI AND AEDES ALBOPICTUS SURVEILLANCE IN JACKSONVILLE, FLORIDA, USA JENNIFER A...trap and oviposition cups (OCs) have both proven effective in the surveillance of Aedes species. This study aimed to determine which of the 2 traps could...best characterize the relative population sizes of Aedes albopictus and Aedes aegypti in an urban section of Jacksonville, FL. Until 1986, Ae
Standard-D hydrogen monitoring system, system design description
International Nuclear Information System (INIS)
Schneider, T.C.
1996-01-01
During most of the year, it is assumed that the vapor space in the 177 radioactive waste tanks on the Hanford Project site contain a uniform mixture of gases. Several of these waste tanks (currently twenty-five, 6 Double Shell Tanks and 19 Single Shell Tanks) were identified as having the potential for the buildup of gasses to a flammable level. An active ventilation system in the Double Shell Tanks and a passive ventilation system in the Single Shell Tanks provides a method of expelling gasses from the tanks. A gas release from a tank causes a temporary rise in the tank pressure, and a potential for increased concentration of hydrogen gas in the vapor space. The gas is released via the ventilation systems until a uniform gas mixture in the vapor space is once again achieved. The Standard Hydrogen Monitoring System (SHMS) is designed to monitor and quantify the percent hydrogen concentration during these potential gas releases. This document describes the design of the Standard-D Hydrogen Monitoring System, (SHMS-D) and its components as it differs from the original SHMS
Radiation monitoring system based on EPICS
International Nuclear Information System (INIS)
Wang Weizhen; Li Jianmin; Wang Xiaobing; Hua Zhengdong; Xu Xunjiang
2008-01-01
Shanghai Synchrotron Radiation Facility (SSRF for short) is a third-generation light source building in China, including a 150 MeV injector, 3.5 GeV booster, 3.5 GeV storage ring and an amount of beam line stations. During operation, a mass of Synchrotron Radiation will be produced by electrons in the booster and the storage ring. Bremsstrahlung and neutrons will also be produced as a result of the interaction between the electrons, especially the beam loss, and the wall of the vacuum beam pipe. SSRF Radiation Monitoring System is established for monitoring the radiation dosage of working area and environment while SSRF operating. The system consists of detectors, intelligent data-collecting modules, monitoring computer, and managing computer. The software system is developed based on EPICS (Experimental Physics and Industrial Control System), implementing the collecting and monitoring the data output from intelligent modules, analyzing the data, and so on. (authors)
FFTF fission gas monitor computer system
International Nuclear Information System (INIS)
Hubbard, J.A.
1987-01-01
The Fast Flux Test Facility (FFTF) is a liquid-metal-cooled test reactor located on the Hanford site. A dual computer system has been developed to monitor the reactor cover gas to detect and characterize any fuel or test pin fission gas releases. The system acquires gamma spectra data, identifies isotopes, calculates specific isotope and overall cover gas activity, presents control room alarms and displays, and records and prints data and analysis reports. The fission gas monitor system makes extensive use of commercially available hardware and software, providing a reliable and easily maintained system. The design provides extensive automation of previous manual operations, reducing the need for operator training and minimizing the potential for operator error. The dual nature of the system allows one monitor to be taken out of service for periodic tests or maintenance without interrupting the overall system functions. A built-in calibrated gamma source can be controlled by the computer, allowing the system to provide rapid system self tests and operational performance reports
Wright, Jennifer A; Larson, Ryan T; Richardson, Alec G; Cote, Noel M; Stoops, Craig A; Clark, Marah; Obenauer, Peter J
2015-03-01
The BG-Sentinel® (BGS) trap and oviposition cups (OCs) have both proven effective in the surveillance of Aedes species. This study aimed to determine which of the 2 traps could best characterize the relative population sizes of Aedes albopictus and Aedes aegypti in an urban section of Jacksonville, FL. Until 1986, Ae. aegypti was considered the dominant container-breeding species in urban northeastern Florida. Since the introduction of Ae. albopictus, Ae. aegypti has become almost completely extirpated. In 2011, a resurgence of Ae. aegypti was detected in the urban areas of Jacksonville; thus this study initially set out to determine the extent of Ae. aegypti reintroduction to the area. We determined that the BGS captured a greater number of adult Ae. aegypti than Ae. albopictus, while OCs did not monitor significantly different numbers of either species, even in areas where the BGS traps suggested a predominance of one species over the other. Both traps were effective at detecting Aedes spp.; however, the BGS proved more diverse by detecting over 20 other species as well. Our results show that in order to accurately determine vectorborne disease threats and the impact of control operations on these 2 species, multiple trapping techniques should be utilized when studying Ae. aegypti and Ae. albopictus population dynamics.
Moisture monitoring and control system engineering study
International Nuclear Information System (INIS)
Carpenter, K.E.; Fadeff, J.G.
1995-01-01
During the past 50 years, a wide variety of chemical compounds have been placed in the 149 single-shell tanks (SSTS) on the Hanford Site. A concern relating to chemical stability, chemical control, and safe storage of the waste is the potential for propagating reactions as a result of ferrocyanide-oxidizer and organic-oxidizer concentrations in the SSTS. Propagating reactions in fuel-nitrate mixtures are precluded if the amounts of fuel and moisture present in the waste are within specified limits. Because most credible ignition sources occur near the waste surface, the main emphasis of this study is toward monitoring and controlling moisture in the top 14 cm (5.5 in.) of waste. The purpose of this engineering study is to recommend a moisture monitoring and control system for use in SSTs containing sludge and saltcake. This study includes recommendations for: (1) monitoring and controlling moisture in SSTs; (2) the fundamental design criteria for a moisture monitoring and control system; and (3) criteria for the deployment of a moisture monitoring and control system in hanford Site SSTs. To support system recommendations, technical bases for selecting and using a moisture monitoring and control system are presented. Key functional requirements and a conceptual design are included to enhance system development and establish design criteria
The SSRL injector beam position monitoring systems
International Nuclear Information System (INIS)
Lavender, W.; Baird, S.; Brennan, S.; Borland, M.; Hettel, R.; Nuhn, H.D.; Ortiz, R.; Safranek, J.; Sebek, J.; Wermelskirchen, C.; Yang, J.
1991-01-01
The beam position monitoring system of the SSRL injector forms a vital component of its operation. Several different types of instrumentation are used to measure the position or intensity of the electron beam in the injector. These include current toroids, fluorescent screens, Faraday cups, the 'Q' meter, a synchrotron light monitor, and electron beam position monitors. This paper focuses on the use of the electron beam position monitors to measure electron trajectories in the injector transport lines and the booster ring. The design of the beam position monitors is described in another paper to be presented at this conference. There are three different beam position monitor systems in the injector. One system consists of a set of five BPMs located on the injection transport line from the linac to the booster (known as the LTB line). There is a second system of six BPMs located on the ejection transport line (known as the BTS line). Finally, there is an array of 40 BPMs installed on the main booster ring itself. This article describes the software and processing electronics of the systems used to measure electron beam trajectories for the new SSRL injector for SPEAR
Bond Graph Modeling and Simulation of Mechatronic Systems
DEFF Research Database (Denmark)
Habib, Tufail; Nielsen, Kjeld; Jørgensen, Kaj Asbjørn
2012-01-01
One of the demanding steps in the design and development of Mechatronic systems is to develop the initial model to visualize the response of a system. The Bond Graph (BG) method is a graphical approach for the design of multidomain systems. That is ideal for visualizing the essential characterist......One of the demanding steps in the design and development of Mechatronic systems is to develop the initial model to visualize the response of a system. The Bond Graph (BG) method is a graphical approach for the design of multidomain systems. That is ideal for visualizing the essential...
Ulysses spacecraft control and monitoring system
Hamer, P. A.; Snowden, P. J.
1991-01-01
The baseline Ulysses spacecraft control and monitoring system (SCMS) concepts and the converted SCMS, residing on a DEC/VAX 8350 hardware, are considered. The main functions of the system include monitoring and displaying spacecraft telemetry, preparing spacecraft commands, producing hard copies of experimental data, and archiving spacecraft telemetry. The SCMS system comprises over 20 subsystems ranging from low-level utility routines to the major monitoring and control software. These in total consist of approximately 55,000 lines of FORTRAN source code and 100 VMS command files. The SCMS major software facilities are described, including database files, telemetry processing, telecommanding, archiving of data, and display of telemetry.
National Satellite Forest Monitoring systems for REDD+
Jonckheere, I. G.
2012-12-01
Reducing Emissions from Deforestation and Forest Degradation (REDD) is an effort to create a financial value for the carbon stored in forests, offering incentives for developing countries to reduce emissions from forested lands and invest in low-carbon paths to sustainable development. "REDD+" goes beyond deforestation and forest degradation, and includes the role of conservation, sustainable management of forests and enhancement of forest carbon stocks. In the framework of getting countries ready for REDD+, the UN-REDD Programme assists developing countries to prepare and implement national REDD+ strategies. For the monitoring, reporting and verification, FAO supports the countries to develop national satellite forest monitoring systems that allow for credible measurement, reporting and verification (MRV) of REDD+ activities. These are among the most critical elements for the successful implementation of any REDD+ mechanism. The UN-REDD Programme through a joint effort of FAO and Brazil's National Space Agency, INPE, is supporting countries to develop cost- effective, robust and compatible national monitoring and MRV systems, providing tools, methodologies, training and knowledge sharing that help countries to strengthen their technical and institutional capacity for effective MRV systems. To develop strong nationally-owned forest monitoring systems, technical and institutional capacity building is key. The UN-REDD Programme, through FAO, has taken on intensive training together with INPE, and has provided technical help and assistance for in-country training and implementation for national satellite forest monitoring. The goal of the support to UN-REDD pilot countries in this capacity building effort is the training of technical forest people and IT persons from interested REDD+ countries, and to set- up the national satellite forest monitoring systems. The Brazilian forest monitoring system, TerraAmazon, which is used as a basis for this initiative, allows
Automated Vehicle Monitoring System
Wibowo, Agustinus Deddy Arief; Heriansyah, Rudi
2014-01-01
An automated vehicle monitoring system is proposed in this paper. The surveillance system is based on image processing techniques such as background subtraction, colour balancing, chain code based shape detection, and blob. The proposed system will detect any human's head as appeared at the side mirrors. The detected head will be tracked and recorded for further action.
Current status of technology development on remote monitoring system
International Nuclear Information System (INIS)
Yoon, Wan Ki; Lee, Y. K.; Lee, Y. D.; Na, W. W.
1997-03-01
IAEA is planning to perform the remote monitoring system in nuclear facility in order to reinforce the economical and efficient inspection. National lab. in U.S. is developing the corresponding core technology and field trial will be done to test the remote monitoring system by considering the case that it replace the current safeguards system. U.S. setup the International Remote Monitoring Project to develop the technology. IAEA makes up remote monitoring team and setup the detail facility to apply remote monitoring system. Therefore, early participation in remote monitoring technology development will make contribution in international remote monitoring system and increase the transparency and confidence in domestic nuclear activities. (author). 12 refs., 20 figs
A comparative effectiveness analysis of three continuous glucose monitors.
Damiano, Edward R; El-Khatib, Firas H; Zheng, Hui; Nathan, David M; Russell, Steven J
2013-02-01
To compare three continuous glucose monitoring (CGM) devices in subjects with type 1 diabetes under closed-loop blood glucose (BG) control. Six subjects with type 1 diabetes (age 52 ± 14 years, diabetes duration 32 ± 14 years) each participated in two 51-h closed-loop BG control experiments in the hospital. Venous plasma glucose (PG) measurements (GlucoScout, International Biomedical) obtained every 15 min (2,360 values) were paired in time with corresponding CGM glucose (CGMG) measurements obtained from three CGM devices, the Navigator (Abbott Diabetes Care), the Seven Plus (DexCom), and the Guardian (Medtronic), worn simultaneously by each subject. Errors in paired PG-CGMG measurements and data reporting percentages were obtained for each CGM device. The Navigator had the best overall accuracy, with an aggregate mean absolute relative difference (MARD) of all paired points of 11.8 ± 11.1% and an average MARD across all 12 experiments of 11.8 ± 3.8%. The Seven Plus and Guardian produced aggregate MARDs of all paired points of 16.5 ± 17.8% and 20.3 ± 18.0%, respectively, and average MARDs across all 12 experiments of 16.5 ± 6.7% and 20.2 ± 6.8%, respectively. Data reporting percentages, a measure of reliability, were 76% for the Seven Plus and nearly 100% for the Navigator and Guardian. A comprehensive head-to-head-to-head comparison of three CGM devices for BG values from 36 to 563 mg/dL revealed marked differences in performance characteristics that include accuracy, precision, and reliability. The Navigator outperformed the other two in these areas.
Shared performance monitor in a multiprocessor system
Chiu, George; Gara, Alan G.; Salapura, Valentina
2012-07-24
A performance monitoring unit (PMU) and method for monitoring performance of events occurring in a multiprocessor system. The multiprocessor system comprises a plurality of processor devices units, each processor device for generating signals representing occurrences of events in the processor device, and, a single shared counter resource for performance monitoring. The performance monitor unit is shared by all processor cores in the multiprocessor system. The PMU comprises: a plurality of performance counters each for counting signals representing occurrences of events from one or more the plurality of processor units in the multiprocessor system; and, a plurality of input devices for receiving the event signals from one or more processor devices of the plurality of processor units, the plurality of input devices programmable to select event signals for receipt by one or more of the plurality of performance counters for counting, wherein the PMU is shared between multiple processing units, or within a group of processors in the multiprocessing system. The PMU is further programmed to monitor event signals issued from non-processor devices.
An automated neutron monitor maintenance system
International Nuclear Information System (INIS)
Moore, F.S.; Griffin, J.C.; Odell, D.M.C.
1996-01-01
Neutron detectors are commonly used by the nuclear materials processing industry to monitor fissile materials in process vessels and tanks. The proper functioning of these neutron monitors must be periodically evaluated. We have developed and placed in routine use a PC-based multichannel analyzer (MCA) system for on-line BF3 and He-3 gas-filled detector function testing. The automated system: 1) acquires spectral data from the monitor system, 2) analyzes the spectrum to determine the detector's functionality, 3) makes suggestions for maintenance or repair, as required, and 4) saves the spectrum and results to disk for review. The operator interface has been designed to be user-friendly and to minimize the training requirements of the user. The system may also be easily customized for various applications
Integrated environmental monitoring and information system
International Nuclear Information System (INIS)
Klinda, J.; Lieskovska, Z.
1998-01-01
The concept of the environmental monitoring within the territory of the Slovak Republic and the concept of the integrated environmental information system of the Slovak Republic were accepted and confirmed by the Government Order No. 449/1992. The state monitoring system covering the whole territory of Slovakia is the most important and consists of 13 Partial Monitoring Systems (PMSs). List of PMSs is included. The listed PMSs are managed according to the concept of the Sectoral Information System (SIS) of the Ministry of the Environment of the Slovak Republic (MESR) which was established by the National Council Act No. 261/1995 Coll. on the SIS. The SIS consists of 18 subsystems which are listed. The overviews of budget of PMSs as well as of environmental publications and periodicals of the MESR are included
Remote Maintenance Monitoring System -
Department of Transportation — The Remote Maintenance and Monitoring System (RMMS) is a collection of subsystems that includes telecommunication components, hardware, and software, which serve to...
Structure health monitoring system using internet and database technologies
International Nuclear Information System (INIS)
Kwon, Il Bum; Kim, Chi Yeop; Choi, Man Yong; Lee, Seung Seok
2003-01-01
Structural health monitoring system should developed to be based on internet and database technology in order to manage efficiently large structures. This system is operated by internet connected with the side of structures. The monitoring system has some functions: self monitoring, self diagnosis, and self control etc. Self monitoring is the function of sensor fault detection. If some sensors are not normally worked, then this system can detect the fault sensors. Also Self diagnosis function repair the abnormal condition of sensors. And self control is the repair function of the monitoring system. Especially, the monitoring system can identify the replacement of sensors. For further study, the real application test will be performed to check some unconvince.
Structural health monitoring system using internet and database technologies
Energy Technology Data Exchange (ETDEWEB)
Kim, Chi Yeop; Choi, Man Yong; Kwon, Il Bum; Lee, Seung Seok [Nonstructive Measurment Lab., KRISS, Daejeon (Korea, Republic of)
2003-07-01
Structure health monitoring system should develope to be based on internet and database technology in order to manage efficiency large structures. This system is operated by internet connected with the side of structures. The monitoring system has some functions: self monitoring, self diagnosis, and self control etc. Self monitoring is the function of sensor fault detection. If some sensors are not normally worked, then this system can detect the fault sensors. Also Self diagnosis function repair the abnormal condition of sensors. And self control is the repair function of the monitoring system. Especially, the monitoring system can identify the replacement of sensors. For further study, the real application test will be performed to check some unconviniences.
Structure health monitoring system using internet and database technologies
Energy Technology Data Exchange (ETDEWEB)
Kwon, Il Bum; Kim, Chi Yeop; Choi, Man Yong; Lee, Seung Seok [Smart Measurment Group. Korea Resarch Institute of Standards and Science, Saejeon (Korea, Republic of)
2003-05-15
Structural health monitoring system should developed to be based on internet and database technology in order to manage efficiently large structures. This system is operated by internet connected with the side of structures. The monitoring system has some functions: self monitoring, self diagnosis, and self control etc. Self monitoring is the function of sensor fault detection. If some sensors are not normally worked, then this system can detect the fault sensors. Also Self diagnosis function repair the abnormal condition of sensors. And self control is the repair function of the monitoring system. Especially, the monitoring system can identify the replacement of sensors. For further study, the real application test will be performed to check some unconvince.
Structural health monitoring system using internet and database technologies
International Nuclear Information System (INIS)
Kim, Chi Yeop; Choi, Man Yong; Kwon, Il Bum; Lee, Seung Seok
2003-01-01
Structure health monitoring system should develope to be based on internet and database technology in order to manage efficiency large structures. This system is operated by internet connected with the side of structures. The monitoring system has some functions: self monitoring, self diagnosis, and self control etc. Self monitoring is the function of sensor fault detection. If some sensors are not normally worked, then this system can detect the fault sensors. Also Self diagnosis function repair the abnormal condition of sensors. And self control is the repair function of the monitoring system. Especially, the monitoring system can identify the replacement of sensors. For further study, the real application test will be performed to check some unconviniences.
International Nuclear Information System (INIS)
Wakasa, Kohji; Nishida, Eiichi; Ishii, Kazuo; Yamanaka, Hiroto.
1987-01-01
In the loose parts monitoring system (LPMS), installed for integrity monitoring of the nuclear power plants; when there occur foreign metallic objects in the reactor primary system, including a steam generator and the piping, the sounds caused by them moving with the cooling water and thereby getting in contact with various structures are detected. Its purpose is, therefore, to detect any abnormality in the reactor plant system through such abnormal sounds due to loose or fallen supports etc., and so provide this information to the reactor operators. In principle, accelerometers are distributed in such as reactor vessel, steam generator, coolant pumps, etc., so that various sounds are collected and converted into electrical signals, followed by analysis of the data. Described are the LPMS configuration/functions, the course taken in LPMS development, future problems, etc. (Mori, K.)
OPTIMIZATION METHODS FOR HYDROECOLOGICAL MONITORING SYSTEMS
Directory of Open Access Journals (Sweden)
Inna Pivovarova
2016-09-01
Full Text Available The paper describes current approaches to the rational distribution of monitoring stations. A short review and the organization of the system of hydro-geological observations in different countries are presented. On the basis of real data we propose a solution to the problem of how to calculate the average area per one hydrological station, which is the main indicator of the efficiency and performance of the monitoring system in general. We conclude that a comprehensive approach to the monitoring system organization is important, because only hydrometric and hydrochemical activities coordinated in time provide possibilities needed to analyse the underline causes of the observed pollutants content dynamics in water bodies in the long term.
Modification of GNPS environment radiation monitoring network system
International Nuclear Information System (INIS)
Jiang Lili; Cao Chunsheng
1999-01-01
GNPS Environment Radiation Continuous Monitoring System (KRS), the only real time on-line system of site radiation monitoring, was put into service in 1993 prior to the first loading the the plant. It is revealed through several years of operation that this system has some deficiencies such as inadequate real time monitoring means, no figure and diagram display function on the central computer, high failures, frequent failure warning signals, thus making the availability of the system at a low level. In recent years, with the rapid development of computer network technology and increasingly strict requirements on the NPP environment protection raised by the government and public, KRS modification had become necessary and urgent. In 1996, GNPS carried out modification work on the measuring geometry condition of γ radiation monitoring sub-station and lightening protection. To enhance the functions of real time monitoring and data auto-processing, further modification of the system was made in 1998, including the update of the software and hardware of KRS central processor, set-up of system computer local network and database. In this way, the system availability and monitoring quality are greatly improved and effective monitoring and analysis means are provided for gaseous release during normal operation and under accident condition
Project W-420 stack monitoring system upgrades
International Nuclear Information System (INIS)
CARPENTER, K.E.
1999-01-01
This project will execute the design, procurement, construction, startup, and turnover activities for upgrades to the stack monitoring system on selected Tank Waste Remediation System (TWRS) ventilation systems. In this plan, the technical, schedule, and cost baselines are identified, and the roles and responsibilities of project participants are defined for managing the Stack Monitoring System Upgrades, Project W-420
Reliability of operating WWER monitoring systems
International Nuclear Information System (INIS)
Yastrebenetsky, M.A.; Goldrin, V.M.; Garagulya, A.V.
1996-01-01
The elaboration of WWER monitoring systems reliability measures is described in this paper. The evaluation is based on the statistical data about failures what have collected at the Ukrainian operating nuclear power plants (NPP). The main attention is devoted to radiation safety monitoring system and unit information computer system, what collects information from different sensors and system of the unit. Reliability measures were used for decision the problems, connected with life extension of the instruments, and for other purposes. (author). 6 refs, 6 figs
Reliability of operating WWER monitoring systems
Energy Technology Data Exchange (ETDEWEB)
Yastrebenetsky, M A; Goldrin, V M; Garagulya, A V [Ukrainian State Scientific Technical Center of Nuclear and Radiation Safety, Kharkov (Ukraine). Instrumentation and Control Systems Dept.
1997-12-31
The elaboration of WWER monitoring systems reliability measures is described in this paper. The evaluation is based on the statistical data about failures what have collected at the Ukrainian operating nuclear power plants (NPP). The main attention is devoted to radiation safety monitoring system and unit information computer system, what collects information from different sensors and system of the unit. Reliability measures were used for decision the problems, connected with life extension of the instruments, and for other purposes. (author). 6 refs, 6 figs.
Wang, Wanshun; Chen, Zhuo; Li, Xiuwen
2018-03-01
The safety monitoring is very important in the operation and management of water resources and hydropower projects. It is the important means to understand the dam running status, to ensure the dam safety, to safeguard people’s life and property security, and to make full use of engineering benefits. This paper introduces the arrangement of engineering safety monitoring system based on the example of a water resource control project. The monitoring results of each monitoring project are analyzed intensively to show the operating status of the monitoring system and to provide useful reference for similar projects.
International Nuclear Information System (INIS)
Huang Libin; Zhong Zhijing; Zhou Yinhang; Guo Hongbo
2014-01-01
The system, employing advanced intelligent terminal, mobile applications, database technology, can achieve all kinds of field monitoring, mobile radiation monitoring data collected for laboratory analysis; employing GPS technology, can achieve the geographic information of the radiation monitoring data, time tagging and other anti-cheating measures; the system also established a mass database management system; the system is suitable for all types of nuclear-related units with special adaptive functions; system will be extended to GIS-based management capabilities of nuclear contamination distribution in latter stage. (authors)
Mechatronics in design of monitoring and diagnostic systems
Energy Technology Data Exchange (ETDEWEB)
Uhl, T.; Barszcz, T. [Univ. of Mining and Metallurgy, Krakow (Poland); Hanc, A. [Energocontrol Ltd., Krakow (Poland)
2003-07-01
Nowadays development of computer engineering in area of hardware and software gives new possibilities of monitoring and diagnostics system design. The paper presents analysis of new possible solutions for design of monitoring and diagnostic systems including; smart sensor design, modular software design and communication modules. New concept of monitoring system based on home page server solution (nano-server) is presented. Smart sensor design concept with embedded hardware for diagnostic application is shown. New software concept for monitoring and diagnostics automation and examples of applications of new design for condition monitoring based on proposed solution are carefully discussed. (orig.)
Tang, Bin; Jiang, Chun; Zhu, Haibin
2012-08-01
Based on the scalar diffraction theory and the fact that a hard-edged aperture function can be expanded into a finite sum of complex Gaussian functions, an approximate analytical solution for Bessel-Gaussian (BG) beams propagating through a double-apertured fractional Fourier transform (FrFT) system is derived in the cylindrical coordinate. By using the approximate analytical formulas, the propagation properties of BG beams passing through a double-apertured FrFT optical system have been studied in detail by some typical numerical examples. The results indicate that the double-apertured FrFT optical system provides a convenient way for controlling the properties of the BG beams by properly choosing the optical parameters.
Monitoring the CMS Data Acquisition System
Bauer, Gerry; Biery, K; Branson, J; Cano, E; Cheung, H; Ciganek, M; Cittolin, S; Coarasa, J A; Deldicque, C; Dusinberre, E; Erhan, S; Fortes Rodrigues, F; Gigi, D; Glege, F; Gomez-Reino, R; Gutleber, J; Hatton, D; Laurens, J F; Lopez Perez, J A; Meijers, F; Meschi, E; Meyer, A; Mommsen, R; Moser, R; O'Dell, V; Oh, A; Orsini, L B; Patras, V; Paus, C; Petrucci, A; Pieri, M; Racz, A; Sakulin, H; Sani, M; Schieferdecker, P; Schwick, C; Shpakov, D; Simon, S; Sumorok, K; Zanetti, M.
2010-01-01
The CMS data acquisition system comprises O(20000) interdependent services that need to be monitored in near real-time. The ability to monitor a large number of distributed applications accurately and effectively is of paramount importance for robust operations. Application monitoring entails the collection of a large number of simple and composed values made available by the software components and hardware devices. A key aspect is that detection of deviations from a specified behaviour is supported in a timely manner, which is a prerequisite in order to take corrective actions efficiently. Given the size and time constraints of the CMS data acquisition system, efficient application monitoring is an interesting research problem. We propose an approach that uses the emerging paradigm of Web-service based eventing systems in combination with hierarchical data collection and load balancing. Scalability and efficiency are achieved by a decentralized architecture, splitting up data collections into regions of col...
Hybrid Wireless Hull Monitoring System for Naval Combat Vessels
2010-03-01
Payload Data Acquisition System (SPDAS) is designed by the Technology Management Group, Inc. ( TMG ). In its design, the monitoring system is intended...monitoring system custom designed by TMG for the U.S. Navy. The Scientific Payload Data Acquisition System (SPDAS) is a wired hull monitoring system
Radiation monitoring system in medical facilities
International Nuclear Information System (INIS)
Matsuno, Kiyoshi
1981-01-01
(1) RI selective liquid effluent monitor is, in many cases, used at medical facilities to obtain data for density of radioactivity of six radionuclides. In comparison with the conventional gross measuring systems, over-evaluation is less, and the monitor is more practical. (2) Preventive monitor for loss of radium needle is a system which prevents missing of radium needle at a flush-toilet in radium treatment wards, and this monitor is capable of sensing a drop-off of radium needle of 0.5 mCi (minimum). (3) Short-lived positron gas measuring device belongs to a BABY CYCLOTRON installed in a hospital, and this device is used to measure density of radioactivity, radioactive impurity and chemical impurity of produced radioactive gas. (author)
Bulk laundry monitoring system
International Nuclear Information System (INIS)
Thakur, Vaishali M.; Jain, Amit; Verma, Amit; Anilkumar, S.; Babu, D.A.R.; Sharma, D.N.; Rande, N.R.; Singh, B.N.
2012-01-01
Protective wear (like boiler suits, hand gloves etc.) is essential while handling radioactive material in plants/laboratories. During the course of work, it is quite possible that protective wear may get contaminated. These protective wears are packed in laundry bags and send to Decontamination Centre (DC). There is a need for monitoring the laundry bags at the time of receipt, as well as before dispatch to respective locations to comply with AERB guidelines, To avoid cross contamination during wash cycle, contaminated bags (> 0.5 mR/h on surface) need to be segregated. Present paper describes the development of such system for monitoring surface dose rate on bags at the time of receipt. The system installed at ETP after calibration, effectively segregates the contaminated bags from the rest and prevents from cross contamination during wash cycle. Reduction in man-rem consumption due to semi automatic monitoring. Improved sensitivity due to good geometry, long counting time, background and attenuation corrections. Optimum utilization of decontamination chemicals based on level of contamination and keeping track of its inventory. Generation of decontamination process data base for improvement
Apparatus, System, And Method For Roadway Monitoring
Claudel, Christian G.
2015-06-02
An apparatus, system, and method for monitoring traffic and roadway water conditions. Traffic flow and roadway flooding is monitored concurrently through a wireless sensor network. The apparatus and system comprises ultrasound rangefinders monitoring traffic flow, flood water conditions, or both. Routing information may be calculated from the traffic conditions, such that routes are calculated to avoid roadways that are impassable or are slow due to traffic conditions.
Apparatus, System, And Method For Roadway Monitoring
Claudel, Christian G.
2015-01-01
An apparatus, system, and method for monitoring traffic and roadway water conditions. Traffic flow and roadway flooding is monitored concurrently through a wireless sensor network. The apparatus and system comprises ultrasound rangefinders monitoring traffic flow, flood water conditions, or both. Routing information may be calculated from the traffic conditions, such that routes are calculated to avoid roadways that are impassable or are slow due to traffic conditions.
International Nuclear Information System (INIS)
Schneider, S.; Lucero, R.; Glidewell, D.
1997-01-01
The Autoridad Regulataria Nuclear (ARN) and the United States Department of Energy (DOE) are cooperating on the development of a Remote Monitoring System for nuclear nonproliferation efforts. A Remote Monitoring System for spent fuel transfer will be installed at the Argentina Nuclear Power Station in Embalse, Argentina. The system has been designed by Sandia National Laboratories (SNL), with Los Alamos National Laboratory (LANL) and Oak Ridge National Laboratory (ORNL) providing gamma and neutron sensors. This project will test and evaluate the fundamental design and implementation of the Remote Monitoring System in its application to regional and international safeguards efficiency. This paper provides a description of the monitoring system and its functions. The Remote Monitoring System consists of gamma and neutron radiation sensors, RF systems, and video systems integrated into a coherent functioning whole. All sensor data communicate over an Echelon LonWorks Network to a single data logger. The Neumann DCM 14 video module is integrated into the Remote Monitoring System. All sensor and image data are stored on a Data Acquisition System (DAS) and archived and reviewed on a Data and Image Review Station (DIRS). Conventional phone lines are used as the telecommunications link to transmit on-site collected data and images to remote locations. The data and images are authenticated before transmission. Data review stations will be installed at ARN in Buenos Aires, Argentina, ABACC in Rio De Janeiro, IAEA Headquarters in Vienna, and Sandia National Laboratories in Albuquerque, New Mexico. 2 refs., 2 figs
Baumstark, Annette; Schmid, Christina; Pleus, Stefan; Haug, Cornelia; Freckmann, Guido
2013-11-01
Partial pressure of oxygen (pO2) in blood samples can affect blood glucose (BG) measurements, particularly in systems that employ the glucose oxidase (GOx) enzyme reaction on test strips. In this study, we assessed the impact of different pO2 values on the performance of five GOx systems and one glucose dehydrogenase (GDH) system. Two of the GOx systems are labeled by the manufacturers to be sensitive to increased blood oxygen content, while the other three GOx systems are not. Aliquots of 20 venous samples were adjusted to the following pO2 values: oxygen sensitive. © 2013 Diabetes Technology Society.
Instrument failure monitoring in nuclear power systems
International Nuclear Information System (INIS)
Tylee, J.L.
1982-01-01
Methods of monitoring dynamic systems for instrument failures were developed and evaluated. In particular, application of these methods to nuclear power plant components is addressed. For a linear system, statistical tests on the innovations sequence of a Kalman filter driven by all system measurements provides a failure detection decision and identifies any failed sensor. This sequence (in an unfailed system) is zero-mean with calculable covariance; hence, any major deviation from these properties is assumed to be due to an instrument failure. Once a failure is identified, the failed instrument is replaced with an optimal estimate of the measured parameter. This failure accommodation is accomplished using optimally combined data from a bank of accommodation Kalman filters (one for each sensor), each driven by a single measurement. Using such a sensor replacement allows continued system operation under failed conditions and provides a system operator with information otherwise unavailable. To demonstrate monitor performance, a liner failure monitor was developed for the pressurizer in the Loss-of-Fluid Test (LOFT) reactor plant. LOFT is a small-scale pressurized water reactor (PWR) research facility located at the Idaho National Engineering Laboratory. A linear, third-order model of the pressurizer dynamics was developed from first principles and validated. Using data from the LOFT L6 test series, numerous actual and simulated water level, pressure, and temperature sensor failures were employed to illustrate monitor capabilities. Failure monitor design was applied to nonlinear dynamic systems by replacing all monitor linear Kalman filters with extended Kalman filters. A nonlinear failure monitor was derived for LOFT reactor instrumentation. A sixth-order reactor model, including descriptions of reactor kinetics, fuel rod heat transfer, and core coolant dynamics, was obtained and verified with test data
Monitoring support system for nuclear power plant
International Nuclear Information System (INIS)
Higashikawa, Yuichi; Kubota, Rhuji; Tanaka, Keiji; Takano, Yoshiyuki
1996-01-01
The nuclear power plants in Japan reach to 49 plants and supply 41.19 million kW in their installed capacities, which is equal to about 31% of total electric power generation and has occupied an important situation as a stable energy supplying source. As an aim to keeping safe operation and working rate of the power plants, various monitoring support systems using computer technology, optical information technology and robot technology each advanced rapidly in recent year have been developed to apply to the actual plants for a plant state monitoring system of operators in normal operation. Furthermore, introduction of the emergent support system supposed on accidental formation of abnormal state of the power plants is also investigated. In this paper, as a monitoring system in the recent nuclear power plants, design of control panel of recent central control room, introduction to its actual plant and monitoring support system in development were described in viewpoints of improvement of human interface, upgrade of sensor and signal processing techniques, and promotion of information service technique. And, trend of research and development of portable miniature detector and emergent monitoring support system are also introduced in a viewpoint of labor saving and upgrade of the operating field. (G.K.)
Beacon-Colss core monitoring system application and benefits
International Nuclear Information System (INIS)
Boyd, W.A.; Yoon, T.Y.
2005-01-01
Westinghouse and KNFC are creating an upgraded core monitoring system by merging the BEACON system (best estimate analyzer for core operation-nuclear) and COLSS (core operating limit supervisory system) into an integrated product. Although both BEACON and COLSS are core monitoring systems that have been in operation at many plants for a number of years, they each have some features and capabilities that are not in the other. Therefore it has been decided to incorporate portions of COLSS into the beacon system to create an optional level to support core monitoring applications on selected combustion engineering (C-E) designed plants. This optional level in the beacon system will be called BEACON-COLSS and will allow the beacon system to monitor the LCO's and Tech Spec limits at CE plants that currently use COLSS. This paper will present the structure of the new core monitoring system and the benefits it achieves for current COLSS plants, i.e., CE plants in the US and KSNP (Korean standard nuclear power plant). (authors)
Applications for cyber security - System and application monitoring
International Nuclear Information System (INIS)
Marron, J. E.
2006-01-01
Standard network security measures are adequate for defense against external attacks. However, many experts agree that the greater threat is from internal sources. Insiders with malicious intentions can change controller instructions, change alarm thresholds, and issue commands to equipment which can damage equipment and compromise control system integrity. In addition to strict physical security the state of the system must be continually monitored. System and application monitoring goes beyond the capabilities of network security appliances. It will include active processes, operating system services, files, network adapters and IP addresses. The generation of alarms is a crucial feature of system and application monitoring. The alarms should be integrated to avoid the burden on operators of checking multiple locations for security violations. Tools for system and application monitoring include commercial software, free software, and ad-hoc tools that can be easily created. System and application monitoring is part of a 'defense-in-depth' approach to a control network security plan. Layered security measures prevent an individual security measure failure from being exploited into a successful security breach. Alarming of individual failures is essential for rapid isolation and correction of single failures. System and application monitoring is the innermost layer of this defense strategy. (authors)
Monitoring of low level environmental gamma exposure by the centralized radiation monitoring system
International Nuclear Information System (INIS)
Katagiri, Hiroshi; Kobayashi, Hideo; Obata, Kazuichi; Kokubu, Morinobu; Itoh, Naoji
1981-07-01
In the Japan Atomic Energy Research Institute (JAERI), a centralized automatic radiation monitoring system developed 20 years ago has recently been improved to monitor low level gamma radiation more accurately in normal operation of the nuclear facilities and to detect abnormal radioactive releases more effectively. The present state of the system is described. This system puts together environmental monitoring data such as gamma exposure rate (20 points), radioactive concentration in the air (4 points) and in water (2 drains), and meteorological items (14 including wind directions, wind speeds, solar radiation and air temperatures at a observation tower of 40 m height). Environmental monitoring around the JAERI site is carried out effectively using the system. Data processing system consists of a central processing unit, a magnetic disk, a magnetic tape, a line printer and a console typewriter. The data at respective monitoring points are transmitted to the central monitoring room by wireless or telephone line. All data are printed out and field in magnetic disk and magnetic tape every 10 minutes. When the emergency levels are exceeded, however, the data are automatically output on a line printer every 2 minute. This system can distinguish very low gamma exposure due to gaseous effluents, about 1 mR/y, from the background. Even in monthly exposures, calculated values based on the data of release amount and meteorology are in good agreement with the measured ones. (author)
2004-12-01
4LB NO.19 1 BG 1 BG 1.00 BG 0.08 0.008 0.4 0.080 0.008 0.400 Increase 6515012714894 SENSOR SPO2 MONITORING FINGER WRAP PROPAQ 24S 5 EA 6 EA 0.25 PG...prescribed for life-threatening infections , and was called for in 3 of the patients, resulting in an 18-g requirement should the patients stay at the MFST...MONITOR PATIENT 206EL Task 032 Set Up Pulse Oximeter 6515012714894 SENSOR OXYGEN MONITORING NON-INVAS ARTERIAL F/ADULT FINGERS 24S
Functional food monitoring as part of the new Dutch dietary monitoring system
Rompelberg CJM; Jager M; Bakker MI; Buurma-Rethans EJM; Ocke MC; CVG
2006-01-01
Good data on functional food consumption necessary for an adequate Dutch nutrition policy are lacking. This lack may be overcome in future by including functional food monitoring in the new dietary monitoring system in the Netherlands. One specific form of monitoring could be an Internet-based
A radiation monitoring system for nuclear power plants
International Nuclear Information System (INIS)
Iwai, Masaru; Nakamori, S.; Ikeda, H.; Oda, M.
1974-01-01
Safety with respect to radiation is vital factor, particularly in view of the increasing number of nuclear power plants. For this purpose, a radiation monitoring system is provided to perform constant supervision. This article describes the purpose, installation location, specifications and circuitry of a system which is divided into three units: the process monitor, area monitor and off-site monitor. (auth.)
Monitoring Distributed Real-Time Systems: A Survey and Future Directions
Goodloe, Alwyn E.; Pike, Lee
2010-01-01
Runtime monitors have been proposed as a means to increase the reliability of safety-critical systems. In particular, this report addresses runtime monitors for distributed hard real-time systems. This class of systems has had little attention from the monitoring community. The need for monitors is shown by discussing examples of avionic systems failure. We survey related work in the field of runtime monitoring. Several potential monitoring architectures for distributed real-time systems are presented along with a discussion of how they might be used to monitor properties of interest.
Automated Cryocooler Monitor and Control System Software
Britchcliffe, Michael J.; Conroy, Bruce L.; Anderson, Paul E.; Wilson, Ahmad
2011-01-01
This software is used in an automated cryogenic control system developed to monitor and control the operation of small-scale cryocoolers. The system was designed to automate the cryogenically cooled low-noise amplifier system described in "Automated Cryocooler Monitor and Control System" (NPO-47246), NASA Tech Briefs, Vol. 35, No. 5 (May 2011), page 7a. The software contains algorithms necessary to convert non-linear output voltages from the cryogenic diode-type thermometers and vacuum pressure and helium pressure sensors, to temperature and pressure units. The control function algorithms use the monitor data to control the cooler power, vacuum solenoid, vacuum pump, and electrical warm-up heaters. The control algorithms are based on a rule-based system that activates the required device based on the operating mode. The external interface is Web-based. It acts as a Web server, providing pages for monitor, control, and configuration. No client software from the external user is required.
Safeguards equipment of the future: Integrated monitoring systems and remote monitoring
International Nuclear Information System (INIS)
Sonnier, C.S.; Johnson, C.S.
1994-01-01
From the beginning, equipment to support IAEA Safeguards could be characterized as that which is used to measure nuclear material, Destructive Assay (DA) and Non Destructive Assay (NDA), and that which is used to provide continuity of knowledge between inspection intervals, Containment ampersand Surveillance (C/S). C/S equipment has often been thought of as Cameras and Seals, with a limited number of monitors being employed as they became available. In recent years, technology has advanced at an extremely rapid rate, and continues to do so. The traditional film cameras are being replaced by video equipment, and fiber optic and electronic seals have come into rather widespread use. Perhaps the most interesting aspect of this evolution, and that which indicates the wave of the future without much question, is the integration of video surveillance and electronic seals with a variety of monitors. This is demonstrated by safeguards systems which are installed in several nuclear facilities in France, Germany, Japan, the UK, the USA, and elsewhere. The terminology of Integrated Monitoring Systems (IMS) has emerged, with the employment of network technology capable of interconnecting all desired elements in a very flexible manner. Also, the technology for transmission of a wide variety of information to off-site locations, termed Remote Monitoring, is in widespread industrial use, requiring very little adaptation for safeguards use. This paper examines the future of the Integrated Monitoring Systems and Remote Monitoring in International Safeguards, including technical and other related factors
Delta count-rate monitoring system
International Nuclear Information System (INIS)
Van Etten, D.; Olsen, W.A.
1985-01-01
A need for a more effective way to rapidly search for gamma-ray contamination over large areas led to the design and construction of a very sensitive gamma detection system. The delta count-rate monitoring system was installed in a four-wheel-drive van instrumented for environmental surveillance and accident response. The system consists of four main sections: (1) two scintillation detectors, (2) high-voltage power supply amplifier and single-channel analyzer, (3) delta count-rate monitor, and (4) count-rate meter and recorder. The van's 6.5-kW generator powers the standard nuclear instrument modular design system. The two detectors are mounted in the rear corners of the van and can be run singly or jointly. A solid-state bar-graph count-rate meter mounted on the dashboard can be read easily by both the driver and passenger. A solid-state strip chart recorder shows trends and provides a permanent record of the data. An audible alarm is sounded at the delta monitor and at the dashboard count-rate meter if a detected radiation level exceeds the set background level by a predetermined amount
Development and application of all-digital monitoring system
International Nuclear Information System (INIS)
Xu Tao; Li Jing; Wang Wei
2014-01-01
All digital control system has developed into a mainstream means of monitoring, and achieved information, intelligence, and networking. All-digital control system is characterized by clear image, large transport stream, so the higher the data storage and network bandwidth should be required. Existing analog surveillance system architecture, hardware and software configuration can not meet the requirements of all-digital monitoring system, so how to solve the original analog surveillance system is gradually transformed into fully digital monitoring system, to avoid incompatibility issues in surveillance monitoring system upgrade become a research project. This paper describes the advantages and future direction of megapixels camera and proposes key technologies to solve the resolution and frame rate with the actual project requirements, achieves a core technology of megapixels video surveillance system, and proposes solutions for the actual renovation project problems. (authors)
Propose Reactor Control and Monitoring System for RTP
International Nuclear Information System (INIS)
Mohd Sabri Minhat; Izhar Abu Hussin; Mohd Idris Taib; Mohd Khairulezwan Abdul Manan; Nurfarhana Ayuni Joha
2011-01-01
Reactor control and monitoring system is a one of the important features used in reactor. The control and monitoring must come together to provide safety, excellent performance and reliable in nuclear reactor technology application. Objectives of this technical paper are to design and propose reactor control system and reactor monitoring system in Research Reactor (RTP) for Reactor Upgrading Project. (author)
Energy Technology Data Exchange (ETDEWEB)
Quan, H.
1996-01-10
This paper summarizes the water monitoring system (WMS) in China applied mainly to surface water and operated within the competence of the Environmental Protection Agency. The WMS consists of a national water monitoring network and a water information system that monitors surface water periodically. The WMS comprises water monitoring stations classified from class 1 to class 4, which are located in 2,222 locations. Stations from class 1 to class 3 are operated by using computers, but class 4 stations are still incapable to use floppy disks to perform information transmission. When an information management system is completed at the China-Japan Friendship Environmental Protection Center being constructed by gratis assistance from the Japanese Government, transmission of water quality data will become possible by means of the cable line system in addition to the table system and the floppy system. The water quality data are published to general people in the forms of Chinese gazette for the environmental conditions, the environment yearbook, and the reports on environmental quality. However, the more important is to publish more publications to make people aware of the actual state of water pollution and have them cooperate in environment preservation. 4 refs., 1 fig.
Beam monitoring system for intense neutron source
International Nuclear Information System (INIS)
Tron, A.M.
2001-01-01
Monitoring system realizing novel principle of operation and allowing to register a two-dimensional beam current distribution within entire aperture (100...200 mm) of ion pipe for a time in nanosecond range has been designed and accomplished for beam control of the INR intense neutron source, for preventing thermo-mechanical damage of its first wall. Key unit of the system is monitor of two-dimensional beam current distribution, elements of which are high resistant to heating by the beam and to radiation off the source. The description of the system and monitor are presented. Implementation of the system for the future sources with more high intensities are discussed. (author)
Quality monitored distributed voting system
Skogmo, David
1997-01-01
A quality monitoring system can detect certain system faults and fraud attempts in a distributed voting system. The system uses decoy voters to cast predetermined check ballots. Absent check ballots can indicate system faults. Altered check ballots can indicate attempts at counterfeiting votes. The system can also cast check ballots at predetermined times to provide another check on the distributed voting system.
A Prototype Wire Position Monitoring System
International Nuclear Information System (INIS)
Wang, Wei
2010-01-01
The Wire Position Monitoring System (WPM) will track changes in the transverse position of LCLS Beam Position Monitors (BPMs) to 1(micro)m over several weeks. This position information will be used between applications of beam based alignment to correct for changes in component alignment. The WPM system has several requirements. The sensor range must be large enough so that precision sensor positioning is not required. The resolution needs to be small enough so that the signal can be used to monitor motion to 1(micro)m. The system must be stable enough so that system drift does not mimic motion of the component being monitored. The WPM sensor assembly consists of two parts, the magnetic sensor and an integrated lock-in amplifier. The magnetic sensor picks up a signal from the alternating current in a stretched wire. The voltage v induced in the sensor is proportional to the wire displacement from the center of the sensor. The integrated lock-in amplifier provides a DC output whose magnitude is proportional to the AC signal from the magnetic sensor. The DC output is either read on a digital voltmeter or digitized locally and communicated over a computer interface.
The NASA Carbon Monitoring System
Hurtt, G. C.
2015-12-01
Greenhouse gas emission inventories, forest carbon sequestration programs (e.g., Reducing Emissions from Deforestation and Forest Degradation (REDD and REDD+), cap-and-trade systems, self-reporting programs, and their associated monitoring, reporting and verification (MRV) frameworks depend upon data that are accurate, systematic, practical, and transparent. A sustained, observationally-driven carbon monitoring system using remote sensing data has the potential to significantly improve the relevant carbon cycle information base for the U.S. and world. Initiated in 2010, NASA's Carbon Monitoring System (CMS) project is prototyping and conducting pilot studies to evaluate technological approaches and methodologies to meet carbon monitoring and reporting requirements for multiple users and over multiple scales of interest. NASA's approach emphasizes exploitation of the satellite remote sensing resources, computational capabilities, scientific knowledge, airborne science capabilities, and end-to-end system expertise that are major strengths of the NASA Earth Science program. Through user engagement activities, the NASA CMS project is taking specific actions to be responsive to the needs of stakeholders working to improve carbon MRV frameworks. The first phase of NASA CMS projects focused on developing products for U.S. biomass/carbon stocks and global carbon fluxes, and on scoping studies to identify stakeholders and explore other potential carbon products. The second phase built upon these initial efforts, with a large expansion in prototyping activities across a diversity of systems, scales, and regions, including research focused on prototype MRV systems and utilization of COTS technologies. Priorities for the future include: 1) utilizing future satellite sensors, 2) prototyping with commercial off-the-shelf technology, 3) expanding the range of prototyping activities, 4) rigorous evaluation, uncertainty quantification, and error characterization, 5) stakeholder
DEFF Research Database (Denmark)
Petersen, Martin Nordal
2007-01-01
We present a simple, yet effective OSNR monitoring technique based on an inherent effect in the optical modulator. Highly accurate OSNR monitoring is demonstrated in a 40 Gb/s dense WDM system with 50 GHz channel spacing.......We present a simple, yet effective OSNR monitoring technique based on an inherent effect in the optical modulator. Highly accurate OSNR monitoring is demonstrated in a 40 Gb/s dense WDM system with 50 GHz channel spacing....
Operational readiness of filtered air discharge monitoring systems
International Nuclear Information System (INIS)
Lafortune, J.F.; Jamieson, T.J.
1993-08-01
An assessment of the operational readiness of the Filtered Air Discharge (FAD) Stack Monitoring systems, installed in Canadian CANDU nuclear power plants, was performed in this project. Relevant Canadian and foreign standards and regulatory requirements have been reviewed and documentation on FAD stack monitoring system design, operation, testing and maintenance have been assessed to identify likely causes and potential failures of FAD stack monitoring systems and their components under both standby and accident conditions. Recommendations have also been provided in this report for design and performance review guidelines for CANDU stations. A case study of the FAD stack monitoring system at Pickering NGS is also documented in this report
A new type gamma-ray spectrum monitoring system
Cheng Bo; Zhou Jian Bin; Zhang Zhi Ming; Tong Yun Fu
2002-01-01
This new radiation monitoring system can be used to monitor the radiation of building materials and the radiation of atmosphere, to explore and evaluate rock for building in the field, and this system can be used to monitor the gamma irradiation near the nuclear establishments in the average situation and in the serious situation of the radiation incident have happened. The control core of this monitoring system is SCM-AT89C52, and gamma-ray sensing head consists of scintillator phi 50 mm x 50 mm NaI(Tl) and PMT GDB44. This system can be used to measure the whole gamma-ray spectrum of 256 channels
Smart health monitoring systems: an overview of design and modeling.
Baig, Mirza Mansoor; Gholamhosseini, Hamid
2013-04-01
Health monitoring systems have rapidly evolved during the past two decades and have the potential to change the way health care is currently delivered. Although smart health monitoring systems automate patient monitoring tasks and, thereby improve the patient workflow management, their efficiency in clinical settings is still debatable. This paper presents a review of smart health monitoring systems and an overview of their design and modeling. Furthermore, a critical analysis of the efficiency, clinical acceptability, strategies and recommendations on improving current health monitoring systems will be presented. The main aim is to review current state of the art monitoring systems and to perform extensive and an in-depth analysis of the findings in the area of smart health monitoring systems. In order to achieve this, over fifty different monitoring systems have been selected, categorized, classified and compared. Finally, major advances in the system design level have been discussed, current issues facing health care providers, as well as the potential challenges to health monitoring field will be identified and compared to other similar systems.
Radiation monitoring system based on Internet
International Nuclear Information System (INIS)
Drndarevic, V.R.; Popovic, A.T; Bolic, M.D.; Pavlovic, R.S.
2001-01-01
This paper presents concept and realization of the modern distributed radiation monitoring system. The system uses existing conventional computer network and it is based on the standard Internet technology. One personal computer (PC) serves as host and system server, while a number of client computers, link to the server computer via standard local area network (LAN), are used as distributed measurement nodes. The interconnection between the server and clients are based on Transmission Control Protocol/Internet Protocol (TCP/IP). System software is based on server-client model. Based on this concept distributed system for gamma ray monitoring in the region of the Institute of Nuclear Sciences Vinca has been implemented. (author)
Underground ventilation remote monitoring and control system
International Nuclear Information System (INIS)
Strever, M.T.; Wallace, K.G. Jr.; McDaniel, K.H.
1995-01-01
This paper presents the design and installation of an underground ventilation remote monitoring and control system at the Waste Isolation Pilot Plant. This facility is designed to demonstrate safe underground disposal of U.S. defense generated transuranic nuclear waste. To improve the operability of the ventilation system, an underground remote monitoring and control system was designed and installed. The system consists of 15 air velocity sensors and 8 differential pressure sensors strategically located throughout the underground facility providing real-time data regarding the status of the ventilation system. In addition, a control system was installed on the main underground air regulators. The regulator control system gives indication of the regulator position and can be controlled either locally or remotely. The sensor output is displayed locally and at a central surface location through the site-wide Central Monitoring System (CMS). The CMS operator can review all sensor data and can remotely operate the main underground regulators. Furthermore, the Virtual Address Extension (VAX) network allows the ventilation engineer to retrieve real-time ventilation data on his personal computer located in his workstation. This paper describes the types of sensors selected, the installation of the instrumentation, and the initial operation of the remote monitoring system
An on-line adaptive core monitoring system
International Nuclear Information System (INIS)
Verspeek, J.A.; Bruggink, J.C.; Karuza, J.
1997-01-01
An on-line core monitoring system has been in operation for three years in the Dodewaard Nuclear Power Plant. The core monitor uses the on-line measured reactor data as an input for a power distribution calculation. The measurements are frequently performed. The system is used for monitoring as well as for predicting purposes. The limiting thermal hydraulic parameters are monitored as well as the pellet-clad interaction limits. The data are added to a history file used for cycle burn-up calculations and trending of parameters. The reactor states are presented through a convenient graphical user interface. (authors)
Monitoring system in reactor dry well
International Nuclear Information System (INIS)
Horie, Akira; Suzuki, Shun-ichi; Yamamoto, Shinji; Kubokawa, Toshihiko; Takagi, Sakae; Yokosawa, Makoto.
1991-01-01
A failed portion of a dry well in a BWR type reactor is monitored and identified from a remote place by a simple structure. That is, laser beams are irradiated under scanning to a portion to be monitored. Then, the reflection light is monitored by a light receiving and monitoring system, and abnormalities such as defects or leaks of monitored portion are optically detected by a remote viewing equipment. With such a constitution, the portion to be monitored in poor operation circumstances of the reactor dry well can always be monitored efficiently from a remote place. The device of the present invention does not undergo the effect of radiation noises, etc. and it is excellent in heat resistance and radiation resistance. (I.S.)
Monitoring system for OpenPBS environment
Energy Technology Data Exchange (ETDEWEB)
Kolosov, V. [ITEP, Moscow (Russian Federation)]. E-mail: victor.kolosov@itep.ru; Lublev, Y. [ITEP, Moscow (Russian Federation); Makarychev, S. [ITEP, Moscow (Russian Federation)
2004-11-21
The OpenPBS batch system is widely used in the HEP community. The Open PBS package has a set of tools to check the current status of the system. This information is useful, but it is not sufficient enough for resource accounting and planning. As a solution for this problem, we developed a monitoring system which parses the logfiles from OpenPBS and stores the information into a SQL database (PostgreSQL). This allows us to analyze the data in many different ways using SQL queries. The system was used in ITEP during the last two years for batch farm monitoring.
Economic analysis of condition monitoring systems for offshore wind turbine sub-systems
DEFF Research Database (Denmark)
May, Allan; MacMillan, David; Thöns, Sebastian
2015-01-01
The use of condition monitoring systems on offshore wind turbines has increased dramatically in recent times. However, their use is mostly restricted to vibration based monitoring systems for the gearbox, generator and drive train. A survey of commercially available condition monitoring systems...... year life cycle. The model uses Hidden Markov Models to represent both the actual system state and the observed condition monitoring state. The CM systems are modelled to include reduced failure types, false alarms, detection rates and 6 month failure warnings. The costs for system failures are derived...... and their associated costs has been completed for the blades, drive train, tower and foundation. This paper considers what value can be obtained from integrating these additional systems into the maintenance plan. This is achieved by running simulations on an operations and maintenance model for a wind farm over a 20...
A blade deflection monitoring system
DEFF Research Database (Denmark)
2017-01-01
A wind turbine blade comprising a system for monitoring the deflection of a wind turbine blade is described. The system comprises a wireless range-measurement system, having at least one wireless communication device located towards the root end of the blade and at least one wireless communication...
Wide-area, real-time monitoring and visualization system
Budhraja, Vikram S.; Dyer, James D.; Martinez Morales, Carlos A.
2013-03-19
A real-time performance monitoring system for monitoring an electric power grid. The electric power grid has a plurality of grid portions, each grid portion corresponding to one of a plurality of control areas. The real-time performance monitoring system includes a monitor computer for monitoring at least one of reliability metrics, generation metrics, transmission metrics, suppliers metrics, grid infrastructure security metrics, and markets metrics for the electric power grid. The data for metrics being monitored by the monitor computer are stored in a data base, and a visualization of the metrics is displayed on at least one display computer having a monitor. The at least one display computer in one said control area enables an operator to monitor the grid portion corresponding to a different said control area.
Body surface mounted biomedical monitoring system using Bluetooth.
Nambu, Masayuki
2007-01-01
Continuous monitoring in daily life is important for the health condition control of the elderly. However, portable or wearable devices need to carry by user on their own will. On the other hand, implantation sensors are not adoptable, because of generic users dislike to insert the any object in the body for monitoring. Therefore, another monitoring system of the health condition to carry it easily is necessary. In addition, ID system is necessary even if the subject live with few families. Furthermore, every measurement system should be wireless system, because not to obstruct the daily life of the user. In this paper, we propose the monitoring system, which is mounted on the body surface. This system will not obstruct the action or behavior of user in daily life, because this system attached the body surface on the back of the user. In addition, this system has wireless communication system, using Bluetooth, and acquired data transfer to the outside of the house via the Internet.
RFID and IOT for Attendance Monitoring System
Directory of Open Access Journals (Sweden)
Dedy Irawan Joseph
2018-01-01
Full Text Available In recent years, RFID technology has been widely used in various sectors, such as in-education, transportation, agriculture, animal husbandry, store sales and other sectors. RFID utilization in education is student attendance monitoring system, by using Internet of Things (IoT and Cloud technology, it will produce a real time attendance monitoring system that can be accessed by various parties, such as lecturer, campus administration and parents. With this monitoring system if there are students who are not present can be immediately discovered and can be taken immediate action and the learning process can run smoothly.
A New Environmental Monitoring System For Silkworm Incubators
Alejandra Duque-Torres; Juan Ruiz-Rosero; Gesille Zambrano-Gonzalez; Martha Almanza-Pinzon; Oscar Mauricio Caicedo Rendon; Gustavo Ramirez-Gonzalez
2018-01-01
A newly Monitoring Environmental Conditions System is proposed based on Raspberry-Pi. This proposal monitors the temperature, humidity, and luminosity in a silkworm incubator. The monitoring data are collected and save in the cloud for the subsequent analysis. The monitoring environmental system is based on Raspberry Pi due to capabilities, features, and low cost. The preliminary tests were realized in a real scenery and the results demonstrating its reliability.
Implant Angle Monitor System of MC3-II
International Nuclear Information System (INIS)
Sato, Fumiaki; Sano, Makoto; Nakaoka, Hiroaki; Fujii, Yoshito; Kudo, Tetuya; Nakanishi, Makoto; Koike, Masazumi; Fujino, Yasushi
2008-01-01
Precise implant angle control is required for the latest generation of ion implanters to meet further shrink semiconductor device requirements. Especially, the highest angle accuracy is required for Halo implant process of Logic devices. The Halo implant angle affects the device performance, because slight differences of beam divergence change the overlap profile towards the extension. Additionally, twist angle accuracy is demanded in case of channeling angle implant. Therefore monitoring beam angles and wafer twist angles is important. A new monitoring system for the MC3-II, SEN Corp.'s single wafer type medium current implanter has been developed. This paper describes the angle control performance and monitoring system of the MC3-II. For the twist angle control, we developed a wafer notch angle monitor. The system monitors the wafer notch image on the platen. And the notch angle variation is calculated by using image processing method. It is also able to adjust the notch angle according to the angle error. For the tilt angle control, we developed a vertical beam profile monitor. The monitor system can detect beam profile of vertical directions with horizontally scanning beam. It also measures beam angles of a tilt direction to a wafer. The system configuration and sample beam data are presented.
ZPR-9 airborne plutonium monitoring system
International Nuclear Information System (INIS)
Rusch, G.K.; McDowell, W.P.; Knapp, W.G.
1975-01-01
An airborne plutonium monitoring system which is installed in the ZPR-9 (Zero Power Reactor No. 9) facility at Argonne National Laboratory is described. The design and operational experience are discussed. This monitoring system utilizes particle size and density discrimination, alpha particle energy discrimination, and a background-subtraction techique operating in cascade to separate airborne-plutonium activity from other, naturally occurring, airborne activity. Relatively high sensitivity and reliability are achieved
IDEA-system - a new computer based expert system for incorporation monitoring
International Nuclear Information System (INIS)
Doerfel, H.
2005-01-01
Full text: There is an increasing number of national and international recommendations and guidelines for incorporation monitoring (ICRP Publications, IAEA Safety Reports, ISO Standards, etc.). These recommendations cover different phases of incorporation monitoring and they provide general requirements for the measuring techniques, the monitoring procedures and for the procedures to evaluate intakes and doses from the monitoring results. There is, however, still a strong need for giving guidance to the dosimetrists on how to apply all the regulations properly. Thus, the EU project IDEAS was launched in order to provide general guidelines for the assessment of internal dose from incorporation monitoring data. These guidelines have recently been discussed in a virtual workshop on the internet (www.ideas-workshop.de) and they are being considered by ICRP for possible adoption in the near future. Recently, in the Karlsruhe Research Centre, a computer-based expert system has been developed for assisting dosimetrists in applying the relevant recommendations and guidelines for incorporation monitoring and internal dosimetry. The expert system gives guidance to the user with respect to: planning of monitoring (estimation of potential exposures, decision on the requirements of monitoring, definition of optimum measuring techniques and monitoring intervals); performing routine and special monitoring and evaluation of primary monitoring results. The evaluation of primary monitoring results is done according to the IDEAS guidelines in a threestage procedure according to the expected level of exposure (E = committed effective dose): standard evaluation with default or site specific parameter values (E 6 mSv). With these well-defined procedures the expert system follows the aim, that all recommendations and guidelines are applied properly and thus: internal exposures of more than 1 mSv are very likely to be detected in all situations; the results in terms of committed effective
La Belle, Jeffrey T; Engelschall, Erica; Lan, Kenneth; Shah, Pankti; Saez, Neil; Maxwell, Stephanie; Adamson, Teagan; Abou-Eid, Michelle; McAferty, Kenyon; Patel, Dharmendra R; Cook, Curtiss B
2014-01-01
A prototype tear glucose (TG) sensor was tested in New Zealand white rabbits to assess eye irritation, blood glucose (BG) and TG lag time, and correlation with BG. A total of 4 animals were used. Eye irritation was monitored by Lissamine green dye and analyzed using image analysis software. Lag time was correlated with an oral glucose load while recording TG and BG readings. Correlation between TG and BG were plotted against one another to form a correlation diagram, using a Yellow Springs Instrument (YSI) and self-monitoring of blood glucose as the reference measurements. Finally, TG levels were calculated using analytically derived expressions. From repeated testing carried over the course of 12 months, little to no eye irritation was detected. TG fluctuations over time visually appeared to trace the same pattern as BG with an average lag times of 13 minutes. TG levels calculated from the device current measurements ranged from 4 to 20 mg/dL and correlated linearly with BG levels of 75-160 mg/dL (TG = 0.1723 BG = 7.9448 mg/dL; R 2 = .7544). The first steps were taken toward preliminary development of a sensor for self-monitoring of tear glucose (SMTG). No conjunctival irritation in any of the animals was noted. Lag time between TG and BG was found to be noticeable, but a quantitative modeling to correlate lag time in this study is unnecessary. Measured currents from the sensors and the calculated TG showed promising correlation to BG levels. Previous analytical bench marking showed BG and TG levels consistent with other literature. © 2014 Diabetes Technology Society.
A Disposable Tear Glucose Biosensor—Part 4
Engelschall, Erica; Lan, Kenneth; Shah, Pankti; Saez, Neil; Maxwell, Stephanie; Adamson, Teagan; Abou-Eid, Michelle; McAferty, Kenyon; Patel, Dharmendra R.; Cook, Curtiss B.
2014-01-01
Objective: A prototype tear glucose (TG) sensor was tested in New Zealand white rabbits to assess eye irritation, blood glucose (BG) and TG lag time, and correlation with BG. Methods: A total of 4 animals were used. Eye irritation was monitored by Lissamine green dye and analyzed using image analysis software. Lag time was correlated with an oral glucose load while recording TG and BG readings. Correlation between TG and BG were plotted against one another to form a correlation diagram, using a Yellow Springs Instrument (YSI) and self-monitoring of blood glucose as the reference measurements. Finally, TG levels were calculated using analytically derived expressions. Results: From repeated testing carried over the course of 12 months, little to no eye irritation was detected. TG fluctuations over time visually appeared to trace the same pattern as BG with an average lag times of 13 minutes. TG levels calculated from the device current measurements ranged from 4 to 20 mg/dL and correlated linearly with BG levels of 75-160 mg/dL (TG = 0.1723 BG = 7.9448 mg/dL; R2 = .7544). Conclusion: The first steps were taken toward preliminary development of a sensor for self-monitoring of tear glucose (SMTG). No conjunctival irritation in any of the animals was noted. Lag time between TG and BG was found to be noticeable, but a quantitative modeling to correlate lag time in this study is unnecessary. Measured currents from the sensors and the calculated TG showed promising correlation to BG levels. Previous analytical bench marking showed BG and TG levels consistent with other literature. PMID:24876546
Development of the simulation monitoring system
International Nuclear Information System (INIS)
Kato, Katsumi; Watanabe, Tadashi; Kume, Etsuo
2001-01-01
Large-scale simulation technique is studied at the Center for Promotion of Computational Science and Engineering for the computational science research in nuclear fields. Visualization and animation processing techniques are developed for efficient understanding of simulation results. The development of the simulation monitoring system, which is used for real-time visualization of ongoing simulations or for successive visualization of calculated results, is described in this report. The standard visualization tool AVS5 or AVS/EXPRESS is used for the simulation monitoring system, and thus, this system can be utilized in various computer environments. (author)
Application of Video Recognition Technology in Landslide Monitoring System
Directory of Open Access Journals (Sweden)
Qingjia Meng
2018-01-01
Full Text Available The video recognition technology is applied to the landslide emergency remote monitoring system. The trajectories of the landslide are identified by this system in this paper. The system of geological disaster monitoring is applied synthetically to realize the analysis of landslide monitoring data and the combination of video recognition technology. Landslide video monitoring system will video image information, time point, network signal strength, power supply through the 4G network transmission to the server. The data is comprehensively analysed though the remote man-machine interface to conduct to achieve the threshold or manual control to determine the front-end video surveillance system. The system is used to identify the target landslide video for intelligent identification. The algorithm is embedded in the intelligent analysis module, and the video frame is identified, detected, analysed, filtered, and morphological treatment. The algorithm based on artificial intelligence and pattern recognition is used to mark the target landslide in the video screen and confirm whether the landslide is normal. The landslide video monitoring system realizes the remote monitoring and control of the mobile side, and provides a quick and easy monitoring technology.
Corral Monitoring System assessment results
International Nuclear Information System (INIS)
Filby, E.E.; Haskel, K.J.
1998-03-01
This report describes the results of a functional and operational assessment of the Corral Monitoring Systems (CMS), which was designed to detect and document accountable items entering or leaving a monitored site. Its development was motivated by the possibility that multiple sites in the nuclear weapons states of the former Soviet Union might be opened to such monitoring under the provisions of the Strategic Arms Reduction Treaty. The assessment was performed at three levels. One level evaluated how well the planned approach addressed the target application, and which involved tracking sensitive items moving into and around a site being monitored as part of an international treaty or other agreement. The second level examined the overall design and development approach, while the third focused on individual subsystems within the total package. Unfortunately, the system was delivered as disassembled parts and pieces, with very poor documentation. Thus, the assessment was based on fragmentary operating data coupled with an analysis of what documents were provided with the system. The system design seemed to be a reasonable match to the requirements of the target application; however, important questions about site manning and top level administrative control were left unanswered. Four weaknesses in the overall design and development approach were detected: (1) poor configuration control and management, (2) inadequate adherence to a well defined architectural standard, (3) no apparent provision for improving top level error tolerance, and (4) weaknesses in the object oriented programming approach. The individual subsystems were found to offer few features or capabilities that were new or unique, even at the conceptual level. The CMS might possibly have offered a unique combination of features, but this level of integration was never realized, and it had no unique capabilities that could be readily extracted for use in another system
Corral Monitoring System assessment results
Energy Technology Data Exchange (ETDEWEB)
Filby, E.E.; Haskel, K.J.
1998-03-01
This report describes the results of a functional and operational assessment of the Corral Monitoring Systems (CMS), which was designed to detect and document accountable items entering or leaving a monitored site. Its development was motivated by the possibility that multiple sites in the nuclear weapons states of the former Soviet Union might be opened to such monitoring under the provisions of the Strategic Arms Reduction Treaty. The assessment was performed at three levels. One level evaluated how well the planned approach addressed the target application, and which involved tracking sensitive items moving into and around a site being monitored as part of an international treaty or other agreement. The second level examined the overall design and development approach, while the third focused on individual subsystems within the total package. Unfortunately, the system was delivered as disassembled parts and pieces, with very poor documentation. Thus, the assessment was based on fragmentary operating data coupled with an analysis of what documents were provided with the system. The system design seemed to be a reasonable match to the requirements of the target application; however, important questions about site manning and top level administrative control were left unanswered. Four weaknesses in the overall design and development approach were detected: (1) poor configuration control and management, (2) inadequate adherence to a well defined architectural standard, (3) no apparent provision for improving top level error tolerance, and (4) weaknesses in the object oriented programming approach. The individual subsystems were found to offer few features or capabilities that were new or unique, even at the conceptual level. The CMS might possibly have offered a unique combination of features, but this level of integration was never realized, and it had no unique capabilities that could be readily extracted for use in another system.
A high reliability oxygen deficiency monitoring system
International Nuclear Information System (INIS)
Parry, R.; Claborn, G.; Haas, A.; Landis, R.; Page, W.; Smith, J.
1993-05-01
The escalating use of cryogens at national laboratories in general and accelerators in particular, along with the increased emphasis placed on personnel safety, mandates the development and installation of oxygen monitoring systems to insure personnel safety in the event of a cryogenic leak. Numerous vendors offer oxygen deficiency monitoring systems but fail to provide important features and/or flexibility. This paper describes a unique oxygen monitoring system developed for the Magnet Test Laboratory (MTL) at the Superconducting Super Collider Laboratory (SSCL). Features include: high reliability, oxygen cell redundancy, sensor longevity, simple calibration, multiple trip points, offending sensor audio and visual indication, global alarms for building evacuation, local and remote analog readout, event and analog data logging, EMAIL event notification, phone line voice status system, and multi-drop communications network capability for reduced cable runs. Of particular importance is the distributed topology of the system which allows it to operate in a stand-alone configuration or to communicate with a host computer. This flexibility makes it ideal for small applications such as a small room containing a cryogenic dewar, as well as larger systems which monitor many offices and labs in several buildings
A high reliability oxygen deficiency monitoring system
International Nuclear Information System (INIS)
Parry, R.; Claborn, G.; Haas, A.; Landis, R.; Page, W.; Smith, J.
1993-01-01
The escalating use of cryogens at national laboratories in general and accelerators in particular, along with the increased emphasis placed on personnel safety, mandates the development and installation of oxygen monitoring systems to insure personnel safety in the event of a cryogenic leak. Numerous vendors offer oxygen deficiency monitoring systems but fail to provide important features and/or flexibility. This paper describes a unique oxygen monitoring system developed for the Magnet Test Laboratory (MTL) at the Superconducting Super Collider Laboratory (SSCL). Features include: high reliability, oxygen cell redundancy, sensor longevity, simple calibration, multiple trip points, offending sensor audio and visual indication, global alarms for building evacuation, local and remote analog readout, event and analog data logging, EMAIL event notification, phone line voice status system, and multi-drop communications network capability for reduced cable runs. Of particular importance is the distributed topology of the system which allows it to operate in a stand-alone configuration or to communicate with a host computer. This flexibility makes it ideal for small applications such as a small room containing a cryogenic dewar, as well as larger systems which monitor many offices and labs in several buildings
An Electrical Energy Consumption Monitoring and Forecasting System
Directory of Open Access Journals (Sweden)
J. L. Rojas-Renteria
2016-10-01
Full Text Available Electricity consumption is currently an issue of great interest for power companies that need an as much as accurate profile for controlling the installed systems but also for designing future expansions and alterations. Detailed monitoring has proved to be valuable for both power companies and consumers. Further, as smart grid technology is bound to result to increasingly flexible rates, an accurate forecast is bound to prove valuable in the future. In this paper, a monitoring and forecasting system is investigated. The monitoring system was installed in an actual building and the recordings were used to design and evaluate the forecasting system, based on an artificial neural network. Results show that the system can provide detailed monitoring and also an accurate forecast for a building’s consumption.
Monitoring the CMS strip tracker readout system
International Nuclear Information System (INIS)
Mersi, S; Bainbridge, R; Cripps, N; Fulcher, J; Wingham, M; Baulieu, G; Bel, S; Delaere, C; Drouhin, F; Mirabito, L; Cole, J; Giassi, A; Gross, L; Hahn, K; Nikolic, M; Tkaczyk, S
2008-01-01
The CMS Silicon Strip Tracker at the LHC comprises a sensitive area of approximately 200 m 2 and 10 million readout channels. Its data acquisition system is based around a custom analogue front-end chip. Both the control and the readout of the front-end electronics are performed by off-detector VME boards in the counting room, which digitise the raw event data and perform zero-suppression and formatting. The data acquisition system uses the CMS online software framework to configure, control and monitor the hardware components and steer the data acquisition. The first data analysis is performed online within the official CMS reconstruction framework, which provides many services, such as distributed analysis, access to geometry and conditions data, and a Data Quality Monitoring tool based on the online physics reconstruction. The data acquisition monitoring of the Strip Tracker uses both the data acquisition and the reconstruction software frameworks in order to provide real-time feedback to shifters on the operational state of the detector, archiving for later analysis and possibly trigger automatic recovery actions in case of errors. Here we review the proposed architecture of the monitoring system and we describe its software components, which are already in place, the various monitoring streams available, and our experiences of operating and monitoring a large-scale system
International Nuclear Information System (INIS)
Takeuchi, Nobuyoshi; Fujimoto, Toshiaki; Nagama, Hideyo
2007-01-01
A positive outlook toward nuclear power plants and a higher level of technologies for using radiation in the medical field are trends that are spreading throughout the world, and as a consequence, demand is increasing for equipment and systems that measure and control radiation. Equipment ranging from radiation detection and measurement devices to computer-based radiation management systems will be set up in overseas. Products that depend on overseas specifications based on IEC and other international standards are being developed. Fuji Electric is advancing the overseas deployment of radiation monitoring systems by adopting measures that will ensure the reliability and traceability of radiation equipment. (author)
Conceptual Inadequacy of the Shore and Johnson Axioms for Wide Classes of Complex Systems
Directory of Open Access Journals (Sweden)
Constantino Tsallis
2015-05-01
Full Text Available It is by now well known that the Boltzmann-Gibbs-von Neumann-Shannon logarithmic entropic functional (\\(S_{BG}\\ is inadequate for wide classes of strongly correlated systems: see for instance the 2001 Brukner and Zeilinger's {\\it Conceptual inadequacy of the Shannon information in quantum measurements}, among many other systems exhibiting various forms of complexity. On the other hand, the Shannon and Khinchin axioms uniquely mandate the BG form \\(S_{BG}=-k\\sum_i p_i \\ln p_i\\; the Shore and Johnson axioms follow the same path. Many natural, artificial and social systems have been satisfactorily approached with nonadditive entropies such as the \\(S_q=k \\frac{1-\\sum_i p_i^q}{q-1}\\ one (\\(q \\in {\\cal R}; \\,S_1=S_{BG}\\, basis of nonextensive statistical mechanics. Consistently, the Shannon 1948 and Khinchine 1953 uniqueness theorems have already been generalized in the literature, by Santos 1997 and Abe 2000 respectively, in order to uniquely mandate \\(S_q\\. We argue here that the same remains to be done with the Shore and Johnson 1980 axioms. We arrive to this conclusion by analyzing specific classes of strongly correlated complex systems that await such generalization.
Reconfigurable Sensor Monitoring System
Alhorn, Dean C. (Inventor); Dutton, Kenneth R. (Inventor); Howard, David E. (Inventor); Smith, Dennis A. (Inventor)
2017-01-01
A reconfigurable sensor monitoring system includes software tunable filters, each of which is programmable to condition one type of analog signal. A processor coupled to the software tunable filters receives each type of analog signal so-conditioned.
Upgrade of the monitoring system of LHCb ECAL
Guz, Iouri; Chernov, Evgeny; Egorychev, Victor; Kandybei, Sergii; Kvaratskheliya, Tengiz; Obraztsov, Vladimir; Perret, Pascal; Philippov, Sergey; Savrina, Daria; Shatalov, Sppavel; Zakoriuchkina, Tatiana; Zhokhov, Anatoli; Zvyagintsev, Serguei
2016-01-01
The LHCb ECAL is a shashlik calorimeter of 6016 cells, covering 7.686.24 m2 area. To monitor the readout chain of each ECAL cell, the LHCb ECAL is equipped with a LED based monitoring system. During the LHC Run I (2009-2012) it was found that the precision of the monitoring suffers from the radiation degradation of transparency of polystyrene clear fibers used to transport the LED light to the ECAL photomultipliers. In order to improve the performance of the monitoring system, and especially in view of significant increase of LHCb working luminosity foreseen after 2018, the present plastic fibers have been replaced by radiation hard quartz fibers. The design of the upgraded version of the LHCb ECAL monitoring system is described here. The usage and performance of the new system for the ECAL calibration during the LHCb Run II are discussed.
System and Method for Monitoring Distributed Asset Data
Gorinevsky, Dimitry (Inventor)
2015-01-01
A computer-based monitoring system and monitoring method implemented in computer software for detecting, estimating, and reporting the condition states, their changes, and anomalies for many assets. The assets are of same type, are operated over a period of time, and outfitted with data collection systems. The proposed monitoring method accounts for variability of working conditions for each asset by using regression model that characterizes asset performance. The assets are of the same type but not identical. The proposed monitoring method accounts for asset-to-asset variability; it also accounts for drifts and trends in the asset condition and data. The proposed monitoring system can perform distributed processing of massive amounts of historical data without discarding any useful information where moving all the asset data into one central computing system might be infeasible. The overall processing is includes distributed preprocessing data records from each asset to produce compressed data.
Timing and control monitor system upgrade design document. Version 4
International Nuclear Information System (INIS)
Brandt, J.J.
1984-01-01
This is a design document for the Timing and Control Monitor System Upgrade Project. This project is intended to provide a replacement system for the existing user Encoder Monitor Systems and Varian 72 Control Room computer systems. All of these systems reside at the Nevada Test Site. The function of the T and C Monitor System is to gather real-time statistics and data on user defined key variables from control, communication, data acquistion systems, and from the monitoring system itself. The control, communication, and data acquisition systems each operate separately from the monitor system. The T and C Monitor System gathers this data in order to verify the readiness of an event to begin countdown. This includes setup, verification, calibration, and peripheral services, report any failures that may occur during the countdown, verify detonation and containment, and assist reentry activities after the event
Experience with neutron flux monitoring systems qualified for post-accident monitoring
International Nuclear Information System (INIS)
Shugars, H.G.; Miller, J.F.
1995-01-01
In this paper we discuss the environmental requirements for excore neutron flux monitors that are qualified for use during and after postulated accidents in Pressurized Water Reactors (PWRs). We emphasize PWRs designed in the United States, which are similar to those used also in parts of Western Europe and Eastern Asia. We then discuss design features of the flux monitoring systems necessary to address the environmental, functional, and regulatory requirements, and the experience with these systems. (author). 9 refs, 2 figs
Supervisory monitoring system in nuclear power plants
International Nuclear Information System (INIS)
Ciftcioglu, O.; Turkcan, E.
1997-01-01
Monitoring of a power plant is one of the essential tasks during operation and the computer-based implementations are nowadays seemingly quite mature. However, presently these are still not satisfactory enough to meet the high standards to the licensing requirements and they are mostly not truly integrated to the plant's design-based monitoring system. This is basically due to the robustness problem as the majority of the methods are not robust enough for the monitoring of the safety parameter set in a plant or intelligent supervision. Therefore, a supervisory monitoring system (SMS) in a plant is necessary to supervise the monitoring tasks: determining the objectives to be obtained and finding the means to support them. SMS deals with the changing plant status and the coordination of the information flow among the monitoring subunits. By means of these robustness and consistency in monitoring is achieved. The paper will give the guidelines of knowledge and data management techniques in a framework of robust comprehensive and coordinated monitoring which is presented as supervisory monitoring. Such a high level monitoring serves for consistent and immediate actions in fault situations while this particularly has vital importance in preventing imminent severe accidents next to the issues of recognition of the monitoring procedures for licensing and enhanced plant safety. (author). 8 refs, 5 figs
Induced Seismicity Monitoring System
Taylor, S. R.; Jarpe, S.; Harben, P.
2014-12-01
There are many seismological aspects associated with monitoring of permanent storage of carbon dioxide (CO2) in geologic formations. Many of these include monitoring underground gas migration through detailed tomographic studies of rock properties, integrity of the cap rock and micro seismicity with time. These types of studies require expensive deployments of surface and borehole sensors in the vicinity of the CO2 injection wells. Another problem that may exist in CO2 sequestration fields is the potential for damaging induced seismicity associated with fluid injection into the geologic reservoir. Seismic hazard monitoring in CO2 sequestration fields requires a seismic network over a spatially larger region possibly having stations in remote settings. Expensive observatory-grade seismic systems are not necessary for seismic hazard deployments or small-scale tomographic studies. Hazard monitoring requires accurate location of induced seismicity to magnitude levels only slightly less than that which can be felt at the surface (e.g. magnitude 1), and the frequencies of interest for tomographic analysis are ~1 Hz and greater. We have developed a seismo/acoustic smart sensor system that can achieve the goals necessary for induced seismicity monitoring in CO2 sequestration fields. The unit is inexpensive, lightweight, easy to deploy, can operate remotely under harsh conditions and features 9 channels of recording (currently 3C 4.5 Hz geophone, MEMS accelerometer and microphone). An on-board processor allows for satellite transmission of parameter data to a processing center. Continuous or event-detected data is kept on two removable flash SD cards of up to 64+ Gbytes each. If available, data can be transmitted via cell phone modem or picked up via site visits. Low-power consumption allows for autonomous operation using only a 10 watt solar panel and a gel-cell battery. The system has been successfully tested for long-term (> 6 months) remote operations over a wide range
Remote monitoring of VRLA batteries for telecommunications systems
Energy Technology Data Exchange (ETDEWEB)
Tsujikawa, Tomonobu; Matsushima, Toshio [NTT Facilities Inc., G.H.Y. Building, 2-13-1 Kita-Otsuka, Toshima-ku, Tokyo 170-0004 (Japan)
2007-05-25
This paper describes a remote monitoring system that can be set up in an operating center to monitor the state of valve regulated lead acid batteries (VRLA) used as a backup power supply for telecommunications. This system has a battery voltage monitoring function, a lifetime prediction function based on ambient temperature, and a discharge circuit diagnosis function. In addition, the system can be equipped with an internal resistance measurement function and an electrolyte leakage detection function to further insure power-supply reliability. Various states of batteries observed with the system are transmitted to the remote operating center by a remote monitoring function. This function enables obtaining immediate information about the condition of batteries and helps to avoid unexpected failures. (author)
Performance Monitoring Enterprise Applications with the BlackBird System
Germano, João P.; da Silva, Alberto Rodrigues; Silva, Fernando M.
This work describes the BlackBird system, which is an analysis and monitoring service for data-intensive enterprise applications, without restrictions on the targeted architecture or employed technologies. A case study is presented for the monitoring of Billing applications from Vodafone Portugal. Monitoring systems are an essential tool for the effective management of Enterprise Applications and the attainment of the demanding service level agreements imposed to these applications. However, due to the increasing complexity and diversity of these applications, adequate monitoring systems are rarely available. The BlackBird monitoring system is able to interact with these applications through different technologies employed by the Monitored Application, and is able to produce Metrics regarding the application service level goals. The BlackBird system can be specified using a set of pre-defined Configuration Objects, allowing it to be extensible and adaptable for applications with different architectures.
System for Collecting Biosignal Data from Multiple Patient Monitoring Systems.
Yoon, Dukyong; Lee, Sukhoon; Kim, Tae Young; Ko, JeongGil; Chung, Wou Young; Park, Rae Woong
2017-10-01
Biosignal data include important physiological information. For that reason, many devices and systems have been developed, but there has not been enough consideration of how to collect and integrate raw data from multiple systems. To overcome this limitation, we have developed a system for collecting and integrating biosignal data from two patient monitoring systems. We developed an interface to extract biosignal data from Nihon Kohden and Philips monitoring systems. The Nihon Kohden system has a central server for the temporary storage of raw waveform data, which can be requested using the HL7 protocol. However, the Philips system used in our hospital cannot save raw waveform data. Therefore, our system was connected to monitoring devices using the RS232 protocol. After collection, the data were transformed and stored in a unified format. From September 2016 to August 2017, we collected approximately 117 patient-years of waveform data from 1,268 patients in 79 beds of five intensive care units. Because the two systems use the same data storage format, the application software could be run without compatibility issues. Our system collects biosignal data from different systems in a unified format. The data collected by the system can be used to develop algorithms or applications without the need to consider the source of the data.
A new infusion pathway intactness monitoring system.
Ogawa, Hidekuni; Yonezawa, Yoshiharu; Maki, Hiromichi; Ninomiya, Ishio; Sata, Koji; Hamada, Shingo; Caldwell, W Morton
2006-01-01
A new infusion pathway monitoring system has been developed for hospital and home use. The system consists of linear integrated circuits and a low-power 8-bit single chip microcomputer which constantly monitors the infusion pathway intactness. An AC (alternating current) voltage is induced on the patient's body by electrostatic coupling from the normal 100 volt, 60 Hz AC power line wiring field in the patient's room. The induced AC voltage can be recorded by a main electrode wrapped around the infusion polyvinyl chloride tube. A reference electrode is wrapped on the electrode to monitor the AC voltage around the main electrode. If the injection needle or infusion tube becomes detached, then the system detects changes in the induced AC voltages and alerts the nursing station, via the nurse call system or PHS (personal handy phone system).
Chaos based blood glucose noninvasive measurement: new concept and custom study
Directory of Open Access Journals (Sweden)
Cui Li
2017-01-01
Full Text Available Background. Non invasive monitoring of Blood Glucose (BG has been a challenge calling for new accurate and fast measurement methods. Objective. To propose new concept of chaos based BG non invasive test aiming at personal customization requirements. Methods. First to build the compact RC model of tissue BG through impedance precision measuring Kit, then to simulate and soft-test BG by Boolean chaotic Codec circuits in soft tool Multisim 13.0, The third to capture the chaotic decoding outputs with the Kit plus PC in calculated signatures of resistor and phase of the tested impedance at the subjects’ left wrist in synchronous test by Bayer BG meter. Results. All in controlled trials of Bayer BG meter, the chaotic BG modelling had gained three new compared formulae in merits of errors less than 1mmol/L and latency less than 1minute. Conclusion. During further verification of this chaotic test paradigm, the opened logic route of above methods will boost measurement experts’ confidence in overcoming future problems of blood glucose monitoring in vivo.
Activity monitoring systems in health care
Kröse, B.; van Oosterhout, T.; van Kasteren, T.; Salah, A.A.; Gevers, T.
2011-01-01
This chapter focuses on activity monitoring in a home setting for health care purposes. First the most current sensing systems are described, which consist of wearable and ambient sensors. Then several approaches for the monitoring of simple actions are discussed, like falls or therapies. After
Geological hazard monitoring system in Georgia
Gaprindashvili, George
2017-04-01
Georgia belongs to one of world's most complex mountainous regions according to the scale and frequency of Geological processes and damage caused to population, farmlands, and Infrastructure facilities. Geological hazards (landslide, debrisflow/mudflow, rockfall, erosion and etc.) are affecting many populated areas, agricultural fields, roads, oil and gas pipes, high-voltage electric power transmission towers, hydraulic structures, and tourist complexes. Landslides occur almost in all geomorphological zones, resulting in wide differentiation in the failure types and mechanisms and in the size-frequency distribution. In Georgia, geological hazards triggered by: 1. Activation of highly intense earthquakes; 2. Meteorological events provoking the disaster processes on the background of global climatic change; 3. Large-scale Human impact on the environment. The prediction and monitoring of Geological Hazards is a very wide theme, which involves different researchers from different spheres. Geological hazard monitoring is essential to prevent and mitigate these hazards. In past years in Georgia several monitoring system, such as Ground-based geodetic techniques, Debrisflow Early Warning System (EWS) were installed on high sensitive landslide and debrisflow areas. This work presents description of Geological hazard monitoring system in Georgia.
Monitoring System for ALICE Surface Areas
Demirbasci, Oguz
2016-01-01
I have been at CERN for 12 weeks within the scope of Summer Student Programme working on a monitoring system project for surface areas of the ALICE experiment during this period of time. The development and implementation of a monitoring system for environmental parameters in the accessible areas where a cheap hardware setup can be deployed were aim of this project. This report explains how it was developed by using Arduino, Raspberry PI, WinCC OA and DIM protocol.
Efficient network monitoring for large data acquisition systems
International Nuclear Information System (INIS)
Savu, D.O.; Martin, B.; Al-Shabibi, A.; Sjoen, R.; Batraneanu, S.M.; Stancu, S.N.
2012-01-01
Though constantly evolving and improving, the available network monitoring solutions have limitations when applied to the infrastructure of a high speed realtime data acquisition (DAQ) system. DAQ networks are particular computer networks where experts have to pay attention to both individual subsections as well as system wide traffic flows while monitoring the network. The ATLAS Network at the Large Hadron Collider (LHC) has more than 200 switches interconnecting 3500 hosts and totaling 8500 high speed links. The use of heterogeneous tools for monitoring various infrastructure parameters, in order to assure optimal DAQ system performance, proved to be a tedious and time consuming task for experts. To alleviate this problem we used our networking and DAQ expertise to build a flexible and scalable monitoring system providing an intuitive user interface with the same look and feel irrespective of the data provider that is used. Our system uses custom developed components for critical performance monitoring and seamlessly integrates complementary data from auxiliary tools, such as NAGIOS, information services or custom databases. A number of techniques (e.g. normalization, aggregation and data caching) were used in order to improve the user interface response time. The end result is a unified monitoring interface, for fast and uniform access to system statistics, which significantly reduced the time spent by experts for ad-hoc and post-mortem analysis. (authors)
Haas, W. J.; Venedam, R. J.; Lohrstorfer, C. F.; Weeks, S. J.
2005-05-01
The Advanced Monitoring System Initiative (AMSI) is a new approach to accelerate the development and application of advanced sensors and monitoring systems in support of Department of Energy needs in monitoring the performance of environmental remediation and contaminant containment activities. The Nevada Site Office of the National Nuclear Security Administration (NNSA) and Bechtel Nevada manage AMSI, with funding provided by the DOE Office of Environmental Management (DOE EM). AMSI has easy access to unique facilities and capabilities available at the Nevada Test Site (NTS), including the Hazardous Materials (HazMat) Spill Center, a one-of-a-kind facility built and permitted for releases of hazardous materials for training purposes, field-test detection, plume dispersion experimentation, and equipment and materials testing under controlled conditions. AMSI also has easy access to the facilities and considerable capabilities of the DOE and NNSA National Laboratories, the Special Technologies Laboratory, Remote Sensing Laboratory, Desert Research Institute, and Nevada Universities. AMSI provides rapid prototyping, systems integration, and field-testing, including assistance during initial site deployment. The emphasis is on application. Important features of the AMSI approach are: (1) customer investment, involvement and commitment to use - including definition of needs, desired mode of operation, and performance requirements; and (2) employment of a complete systems engineering approach, which allows the developer to focus maximum attention on the essential new sensing element or elements while AMSI assumes principal responsibility for infrastructure support elements such as power, packaging, and general data acquisition, control, communication, visualization and analysis software for support of decisions. This presentation describes: (1) the needs for sensors and performance monitoring for environmental systems as seen by the DOE Long Term Stewardship Science and
User interface design and system integration aspects of core monitoring systems
International Nuclear Information System (INIS)
Berg, O.; Bodal, T.; Hornaes, A.; Porsmyr, J.
2000-01-01
The present paper describes our experience with the SCORPIO core monitoring system using generic building blocks for the MMI and system integration. In this context the different layers of the software system are discussed starting with the communication system, interfacing of various modules (e.g. physics codes), administration of several modules and generation of graphical user interfaces for different categories of end-users. A method by which re-use of software components can make the system development and maintenance more efficient is described. Examples are given from different system installation projects. The methodology adopted is considered particularly important in the future, as it is anticipated that core monitoring systems will be expanded with new functions (e.g. information from technical specifications, procedures, noise analysis, etc). Further, efficient coupling of off-line tools for core physics calculations and on-line modules in core monitoring can pave the way for cost savings. (authors)
Environmental radiation monitoring system with GPS (global positioning system)
International Nuclear Information System (INIS)
Komoto, Itsuro
2000-01-01
This system combines a radiation monitoring car with GPS and a data processor (personal computer). It distributes the position information acquired through GPS to the data such as measured environmental radiation dose rate and energy spectrum. It also displays and edits the data for each measuring position on a map. Transmitting the data to the power station through mobile phone enables plan managers to easily monitor the environmental radiation dose rate nearby and proper emergency monitoring. (author)
296-B-10 stack monitoring and sampling system annual system assessment report
International Nuclear Information System (INIS)
Ridge, T.M.
1995-01-01
B Plant Administration Manual, requires an annual system assessment to evaluate and report the present condition of the sampling and monitoring system associated with stack 296-B-10 at B Plant. The ventilation system of WESF (Waste Encapsulation and Storage Facility) is designed to provide airflow patterns so that air movement throughout the building is from areas of lesser radioactivity to areas of greater radioactivity. All potentially contaminated areas are maintained at a negative pressure with respect to the atmosphere so that air flows into the building at all times. The exhaust discharging through the 296-B-10 stack is continuously monitored and sampled using a sampling and monitoring probe assembly located approximately 17.4 meters (57 feet) above the base of the stack. The probe assembly consists of 5 nozzles for the sampling probe and 2 nozzles to monitor the flow. The sampling and monitoring system associated with Stack 296-B-10 is functional and performing satisfactorily
RadNet (Environmental Radiation Ambient Monitoring System)
U.S. Environmental Protection Agency — RadNet, formerly Environmental Radiation Ambient Monitoring System (ERAMS), is a national network of monitoring stations that regularly collect air, precipitation,...
IDEA system - a new computer-based expert system for incorporation monitoring
International Nuclear Information System (INIS)
Doerfel, H.
2007-01-01
Recently, at the Karlsruhe Research Centre, a computer-based expert system, Internal Dose Equivalent Assessment System (IDEA System), has been developed for assisting dosimetrists in applying the relevant recommendations and guidelines for internal dosimetry. The expert system gives guidance to the user with respect to: (a) planning of monitoring, (b) performing routine and special monitoring, and (c) evaluation of primary monitoring results. The evaluation is done according to the IDEA System guidelines (Doerfel, H. et al., General guidelines for the estimation of committed effective dose from incorporation monitoring data. Research Report FZKA 7243, Research Center Karlsruhe, Karlsruhe (2006). ISSN 0947-8260.) in a three-stage procedure according to the expected level of exposure. At the first level the evaluation is performed with default or site-specific parameter values, at the second level case-specific parameter values are applied and at the third level a special evaluation is performed with individual adjustment of model parameter values. With these well-defined procedures the expert system follows the aim, in which all recommendations and guidelines are applied properly and the results in terms of committed effective and organ doses are close to the best estimate. (author)
Monitoring solar-thermal systems: An outline of methods and procedures
Energy Technology Data Exchange (ETDEWEB)
Rosenthal, A. [New Mexico State Univ., Las Cruces, NM (United States). Southwest Technology Development Inst.
1994-04-01
This manual discusses the technical issues associated with monitoring solar-thermal systems. It discusses some successful monitoring programs that have been implemented in the past. It gives the rationale for selecting a program of monitoring and gives guidelines for the design of new programs. In this report, solar thermal monitoring systems are classified into three levels. For each level, the report discusses the kinds of information obtained by monitoring, the effort needed to support the monitoring program, the hardware required, and the costs involved. Ultimately, all monitoring programs share one common requirement: the collection of accurate data that characterize some aspect or aspects of the system under study. This report addresses most of the issues involved with monitoring solar thermal systems. It does not address such topics as design fundamentals of thermal systems or the relative merits of the many different technologies employed for collection of solar energy.
Best Management Practices Monitoring Guide for Stream Systems
Mesner, Nancy
2011-01-01
Best Management Practices Monitoring Guide for Stream Systems provides guidance on establishing a water quality monitoring program that will demonstrate the effectiveness of Best Management Practices (BMPs) to reduce nonpoint source pollution in stream systems.
Air Quality Monitoring System and Benchmarking
DEFF Research Database (Denmark)
Liu, Xiufeng; Nielsen, Per Sieverts
2017-01-01
Air quality monitoring has become an integral part of smart city solutions. This paper presents an air quality monitoring system based on Internet of Things (IoT) technologies, and establishes a cloud-based platform to address the challenges related to IoT data management and processing capabilit...... capabilities, including data collection, storage, analysis, and visualization. In addition, this paper also benchmarks four state-of-the-art database systems to investigate the appropriate technologies for managing large-scale IoT datasets....
The design of radiation monitor passageway system
International Nuclear Information System (INIS)
Chu Chengsheng
2006-10-01
The Radiation Monitor Passageway System is designed as four modules, the radiation detection modules, the control modules, the mechanism modules and the optional modules. this system integrate the radiation detection technology and door ban control technology. It is a effective radiation monitor equipment with high detect sensitiveness, it will be hopeful devoted to national nuclear safeguard. (authors)
Development of distributed plant monitoring and diagnosis system at Monju
International Nuclear Information System (INIS)
Okusa, Kyoichi; Tamayama, Kiyoshi; Kitamura, Tomomi
2003-01-01
In a nuclear plant, it is required to detect an anomaly as early as possible and to inhibit adverse consequences. This requirement is especially important for a prototype Fast Breeder Reactor Monju. Therefore, a monitoring and diagnosis system is required to be developed for Monju plant equipments. In these days, such a monitoring and diagnosis system can be realized using Web technology with rationalized system resources due to the remarkable progress of computer network technology. Then, we developed a Web based platform for the monitoring and diagnosis system of Monju. Distributed architecture, standardization and highly flexible system structure have been taken account of in the development. This newly developed platform and prototype monitoring and diagnosis systems have been validated. Prototype monitoring and diagnosis systems on the platform acquire Monju plant data and display the data on client computers using Monju intranet with acceptable delay times. The prototype monitoring and diagnosis systems for Monju have been developed on the platform and the whole system has been validated. (author)
Design Of Pump Monitoring Of Primary Cooling System
International Nuclear Information System (INIS)
Indrakoesoema, Koes; Sujarwono
2000-01-01
Monitoring of 3 primary cooling pumps done visually by operator on the spot. The operator must be check oil in a sight glass, oil leakage during pump operation and water leakage. If reaktor power increase about more than 3 MW, the radiation exposure also increase in the primary cell and that's way the operator can not check the pumps. To continuing monitor all pump without delay, one system has been added I.e Closed Circuit Television (CCTV). This system using 3 video camera to monitor 3 pumps and connected to one receiver video monitor by coaxial cable located in Main Control Room. The sequence monitoring can be done by sequential switcher
Expert systems for real-time monitoring and fault diagnosis
Edwards, S. J.; Caglayan, A. K.
1989-01-01
Methods for building real-time onboard expert systems were investigated, and the use of expert systems technology was demonstrated in improving the performance of current real-time onboard monitoring and fault diagnosis applications. The potential applications of the proposed research include an expert system environment allowing the integration of expert systems into conventional time-critical application solutions, a grammar for describing the discrete event behavior of monitoring and fault diagnosis systems, and their applications to new real-time hardware fault diagnosis and monitoring systems for aircraft.
Schrock, Linda E
2008-07-01
This article reviews the literature to date and reports on a new study that documented the frequency of manual code-requiring blood glucose (BG) meters that were miscoded at the time of the patient's initial appointment in a hospital-based outpatient diabetes education program. Between January 1 and May 31, 2007, the type of BG meter and the accuracy of the patient's meter code (if required) and procedure for checking BG were checked during the initial appointment with the outpatient diabetes educator. If indicated, reeducation regarding the procedure for the BG meter code entry and/or BG test was provided. Of the 65 patients who brought their meter requiring manual entry of a code number or code chip to the initial appointment, 16 (25%) were miscoded at the time of the appointment. Two additional problems, one of dead batteries and one of improperly stored test strips, were identified and corrected at the first appointment. These findings underscore the importance of checking the patient's BG meter code (if required) and procedure for testing BG at each encounter with a health care professional or providing the patient with a meter that does not require manual entry of a code number or chip to match the container of test strips (i.e., an autocode meter).
International Nuclear Information System (INIS)
Dincklage, R.D. von
1982-01-01
A continuously operating and fast system for the monitoring of radiactive materials is outlined. Its application to nuclear technology particularly to reprocessing is emphasized. Using high-resolution α-ray spectrocopy and the gas-jet method for the rapid transportation of the radionuclides to the solid state detectors makes detection limits as low as 0.2 μg/cm 3 for Pu-239 feasible. (orig.)
On the use of multi-agent systems for the monitoring of industrial systems
Rezki, Nafissa; Kazar, Okba; Mouss, Leila Hayet; Kahloul, Laid; Rezki, Djamil
2016-03-01
The objective of the current paper is to present an intelligent system for complex process monitoring, based on artificial intelligence technologies. This system aims to realize with success all the complex process monitoring tasks that are: detection, diagnosis, identification and reconfiguration. For this purpose, the development of a multi-agent system that combines multiple intelligences such as: multivariate control charts, neural networks, Bayesian networks and expert systems has became a necessity. The proposed system is evaluated in the monitoring of the complex process Tennessee Eastman process.
LHCb: Monitoring the DIRAC Distribution System
Nandakumar, R; Santinelli, R
2009-01-01
DIRAC is the LHCb gateway to any computing grid infrastructure (currently supporting WLCG) and is intended to reliably run large data mining activities. The DIRAC system consists of various services (which wait to be contacted to perform actions) and agents (which carry out periodic activities) to direct jobs as required. An important part of ensuring the reliability of the infrastructure is the monitoring and logging of these DIRAC distributed systems. The monitoring is done collecting information from two sources - one is from pinging the services or by keeping track of the regular heartbeats of the agents, and the other from the analysis of the error messages generated by both agents and services and collected by the logging system. This allows us to ensure that he components are running properly and to collect useful information regarding their operations. The process status monitoring is displayed using the SLS sensor mechanism which also automatically allows one to plot various quantities and also keep ...
Automated wireless monitoring system for cable tension using smart sensors
Sim, Sung-Han; Li, Jian; Jo, Hongki; Park, Jongwoong; Cho, Soojin; Spencer, Billie F.; Yun, Chung-Bang
2013-04-01
Cables are critical load carrying members of cable-stayed bridges; monitoring tension forces of the cables provides valuable information for SHM of the cable-stayed bridges. Monitoring systems for the cable tension can be efficiently realized using wireless smart sensors in conjunction with vibration-based cable tension estimation approaches. This study develops an automated cable tension monitoring system using MEMSIC's Imote2 smart sensors. An embedded data processing strategy is implemented on the Imote2-based wireless sensor network to calculate cable tensions using a vibration-based method, significantly reducing the wireless data transmission and associated power consumption. The autonomous operation of the monitoring system is achieved by AutoMonitor, a high-level coordinator application provided by the Illinois SHM Project Services Toolsuite. The monitoring system also features power harvesting enabled by solar panels attached to each sensor node and AutoMonitor for charging control. The proposed wireless system has been deployed on the Jindo Bridge, a cable-stayed bridge located in South Korea. Tension forces are autonomously monitored for 12 cables in the east, land side of the bridge, proving the validity and potential of the presented tension monitoring system for real-world applications.
Design of smart neonatal health monitoring system using SMCC.
De, Debashis; Mukherjee, Anwesha; Sau, Arkaprabha; Bhakta, Ishita
2017-02-01
Automated health monitoring and alert system development is a demanding research area today. Most of the currently available monitoring and controlling medical devices are wired which limits freeness of working environment. Wireless sensor network (WSN) is a better alternative in such an environment. Neonatal intensive care unit is used to take care of sick and premature neonates. Hypothermia is an independent risk factor for neonatal mortality and morbidity. To prevent it an automated monitoring system is required. In this Letter, an automated neonatal health monitoring system is designed using sensor mobile cloud computing (SMCC). SMCC is based on WSN and MCC. In the authors' system temperature sensor, acceleration sensor and heart rate measurement sensor are used to monitor body temperature, acceleration due to body movement and heart rate of neonates. The sensor data are stored inside the cloud. The health person continuously monitors and accesses these data through the mobile device using an Android Application for neonatal monitoring. When an abnormal situation arises, an alert is generated in the mobile device of the health person. By alerting health professional using such an automated system, early care is provided to the affected babies and the probability of recovery is increased.
Diagnostic and monitoring systems in nuclear power plants
International Nuclear Information System (INIS)
Wehling, H.J.; Jax, P.; Streicher, V.
1987-01-01
Monitoring systems are important for the availability of nuclear power plants. A survey is given about such systems designed and constructed by the Kraftwerk Union AG Erlangen (Federal Republic of Germany) in order to assure the mechanical integrity of reactor cooling systems. Three monitoring systems based on microprocessors are presented: KUES (acoustic detection of loose parts), SUES (vibration), and FAMOS (fatigue)
Decision Fusion System for Bolted Joint Monitoring
Directory of Open Access Journals (Sweden)
Dong Liang
2015-01-01
Full Text Available Bolted joint is widely used in mechanical and architectural structures, such as machine tools, industrial robots, transport machines, power plants, aviation stiffened plate, bridges, and steel towers. The bolt loosening induced by flight load and environment factor can cause joint failure leading to a disastrous accident. Hence, structural health monitoring is critical for the bolted joint detection. In order to realize a real-time and convenient monitoring and satisfy the requirement of advanced maintenance of the structure, this paper proposes an intelligent bolted joint failure monitoring approach using a developed decision fusion system integrated with Lamb wave propagation based actuator-sensor monitoring method. Firstly, the basic knowledge of decision fusion and classifier selection techniques is briefly introduced. Then, a developed decision fusion system is presented. Finally, three fusion algorithms, which consist of majority voting, Bayesian belief, and multiagent method, are adopted for comparison in a real-world monitoring experiment for the large aviation aluminum plate. Based on the results shown in the experiment, a big potential in real-time application is presented that the method can accurately and rapidly identify the bolt loosening by analyzing the acquired strain signal using proposed decision fusion system.
Methods, apparatus, and systems for monitoring transmission systems
Polk, Robert E [Idaho Falls, ID; Svoboda, John M [Idaho Falls, ID; West, Phillip B [Idaho Falls, ID; Heath, Gail L [Iona, ID; Scott, Clark L [Idaho Falls, ID
2010-08-31
A sensing platform for monitoring a transmission system, and method therefor, may include a sensor that senses one or more conditions relating to a condition of the transmission system and/or the condition of an environment around the transmission system. A control system operatively associated with the sensor produces output data based on an output signal produced by the sensor. A transmitter operatively associated with the control system transmits the output data from the control system.
A monitor system for end cap shower counter of Beijing spectrometer
International Nuclear Information System (INIS)
Wang Man; Xia Xiaomi; Lai Yuanfen; Cheng Baosen; Li Jin
1993-01-01
To keep a large-scale detector system running in a correct condition and to obtain some correct parameters, it is necessary to have a monitor system monitoring the detector system operation in real time. In the paper, the structure of End Cap Shower Counter monitor system of Beijing Spectrometer is described. Some properties of this monitor system and the real-time monitoring results during operation of Beijing Spectrometer are given
Implementation of medical monitor system based on networks
Yu, Hui; Cao, Yuzhen; Zhang, Lixin; Ding, Mingshi
2006-11-01
In this paper, the development trend of medical monitor system is analyzed and portable trend and network function become more and more popular among all kinds of medical monitor devices. The architecture of medical network monitor system solution is provided and design and implementation details of medical monitor terminal, monitor center software, distributed medical database and two kind of medical information terminal are especially discussed. Rabbit3000 system is used in medical monitor terminal to implement security administration of data transfer on network, human-machine interface, power management and DSP interface while DSP chip TMS5402 is used in signal analysis and data compression. Distributed medical database is designed for hospital center according to DICOM information model and HL7 standard. Pocket medical information terminal based on ARM9 embedded platform is also developed to interactive with center database on networks. Two kernels based on WINCE are customized and corresponding terminal software are developed for nurse's routine care and doctor's auxiliary diagnosis. Now invention patent of the monitor terminal is approved and manufacture and clinic test plans are scheduled. Applications for invention patent are also arranged for two medical information terminals.
Remote monitoring system workshop and technical cooperation
Energy Technology Data Exchange (ETDEWEB)
Kim, Jung Soo; Kwack, E. H.; Yoon, W. K.; Kim, J. S.; Cha, H. Y.; Na, W.W
2000-06-01
RMS workshop at the year focus on installing the material monioring system at technology lab. within TCNC. This system was developed by cooperative monitoring center(CMC) belonging to Sandia national lab. MMS consisted of data storage computer, data collection computer and easily connet to DCM-14 camera using monitoring the NPP by IAEA. The system run when the motion is catching and stroes the event data to MMS server. Also, the system communicate with the internet and then they access to check the event data only if the authencated person.
Remote monitoring system workshop and technical cooperation
International Nuclear Information System (INIS)
Kim, Jung Soo; Kwack, E. H.; Yoon, W. K.; Kim, J. S.; Cha, H. Y.; Na, W.W.
2000-06-01
RMS workshop at the year focus on installing the material monioring system at technology lab. within TCNC. This system was developed by cooperative monitoring center(CMC) belonging to Sandia national lab. MMS consisted of data storage computer, data collection computer and easily connet to DCM-14 camera using monitoring the NPP by IAEA. The system run when the motion is catching and stroes the event data to MMS server. Also, the system communicate with the internet and then they access to check the event data only if the authencated person
Research and Implementation of Distributed Database HBase Monitoring System
Directory of Open Access Journals (Sweden)
Guo Lisi
2017-01-01
Full Text Available With the arrival of large data age, distributed database HBase becomes an important tool for storing data in massive data age. The normal operation of HBase database is an important guarantee to ensure the security of data storage. Therefore designing a reasonable HBase monitoring system is of great significance in practice. In this article, we introduce the solution, which contains the performance monitoring and fault alarm function module, to meet a certain operator’s demand of HBase monitoring database in their actual production projects. We designed a monitoring system which consists of a flexible and extensible monitoring agent, a monitoring server based on SSM architecture, and a concise monitoring display layer. Moreover, in order to deal with the problem that pages renders too slow in the actual operation process, we present a solution: reducing the SQL query. It has been proved that reducing SQL query can effectively improve system performance and user experience. The system work well in monitoring the status of HBase database, flexibly extending the monitoring index, and issuing a warning when a fault occurs, so that it is able to improve the working efficiency of the administrator, and ensure the smooth operation of the project.
PC based vibration monitoring system
International Nuclear Information System (INIS)
Jain, Sanjay K.; Roy, D.A.; Pithawa, C.K.; Patil, R.K.
2004-01-01
Health of large rotating machinery gets reflected in the vibration signature of the rotor and supporting structures and proper recording of these signals and their analysis can give a clear picture of the health of the machine. Using these data and their trending, it is possible to predict an impending trouble in the machine so that preventive action can be taken in time and catastrophic failure can be avoided. Continuous monitoring and analysis can give quick warning and enable operator to take preventive measures. Reactor Control Division, BARC is developing a PC based Vibration monitoring system for turbo generator machinery. The System can acquire 20 vibration signals at a rate of 5000 samples per second and also 15 process signals at a rate of 100 samples/ sec. The software for vibration monitoring system includes acquisition modules, analysis modules and Graphical User Interface module. The acquisition module involves initialization, setting of required parameters and acquiring the data from PC-based data acquisition cards. The acquired raw vibration data is then stored for analysis using various software packages. The display and analysis of acquired data is done in LabVIEW 7.0 where the data is displayed in time as well as frequency domain along with the RMS value of the signal. (author)
Development of an enhanced loose parts monitoring system (LPMS)
International Nuclear Information System (INIS)
Choi, Y. C.; Park, J. H.; Yoon, D. B.; Choi, K. S.; Sohn, C. H.
2006-01-01
LPMS (loose parts monitoring system) is one of the most important structural integrity monitoring systems. It is operated for a early detection of the impacts by loosened or detached metallic, objects on the primary pressure boundary in a nuclear power plant. The impacted parts might cause flow blockage in the fuel channel, prevent the control rod from moving properly, damage the pump impeller, and give rise to cracks on the steam generator tube sheet, etc. In Korea, The LPMS is currently operating in all of the nuclear power plants as a subsystem in the NIMS (NSSS Integrity Monitoring System), However the performances are being deteriorated in both the hardware and software since it was designed in 1980's. In particular the system is not capable of promptly responding to the continuously triggered impacts in a short period failing to monitor the real loose parts. Also the diagnostic tools to estimate the location and the mass or energy of the impact source have not been reflected. Therefore, a new loose parts monitoring system has been developed to improve the capabilities of the current one and ultimately to replace it. An enhanced Loose Parts Monitoring System(LPMS) has been developed by KAERI(Korea Atomic Energy Research Inst.), not only to improve the performance of an on-line signal processing for a monitoring system but also to enhance the evaluation technique of the true impact signals by loose parts. This new system has taken into account the state-of-the-art technology to cover the problems with the conventional system. (authors)
Environmental monitoring systems: a new type of mobile laboratory
International Nuclear Information System (INIS)
Bruecher, L.; Langmueller, G.; Tuerschmann, G.
1999-01-01
Nuclear facilities are obligated to monitor the environmental radiation in their vicinity, which is often fulfilled by monitoring cars, combined with fixed monitoring stations. The MOLAR Mobile Laboratory for Environmental Radiation Monitoring as described here is being used under normal and accident conditions as a spot check monitoring system or to perform continuous measurements along a driving track. The mobile laboratories are continuously connected with the control centre's CRCS Central Radiological Computer System, where the RIS Radiological Information System provides corresponding evaluation functions. The mobile labs contain measuring and controlling units like γ-dose rate monitors, γ-spectrometer with a HpGe High Purity Germanium detector, a lead shielded measuring cell and MCA Multi-Channel Analyser, portable β-contamination monitor, α/β/γ multipurpose quick measuring unit, aerosol and iodine sampling units. The collected samples are safely stored for the transport to the environmental laboratory for being analysed later. The geographical location of the moving car is continuously determined by the satellite based GPS Global Positioning System and transferred in the on-board rack mounted computer system for being stored and locally displayed. Real-time data transmission via radio and mobile phone is continuously performed to supply the RIS Radiological Information System in the control centre via radio and mobile phone. The latter also serves for voice communication. Currently three MOLAR systems can be operated parallel and independent from the control centre. The system is ready to be extended to more mobile labs. This combination of mobile monitoring, sample analysis and radiological assessment of environmental data in combination with process occurrences has turned out to be a powerful instrument for emergency preparedness and environmental supervising. (orig.) [de
Design of multi-channel analyzer's monitoring system based on embedded system
International Nuclear Information System (INIS)
Yang Tao; Wei Yixiang
2007-01-01
A new Multi-Channel Analyzer's Monitoring system based on ARM9 Embedded system is introduced in this paper. Some solutions to problem are also discussed during the procedure of design, installation and debugging on Linux system. The Monitoring system is developed by using MiniGUI and Linux software system API, with the functions of collecting, displaying and I/O data controlling 1024 channels datum. They are all realized in real time, with the merits of low cost, small size and portability. All these lay the foundation of developing homemade Digital and Portable nuclear spectrometers. (authors)
Limerick Nuclear Generating Station vibration monitoring system
International Nuclear Information System (INIS)
Mikulski, R.
1988-01-01
Philadelphia Electric Company utilizes a vibration monitoring computer system at its Limerick Nuclear Generating Station to evaluate machine performance. Performance can be evaluated through instantaneous sampling, online static and transient data. The system functions as an alarm monitor, displaying timely alarm data to the control area. The passage of time since the system's inception has been a learning period. Evaluation through continuous use has led to many enhancements in alarm handling and in the acquisition and display of machine data. Due to the system's sophistication, a routine maintenance program is a necessity. This paper describes the system's diagnostic tools and current utilization. System development and maintenance techniques will also be discussed
Study on intermediate frequency power supply automatic monitor system
International Nuclear Information System (INIS)
Wang Yuntong; Xu Bin
2007-06-01
A new design project of the automatic monitor system for the intermediate frequency power supply system by using the communication server is put for- ward and the realizing principle method and the key technique are clarified in detail. This system made use of the conversion function with the series communication server's control, realized the data collecting function by the double machine backup and redundancy. The new network system adopted the photoelectric-insulated-communication connect device and the diagnosis technique, increased the anti-interference ability, the communication adopted the technique by the alarm information sending out in first and circularly repeating, the slowly speed is overcame in the original monitor network system, and strengthened the celerity of the monitor system and the reliability of the alarm report. After the new monitor system running, the result shows that the functions is more perfect than the original monitor system, the usage is more convenient, have the higher and dependable stability, the report of alarm is more quickly, and is convenient for the analysis after the trouble, at the same time, the system still have the strong ability and value to expand. (authors)
An integrated system for pipeline condition monitoring
Energy Technology Data Exchange (ETDEWEB)
Strong, Andrew P.; Lees, Gareth; Hartog, Arthur; Twohig, Richard; Kader, Kamal; Hilton, Graeme; Mullens, Stephen; Khlybov, Artem [Schlumberger, Southampton (United Kingdom); Sanderson, Norman [BP Exploration, Sunbury (United Kingdom)
2009-07-01
In this paper we present the unique and innovative 'Integriti' pipeline and flow line integrity monitoring system developed by Schlumberger in collaboration with BP. The system uses optical fiber distributed sensors to provide simultaneous distributed measurements of temperature, strain and vibration for the detection, monitoring, and location of events including: Third Party Interference (TPI), including multiple simultaneous disturbances; geo-hazards and landslides; gas and oil leaks; permafrost protection. The Integriti technology also provides a unique means for tracking the progress of cleaning and instrumented pigs using existing optical telecom and data communications cables buried close to pipelines. The Integriti solution provides a unique and proactive approach to pipeline integrity management. It performs analysis of a combination of measurands to provide the pipeline operator with an event recognition and location capability, in effect providing a hazard warning system, and offering the operator the potential to take early action to prevent loss. Through the use of remote, optically powered amplification, an unprecedented detection range of 100 km is possible without the need for any electronics and therefore remote power in the field. A system can thus monitor 200 km of pipeline when configured to monitor 100 km upstream and downstream from a single location. As well as detecting conditions and events leading to leaks, this fully integrated system provides a means of detecting and locating small leaks in gas pipelines below the threshold of present online leak detection systems based on monitoring flow parameters. Other significant benefits include: potential reductions in construction costs; enhancement of the operator's existing integrity management program; potential reductions in surveillance costs and HSE risks. In addition to onshore pipeline systems this combination of functionality and range is available for practicable
BABY MONITORING SYSTEM USING WIRELESS SENSOR NETWORKS
Directory of Open Access Journals (Sweden)
G. Rajesh
2014-09-01
Full Text Available Sudden Infant Death Syndrome (SIDS is marked by the sudden death of an infant during sleep that is not predicted by the medical history and remains unexplained even after thorough forensic autopsy and detailed death investigation. In this we developed a system that provides solutions for the above problems by making the crib smart using the wireless sensor networks (WSN and smart phones. The system provides visual monitoring service through live video, alert services by crib fencing and awakens alert, monitoring services by temperature reading and light intensity reading, vaccine reminder and weight monitoring.
The Wettzell System Monitoring Concept and First Realizations
Ettl, Martin; Neidhardt, Alexander; Muehlbauer, Matthias; Ploetz, Christian; Beaudoin, Christopher
2010-01-01
Automated monitoring of operational system parameters for the geodetic space techniques is becoming more important in order to improve the geodetic data and to ensure the safety and stability of automatic and remote-controlled observations. Therefore, the Wettzell group has developed the system monitoring software, SysMon, which is based on a reliable, remotely-controllable hardware/software realization. A multi-layered data logging system based on a fanless, robust industrial PC with an internal database system is used to collect data from several external, serial, bus, or PCI-based sensors. The internal communication is realized with Remote Procedure Calls (RPC) and uses generative programming with the interface software generator idl2rpc.pl developed at Wettzell. Each data monitoring stream can be configured individually via configuration files to define the logging rates or analog-digital-conversion parameters. First realizations are currently installed at the new laser ranging system at Wettzell to address safety issues and at the VLBI station O Higgins as a meteorological data logger. The system monitoring concept should be realized for the Wettzell radio telescope in the near future.
Aerospace Systems Monitor, Phase II
National Aeronautics and Space Administration — Proposal Title: Aerospace Systems Monitor PHASE 1 Technical Abstract: This Phase II STTR project will continue development and commercialization of the Aerospace...
A dose monitoring system for dental radiography
Energy Technology Data Exchange (ETDEWEB)
Lee, Chena; Lee, Sam Sun; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Woo Jin; Heo, Min Suk; Choi, Soon Chul [Dept. of Oral and Maxillofacial Radiology and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of); Symkhampha, Khanthaly [Dept. of Oral and Maxillofacial Radiology, Department of Basic Science, Faculty of Dentistry, University of Health Sciences, Vientiane (Lao People' s Democratic Republic); Lee, Woo Jin [Dept. of Interdisciplinary Program in Radiation, Applied Life Sciences Major, College of Medicine, BK21, and Dental Research Institute, Seoul National University, Seoul (Korea, Republic of); Yeom, Heon Young [School of Computer Science Engineering, Seoul National University, Seoul (Korea, Republic of)
2016-06-15
The current study investigates the feasibility of a platform for a nationwide dose monitoring system for dental radiography. The essential elements for an unerring system are also assessed. An intraoral radiographic machine with 14 X-ray generators and five sensors, 45 panoramic radiographic machines, and 23 cone-beam computed tomography (CBCT) models used in Korean dental clinics were surveyed to investigate the type of dose report. A main server for storing the dose data from each radiographic machine was prepared. The dose report transfer pathways from the radiographic machine to the main sever were constructed. An effective dose calculation method was created based on the machine specifications and the exposure parameters of three intraoral radiographic machines, five panoramic radiographic machines, and four CBCTs. A viewing system was developed for both dentists and patients to view the calculated effective dose. Each procedure and the main server were integrated into one system. The dose data from each type of radiographic machine was successfully transferred to the main server and converted into an effective dose. The effective dose stored in the main server is automatically connected to a viewing program for dentist and patient access. A patient radiation dose monitoring system is feasible for dental clinics. Future research in cooperation with clinicians, industry, and radiologists is needed to ensure format convertibility for an efficient dose monitoring system to monitor unexpected radiation dose.
A dose monitoring system for dental radiography
International Nuclear Information System (INIS)
Lee, Chena; Lee, Sam Sun; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Woo Jin; Heo, Min Suk; Choi, Soon Chul; Symkhampha, Khanthaly; Lee, Woo Jin; Yeom, Heon Young
2016-01-01
The current study investigates the feasibility of a platform for a nationwide dose monitoring system for dental radiography. The essential elements for an unerring system are also assessed. An intraoral radiographic machine with 14 X-ray generators and five sensors, 45 panoramic radiographic machines, and 23 cone-beam computed tomography (CBCT) models used in Korean dental clinics were surveyed to investigate the type of dose report. A main server for storing the dose data from each radiographic machine was prepared. The dose report transfer pathways from the radiographic machine to the main sever were constructed. An effective dose calculation method was created based on the machine specifications and the exposure parameters of three intraoral radiographic machines, five panoramic radiographic machines, and four CBCTs. A viewing system was developed for both dentists and patients to view the calculated effective dose. Each procedure and the main server were integrated into one system. The dose data from each type of radiographic machine was successfully transferred to the main server and converted into an effective dose. The effective dose stored in the main server is automatically connected to a viewing program for dentist and patient access. A patient radiation dose monitoring system is feasible for dental clinics. Future research in cooperation with clinicians, industry, and radiologists is needed to ensure format convertibility for an efficient dose monitoring system to monitor unexpected radiation dose
Monitoring of the Deposition of PAHs and Metals Produced by a Steel Plant in Taranto (Italy
Directory of Open Access Journals (Sweden)
M. Amodio
2014-01-01
Full Text Available A high time-resolved monitoring campaign of bulk deposition of PAHs and metals was conducted near the industrial area and at an urban background site in province of Taranto (Italy in order to evaluate the impact of the biggest European steel plant. The deposition fluxes of the sum of detected PAHs at the industrial area ranged from 92 to 2432 ng m−2d−1. In particular the deposition fluxes of BaP, BaA, and BkF were, on average, 10, 14, and 8 times higher than those detected at the urban background site, respectively. The same finding was for metals. The deposition fluxes of Ni (19.8 µg m−2 d−1 and As (2.2 µg m−2 d−1 at the industrial site were about 5 times higher than those at the urban background site, while the deposition fluxes of Fe (57 mg m−2d−1 and Mn (1.02 mg m−2d−1 about 31 times higher. Precipitation and wind speed played an important role in PAH deposition fluxes. Fe and Mn fluxes at the industrial site resulted high when wind direction favored the transport of air masses from the steel plant to the receptor site. The impact of the industrial area was also confirmed by IP/(IP + BgP, IP/BgP, and BaP/BgP diagnostic ratios.
A low frequency RFI monitoring system
Amiri, Shahram; Shankar, N. Udaya; Girish, B. S.; Somashekar, R.
Radio frequency interference (RFI) is a growing problem for research in radio astronomy particularly at wavelengths longer than 2m. For satisfactory operation of a radio telescope, several bands have been protected for radio astronomy observations by the International Telecommunication Union. Since the radiation from cosmic sources are typically 40 to 100 dB below the emission from services operating in unprotected bands, often the out-of-band emission limits the sensitivity of astronomical observations. Moreover, several radio spectral emissions from cosmic sources are present in the frequency range outside the allocated band for radio astronomy. Thus monitoring of RFI is essential before building a receiver system for low frequency radio astronomy. We describe the design and development of an RFI monitoring system operating in the frequency band 30 to 100 MHz. This was designed keeping in view our proposal to extend the frequency of operation of GMRT down to 40 MHz. The monitor is a PC based spectrometer recording the voltage output of a receiver connected to an antenna, capable of digitizing the low frequency RF directly with an 8 bit ADC and sampling bandwidths up to 16 MHz. The system can operate continuously in almost real-time with a loss of only 2% of data. Here we will present the systems design aspects and the results of RFI monitoring carried out at the Raman Research Institute, Bangalore and at the GMRT site in Khodad.
Wireless patient monitoring system for a moving-actuator type artificial heart.
Nam, K W; Chung, J; Choi, S W; Sun, K; Min, B G
2006-10-01
In this study, we developed a wireless monitoring system for outpatients equipped with a moving-actuator type pulsatile bi-ventricular assist device, AnyHeart. The developed monitoring system consists of two parts; a Bluetooth-based short-distance self-monitoring system that can monitor and control the operating status of a VAD using a Bluetooth-embedded personal digital assistant or a personal computer within a distance of 10 meters, and a cellular network-based remote monitoring system that can continuously monitor and control the operating status of AnyHeart at any location. Results of in vitro experiments demonstrate the developed system's ability to monitor the operational status of an implanted AnyHeart.
296-B-5 Stack monitoring and sampling system annual system assessment report
International Nuclear Information System (INIS)
Ridge, T.M.
1995-02-01
The B Plant Administration Manual requires an annual system assessment to evaluate and report the present condition of the sampling and monitoring system associated with Stack 296-B-5 at B Plant. The sampling and monitoring system associated with stack 296-B-5 is functional and performing satisfactorily. This document is an annual assessment report of the systems associated with the 296-B-5 stack
EDGAR, a new plant radiation monitoring system
International Nuclear Information System (INIS)
Vuong, Q.M.; Da Costa Vieira, D.
2004-01-01
The EDGAR system is a new radiation monitoring system for nuclear power plant, reprocessing plant and nuclear research reactor for radioactive contamination, gamma and neutron field monitoring. Developed by French Atomic Energy Agency, this system provides not only complete functions of standard RMS, also allows spectroscopy level detection of alpha and beta particles based on a patented collimator unit. A complete computerized approach has been taken allowing full installation control in a single PC based display and communication unit. (author)
Optimising corrosion monitoring in district heating systems
DEFF Research Database (Denmark)
Hilbert, Lisbeth Rischel; Thorarinsdottir, R.I.; Andersen, A.
2002-01-01
A three-year project - financially supported by the Nordic Industrial Fund - on monitoring of corrosion in district heating systems has been initiated with participation of researchers and industrial partners in Denmark, Finland, Iceland, Norway and Sweden. The primary objective of the project...... is to improve the quality control in district heating systems by corrosion monitoring. In Danish systems electrochemical impedance spectroscopy (EIS), linear polarisation resistance (LPR), high-sensitive electrical resistance (ER) technology, crevice corrosion probes, as well as weight loss coupons...
DEFF Research Database (Denmark)
Georgieva, Tania I.; Mikkelsen, Marie Just; Ahring, Birgitte Kiær
2008-01-01
was not detoxified, ethanol yield in a range of 0.39-0.42 g/g was obtained. Overall, sugar efficiency to ethanol was 68-76%. The reactor was operated continuously for approximately 143 days, and no contamination was seen without the use of any agent for preventing bacterial infections. The tested microorganism has......Thermophilic ethanol fermentation of wet-exploded wheat straw hydrolysate was investigated in a continuous immobilized reactor system. The experiments were carried out in a lab-scale fluidized bed reactor (FBR) at 70C. Undetoxified wheat straw hydrolysate was used (3-12% dry matter), corresponding...... to sugar mixtures of glucose and xylose ranging from 12 to 41 g/l. The organism, thermophilic anaerobic bacterium Thermoanaerobacter BG1L1, exhibited significant resistance to high levels of acetic acid (up to 10 g/l) and other metabolic inhibitors present in the hydrolysate. Although the hydrolysate...
Radiation Monitoring System in Advanced Spent Fuel Conditioning Process Facility
Energy Technology Data Exchange (ETDEWEB)
You, Gil Sung; Kook, D. H.; Choung, W. M.; Ku, J. H.; Cho, I. J.; You, G. S.; Kwon, K. C.; Lee, W. K.; Lee, E. P
2006-09-15
The Advanced spent fuel Conditioning Process is under development for effective management of spent fuel by converting UO{sub 2} into U-metal. For demonstration of this process, {alpha}-{gamma} type new hot cell was built in the IMEF basement . To secure against radiation hazard, this facility needs radiation monitoring system which will observe the entire operating area before the hot cell and service area at back of it. This system consists of 7 parts; Area Monitor for {gamma}-ray, Room Air Monitor for particulate and iodine in both area, Hot cell Monitor for hot cell inside high radiation and rear door interlock, Duct Monitor for particulate of outlet ventilation, Iodine Monitor for iodine of outlet duct, CCTV for watching workers and material movement, Server for management of whole monitoring system. After installation and test of this, radiation monitoring system will be expected to assist the successful ACP demonstration.
Radiation Monitoring System in Advanced Spent Fuel Conditioning Process Facility
International Nuclear Information System (INIS)
You, Gil Sung; Kook, D. H.; Choung, W. M.; Ku, J. H.; Cho, I. J.; You, G. S.; Kwon, K. C.; Lee, W. K.; Lee, E. P.
2006-09-01
The Advanced spent fuel Conditioning Process is under development for effective management of spent fuel by converting UO 2 into U-metal. For demonstration of this process, α-γ type new hot cell was built in the IMEF basement . To secure against radiation hazard, this facility needs radiation monitoring system which will observe the entire operating area before the hot cell and service area at back of it. This system consists of 7 parts; Area Monitor for γ-ray, Room Air Monitor for particulate and iodine in both area, Hot cell Monitor for hot cell inside high radiation and rear door interlock, Duct Monitor for particulate of outlet ventilation, Iodine Monitor for iodine of outlet duct, CCTV for watching workers and material movement, Server for management of whole monitoring system. After installation and test of this, radiation monitoring system will be expected to assist the successful ACP demonstration
[Development of automatic urine monitoring system].
Wei, Liang; Li, Yongqin; Chen, Bihua
2014-03-01
An automatic urine monitoring system is presented to replace manual operation. The system is composed of the flow sensor, MSP430f149 single chip microcomputer, human-computer interaction module, LCD module, clock module and memory module. The signal of urine volume is captured when the urine flows through the flow sensor and then displayed on the LCD after data processing. The experiment results suggest that the design of the monitor provides a high stability, accurate measurement and good real-time, and meets the demand of the clinical application.
Quaternion Based Thermal Condition Monitoring System
Wong, Wai Kit; Loo, Chu Kiong; Lim, Way Soong; Tan, Poi Ngee
In this paper, we will propose a new and effective machine condition monitoring system using log-polar mapper, quaternion based thermal image correlator and max-product fuzzy neural network classifier. Two classification characteristics namely: peak to sidelobe ratio (PSR) and real to complex ratio of the discrete quaternion correlation output (p-value) are applied in the proposed machine condition monitoring system. Large PSR and p-value observe in a good match among correlation of the input thermal image with a particular reference image, while small PSR and p-value observe in a bad/not match among correlation of the input thermal image with a particular reference image. In simulation, we also discover that log-polar mapping actually help solving rotation and scaling invariant problems in quaternion based thermal image correlation. Beside that, log-polar mapping can have a two fold of data compression capability. Log-polar mapping can help smoother up the output correlation plane too, hence makes a better measurement way for PSR and p-values. Simulation results also show that the proposed system is an efficient machine condition monitoring system with accuracy more than 98%.
Integrated monitoring of wind plant systems
Whelan, Matthew J.; Janoyan, Kerop D.; Qiu, Tong
2008-03-01
Wind power is a renewable source of energy that is quickly gaining acceptance by many. Advanced sensor technologies have currently focused solely on improving wind turbine rotor aerodynamics and increasing of the efficiency of the blade design and concentration. Alternatively, potential improvements in wind plant efficiency may be realized through reduction of reactionary losses of kinetic energy to the structural and substructural systems supporting the turbine mechanics. Investigation of the complete dynamic structural response of the wind plant is proposed using a large-scale, high-rate wireless sensor network. The wireless network enables sensors to be placed across the sizable structure, including the rotating blades, without consideration of cabling issues and the economic burden associated with large spools of measurement cables. A large array of multi-axis accelerometers is utilized to evaluate the modal properties of the system as well as individual members and would enable long-term structural condition monitoring of the wind turbine as well. Additionally, environmental parameters, including wind speed, temperature, and humidity, are wirelessly collected for correlation. Such a wireless system could be integrated with electrical monitoring sensors and actuators and incorporated into a remote multi-turbine centralized plant monitoring and control system.
Implementation of remove monitoring in facilities under safeguards with unattended systems
International Nuclear Information System (INIS)
Beddingfield, David H.; Nordquist, Heather A.; Umebayaashi, Eiji
2009-01-01
Remote monitoring is being applied by the International Atomic Energy Agency (IAEA) at nuclear facilities around the world. At the Monju Reactor in Japan we have designed, developed and implemented a remote monitoring approach that can serve as a model for applying remote monitoring to facilities that are already under full-scope safeguards using unattended instrumentation. Remote monitoring implementations have historically relied upon the use of specialized data collection hardware and system design features that integrate remote monitoring into the safeguards data collection system. The integration of remote monitoring and unattended data collection increases the complexity of safeguards data collection systems. This increase in complexity necessarily produces a corresponding reduction of system reliability compared to less-complex unattended monitoring systems. At the Monju facility we have implemented a remote monitoring system that is decoupled from the activity of safeguards data collection. In the completed system the function of remote data transfer is separated from the function of safeguards data collection. As such, a failure of the remote monitoring function cannot produce an associated loss of safeguards data, as is possible with integrated remote-monitoring implementations. Currently, all safeguards data from this facility is available to the IAEA on a 24/7 basis. This facility employs five radiation-based unattended systems, video surveillance and numerous optical seal systems. The implementation of remote monitoring at this facility, while increasing the complexity of the safeguards system, is designed to avoid any corresponding reduction in reliability of the safeguards data collection systems by having decoupled these functions. This design and implementation can serve as a model for implementation of remote monitoring at nuclear facilities that currently employ unattended safeguards systems.
Sinabro: A Smartphone-Integrated Opportunistic Electrocardiogram Monitoring System
Sungjun Kwon; Dongseok Lee; Jeehoon Kim; Youngki Lee; Seungwoo Kang; Sangwon Seo; Kwangsuk Park
2016-01-01
In our preliminary study, we proposed a smartphone-integrated, unobtrusive electrocardiogram (ECG) monitoring system, Sinabro, which monitors a user?s ECG opportunistically during daily smartphone use without explicit user intervention. The proposed system also monitors ECG-derived features, such as heart rate (HR) and heart rate variability (HRV), to support the pervasive healthcare apps for smartphones based on the user?s high-level contexts, such as stress and affective state levels. In th...
Personnel external dose monitoring system
International Nuclear Information System (INIS)
Zhao Hengyuan
1989-01-01
The status and trend of personnel external dose monitoring system are introduced briefly. Their characteristics, functions and TLD bedges of some commercially available automatic TLD system, including UD-710A (Matsushita, Japan), Harshaw-2271, 2276 (Harshaw, USA), Harshaw-8000 (Harshaw/Filtrol), Studsvik-1313 (Sweden) and Pitman-800 (UK) were depicted in detail. Finally, personnel dose management and record keeping system were presented and two examples were given
MINED GEOLOGIC DISPOSAL SYSTEM (MGDS) MONITORING AND CONTROL SYSTEMS CENTRALIZATION TECHNICAL REPORT
International Nuclear Information System (INIS)
M.J. McGrath
1998-01-01
The objective of this report is to identify and document Mined Geologic Disposal System (MGDS) requirements for centralized command and control. Additionally, to further develop the MGDS monitoring and control functions. This monitoring and control report provides the following information: (1) Determines the applicable requirements for a monitoring and control system for repository operations and construction (excluding Performance Confirmation). (2) Makes a determination as to whether or not centralized command and control is required
Real time kernel performance monitoring with SystemTap
CERN. Geneva
2018-01-01
SystemTap is a dynamic method of monitoring and tracing the operation of a running Linux kernel. In this talk I will present a few practical use cases where SystemTap allowed me to turn otherwise complex userland monitoring tasks in simple kernel probes.
Operational experience with two tritium-effluent-monitoring systems
International Nuclear Information System (INIS)
Haynie, J.S.; Gutierrez, J.A.
1982-01-01
Two new tritium stack monitoring systems were designed and built. The operational experience of a wide-range detector with a useful range of a few μCi/m 3 to 10 8 μCi/m 3 , and a second monitoring system using an improved Kanne chamber and a new electrometer, called a Model 39 Electrometer-Chargemeter are discussed. Both tritium chambers have been designed to have a reduced sensitivity to tritium contamination, a fast response, and an integrating chargemeter with digital readout for easy conversion to microcuries. The calibration of these monitors and advantages of using these chambers over conventional systems are discussed
Quebec firm develops satellite monitoring system
Energy Technology Data Exchange (ETDEWEB)
Anon
2004-09-01
Satellite-based technology that gives project owners an affordable way to monitor and control wind turbine operation, even in remote sites, is announced. Called Satwind, the system can be adapted to any scale, ranging from simple, low-cost units for small wind turbines to advanced versions designed to handle more complex wind-diesel installations, as well as large turbines used in offshore projects. Current installations include a turbine in the Tunisian desert and two Quebec wind-diesel plants accessible only by helicopter. The system can be operated directly from a cell-phone, in a user-friendly Internet manner, without the need to be connected to a complex centralized wind farm monitoring system.
Lu, Helen H; Tang, Amy; Oh, Seong Cheol; Spalazzi, Jeffrey P; Dionisio, Kathie
2005-11-01
Biodegradable polymer-ceramic composites are attractive systems for bone tissue engineering applications. These composites have the combined advantages of the component phases, as well as the inherent ease in optimization where desired material properties can be tailored in a well-controlled manner. This study focuses on the optimization of a polylactide-co-glycolide (PLAGA) and 45S5 bioactive glass (BG) composite for bone tissue engineering. The first objective is to examine the effects of composition or overall BG content on the formation of a Ca-P layer on the PLAGA-BG composite. It is expected that with increasing BG content (0%, 10%, 25%, 50% by weight), the required incubation time in a simulated body fluid (SBF) for the composite to form a detectable surface Ca-P layer will decrease. Both the kinetics and the chemistry will be determined using SEM+EDAX, FTIR, and mu-CT methods. Solution phosphorous and calcium concentrations will also be measured. The second objective of the study is to determine the effects of BG content on the maturation of osteoblast-like cells on the PLAGA-BG composite. It is hypothesized that mineralization will increase with increasing BG content, and the composite will support the proliferation and differentiation of osteoblasts. Specifically, cell proliferation, alkaline phosphatase activity and mineralization will be monitored as a function of BG content (0%, 10%, 50% by weight) and culturing time. It was found that the kinetics of Ca-P layer formation and the resulting Ca-P chemistry were dependent on BG content. The response of human osteoblast-like cells to the PLAGA-BG composite was also a function of BG content. The 10% and 25% BG composite supported greater osteoblast growth and differentiation compared to the 50% BG group. The results of this study suggest that there is a threshold BG content which is optimal for osteoblast growth, and the interactions between PLAGA and BG may modulate the kinetics of Ca-P formation and the
Performace Of Multi-Probe Corrosion Monitoring Systems At The Hanford Site
International Nuclear Information System (INIS)
Carothers, K.D.; Boomer, K.D.; Anda, V.S.; Dahl, M.M.; Edgemon, G.L.
2010-01-01
Between 2007 and 2009, several different multi-probe corrosion monitoring systems were designed and installed in high-level nuclear waste tanks at the U.S. Department of Energy's Hanford Site in WaShington State. The probe systems are being monitored to ensure waste tanks operate in regions that minimize localized corrosion (i.e., pitting) and stress corrosion cracking. The corrosion monitoring systems have been installed in wastes with different chemistry types. An ongoing effort during the same time period has generated non-radioactive simulants that are tested in the laboratory to establish baseline corrosion monitoring system performance and characterize data to allow interpretation of readings from the multiple corrosion monitoring systems. Data collection from these monitoring systems has reached the point where the results allow comparison with the laboratory testing. This paper presents analytical results from the corrosion monitoring system development program.
Computerized x-ray dose-monitoring system
International Nuclear Information System (INIS)
Hummel, R.H.; Wesenberg, R.L.; Amundson, G.M.
1985-01-01
An x-ray dose-monitoring system using a small digital computer is described. Initially, and for every 6 months afterward, the system is calibrated using an exposure meter. For each exposure, the computer receives values of x-ray technique and beam geometry from the x-ray generator through a specially designed electronic interface. Then, by means of calibration data, entrance exposure, area exposure product, and integral dose are obtained and printed for each patient examined. The overall accuracy of the system is better than +/-20%. Operation is semiautomatic, requiring minimum operator intervention. Over 2000 patients have been monitored with the device. Because the system is computer-based, it offers the opportunity for statistical analysis of the data base created, as the results for each patient are stored on computer disk
Background compensation methodologies for contamination monitoring systems
International Nuclear Information System (INIS)
Raman, Anand; Chaudhury, Probal; Pradeepkumar, K.S.
2014-01-01
Radiation surveillance program in the various nuclear facilities incorporate contamination monitoring as an important component. Contamination monitoring programs constitute monitoring for alpha and beta contamination of the physical entities associated with the working personnel that include his hands, feet, clothing, shoes as well as the general surface areas in the working environment like floors. All these measurements are fraught with the contribution of the ambient gamma background radiation fields. These inhibit a proper and precise estimation of the contamination concentration being monitored. This paper investigates the efficacy of two methodologies that have been incorporated in two of the contamination monitoring systems developed in the Division. In the first system discussed, a high degree of gamma compensation has been achieved for an uniform exposure of the order of 50 nSv/hr to 100 mSv/hr. In the second system discussed, the degree of gamma compensation achieved is equal to those dictated by the statistical nature of the uncertainties associated with the subtraction of background from the source data. These two methods can be very effectively employed depending on the application requirement. A minimum detection level equivalent to 0.37 Bq/cdm 2 has been achieved in both these cases
Systems engineering approach towards performance monitoring of emergency diesel generator
International Nuclear Information System (INIS)
Nurhayati Ramli; Lee, Y.K.
2013-01-01
Full-text: Systems engineering is an interdisciplinary approach and means to enable the realization of successful systems. In this study, systems engineering approach towards the performance monitoring of Emergency Diesel Generator (EDG) is presented. Performance monitoring is part and parcel of predictive maintenance where the systems and components conditions can be detected before they result into failures. In an effort to identify the proposal for addressing performance monitoring, the EDG boundary has been defined. Based on the Probabilistic Safety Analysis (PSA) results and industry operating experiences, the most critical component is identified. This paper proposed a systems engineering concept development framework towards EDG performance monitoring. The expected output of this study is that the EDG reliability can be improved by the performance monitoring alternatives through the systems engineering concept development effort. (author)
G-Cloud Monitor: A Cloud Monitoring System for Factory Automation for Sustainable Green Computing
Directory of Open Access Journals (Sweden)
Hwa-Young Jeong
2014-11-01
Full Text Available Green and cloud computing (G-cloud are new trends in all areas of computing. The G-cloud provides an efficient function, which enables users to access their programs, systems and platforms at anytime and anyplace. Green computing can also yield greener technology by reducing power consumption for sustainable environments. Furthermore, in order to apply user needs to the system development, the user characteristics are regarded as some of the most important factors to be considered in product industries. In this paper, we propose a cloud monitoring system to observe and manage the manufacturing system/factory automation for sustainable green computing. For monitoring systems, we utilized the resources in the G-cloud environments, and hence, it can reduce the amount of system resources and devices, such as system power and processes. In addition, we propose adding a user profile to the monitoring system in order to provide a user-friendly function. That is, this function allows system configurations to be automatically matched to the individual’s requirements, thus increasing efficiency.
Development of CANDU core monitoring system
International Nuclear Information System (INIS)
Yoon, M. Y.; Yeam, C. S.; Kwon, O. H.; Kim, K. H.
2003-01-01
The research was performed to develop a CANDU Core Monitoring System(CCMS) that enables operators to have efficient core management by monitoring core power distribution, burnup distribution, and the other important core variables and managing the past core history for Wolsong Nuclear Power Plant(NPP) No. 1. CCMS uses RFSP(Reactor Fueling Simulation Program) for continuous core calculation by integrating the algorithm and assumptions validated and uses the information taken from DCC(Digital Control Computer) for the purpose of producing basic input data. CCMS could be largely divided into two modules; CCMS server program and CCMS client program. CCMS server program plays the role in automatic and continuous RFSP run and management of the past output data resulting from the run using Data Base Management System(DBMS). CCMS client program enables users to monitor current and past core status with GUI(Graphic-User Interface) environment predefined. The effectiveness of CCMS was verified by comparing the data resulted from field-test of the system for about 43 hours with the data used in the field of Wolsong NPP No. 1
Development of CANDU core monitoring system
Energy Technology Data Exchange (ETDEWEB)
Yoon, M. Y.; Yeam, C. S.; Kwon, O. H.; Kim, K. H. [Institute for Advanced Engineering, Yongin (Korea, Republic of)
2003-07-01
The research was performed to develop a CANDU Core Monitoring System(CCMS) that enables operators to have efficient core management by monitoring core power distribution, burnup distribution, and the other important core variables and managing the past core history for Wolsong Nuclear Power Plant(NPP) No. 1. CCMS uses RFSP(Reactor Fueling Simulation Program) for continuous core calculation by integrating the algorithm and assumptions validated and uses the information taken from DCC(Digital Control Computer) for the purpose of producing basic input data. CCMS could be largely divided into two modules; CCMS server program and CCMS client program. CCMS server program plays the role in automatic and continuous RFSP run and management of the past output data resulting from the run using Data Base Management System(DBMS). CCMS client program enables users to monitor current and past core status with GUI(Graphic-User Interface) environment predefined. The effectiveness of CCMS was verified by comparing the data resulted from field-test of the system for about 43 hours with the data used in the field of Wolsong NPP No. 1.
Evaluation of a multiport groundwater monitoring system
International Nuclear Information System (INIS)
Gilmore, T.J.; Hall, S.H.; Olsen, K.B.; Spane, F.A. Jr.
1991-03-01
In 1988 and 1989, Pacific Northwest Laboratory installed a multiport groundwater monitoring system in two wells on the Hanford Site: one near the 216-B-3 Pond in the center of the Hanford Site and one just north of the 300 Area near the Columbia River. The system was installed to provide the US Department of Energy with needed three-dimensional data on the vertical distribution of contaminants and hydraulic heads on the Hanford Site. This study evaluates the ability of the multiport system to obtain hydrogeologic data at multiple points vertically in a single borehole, and addresses the representativeness of the data. Data collected from the two wells indicate that the multiport system is well suited for groundwater monitoring networks requiring three-dimensional characterization of the hydrogeologic system. A network of these systems could provide valuable information on the hydrogeologic environment. However, the advantages of the multiport system diminish when the system is applied to long-term monitoring networks (30+ years) and to deeper wells (<300 ft). For shallow wells, the multiport system provides data in a cost-effective manner that would not be reasonably obtainable with the conventional methods currently in use at the Hanford Site. 17 refs., 28 figs., 6 tabs
Data monitoring system for PV solar generators
International Nuclear Information System (INIS)
Stoev, M.; Katerski, A.; Williams, A.
2000-01-01
The two 1.5 kWp photovoltaic (PV) solar generators are installed and the new PC data monitoring system is developed by applying EC standards for European Solar Test Installation (ESTI). The schematic system diagram of PV generator is presented. The recording parameters for analytical and global monitoring are discussed. The meteorological data from ESTI sensors, temperature sensor and electrical data from inverter and calibrated shunt are stored via analog digital converters (ADC) on a hard disk of data storage PC. Data Logger and Monitor software for automatic data acquisition, treatment and visual distance control of all output PV data from PV solar generator has been created
Real-Time Spatial Monitoring of Vehicle Vibration Data as a Model for TeleGeoMonitoring Systems
Robidoux, Jeff
2005-01-01
This research presents the development and proof of concept of a TeleGeoMonitoring (TGM) system for spatially monitoring and analyzing, in real-time, data derived from vehicle-mounted sensors. In response to the concern for vibration related injuries experienced by equipment operators in surface mining and construction operations, the prototype TGM system focuses on spatially monitoring vehicle vibration in real-time. The TGM vibration system consists of 3 components: (1) Data Acquisition ...
Advancing satellite operations with intelligent graphical monitoring systems
Hughes, Peter M.; Shirah, Gregory W.; Luczak, Edward C.
1993-01-01
For nearly twenty-five years, spacecraft missions have been operated in essentially the same manner: human operators monitor displays filled with alphanumeric text watching for limit violations or other indicators that signal a problem. The task is performed predominately by humans. Only in recent years have graphical user interfaces and expert systems been accepted within the control center environment to help reduce operator workloads. Unfortunately, the development of these systems is often time consuming and costly. At the NASA Goddard Space Flight Center (GSFC), a new domain specific expert system development tool called the Generic Spacecraft Analyst Assistant (GenSAA) has been developed. Through the use of a highly graphical user interface and point-and-click operation, GenSAA facilitates the rapid, 'programming-free' construction of intelligent graphical monitoring systems to serve as real-time, fault-isolation assistants for spacecraft analysts. Although specifically developed to support real-time satellite monitoring, GenSAA can support the development of intelligent graphical monitoring systems in a variety of space and commercial applications.
On-line monitoring system for utility boiler diagnostics
International Nuclear Information System (INIS)
Radovanovic, P.M.; Afgan, N.H.; Caralho, M.G.
1997-01-01
The paper deals with the new developed modular type Monitoring System for Utility Boiler Diagnostics. Each module is intended to assess the specific process and can be used as a stand alone application. Four modules are developed, namely: LTC - module for the on-line monitoring of parameters related to the life-time consumption of selected boiler components; TRD - module for the tube rupture detection by the position and working fluid Ieakage quantity; FAM - module for the boiler surfaces fouling (slagging) assessment and FLAP - module for visualization of the boiler furnace flame position. All four modules are tested on respective pilot plants built oil the 200 and 300 MWe utility boilers. Monitoring System is commercially available and can be realized in any combination of its modules depending on demands induced by the operational problems of specific boiler. Further development of Monitoring System is performed in accordance with the respective EU project on development of Boiler Expert System. (Author)
The Westinghouse BEACON on-line core monitoring system
International Nuclear Information System (INIS)
Buechel, Robert J.; Boyd, William A.; Casadei, Alberto L.
1995-01-01
BEACON (Best Estimate Analysis of Core Operations - Nuclear), a core monitoring and operational support package developed by Westinghouse, has been installed at many operating PWRs worldwide. The BEACON system is a real-time monitoring system which can be used in plants with both fixed and movable incore detector systems and utilizes an on-line nodal model combined with core instrumentation data to provide continuous core power distribution monitoring. In addition, accurate core-predictive capabilities utilizing a full core nodal model updated according to plant operating history can be made to provide operational support. Core history information is kept and displayed to help operators anticipate core behavior and take pro-active control actions. The BEACON system has been licensed by the U.S. Nuclear Regulatory Commission for direct, continuous monitoring of DNBR and peak linear heat rate. This allows BEACON to be integrated into the plant technical specifications to permit significant relaxation of operating limitations defined by conventional technical specifications. (author). 4 refs, 2 figs, 1 tab
Tuning permissiveness of active safety monitors for autonomous systems
Masson , Lola; Guiochet , Jérémie; Waeselynck , Hélène; Cabrera , Kalou; Cassel , Sofia; Törngren , Martin
2018-01-01
International audience; Robots and autonomous systems have become a part of our everyday life, therefore guaranteeing their safety is crucial.Among the possible ways to do so, monitoring is widely used, but few methods exist to systematically generate safety rules to implement such monitors. Particularly, building safety monitors that do not constrain excessively the system's ability to perform its tasks is necessary as those systems operate with few human interventions.We propose in this pap...
ATLAS Tile calorimeter calibration and monitoring systems
Marjanovic, Marija; The ATLAS collaboration
2018-01-01
The ATLAS Tile Calorimeter (TileCal) is the central section of the hadronic calorimeter of the ATLAS experiment. This sampling calorimeter uses steel plates as absorber and scintillating tiles as active medium. The light produced by the passage of charged particles is transmitted by wavelength shifting fibers to photo-multiplier tubes (PMTs), located in the outer part of the calorimeter. The readout is segmented into about 5000 cells, each one being read out by two PMTs in parallel. To calibrate and monitor the stability and performance of the full readout chain during the data taking, a set of calibration sub-systems is used. The TileCal calibration system comprises Cesium radioactive sources, laser, charge injection elements, and an integrator based readout system. Combined information from all systems allows to monitor and to equalize the calorimeter response at each stage of the signal evolution, from scintillation light to digitization. Calibration runs are monitored from a data quality perspective and u...
On-line Monitoring System for Power Transformers
Directory of Open Access Journals (Sweden)
Alexandru HOTEA
2016-12-01
Full Text Available Power transformers are the most important and expensive equipment from the electricity transmission system, so it is very important to know the real state of health of such equipment in every moment. De-energizing the power transformer accidentally due to internal defects can generate high costs. Annual maintenance proved to be ineffective in many cases to determine the internal condition of the equipment degradation due to faults rapidly evolving. An On-line Monitoring System for Power Transformers help real-time condition assessment and to detect errors early enough to take action to eliminate or minimize them. After abnormality detected, it is still important to perform full diagnostic tests to determine the exact condition of the equipment. On-line monitoring systems can help increase the level of availability and reliability of power transformers and lower costs of accidental interruption. This paper presents cases studies on several power transformers equipped with on-line monitoring systems from Transelectrica substation.
Microcomputer-based monitoring and control system
International Nuclear Information System (INIS)
Talaska, D.
1979-03-01
This report describes a microcomputer-based monitoring and control system devised within, and used by, the Cryogenic Operations group at SLAC. Presently, a version of it is operating at the one meter liquid hydrogen bubble chamber augmenting the conventional pneumatic and human feedback system. Its use has greatly improved the controlled tolerances of temperature and pulse shape, and it has nearly eliminated the need for operating personnel to adjust the conventional pneumatic control system. The latter is most important since the rapid cycling machine can demand attentions beyond the operator's skill. Similar microcomputer systems are being prepared to monitor and control cryogenic devices situated in regions of radiation which preclude human entry and at diverse locations which defy the dexterity of the few operators assigned to maintain them. An IMSAI 8080 microcomputer is basic to the system. The key to the use of the IMSAI 8080 in this system was in the development of unique interface circuitry, and the report is mostly concerned with this
Tracer verification and monitoring of containment systems (II)
International Nuclear Information System (INIS)
Williams, C.V.; Dunn, S.D.; Lowry, W.E.
1997-01-01
A tracer verification and monitoring system, SEAtrace trademark, has been designed and field tested which uses gas tracers to evaluate, verify, and monitor the integrity of subsurface barriers. This is accomplished using an automatic, rugged, autonomous monitoring system combined with an inverse optimization code. A gaseous tracer is injected inside the barrier and an array of wells outside the barrier are monitored. When the tracer gas is detected, a global optimization code is used to calculate the leak parameters, including leak size, location, and when the leak began. The multipoint monitoring system operates in real-time, can be used to measure both the tracer gas and soil vapor contaminants, and is capable of unattended operation for long periods of time (months). The global optimization code searches multi-dimensional open-quotes spaceclose quotes to find the best fit for all of the input parameters. These parameters include tracer gas concentration histories from multiple monitoring points, medium properties, barrier location, and the source concentration. SEAtrace trademark does not attempt to model all of the nuances associated with multi-phase, multi-component flow, but rather, the inverse code uses a simplistic forward model which can provide results which are reasonably accurate. The system has calculated leak locations to within 0.5 meters and leak radii to within 0.12 meters
System for monitoring microclimate conditions in greenhouse
Directory of Open Access Journals (Sweden)
Marković Dušan B.
2014-01-01
Full Text Available Monitoring microclimate parameters in different kind of environments has significant contribution to many areas of human activity and production processes. One of them is vegetable production in greenhouses where measurement of its microclimate parameters may influence the decision on taking appropriate action and protect crops. It is also important to preserve optimal condition in greenhouses to facilitate the process of transpiration, plant mineral nutrition and prevent of a variety physiological damage caused by a deficit of some specific nutrients. Systems for monitoring have wide application in the last years thanks to development of modern computer technology. In this paper model of the monitoring system based on smart transducer concept was introduced. Within the system components are based on MSP430 ultra low power micro controllers. They are using wireless communication to exchange data within the system that was structured according to smart transducer concept. User applications from the network could access to system interface using HTTP protocol where web server could be running on the computer or it could be an embedded web server running on micro controller based device.
Automated system for data acquisition and monitoring
Directory of Open Access Journals (Sweden)
Borza Sorin
2017-01-01
Full Text Available The Environmental management has become, with the development of human society a very important issue. There have been multiple systems that automatically monitors the environment. In this paper we propose a system that integrates GIS software and data acquisition software. In addition the proposed system implements new AHP multicriteria method that can get an answer online on each pollutant influence on limited geographical area in which the monitors. Factors pollutants of limited geographical areas are taken automatically by specific sensors through acquisition board. Labview software, with virtual instrument created by transferring them into a database Access. Access database they are taken up by software Geomedia Professional and processed using multi-criteria method AHP, so that at any moment, their influence on the environment and classify these influences, can be plotted on the screen monitoring system. The system allows, the automatic collection of data, the memorization and the generation of GIS elements. The research presented in this paper were aimed at implementing multi-criteria methods in GIS software.
Partial monitoring system Radioactivity of the Environment, 2006
International Nuclear Information System (INIS)
Melicherova, T.
2007-01-01
In this report the Partial monitoring system 'Radioactivity of the Environment' for the year 2006 is presented. International co-operation of the Slovak Hydrometeorological Institute in the Partial monitoring system 'Radioactivity of the Environment' of the Slovak Republic, international co-operation as well as financial data are reviewed
International Nuclear Information System (INIS)
Schneider, Sigfried L.; Glidewell, Donnie D.; Bonino, Anibal; Bosler, Gene; Mercer, David; Maxey, Curt; Vones, Jaromir; Martelle, Guy; Busse, James; Kadner, Steve; White, Mike; Rovere, Luis
1999-01-01
The Autoridad Regulatoria Nuclear of Argentina (ARN), the International Atomic Energy Agency (IAEA), ABACC, the US Department of Energy, and the US Support Program POTAS, cooperated in the development of a Remote Monitoring System for nuclear nonproliferation efforts. This system was installed at the Embalse Nuclear Power Station last year to evaluate the feasibility of using radiation sensors in monitoring the transfer of spent fuel from the spent fuel pond to dry storage. The key element in this process is to maintain continuity of knowledge throughout the entire transfer process. This project evaluated the fundamental design and implementation of the Remote Monitoring System in its application to regional and international safeguard efficiency. New technology has been developed to enhance the design of the system to include storage capability on board sensor platforms. This evaluation has led to design enhancements that will assure that no data loss will occur during loss of RF transmission of the sensors
Development of mobile air pollution monitoring system (LIDAR)
Energy Technology Data Exchange (ETDEWEB)
Cha, Hyung Ki; Song, Kyu Seok; Kim, Dukh Yeon; Yang, Ki Ho; Lee, Jong Min; Yoon, S.; Rostov, A
2001-01-01
Most air pollution monitoring technologies accompany a time-consuming sample treatment and provide pollution information only for a local area. Thus, they have a critical restriction in monitoring time-dependent pollution variation effectively over the wide range of area both in height and in width. LIDAR(Light Detection And Ranging) is a new technology to overcome such drawbacks of the existing pollution monitoring technologies and has long been investigated in the advanced countries. The coal of this project is to develop the mobile air pollution monitoring system and to apply the system to the detection of various pollutants, such as ozone, nitrogen dioxide, sulfur dioxide and aerosols.
Development of mobile air pollution monitoring system (LIDAR)
International Nuclear Information System (INIS)
Cha, Hyung Ki; Song, Kyu Seok; Kim, Dukh Yeon; Yang, Ki Ho; Lee, Jong Min; Yoon, S.; Rostov, A.
2001-01-01
Most air pollution monitoring technologies accompany a time-consuming sample treatment and provide pollution information only for a local area. Thus, they have a critical restriction in monitoring time-dependent pollution variation effectively over the wide range of area both in height and in width. LIDAR(Light Detection And Ranging) is a new technology to overcome such drawbacks of the existing pollution monitoring technologies and has long been investigated in the advanced countries. The coal of this project is to develop the mobile air pollution monitoring system and to apply the system to the detection of various pollutants, such as ozone, nitrogen dioxide, sulfur dioxide and aerosols
Modernization of WWER-1000 radiation monitoring systems
Energy Technology Data Exchange (ETDEWEB)
Smith, T [General Atomics, San Diego, CA (United States)
1996-12-31
A modernization scheme of the radiation monitoring system for WWER-1000 is proposed. It has a purpose to comply with international standards and to reduce operational and maintenance cost by deleting obsolete components and reducing the number of detector channels. Detailed layouts of I/C system architecture, digital radiation monitoring system (DRAMS) architecture and LRP block diagram are presented. If planned and implemented properly, this program can provide cost savings by reducing time required to access and display data and maintenance cost by deleting obsolete parts and decreasing the number of detector channels. 3 figs.
Modernization of WWER-1000 radiation monitoring systems
International Nuclear Information System (INIS)
Smith, T.
1995-01-01
A modernization scheme of the radiation monitoring system for WWER-1000 is proposed. It has a purpose to comply with international standards and to reduce operational and maintenance cost by deleting obsolete components and reducing the number of detector channels. Detailed layouts of I/C system architecture, digital radiation monitoring system (DRAMS) architecture and LRP block diagram are presented. If planned and implemented properly, this program can provide cost savings by reducing time required to access and display data and maintenance cost by deleting obsolete parts and decreasing the number of detector channels. 3 figs
Parkin, Christopher G; Schwenke, Stephanie; Ossege, Anna Katharina; Gruchmann, Torsten
2017-01-01
Manufacturers now incorporate blood glucose (bG) value interpretation tools into their monitoring systems; however, usability of these support tools has not been well studied. We evaluated the utility and perceived benefits of support tool use by individuals with type 1 (T1D) and type 2 diabetes (T2D). This 3-arm, randomized, simulation study assessed the impact of use of bG value interpretation support tools on participants' ability to correctly interpret bG values, using 1 of 3 tools: a new tool that uses colored scales with target range indicator (TRI), Colors and Smiley icons (already available). Participants assessed 50 bG values without use of any tool and repeated the assessment using 1 of the 3 tool configurations. Changes in percentage of correct responses when using a support tool and user perceptions were assessed. Data sets from 140 participants were analyzed. Increases in correct responses were seen in all study groups but most notably in the TRI group (26%, P .627). Most TRI users felt confident (94%), agreed the tool will help them identify high and low values (96%) and will help them to make correct insulin dosage decisions (80%). Use of the TRI significantly increases users' ability to correctly and confidently determine their glycemic risk when self-monitoring bG levels. This suggests the tool may offer clinical value to individuals with T1D and T2D.
Meteorological monitoring system of TÜBİTAK National Observatory
Koçak, M.; Selam, S. O.; Keskn, V.
2004-10-01
A custom meteorological monitoring system was constructed to reliably monitor the meteorological parameters of the site of TÜBİTAK National Observatory (TÜBİTAK: The Scientific and Technical Research Council of Turkey). The site is located on a mountain top known as Bakırlıtepe about 50 km west of the Antalya City at a height of 2547m. The system has software (C-based data acquisition/archiving structure and PHP based WEB monitoring support) and micro-controller based control electronics, fiber based custom designed encoder sensors (for wind speed and direction) and transmission lines using fiberoptic to RS232 transcievers. The constructed system can be used in any robotic telescope project for data monitoring and alert system creation.
Helmet-based physiological signal monitoring system.
Kim, Youn Sung; Baek, Hyun Jae; Kim, Jung Soo; Lee, Haet Bit; Choi, Jong Min; Park, Kwang Suk
2009-02-01
A helmet-based system that was able to monitor the drowsiness of a soldier was developed. The helmet system monitored the electrocardiogram, electrooculogram and electroencephalogram (alpha waves) without constraints. Six dry electrodes were mounted at five locations on the helmet: both temporal sides, forehead region and upper and lower jaw strips. The electrodes were connected to an amplifier that transferred signals to a laptop computer via Bluetooth wireless communication. The system was validated by comparing the signal quality with conventional recording methods. Data were acquired from three healthy male volunteers for 12 min twice a day whilst they were sitting in a chair wearing the sensor-installed helmet. Experimental results showed that physiological signals for the helmet user were measured with acceptable quality without any intrusions on physical activities. The helmet system discriminated between the alert and drowsiness states by detecting blinking and heart rate variability (HRV) parameters extracted from ECG. Blinking duration and eye reopening time were increased during the sleepiness state compared to the alert state. Also, positive peak values of the sleepiness state were much higher, and the negative peaks were much lower than that of the alert state. The LF/HF ratio also decreased during drowsiness. This study shows the feasibility for using this helmet system: the subjects' health status and mental states could be monitored without constraints whilst they were working.
Hydrological Monitoring System Design and Implementation Based on IOT
Han, Kun; Zhang, Dacheng; Bo, Jingyi; Zhang, Zhiguang
In this article, an embedded system development platform based on GSM communication is proposed. Through its application in hydrology monitoring management, the author makes discussion about communication reliability and lightning protection, suggests detail solutions, and also analyzes design and realization of upper computer software. Finally, communication program is given. Hydrology monitoring system from wireless communication network is a typical practical application of embedded system, which has realized intelligence, modernization, high-efficiency and networking of hydrology monitoring management.
An interactive beam position monitor system simulator
International Nuclear Information System (INIS)
Ryan, W.A.; Shea, T.J.
1993-03-01
A system simulator has been implemented to aid the development of the RHIC position monitor system. Based on the LabVIEW software package by National Instruments, this simulator allows engineers and technicians to interactively explore the parameter space of a system during the design phase. Adjustable parameters are divided into three categories: beam, pickup, and electronics. The simulator uses these parameters in simple formulas to produce results in both time-domain and frequencydomain. During the prototyping phase, these simulated results can be compared to test data acquired with the same software package. The RHIC position monitor system is presented as an example, but the software is applicable to several other systems as well
Monitoring osseointegration and developing intelligent systems (Conference Presentation)
Salvino, Liming W.
2017-05-01
Effective monitoring of structural and biological systems is an extremely important research area that enables technology development for future intelligent devices, platforms, and systems. This presentation provides an overview of research efforts funded by the Office of Naval Research (ONR) to establish structural health monitoring (SHM) methodologies in the human domain. Basic science efforts are needed to utilize SHM sensing, data analysis, modeling, and algorithms to obtain the relevant physiological and biological information for human-specific health and performance conditions. This overview of current research efforts is based on the Monitoring Osseointegrated Prosthesis (MOIP) program. MOIP develops implantable and intelligent prosthetics that are directly anchored to the bone of residual limbs. Through real-time monitoring, sensing, and responding to osseointegration of bones and implants as well as interface conditions and environment, our research program aims to obtain individualized actionable information for implant failure identification, load estimation, infection mitigation and treatment, as well as healing assessment. Looking ahead to achieve ultimate goals of SHM, we seek to expand our research areas to cover monitoring human, biological and engineered systems, as well as human-machine interfaces. Examples of such include 1) brainwave monitoring and neurological control, 2) detecting and evaluating brain injuries, 3) monitoring and maximizing human-technological object teaming, and 4) closed-loop setups in which actions can be triggered automatically based on sensors, actuators, and data signatures. Finally, some ongoing and future collaborations across different disciplines for the development of knowledge automation and intelligent systems will be discussed.
Safeguards equipment of the future integrated monitoring systems and remote monitoring
International Nuclear Information System (INIS)
Sonnier, C.S.; Johnson, C.S.
1994-01-01
Becoming aware of the significant events of the past four years and their effect on the expectations to international safeguards, it is necessary to reflect on which direction the development of nuclear safeguards in a new era needs to take and the implications. The lime proven monitoring techniques, based on quantitative factor's and demonstrated universal application, have shown their merit. However, the new expectations suggest a possibility that a future IAEA safeguards system could rely more heavily on the value of a comprehensive, transparent and open implementation regime. Within such a regime, the associated measures need to be determined and technological support identified. This paper will identify the proven techniques which, with appropriate implementation support, could most quickly make available additional measures for a comprehensive, transparent and open implementation regime. In particular, it will examine the future of Integrated Monitoring Systems and Remote Monitoring in international safeguards, including technical and other related factors
Smart Sensor Network System For Environment Monitoring
Directory of Open Access Journals (Sweden)
Javed Ali Baloch
2012-07-01
Full Text Available SSN (Smart Sensor Network systems could be used to monitor buildings with modern infrastructure, plant sites with chemical pollution, horticulture, natural habitat, wastewater management and modern transport system. To sense attributes of phenomena and make decisions on the basis of the sensed value is the primary goal of such systems. In this paper a Smart Spatially aware sensor system is presented. A smart system, which could continuously monitor the network to observe the functionality and trigger, alerts to the base station if a change in the system occurs and provide feedback periodically, on demand or even continuously depending on the nature of the application. The results of the simulation trials presented in this paper exhibit the performance of a Smart Spatially Aware Sensor Networks.
Monitoring SLAC High Performance UNIX Computing Systems
International Nuclear Information System (INIS)
Lettsome, Annette K.
2005-01-01
Knowledge of the effectiveness and efficiency of computers is important when working with high performance systems. The monitoring of such systems is advantageous in order to foresee possible misfortunes or system failures. Ganglia is a software system designed for high performance computing systems to retrieve specific monitoring information. An alternative storage facility for Ganglia's collected data is needed since its default storage system, the round-robin database (RRD), struggles with data integrity. The creation of a script-driven MySQL database solves this dilemma. This paper describes the process took in the creation and implementation of the MySQL database for use by Ganglia. Comparisons between data storage by both databases are made using gnuplot and Ganglia's real-time graphical user interface
Effective HTCondor-based monitoring system for CMS
Balcas, J.; Bockelman, B. P.; Da Silva, J. M.; Hernandez, J.; Khan, F. A.; Letts, J.; Mascheroni, M.; Mason, D. A.; Perez-Calero Yzquierdo, A.; Vlimant, J.-R.; pre="for the"> CMS Consortium, 2017-10-01 The CMS experiment at the LHC relies on HTCondor and glideinWMS as its primary batch and pilot-based Grid provisioning systems, respectively. Given the scale of the global queue in CMS, the operators found it increasingly difficult to monitor the pool to find problems and fix them. The operators had to rely on several different web pages, with several different levels of information, and sift tirelessly through log files in order to monitor the pool completely. Therefore, coming up with a suitable monitoring system was one of the crucial items before the beginning of the LHC Run 2 in order to ensure early detection of issues and to give a good overview of the whole pool. Our new monitoring page utilizes the HTCondor ClassAd information to provide a complete picture of the whole submission infrastructure in CMS. The monitoring page includes useful information from HTCondor schedulers, central managers, the glideinWMS frontend, and factories. It also incorporates information about users and tasks making it easy for operators to provide support and debug issues.
Preliminary evaluation of DOE-NEPA monitoring system
International Nuclear Information System (INIS)
1981-01-01
The objective of this analysis was to perform a preliminary investigation of the problems involved in designing a Department of Energy-National Environmental Policy Act (DOE-NEPA) compliance monitoring system. The requirement for such a system arose from the Council on Environmental Quality (CEQ-NEPA regulation effective July 30, 1979. The CEQ regulation uses the term monitoring to denote any method by which the lead agency can assure implementation of Environmental Impact Statement (EIS) and Record of Decision (ROD) environmental mitigation commitments. Monitoring is required for mitigation measures in important cases and may be carried out at agency discretion for all other cases. No definition of important is given in the regulation. The NEPA intent is that all environmental information and planning be incorporated into the decision process as early as possible. In keeping with this concept, any monitoring or enforcement program for a mitigation measure is expected to be adopted and briefly and concisely described in the ROD. Information is presented in four chapters entitled: federal and state compliance monitoring surveys; EIS information analysis; enforcement mechanisms; and administrative practice
Communications interface for plant monitoring system
International Nuclear Information System (INIS)
Lee, K.L.; Morgan, F.A.
1988-01-01
This paper presents the communications interface for an intelligent color graphic system which PSE and G developed as part of a plant monitoring system. The intelligent graphic system is designed to off-load traditional host functions such as dynamic graphic updates, keyboard handling and alarm display. The distributed system's data and synchronization problems and their solutions are discussed
New system of the in core monitoring - PTK SVRK
International Nuclear Information System (INIS)
Urban, P.
2000-01-01
In this paper author describes new system (PTK SVRK) for in-core monitoring system of the Mochovce nuclear power plant installed instead of the HINDUKUSH in-core monitoring system, which are determined to monitor the core parameters. This system (HINDUKUSH), supplied by the Russian party in scope of the original design, became old during the idle time, and the components, which is it built from, are not produced any more. Thus, its utilisation had to undergo a technical end economic analysis. It resulted in classification to the work complex of the technical specification of safety measures. Its implementation conditioned the commissioning of the power plant nuclear unit. The program and technical system of the in-core monitoring (PTK SVRK) consists of two levels - a 'closed' basic, which fulfils the task of the primal system operation for the Unit operators, and an 'open' top level, which serves as a tool for the additional tasks of a prognosis, monitoring, and analysis of the processes taking place in the nuclear core by the monitoring physicists. The basic level of PTK SVRK has 100% redundancy because of its composition and configuration. It is namely formed by two identical, equivalent, and independent sets. Any of them may be operational or redundant. Every set consists of an apparatus processing the signals coming from the technology or the calculation complex, which converts these signals to physical parameters and controls the physically mathematical model of the monitored equipment. The results are presented to the operational staff as outputs on the workstations in the control room in a form of cartograms, graphs, histograms, tables, etc. The bases of the system calculation model are time-proven programs BIPR7 and PERMAK, which are used also in this power plant. The top level of PTK SVRK has a structure supporting the system openness for its further utilisation. Today it is formed by a server and two workstations. Besides the above-mentioned tasks, the
Honey Bee Colonies Remote Monitoring System
Directory of Open Access Journals (Sweden)
Sergio Gil-Lebrero
2016-12-01
Full Text Available Bees are very important for terrestrial ecosystems and, above all, for the subsistence of many crops, due to their ability to pollinate flowers. Currently, the honey bee populations are decreasing due to colony collapse disorder (CCD. The reasons for CCD are not fully known, and as a result, it is essential to obtain all possible information on the environmental conditions surrounding the beehives. On the other hand, it is important to carry out such information gathering as non-intrusively as possible to avoid modifying the bees’ work conditions and to obtain more reliable data. We designed a wireless-sensor networks meet these requirements. We designed a remote monitoring system (called WBee based on a hierarchical three-level model formed by the wireless node, a local data server, and a cloud data server. WBee is a low-cost, fully scalable, easily deployable system with regard to the number and types of sensors and the number of hives and their geographical distribution. WBee saves the data in each of the levels if there are failures in communication. In addition, the nodes include a backup battery, which allows for further data acquisition and storage in the event of a power outage. Unlike other systems that monitor a single point of a hive, the system we present monitors and stores the temperature and relative humidity of the beehive in three different spots. Additionally, the hive is continuously weighed on a weighing scale. Real-time weight measurement is an innovation in wireless beehive—monitoring systems. We designed an adaptation board to facilitate the connection of the sensors to the node. Through the Internet, researchers and beekeepers can access the cloud data server to find out the condition of their hives in real time.
Design of hand held RID's monitoring system based on embedded system
International Nuclear Information System (INIS)
Wang Hongwei; Wei Yixiang
2008-01-01
In this paper we introduce the design of monitoring system for the hand held radionuclide identification device (RID), constructed under the embedded operating system of WinCE. At first, we introduce the design of hardware and software platform, and following is the major part of technical view of the software system, including the driver development, P/Invoke mechanism to call the C/C++ subroutines, multi-thread technology. In the experimental hardware platform, we have developed a front-end monitoring system for portable device targeted nuclide identification and orientation. It's a full-featured and flexible system, with the functions of data acquisition, radioactivity locating, data import and export, etc. (authors)
Towards a Global Monitoring System for CMS Computing Operations
Energy Technology Data Exchange (ETDEWEB)
Bauerdick, L. A.T. [Fermilab; Sciaba, Andrea [CERN
2012-01-01
The operation of the CMS computing system requires a complex monitoring system to cover all its aspects: central services, databases, the distributed computing infrastructure, production and analysis workflows, the global overview of the CMS computing activities and the related historical information. Several tools are available to provide this information, developed both inside and outside of the collaboration and often used in common with other experiments. Despite the fact that the current monitoring allowed CMS to successfully perform its computing operations, an evolution of the system is clearly required, to adapt to the recent changes in the data and workload management tools and models and to address some shortcomings that make its usage less than optimal. Therefore, a recent and ongoing coordinated effort was started in CMS, aiming at improving the entire monitoring system by identifying its weaknesses and the new requirements from the stakeholders, rationalise and streamline existing components and drive future software development. This contribution gives a complete overview of the CMS monitoring system and a description of all the recent activities that have been started with the goal of providing a more integrated, modern and functional global monitoring system for computing operations.
Design of position monitor module in radioactive material transport monitoring system
International Nuclear Information System (INIS)
Adi Abimanyu; Dwi Yuliansari N
2013-01-01
Aspects of safety and security of radioactive substances from the sender to the receiver is to be secured so as not to harm humans. In general, monitoring is done through conversation by telephone to determine the location and rate of exposure of radioactive substances. Through the development of science and technology makes it possible to develop a system of monitoring the transport of radioactive substances in real time by combining radiation monitor module, position monitors module and sending information nir-cable. Position monitor module developed using GPS-receiver and a micro controller ATMega8 based serial interrupts communication. Testing is done by testing communication between micro controller and GPS and also testing reading position by GPS receiver. From the test results concluded that the developed modules is good in serial communication is based on serial interrupts, good position measurement to be used outdoors and is not good enough for measurements indoors because the GPS receiver used is not using an outdoor antenna. (author)
Advanced Pulse Oximetry System for Remote Monitoring and Management
Pak, Ju Geon; Park, Kee Hyun
2012-01-01
Pulse oximetry data such as saturation of peripheral oxygen (SpO2) and pulse rate are vital signals for early diagnosis of heart disease. Therefore, various pulse oximeters have been developed continuously. However, some of the existing pulse oximeters are not equipped with communication capabilities, and consequently, the continuous monitoring of patient health is restricted. Moreover, even though certain oximeters have been built as network models, they focus on exchanging only pulse oximetry data, and they do not provide sufficient device management functions. In this paper, we propose an advanced pulse oximetry system for remote monitoring and management. The system consists of a networked pulse oximeter and a personal monitoring server. The proposed pulse oximeter measures a patient's pulse oximetry data and transmits the data to the personal monitoring server. The personal monitoring server then analyzes the received data and displays the results to the patient. Furthermore, for device management purposes, operational errors that occur in the pulse oximeter are reported to the personal monitoring server, and the system configurations of the pulse oximeter, such as thresholds and measurement targets, are modified by the server. We verify that the proposed pulse oximetry system operates efficiently and that it is appropriate for monitoring and managing a pulse oximeter in real time. PMID:22933841
A Bridge Deflection Monitoring System Based on CCD
Directory of Open Access Journals (Sweden)
Baohua Shan
2016-01-01
Full Text Available For long-term monitoring of the midspan deflection of Songjiazhuang cloverleaf junction on 309 national roads in Zibo city, this paper proposes Zhang’s calibration-based DIC deflection monitoring method. CCD cameras are used to track the change of targets’ position, Zhang’s calibration algorithm is introduced to acquire the intrinsic and extrinsic parameters of CCD cameras, and the DIC method is combined with Zhang’s calibration algorithm to measure bridge deflection. The comparative test between Zhang’s calibration and scale calibration is conducted in lab, and experimental results indicate that the proposed method has higher precision. According to the deflection monitoring scheme, the deflection monitoring software for Songjiazhuang cloverleaf junction is developed by MATLAB, and a 4-channel CCD deflection monitoring system for Songjiazhuang cloverleaf junction is integrated in this paper. This deflection monitoring system includes functions such as image preview, simultaneous collection, camera calibration, deflection display, and data storage. In situ deflection curves show a consistent trend; this suggests that the proposed method is reliable and is suitable for the long-term monitoring of bridge deflection.
Reactivity Monitoring of Accelerator-Driven Nuclear Reactor Systems
Uyttenhove, W.
2016-01-01
This thesis provides a methodology and set-up of a reactivity monitoring tool for Accelerator-Driven Systems (ADS). The reactivity monitoring tool should guarantee the operation of an ADS at a safe margin from criticality. Robustness is assured in different aspects of the monitoring tool: the choice
Garment design for an ambulatory pregnancy monitoring system
Perusquia Hernandez, Monica; Chen, W.; Feijs, L.M.G.; Pecchia, L.; Chen, L.L.; Nugent, C.; Bravo, J.
2014-01-01
Constant pregnancy monitoring is a promising alternative to reduce the number of stillbirths and preterm delivery due to false alarms. Tele-monitoring systems can provide regular, accurate and timely monitoring to re-duce risks, costs and the time the mothers-to-be spend at hospitals. A smart
The evolution of industrial power monitoring and control systems
Energy Technology Data Exchange (ETDEWEB)
Nicholson, K. E.
1998-04-01
The evolution of power monitoring and control systems in industrial situations are described. Computer-based PMC (power monitoring and control) systems are discussed in two sections. Section 1 covers the PC/DOS based systems in use up to the 1990s. These systems had multitasking capability, sufficient for scanning a serial line running a multi-drop protocol to field instruments, which in turn were running either proprietary or PLC subsets, maintaining a level of operator display, data logging and query support. Since the mid-1990s the second generation of industrial power monitoring and control systems based on the PC/NT system came into use, driven to market by three factors: (1) availability of low cost PCs, (2) widespread availability of computer networking technologies, and (3) the appearance of the robust, industrially viable NT operating system. Second generation systems are characterized by division into two tiers; a monitoring system focused on remote metering, and a second tier of a modular system capable of fully implementing both power monitoring and supervisory control. Looking toward the future, the requirements for systems is expected to become more unique, driven by the need for information for energy procurement decision making, automatic control for integrating power acquisition from multiple suppliers, power capacity and integrated power and production control planning needs, and power quality and reliability issues. A review of the functionality of PMC systems, and system architectures was also provided. Results of a survey of PMC systems applications were also discussed. 2 refs., 4 tabs., 8 figs.
International Nuclear Information System (INIS)
Koenig, L.A.; Winter, M.; Schmitt, A.
1980-10-01
The two on-line monitoring systems used in KfK environmental monitoring should be taken as measures of accident precaution and they are restricted to measurement of gamma local dose rates and of the (β + γ)-radiation levels. One of the systems serves to monitor the KfK operational area, the second serves to monitor the surrounding communities up to a radius of 8 km. By use of two different types of detectors the first system covers a range of measurement of 10 μrem/h to 1000 rem/h. By the second system only increases in the radiation level can be detected. It allows to record accidents in which countermeasures must be taken very urgently. The two monitoring systems are described which have been operated and partly been developed at the KfK. The possibilities and limits of using them for environmental monitoring are discussed. (orig./HP) [de
Real-time health monitoring of civil infrastructure systems in Colombia
Thomson, Peter; Marulanda Casas, Johannio; Marulanda Arbelaez, Johannio; Caicedo, Juan
2001-08-01
Colombia's topography, climatic conditions, intense seismic activity and acute social problems place high demands on the nations deteriorating civil infrastructure. Resources that are available for maintenance of the road and railway networks are often misdirected and actual inspection methods are limited to a visual examination. New techniques for inspection and evaluation of safety and serviceability of civil infrastructure, especially bridges, must be developed. Two cases of civil structures with health monitoring systems in Colombia are presented in this paper. Construction of the Pereria-Dos Quebradas Viaduct was completed in 1997 with a total cost of 58 million dollars, including 1.5 million dollars in health monitoring instrumentation provided and installed by foreign companies. This health monitoring system is not yet fully operational due to the lack of training of national personnel in system operation and extremely limited technical documentation. In contrast to the Pereria-Dos Quebradas Viaduct monitoring system, the authors have proposed a relatively low cost health monitoring system via telemetry. This system has been implemented for real-time monitoring of accelerations of El Hormiguero Bridge spanning the Cauca River using the Colombian Southwest Earthquake Observatory telemetry systems. This two span metallic bridge, located along a critical road between the cities of Puerto Tejada and Cali in the Cauca Valley, was constructed approximately 50 years ago. Experiences with this system demonstrate how effective low cost systems can be used to remotely monitor the structural integrity of deteriorating structures that are continuously subject to high loading conditions.
Energy Monitoring System Berbasis Web
Directory of Open Access Journals (Sweden)
Novan Zulkarnain
2013-12-01
Full Text Available Government through the Ministry of Energy and Mineral Resources (ESDM encourages the energy savings at whole buildings in Indonesia. Energy Monitoring System (EMS is a web-based solution to monitor energy usage in a building. The research methods used are the analysis, prototype design and testing. EMSconsists of hardware which consists of electrical sensors, temperature-humidity sensor, and a computer. Data on EMS are designed using Modbus protocol, stored in MySQL database application, and displayed on charts through Dashboard on LED TV using PHP programming.
Making intelligent systems team players. A guide to developing intelligent monitoring systems
Land, Sherry A.; Malin, Jane T.; Thronesberry, Carroll; Schreckenghost, Debra L.
1995-01-01
This reference guide for developers of intelligent monitoring systems is based on lessons learned by developers of the DEcision Support SYstem (DESSY), an expert system that monitors Space Shuttle telemetry data in real time. DESSY makes inferences about commands, state transitions, and simple failures. It performs failure detection rather than in-depth failure diagnostics. A listing of rules from DESSY and cue cards from DESSY subsystems are included to give the development community a better understanding of the selected model system. The G-2 programming tool used in developing DESSY provides an object-oriented, rule-based environment, but many of the principles in use here can be applied to any type of monitoring intelligent system. The step-by-step instructions and examples given for each stage of development are in G-2, but can be used with other development tools. This guide first defines the authors' concept of real-time monitoring systems, then tells prospective developers how to determine system requirements, how to build the system through a combined design/development process, and how to solve problems involved in working with real-time data. It explains the relationships among operational prototyping, software evolution, and the user interface. It also explains methods of testing, verification, and validation. It includes suggestions for preparing reference documentation and training users.
Design of Kartini reactor radiation monitor system using lab view
International Nuclear Information System (INIS)
Adi Abimanyu; Jumari; Achmad Fahrul Aji; Muhammad Khoiri
2014-01-01
Kartini Reactor operation will result in radiation exposure. Gamma radiation exposure rate at the Kartini Reactor monitored by several radiation monitors (Ludlum) that integrate with the computer, so that the rate of radiation exposure is always monitored. Current monitoring system combines six radiation monitor in one computer monitor radiation, and monitoring performed by operators and supervisors to see how the radiation exposure rate measured in the area around the reactor core in a periodic time manually. This research will develop a system to monitor radiation exposure in Kartini reactor based ATMega8 micro controller for interface between radiation monitor and computer and also Graphical User Interface (GUI) develop using Lab view software that makes monitoring is easier and documented regularly. This system is testing by simulation, it is done by replacing the function of the radiation monitoring devices (Ludlum) in Kartini Reactor with computers that send serial data with the same format with a format that is sent by Ludlum. The results show that the interface system has the ability to operate in a range of baud rate 1,200 bps, 2,400 bps, 4,800 bps, 9,600 bps, 14,400 bps, 19,200 bps and 38,400 bps, with the ability to provide realtime information every 6 seconds and able to document the rate of exposure to radiation in the form of logbook. (author)
Benchmarking Glucose Results through Automation: The 2009 Remote Automated Laboratory System Report
Anderson, Marcy; Zito, Denise; Kongable, Gail
2010-01-01
Background Hyperglycemia in the adult inpatient population remains a topic of intense study in U.S. hospitals. Most hospitals have established glycemic control programs but are unable to determine their impact. The 2009 Remote Automated Laboratory System (RALS) Report provides trends in glycemic control over 4 years to 576 U.S. hospitals to support their effort to manage inpatient hyperglycemia. Methods A proprietary software application feeds de-identified patient point-of-care blood glucose (POC-BG) data from the Medical Automation Systems RALS-Plus data management system to a central server. Analyses include the number of tests and the mean and median BG results for intensive care unit (ICU), non-ICU, and each hospital compared to the aggregate of the other hospitals. Results More than 175 million BG results were extracted from 2006–2009; 25% were from the ICU. Mean range of BG results for all inpatients in 2006, 2007, 2008, and 2009 was 142.2–201.9, 145.6–201.2, 140.6–205.7, and 140.7–202.4 mg/dl, respectively. The range for ICU patients was 128–226.5, 119.5–219.8, 121.6–226.0, and 121.1–217 mg/dl, respectively. The range for non-ICU patients was 143.4–195.5, 148.6–199.8, 145.2–201.9, and 140.7–203.6 mg/dl, respectively. Hyperglycemia rates of >180 mg/dl in 2008 and 2009 were examined, and hypoglycemia rates of Automated POC-BG data management software can assist in this effort. PMID:21129348
Monitoring system of the Tritium Research Laboratory, Sandia Laboratories, Livermore, CA
International Nuclear Information System (INIS)
Wall, W.R.; Hafner, R.S.; Westfall, D.L.; Ristau, R.D.
1978-11-01
Automated tritium monitoring is now in use at the Tritium Research Laboratory (TRL). Betatec 100 tritium monitors, along with several Sandia-designed accessories, have been combined with a PDP 11/40 computer to automatically read and record tritium concentrations of room air, containment, and cleanup systems. Each individual monitoring system, in addition to a local display in the area of interest, has a visible/audible display in the control room. Each system is then channeled into the PDP 11/40 computer, providing immediate assessment of the status of the entire laboratory from a central location. Measurement capability ranges from μCi/m 3 levels for room air monitoring to kCi/m 3 levels for glove box and cleanup systems monitoring. In this report the overall monitoring system and its capabilities are discussed, with detailed descriptions given of monitors and their components
Andriushin, A. V.; Dolbikova, N. S.; Kiet, S. V.; Merzlikina, E. I.; Nikitina, I. S.
2017-11-01
The reliability of the main equipment of any power station depends on the correct water chemistry. In order to provide it, it is necessary to monitor the heat carrier quality, which, in its turn, is provided by the chemical monitoring system. Thus, the monitoring system reliability plays an important part in providing reliability of the main equipment. The monitoring system reliability is determined by the reliability and structure of its hardware and software consisting of sensors, controllers, HMI and so on [1,2]. Workers of a power plant dealing with the measuring equipment must be informed promptly about any breakdowns in the monitoring system, in this case they are able to remove the fault quickly. A computer consultant system for personnel maintaining the sensors and other chemical monitoring equipment can help to notice faults quickly and identify their possible causes. Some technical solutions for such a system are considered in the present paper. The experimental results were obtained on the laboratory and experimental workbench representing a physical model of a part of the chemical monitoring system.
Directory of Open Access Journals (Sweden)
Guang Ya LIU
2014-02-01
Full Text Available Partial discharge inside a transformer is mainly responsible for the insulation aging and damage of the transformer. However, partial discharge is usually accompanied by external signals like sound, light and electrical signals and detectable physical phenomena such as characteristical gas and dielectric loss. Therefore, it is of great significance to monitor online the external signals and phenomena formed during partial discharge of the transformer when the transformer diagnoses faults. This paper gives a comprehensive overview of the electro-acoustic joint monitoring principles and its monitoring systems and the judgment skills concerned, on the basis of which the monitoring system is designed.
Smart Bin: Internet-of-Things Garbage Monitoring System
Directory of Open Access Journals (Sweden)
Mustafa M.R
2017-01-01
Full Text Available This work introduces the design and development of smart green environment of garbage monitoring system by measuring the garbage level in real time and to alert the municipality where never the bin is full based on the types of garbage. The proposed system consisted the ultrasonic sensors which measure the garbage level, an ARM microcontroller which controls system operation whereas everything will be connected to ThingSpeak. This work demonstrates a system that allows the waste management to monitor based on the level of the garbage depth inside the dustbin. The system shows the status of different four types of garbage; domestic waste, paper, glass and plastic through LCD and ThingSpeak in a real time to store the data for future use and analysis, such as prediction of peak level of garbage bin fullness. It is expected that this system can create greener environment by monitoring and controlling the collection of garbage smartly through Internet-of-Things.
[Microinjection Monitoring System Design Applied to MRI Scanning].
Xu, Yongfeng
2017-09-30
A microinjection monitoring system applied to the MRI scanning was introduced. The micro camera probe was used to stretch into the main magnet for real-time video injection monitoring of injection tube terminal. The programming based on LabVIEW was created to analysis and process the real-time video information. The feedback signal was used for intelligent controlling of the modified injection pump. The real-time monitoring system can make the best use of injection under the condition that the injection device was away from the sample which inside the magnetic room and unvisible. 9.4 T MRI scanning experiment showed that the system in ultra-high field can work stability and doesn't affect the MRI scans.
Design of BEPCII bunch current monitor system
International Nuclear Information System (INIS)
Zhang Lei; Ma Huizhou; Yue Junhui; Lei Ge; Cao Jianshe; Ma Li
2008-01-01
BEPC II is an electron-positron collider designed to run under multi-bunches and high beam current condition. The accelerator consists of an electron ring, a positron ring and a linear injector. In order to achieve the target luminosity and implement the equal bunch charge injection, the Bunch Current Monitor (BCM) system is built on BEPC II. The BCM system consists of three parts: the front-end circuit, the bunch current acquisition system and the bucket selection system. The control software of BCM is based on VxWorks and EPICS. With the help of BCM system, the bunch current in each bucket can be monitored in the Central Control Room. The BEPC II timing system can also use the bunch current database to decide which bucket needs to refill to implement 'top-off' injection. (authors)
Uzbekistan Radiation Portal Monitoring System
International Nuclear Information System (INIS)
Richardson, J; Knapp, R; Loshak, A; Yuldashev, B; Petrenko, V
2005-01-01
The work proposed in this presentation builds on the foundation set by the DTRA funded demonstration project begun in 2000 and completed in December of 2003. This previous work consisted of two phases whose overall objective was to install portal radiation monitors at four select ports-of-entry in Uzbekistan (Tashkent International Airport, Gisht-Kuprik (Kazakhstan border), Alat (Turkmenistan border), and Termez (Afghanistan border)) in order to demonstrate their effectiveness in preventing the illicit trafficking of nuclear materials. The objectives also included developing and demonstrating capabilities in the design, installation, operation, training, and maintenance of a radiation portal monitoring system. The system and demonstration project has proved successful in many ways. An effective working relationship among the Uzbekistan Customs Services, Uzbekistan Border Guards, and Uzbekistan Institute of Nuclear Physics has been developed. There has been unprecedented openness with the sharing of portal monitor data with Lawrence Livermore National Laboratory. The system has proved to be effective, with detection of illicit trafficking, and, at Alat, an arrest of three persons illegally transporting radioactive materials into Turkmenistan. The demonstration project has made Uzbekistan a model nonproliferation state in Central Asia and, with an expanded program, places them in a position to seal a likely transit route for illicit nuclear materials. These results will be described. In addition, this work is currently being expanded to include additional ports-of-entry in Uzbekistan. The process for deciding on which additional ports-of-entry to equip will also be described
Sinabro: A Smartphone-Integrated Opportunistic Electrocardiogram Monitoring System.
Kwon, Sungjun; Lee, Dongseok; Kim, Jeehoon; Lee, Youngki; Kang, Seungwoo; Seo, Sangwon; Park, Kwangsuk
2016-03-11
In our preliminary study, we proposed a smartphone-integrated, unobtrusive electrocardiogram (ECG) monitoring system, Sinabro, which monitors a user's ECG opportunistically during daily smartphone use without explicit user intervention. The proposed system also monitors ECG-derived features, such as heart rate (HR) and heart rate variability (HRV), to support the pervasive healthcare apps for smartphones based on the user's high-level contexts, such as stress and affective state levels. In this study, we have extended the Sinabro system by: (1) upgrading the sensor device; (2) improving the feature extraction process; and (3) evaluating extensions of the system. We evaluated these extensions with a good set of algorithm parameters that were suggested based on empirical analyses. The results showed that the system could capture ECG reliably and extract highly accurate ECG-derived features with a reasonable rate of data drop during the user's daily smartphone use.
Sinabro: A Smartphone-Integrated Opportunistic Electrocardiogram Monitoring System
Directory of Open Access Journals (Sweden)
Sungjun Kwon
2016-03-01
Full Text Available In our preliminary study, we proposed a smartphone-integrated, unobtrusive electrocardiogram (ECG monitoring system, Sinabro, which monitors a user’s ECG opportunistically during daily smartphone use without explicit user intervention. The proposed system also monitors ECG-derived features, such as heart rate (HR and heart rate variability (HRV, to support the pervasive healthcare apps for smartphones based on the user’s high-level contexts, such as stress and affective state levels. In this study, we have extended the Sinabro system by: (1 upgrading the sensor device; (2 improving the feature extraction process; and (3 evaluating extensions of the system. We evaluated these extensions with a good set of algorithm parameters that were suggested based on empirical analyses. The results showed that the system could capture ECG reliably and extract highly accurate ECG-derived features with a reasonable rate of data drop during the user’s daily smartphone use.
Glycemic Variation in Tumor Patients with Total Parenteral Nutrition
Directory of Open Access Journals (Sweden)
Jin-Cheng Yang
2015-01-01
Full Text Available Background: Hyperglycemia is associated with poor clinical outcomes and mortality in several patients. However, studies evaluating hyperglycemia variation in tumor patients receiving total parenteral nutrition (TPN are scarce. The aim of this study was to assess the relationship between glycemia and tumor kinds with TPN by monitoring glycemic variation in tumor patients. Methods: This retrospective clinical trial selected 312 patients with various cancer types, whose unique nutrition treatment was TPN during the monitoring period. All patients had blood glucose (BG values assessed at least six times daily during the TPN infusion. The glycemic variation before and after TPN was set as the indicator to evaluate the factors influencing BG. Results: The clinical trial lasted 7.5 ± 3.0 days adjusted for age, gender, family cancer history and blood types. There were six cancer types: Hepatic carcinoma (HC, 21.8%, rectal carcinoma (17.3%, colon carcinoma (CC, 14.7%, gastric carcinoma (29.8%, pancreatic carcinoma (11.5%, and duodenal carcinoma (DC, 4.8%. The patients were divided into diabetes and nondiabetes groups. No statistical differences in TPN glucose content between diabetes and nondiabetes groups were found; however, the tumor types affected by BG values were obvious. With increasing BG values, DC, HC and CC were more represented than other tumor types in this sequence in diabetic individuals, as well as in the nondiabetic group. BG was inclined to be more easily influenced in the nondiabetes group. Other factors did not impact BG values, including gender, body mass index, and TPN infusion duration time. Conclusions: When tumor patients are treated with TPN, BG levels should be monitored according to different types of tumors, besides differentiating diabetes or nondiabetes patients. Special BG control is needed for DC, HC and CC in both diabetic and nondiabetic patients. If BG overtly increases, positive measurements are needed to control BG
40 CFR 65.161 - Continuous records and monitoring system data handling.
2010-07-01
... section. (D) Owners and operators shall retain the current description of the monitoring system as long as... Routing to a Fuel Gas System or a Process § 65.161 Continuous records and monitoring system data handling...) Monitoring system breakdowns, repairs, preventive maintenance, calibration checks, and zero (low-level) and...
Automated Intelligent Monitoring and the Controlling Software System for Solar Panels
Nalamvar, Hitesh Sanzhay; Ivanov, Maksim Anatoljevich; Baydali, Sergey Anatolievich
2017-01-01
The inspection of the solar panels on a periodic basis is important to improve longevity and ensure performance of the solar system. To get the most solar potential of the photovoltaic (PV) system is possible through an intelligent monitoring & controlling system. The monitoring & controlling system has rapidly increased its popularity because of its user-friendly graphical interface for data acquisition, monitoring, controlling and measurements. In order to monitor the performance of the sys...
Batch management based monitoring system: design, implement, and visualization
International Nuclear Information System (INIS)
Kan Bowen; Shi Jingyan
2012-01-01
Torque, an efficient PBS (Portable Batch System)-based open source Resource Management system, was originally developed by Ames research center of NASA, which was designed to satisfy the computing requirements of heterogeneous network. With the development of distributed computing, Torque has been widely used in high performance computing cluster. However, because of the lack of a well designed monitoring system, it is difficult to monitor, record, and control, leading to low stability, reliability and manageability. To overcome those problems, this paper designs and implements an adaptive lightweight monitoring system for torque from five aspects. 1) A lightweight circulating filtration logging system is developed to obtain the real-time running status of torque; 2) One uniform interface was provided for administrators to define monitoring commands, which can query management resources of torque; 3) Storage strategy is designed to make monitoring information persistent; 4) One uniform interface is provided for users to customized alarms, which can submit exceptions and errors to users via emails and SMS in real time; 5) HTML5 technology is applied in the customizable visualization of the jobs' status in torque in real time. (authors)
Centralized operation and monitoring system for nuclear power plants
International Nuclear Information System (INIS)
Kudo, Mitsuru; Sato, Hideyuki; Murata, Fumio
1988-01-01
According to the prospect of long term energy demand, in 2000, the nuclear power generation facilities in Japan are expected to take 15.9% of the total energy demand. From this fact, it is an important subject to supply nuclear power more stably, and in the field of instrumentation and control, many researches and developments and the incessant effort of improvement have been continued. In the central operation and monitoring system which is the center of the stable operation of nuclear power plants, the man-machine technology aiding operators by electronic and computer application technologies has been positively developed and applied. It is considered that hereafter, for the purpose of rationally heightening the operation reliability of the plants, the high quality man-machine system freely using the most advanced technologies such as high reliability digital technology, optical information transmission, knowledge engineering and so on is developed and applied. The technical trend of operation and monitoring system, the concept of heightening operation and monitoring capability, the upgrading of operation and monitoring system, and the latest operation, monitoring and control systems for nuclear power plants and waste treatment facilities are described. (K.I.)
Dealing with distributed intelligence in monitoring and control systems
International Nuclear Information System (INIS)
McLaren, R.A.
1981-01-01
The Euorpean Hybrid Spectrometer is built up of many individual detectors, each having widely varying monitoring and control requirements. With the advent of cheap microprocessor systems a shift from the concept of a single monitoring and control computer of that of distributed intelligent controllers has been economically feasible. A detector designer can now thoroughly test and debug a complete monitoring and control system on a local, dedicated micro-computer, while during operation, the central computer can be relieved of many simple repetitive tasks. Rapidly, however, it has become obvious that the designers of these systems have to take into account the final operational environment and build into both the hardware and software, features allowing easy integration into a central monitoring and control chain. In addition, the problems of maintenance and enventual modification have to be taken into consideration early in the development. Examples of currently operational systems will be briefly described to demonstrate how a set of basic guidelines plus standardisation of hardware/software can minimise the problems of integration and maintenance. Based on practical experience gained in the European Hybrid Spectrometer, investigations are proceeding on various possible alternatives for future micro-computer based monitoring and control systems. (orig.)
Design of multi-function Hanford tank corrosion monitoring system
International Nuclear Information System (INIS)
EDGEMON, G.L.
1999-01-01
A multi-fiction corrosion monitoring system has been designed for installation into DST 241-AN-105 at the Hanford Site in fiscal year 1999. The 241-AN-105 system is the third-generation corrosion monitoring system described by TTP RLO-8-WT-21. Improvements and upgrades from the second-generation system (installed in 241-AN-102) that have been incorporated into the third-generation system include: Gasket seating surfaces utilize O-rings instead of a washer type gasket for improved seal; Probe design contains an equally spaced array of 22 thermocouples; Probe design contains an adjustable verification thermocouple; Probe design contains three ports for pressure/gas sampling; Probe design contains one set of strain gauges to monitor probe flexure if flexure occurs; Probe utilizes an adjustable collar to allow depth adjustment of probe during installation; System is capable of periodically conducting LPR scans; System is housed in a climate controlled enclosure adjacent to the riser containing the probe; System uses wireless Ethernet links to send data to Hanford Local Area Network; System uses commercial remote access software to allow remote command and control; and Above ground wiring uses driven shields to reduce external electrostatic noise in the data. These new design features have transformed what was primarily a second-generation corrosion monitoring system into a multi-function tank monitoring system that adds a great deal of functionality to the probe, provides for a better understanding of the relationship between corrosion and other tank operating parameters, and optimizes the use of the riser that houses the probe in the tank
International Nuclear Information System (INIS)
Boonmee, Chaiyant; Watjanatepin, Napat; Plangklang, Boonyang
2009-01-01
PV-grid-connected systems are worldwide installed because it allows consumer to reduce energy consumption from the electricity grid and to feed the surplus energy back into the grid. The system needs no battery so therefore the system price is very cheap comparing to other PV systems. PV-grid-connected systems are used in buildings that already hooked up to the electrical grid. Finding efficiency of the PV-grid-connected system can be done by using a standard instrument which needs to disconnect the PV arrays from the grid before measurement. The measurement is also difficult and we lose energy during the measurement. This paper will present the system performance of a PV-grid-connected system installed in Thailand by using a monitoring system. The monitored data are installed by acquisition software into a computer. Analysis of monitored data will be done to find out the system performance without disconnecting the PV arrays from the system. The monitored data include solar radiation, PV voltage, PV current, and PV power which has been recorded from a 5 kWp system installed of amorphous silicon PV at Rajamangala University of Technology Suvarnabhumi, Nonthaburi, Thailand. The system performance of the system by using the data monitored is compared to the standard instrument measurement. The paper will give all details about system components, monitoring system, and monitored data. The result of data analysis will be fully given. (author)
Integrating existing radiation monitors into a microprocessor-based display system
International Nuclear Information System (INIS)
Kalita, R, S.; Bartucci, C.M.; Mason, R.G.; Greaves, C.
1992-01-01
Plantwide digital radiation monitoring systems (RMSs) have been generally installed as part of the original design for newer nuclear reactors. For older plants, area and process radiation monitors were either analog or a combination of analog and digital but were not part of an integrated system design. At some plants, individual monitors have been replaced or modified, resulting in a rainbow of different monitors and vendors being represented at the plant. Usually at some point, consideration is given to replacing these monitors with a state-of-the-art RMS to improve overall reliability and achieve the benefits of sound human factors engineering. This can be a very costly project in terms of expenditures for engineering, equipment, construction, startup, and time. When human engineering deficiencies (HEDs) became an issue at Zion station, Commonwealth Edison elected to install a computer-based radiation monitoring display system (RMDS) that would interface existing raidation monitors. After reviewing the existing as-built RMS configuration and internal circuits of the various monitors, it was concluded that a microprocessor-based RMDS could be successfully designed and installed that would solve the HEDs and would tie the older analog channels into a system configuration. Although in many cases, internal modifications were made to existing RMS monitors, the RMDS upgrade allowed the existing RMS monitors to retain their original functionality and location
Monitoring and information management system at the Underground Research Laboratory
International Nuclear Information System (INIS)
Strobel, G.S.; Chernis, P.J.; Bushman, A.T.; Spinney, M.H.; Backer, R.J.
1996-01-01
Atomic Energy of Canada Limited (AECL) has developed a customer oriented monitoring and information management system at the Underground Research Laboratory (URL) near Lac du Bonnet, Manitoba. The system is used to monitor instruments and manage, process, and distribute data. It consists of signal conditioners and remote loggers, central schedule and control systems, computer aided design and drafting work centres, and the communications linking them. The monitoring and communications elements are designed to meet the harsh demands of underground conditions while providing accurate monitoring of sensitive instruments to rigorous quality assured specifications. These instruments are used for testing of the concept for the deep geological disposal of nuclear fuel waste as part of the Canadian Nuclear Fuel Waste Management Program. Many of the tests are done in situ and at full-scale. The monitoring and information management system services engineering, research, and support staff working to design, develop, and demonstrate and present the concept. Experience gained during development of the monitoring and information management system at the URL, can be directly applied at the final disposal site. (author)
Monitoring and information management system at the Underground Research Laboratory
Energy Technology Data Exchange (ETDEWEB)
Strobel, G.S.; Chernis, P.J.; Bushman, A.T.; Spinney, M.H.; Backer, R.J. [Atomic Energy of Canada Limited, Pinawa, Manitoba (Canada)
1996-07-01
Atomic Energy of Canada Limited (AECL) has developed a customer oriented monitoring and information management system at the Underground Research Laboratory (URL) near Lac du Bonnet, Manitoba. The system is used to monitor instruments and manage, process, and distribute data. It consists of signal conditioners and remote loggers, central schedule and control systems, computer aided design and drafting work centres, and the communications linking them. The monitoring and communications elements are designed to meet the harsh demands of underground conditions while providing accurate monitoring of sensitive instruments to rigorous quality assured specifications. These instruments are used for testing of the concept for the deep geological disposal of nuclear fuel waste as part of the Canadian Nuclear Fuel Waste Management Program. Many of the tests are done in situ and at full-scale. The monitoring and information management system services engineering, research, and support staff working to design, develop, and demonstrate and present the concept. Experience gained during development of the monitoring and information management system at the URL, can be directly applied at the final disposal site. (author)
Amplified OTDR Systems for Multipoint Corrosion Monitoring
Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.
2012-01-01
We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017
A design condition for incorporating human judgement into monitoring systems
International Nuclear Information System (INIS)
Tanaka, K.; Klir, G.J.
1999-01-01
In safety monitoring, there exists an uncertainty situation in which the sensor cannot detect whether or not the monitored object is in danger. For the uncertainty zone identified by a non-homogeneous safety monitoring system that utilizes two types of sensors with different thresholds, operators or experts are expected to judge whether the real state is safe or dangerous on the basis of additional information from a detailed inspection or other related sensors output. However, the activities for inspection performed by relevant humans may require additional cost and introduce inspection errors. The present article proposes two types of an automatic monitoring system not involving any human inspection or a human-machine (H-M) cooperative monitoring system with inspection. In order to compare the systems, an approach based on the Dempster-Shafer theory is proposed as uncertainty analysis by this theory (it is simpler than by the traditional Bayesian approach). By comparing their expected losses as a result of failed dangerous failures or failed safe failures as well as the inspection errors, the condition is determined under which H-M cooperative systems incorporating human judgements are more effective than automatic monitoring systems
Risk-based reconfiguration of safety monitoring system using dynamic Bayesian network
International Nuclear Information System (INIS)
Kohda, Takehisa; Cui Weimin
2007-01-01
To prevent an abnormal event from leading to an accident, the role of its safety monitoring system is very important. The safety monitoring system detects symptoms of an abnormal event to mitigate its effect at its early stage. As the operation time passes by, the sensor reliability decreases, which implies that the decision criteria of the safety monitoring system should be modified depending on the sensor reliability as well as the system reliability. This paper presents a framework for the decision criteria (or diagnosis logic) of the safety monitoring system. The logic can be dynamically modified based on sensor output data monitored at regular intervals to minimize the expected loss caused by two types of safety monitoring system failure events: failed-dangerous (FD) and failed-safe (FS). The former corresponds to no response under an abnormal system condition, while the latter implies a spurious activation under a normal system condition. Dynamic Bayesian network theory can be applied to modeling the entire system behavior composed of the system and its safety monitoring system. Using the estimated state probabilities, the optimal decision criterion is given to obtain the optimal diagnosis logic. An illustrative example of a three-sensor system shows the merits and characteristics of the proposed method, where the reasonable interpretation of sensor data can be obtained
Development of condition monitoring and diagnosis system for standby diesel generator
Energy Technology Data Exchange (ETDEWEB)
Choi, Kwang Hee; Park, Jong Hyuck; Park, Jong Eun [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)
2009-05-15
The emergency diesel generator (EDG) of the nuclear power plant is designed to supply the power to the nuclear on Station Black Out (SBO) condition. The operation reliability of onsite emergency diesel generator should be ensured by a condition monitoring system designed to monitor and analysis the condition of diesel generator. For this purpose, we have developed the online condition monitoring and diagnosis system for the wolsong unit 3 and 4 standby diesel generator including diesel engine performance. In this paper, technologies of condition monitoring and diagnosis system (SDG MDS) for the wolsong standby diesel generator are described. By using the condition monitoring module of the SDG MDS, performance monitoring function for major operating parameters of EDG reliability program required by Reg. guide 1.155 can be operated as on line monitoring system.
Development of condition monitoring and diagnosis system for standby diesel generator
International Nuclear Information System (INIS)
Choi, Kwang Hee; Park, Jong Hyuck; Park, Jong Eun
2009-01-01
The emergency diesel generator (EDG) of the nuclear power plant is designed to supply the power to the nuclear on Station Black Out (SBO) condition. The operation reliability of onsite emergency diesel generator should be ensured by a condition monitoring system designed to monitor and analysis the condition of diesel generator. For this purpose, we have developed the online condition monitoring and diagnosis system for the wolsong unit 3 and 4 standby diesel generator including diesel engine performance. In this paper, technologies of condition monitoring and diagnosis system (SDG MDS) for the wolsong standby diesel generator are described. By using the condition monitoring module of the SDG MDS, performance monitoring function for major operating parameters of EDG reliability program required by Reg. guide 1.155 can be operated as on line monitoring system
Automatic Energy Control And Monitoring System For Building
Directory of Open Access Journals (Sweden)
Hnin Nu Thaung
2015-08-01
Full Text Available The use of smart home technology in the home or building offers significant potential for energy savings. In this paper an energy management system based on wireless sensor networks. The proposed system is composed of two main components a wireless sensor network and monitoring terminal. Wireless sensors are used for sensing and transmitting electricity data and remote monitoring and control of appliances are provided to users through computer. The system enables users to save energy by monitoring and controlling appliances through terminal. This paper gives an overview of sensor technology and wireless networks in the development of an intelligent energy management system for buildings. This technology has ample potential to change the way live and work. ZigBee is used as a communication medium in building intelligent energy management system in this paper. From the prototype setup it is shown that ZigBee is a suitable technology to be adopted as the communication infrastructure in energy management system for buildings .The proposed system can be installed and maintained in residential environments with ease.
Beam loss monitor system for machine protection
Dehning, B
2005-01-01
Most beam loss monitoring systems are based on the detection of secondary shower particles which depose their energy in the accelerator equipment and finally also in the monitoring detector. To allow an efficient protection of the equipment, the likely loss locations have to be identified by tracking simulations or by using low intensity beams. If superconducting magnets are used for the beam guiding system, not only a damage protection is required but also quench preventions. The quench levels for high field magnets are several orders of magnitude below the damage levels. To keep the operational efficiency high under such circumstances, the calibration factor between the energy deposition in the coils and the energy deposition in the detectors has to be accurately known. To allow a reliable damage protection and quench prevention, the mean time between failures should be high. If in such failsafe system the number of monitors is numerous, the false dump probability has to be kept low to keep a high operation...
[A wireless mobile monitoring system based on bluetooth technology].
Sun, Shou-jun; Wu, Kai; Wu, Xiao-Ming
2006-09-01
This paper presents a wireless mobile monitoring system based on Bluetooth technology. This system realizes the remote mobile monitoring of multiple physiological parameters, and has the characters of easy use, low cost, good reliability and strong capability of anti-jamming.
The cyclical monitoring system for digital power supplies at SSRF
International Nuclear Information System (INIS)
Tang Junlong; Li Deming; Shen Tianjian
2009-01-01
Based on available digital PS testing system and long-distance monitoring hardwares, the cyclical monitoring system for digital power supplies (PS) was developed at SSRF. Two models, i.e.long-distance cyclical monitoring and local cyclical monitoring, were established. The software developed in LabVIEW language was applied to the two models without any user interface modification. The user interface is simple. The system is suitable for debugging the digital PSs during long-distance monitoring and examining the performance. The long-distance model imitates the digital PSs' status for fault analysis and communication between the digital PS and the centre control room. The local model simultaneously examines stability of 18 new PSs for 24 h, monitors the PS controller, and detects malfunction. Parameters and status of the controller can be stored in Excel or Text file. The two models have been used at SSRF for monitoring the digital PSs. (authors)
Icinga Monitoring System Interface
Neculae, Alina Georgiana
2014-01-01
The aim of this project is to develop a web interface that would be used by the Icinga monitoring system to manage the CMS online cluster, in the experimental site. The interface would allow users to visualize the information in a compressed and intuitive way, as well as modify the information of each individual object and edit the relationships between classes.
Development of a Remote Monitoring System Using Meteor Burst Technology
International Nuclear Information System (INIS)
Ewanic, M.A.; Dunstan, M.T.; Reichhardt, D.K.
2006-01-01
Monitoring the cleanup and closure of contaminated sites requires extensive data acquisition, processing, and storage. At remote sites, the task of monitoring often becomes problematical due to the lack of site infrastructure (i.e., electrical power lines, telephone lines, etc.). MSE Technology Applications, Inc. (MSE) has designed an economical and efficient remote monitoring system that will handle large amounts of data; process the data, if necessary; and transmit this data over long distances. Design criteria MSE considered during the development of the remote monitoring system included: the ability to handle multiple, remote sampling points with independent sampling frequencies; robust (i.e., less susceptible to moisture, heat, and cold extremes); independent of infrastructure; user friendly; economical; and easy to expand system capabilities. MSE installed and tested a prototype system at the Mike Mansfield Advanced Technology Center (MMATC), Butte, Montana, in June 2005. The system MSE designed and installed consisted of a 'master' control station and two remote 'slave' stations. Data acquired at the two slave stations were transmitted to the master control station, which then transmits a complete data package to a ground station using meteor burst technology. The meteor burst technology has no need for hardwired land-lines or man-made satellites. Instead, it uses ionized particles in the Earth's atmosphere to propagate a radio signal. One major advantage of the system is that it can be configured to accept data from virtually any type of device, so long as the signal from the device can be read and recorded by a standard data-logger. In fact, MSE has designed and built an electrical resistivity monitoring system that will be powered and controlled by the meteor burst system components. As sites move through the process of remediation and eventual closure, monitoring provides data vital to the successful long term management of the site. The remote
Remote monitoring: An implementation on the Gemini System
International Nuclear Information System (INIS)
Sheridan, R.; Ondrik, M.; Kadner, S.; Resnik, W.; Chitumbo, K.; Corbell, B.
1996-01-01
The Gemini System consists of a sophisticated, digital surveillance unit and a high performance review system. Due to the open architectural design of the Gemini System, it provides an excellent hardware and software platform to support remote monitoring. The present Gemini System provides the user with the following Remote Monitoring features, via a modem interface and powerful support software: state-of-health reporting, alarm reporting, and remote user interface. Future enhancements will contribute significantly to the Gemini''s ability to provide a broader spectrum of network interfaces and remote review
Zhang, Yu; Yang, Wei; Han, Dongsheng; Kim, Young-Il
2014-01-01
Environment monitoring is important for the safety of underground coal mine production, and it is also an important application of Wireless Sensor Networks (WSNs). We put forward an integrated environment monitoring system for underground coal mine, which uses the existing Cable Monitoring System (CMS) as the main body and the WSN with multi-parameter monitoring as the supplementary technique. As CMS techniques are mature, this paper mainly focuses on the WSN and the interconnection between t...
Web Based Room Monitoring System Using Webcam
Directory of Open Access Journals (Sweden)
Tole Sutikno
2008-04-01
Full Text Available A security has become very important along with the increasing number of crime cases. If some security system fails, there is a need for a mechanism that capable in recording the criminal act. Therefore, it can be used for investigation purpose of the authorities. The objective of this research is to develop a security system using video streaming that able to monitor in real-time manner, display movies in a browser, and record a video as triggered by a sensor. This monitoring system comprises of two security level camera as a video recorder of special events based on infrared sensor that is connected to a microcontroller via serial communication and camera as a real-time room monitor. The hardware system consists of infrared sensor circuit to detect special events that is serially communicated to an AT89S51 microcontroller that controls the system to perform recording process, and the software system consists of a server that displaying video streaming in a webpage and a video recorder. The software for video recording and server camera uses Visual Basic 6.0 and for video streaming uses PHP 5.1.6. As the result, the system can be used to record special events that it is wanted, and can displayed video streaming in a webpage using LAN infrastructure.
Psychometric aspects of pupil monitoring systems
Glas, Cornelis A.W.; Geerlings, Hanneke
2009-01-01
Pupil monitoring systems support the teacher in tailoring teaching to the individual level of a student and in comparing the progress and results of teaching with national standards. The systems are based on the availability of an item bank calibrated using item response theory. The assessment of
Radioactive gases monitor system: tritium, radon, noble gases
International Nuclear Information System (INIS)
Egey, J.Z.; Matatagui, E.
2015-01-01
A system for monitoring the radioactive gases tritium, radon and noble gases is described. We present the description of the sensor and the associated electronics that have been developed to monitor the presence of radioactive gases in air or other gaseous effluents. The system has a high sensitivity and a wide range of operation. The sensor is an ionization chamber, featuring the internal circulation of the gas to monitor and the associated electronics has a resolution better than 10 E-15A (fA). It allows the detection of the individual pulses that are produced during the alpha decay of radon and its daughter elements. The measurement system is made up of a commercial data acquisition system connected to a computer. The acquired data is presented on a graphical display and it is stored for later processing and analysis. We have a system that is of simple construction and versatile. Here we present the experimental results. (authors) [es
International Nuclear Information System (INIS)
Kim, Ma Woong; Shin, Hyeong Ki; Lee, Sang Kyu; Kim, Hyun Koon; Yoo, Kun Joong; Ryu, Yong Ho; Son, Han Seong; Song, Deok Yong
2007-01-01
As increase of operating nuclear power plants, an accident monitoring system is essential to ensure the operational safety of nuclear power plant. Thus, KINS has developed the Computerized Advisory System for a Radiological Emergency (CARE) system to monitor the operating status of nuclear power plant continuously. However, during the accidents or/and incidents some parameters could not be provided from the process computer of nuclear power plant to the CARE system due to limitation of To enhance the CARE system more effective for CANDU reactors, there is a need to provide complement the feature of the CARE in such a way to providing the operating parameters using to using safety analysis tool such as CANDU Integrated Safety Analysis System (CISAS) for CANDU reactors. In this study, to enhance the safety monitoring measurement two computerized systems such as a CANDU Operational Safety Monitoring System (COSMOS) and prototype of CANDU Emergency Preparedness Advisory System (CEPAS) are developed. This study introduces the two integrated safety monitoring system using the R and D products of the national mid- and long-term R and D such as CISAS and ISSAC code
Pickering Nuclear site wide groundwater monitoring system
International Nuclear Information System (INIS)
DeWilde, J.; Chin-Cheong, D.; Lledo, C.; Wootton, R.; Belanger, D.; Hansen, K.
2001-01-01
Ontario Power Generation Inc. (OPG) is continuing its efforts to understand the chemical and physical characteristics of the groundwater flow systems beneath the Pickering Nuclear Generating Station (PNGS). To this end, OPG constructed a site-wide Groundwater Monitoring System (GMS) at the PNGS to provide support to other ongoing environmental investigations and to provide a means to monitor current and future groundwater environmental issues. This paper will present the results of this work, including the development of a state-of-the-art data management system for storage and retrieval of environmental data for the site, which has applications for other power generation facilities. (author)
The AGS Booster Beam Position Monitor system
International Nuclear Information System (INIS)
Ciardullo, D.J.; Abola, A.; Beadle, E.R.; Smith, G.A.; Thomas, R.; Van Zwienen, W.; Warkentien, R.; Witkover, R.L.
1991-01-01
To accelerate both protons and heavy ions, the AGS Booster requires a broadband (multi-octave) beam position monitoring system with a dynamic range spanning several orders of magnitude (2 x 10 10 to 1.5 x 10 13 particles per pulse). System requirements include the ability to acquire single turn trajectory and average orbit information with ± 0.1 mm resolution. The design goal of ± 0.5 mm corrected accuracy requires that the detectors have repeatable linear performance after periodic bakeout at 300 degree C. The system design and capabilities of the Booster Beam Position Monitor will be described, and initial results presented. 7 refs., 5 figs
Embedded data acquisition system for neutron monitors
International Nuclear Information System (INIS)
Población, Ó G; Tejedor, I G; Sánchez, S; Blanco, J J; Gómez-Herrero, R; Medina, J; Steigies, C T
2014-01-01
This article presents the design and implementation of a new data acquisition system to be used as replacement for the old ones that have been in use with neutron monitors for the last decades and, which are eventually becoming obsolete. This new system is also intended to be used in new installations, enabling these scientific instruments to use today's communication networks to send data and receive commands from the operators. This system is currently running in two stations: KIEL2, in the Christian-Albrechts-Universität zu Kiel, Kiel, Germany, and CALMA, in the Castilla-La Mancha Neutron Monitor, Guadalajara, Spain
Data-acquisition system for radon monitoring
International Nuclear Information System (INIS)
Franklin, J.C.; Zawadzki, R.J.; Meyer, T.O.; Hill, A.L.
1976-01-01
A data-acquisition system was designed by the Bureau of Mines to monitor five detectors with radon continuously flowing through each. These detectors could be monitored up to 12 times an hour, but were only monitored according to a preset time, thus allowing radon to be monitored continuously in a uranium mine. The counter can be set to monitor each detector for any period of time up to 16.5 minutes. This allows very low concentrations to be monitored longer to reduce statistical error. There would be no upper limit in radon concentration that could be monitored, but there would be a lower limit of 50 pCi/l. Each detector was calibrated by the Lucas flask method. Multiple samples were taken at two different concentrations, and the correction factor for each detector was determined by a least squares fit of the data. To verify the calibrations, a series of measurements at several concentrations were made against a constant source. The agreement at low radon concentrations (300 pCi/l) with the two-filter method was within 3 percent; thus, the total error would be this difference plus the two-filter error. At high concentrations, the coefficient of variation ranged between 2.1 and 9.8 percent for the five different detector units
International Nuclear Information System (INIS)
Nakao, Noriaki; Kosako, Kazuaki; Kinoshita, Norikazu; Kawaguchi, Masato
2016-01-01
Lands that were contaminated with radioactive elements following the Fukushima Daiichi Nuclear Power Plant accident in 2011 have been decontaminated, and the construction of an interim storage facility for radioactive waste is planned. A GPS monitoring system was developed to concomitantly determine a location and measure the radiation level at the location. Moreover, a mapping system that produces radiation maps at the measurement locations and also predicts post-decontamination radiation maps using the compiled Monte Carlo simulation program was constructed. These systems were used for decontamination planning and estimation of the decontamination effect. An LED-coupled scintillating fiber detector was developed for visually monitoring radiation in real time at the interim storage facility. The LEDs display different colors corresponding to different radiation levels at the measurement locations along the fiber detector, the maximum length of which is 50 m. Thus, the radiation levels at all positions along the length of the detector can be visually monitored in real time. Moreover, it is useful for radiation safety and for risk communication with radiation workers and residents close to the site. (author)
Energy Technology Data Exchange (ETDEWEB)
Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul, E-mail: kchoi@cbu.ac.kr
2013-11-01
The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2.
International Nuclear Information System (INIS)
Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul
2013-01-01
The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2
Continuous monitoring system for environmental {gamma} radiation near nuclear facility
Energy Technology Data Exchange (ETDEWEB)
Hua, Jin; Qingyu, Yue; Wenhai, Wang [Academia Sinica, Beijing, BJ (China). Inst. of Atomic Energy
1996-06-01
The continuous monitoring system which is used for the environmental routine and accident emergency {gamma} radiation monitoring near nuclear facility is described. The continuous monitoring system consists of a high pressurized ionization chamber, integrated weak current amplifier, V/F converter and intelligent data recorder. The data gained by recorder can be transmitted to a PC through a standard RS-232-C interface for the data handling and graph plotting. This continuous monitoring system has the functions of alarm over threshold and recorded output signal of detector and temperature. The measuring range is from 10 nGy{center_dot}h{sup -1} to 10 mGy{center_dot}h{sup -1} because a high insulation switch atomically changed measuring ranges is used. The monitoring system has been operating continuously for a long time with high stability and reliability. (5 figs., 2 tabs.).
Continuous monitoring system for environmental γ radiation near nuclear facility
International Nuclear Information System (INIS)
Jin Hua; Yue Qingyu; Wang Wenhai
1996-06-01
The continuous monitoring system which is used for the environmental routine and accident emergency γ radiation monitoring near nuclear facility is described. The continuous monitoring system consists of a high pressurized ionization chamber, integrated weak current amplifier, V/F converter and intelligent data recorder. The data gained by recorder can be transmitted to a PC through a standard RS-232-C interface for the data handling and graph plotting. This continuous monitoring system has the functions of alarm over threshold and recorded output signal of detector and temperature. The measuring range is from 10 nGy·h -1 to 10 mGy·h -1 because a high insulation switch atomically changed measuring ranges is used. The monitoring system has been operating continuously for a long time with high stability and reliability. (5 figs., 2 tabs.)
Software for airborne radiation monitoring system
International Nuclear Information System (INIS)
Sheinfeld, M.; Kadmon, Y.; Tirosh, D.; Elhanany, I.; Gabovitch, A.; Barak, D.
1997-01-01
The Airborne Radiation Monitoring System monitors radioactive contamination in the air or on the ground. The contamination source can be a radioactive plume or an area contaminated with radionuclides. This system is composed of two major parts: Airborne Unit carried by a helicopter, and Ground Station carried by a truck. The Airborne software is intended to be the core of a computerized airborne station. The software is written in C++ under MS-Windows with object-oriented methodology. It has been designed to be user-friendly: function keys and other accelerators are used for vital operations, a help file and help subjects are available, the Human-Machine-Interface is plain and obvious. (authors)
Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture
McCown, Steven H [Rigby, ID; Derr, Kurt W [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID
2012-05-08
Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture are described. According to one embodiment, a wireless device monitoring method includes accessing device configuration information of a wireless device present at a secure area, wherein the device configuration information comprises information regarding a configuration of the wireless device, accessing stored information corresponding to the wireless device, wherein the stored information comprises information regarding the configuration of the wireless device, comparing the device configuration information with the stored information, and indicating the wireless device as one of authorized and unauthorized for presence at the secure area using the comparing.
Monitoring system of arch bridge for safety network management
Joo, Bong Chul; Yoo, Young Jun; Lee, Chin Hyung; Park, Ki Tae; Hwang, Yoon Koog
2010-03-01
Korea has constructed the safety management network monitoring test systems for the civil infrastructure since 2006 which includes airport structure, irrigation structure, railroad structure, road structure, and underground structure. Bridges among the road structure include the various superstructure types which are Steel box girder bridge, suspension bridge, PSC-box-girder bridge, and arch bridge. This paper shows the process of constructing the real-time monitoring system for the arch bridge and the measured result by the system. The arch type among various superstructure types has not only the structural efficiency but the visual beauty, because the arch type superstructure makes full use of the feature of curve. The main measuring points of arch bridges composited by curved members make a difference to compare with the system of girder bridges composited by straight members. This paper also shows the method to construct the monitoring system that considers the characteristic of the arch bridge. The system now includes strain gauges and thermometers, and it will include various sensor types such as CCTV, accelerometers and so on additionally. For the long term and accuracy monitoring, the latest optical sensors and equipments are applied to the system.
DEFF Research Database (Denmark)
Rather, Zakir Hussain; Chen, Zhe; Thøgersen, Paul
2013-01-01
Power System security has become a major concern across the global power system community. This paper presents wide area measurement system (WAMS) based security assessment and monitoring of modern power system. A new three dimensional security index (TDSI) has been proposed for online security...... monitoring of modern power system with large scale renewable energy penetration. Phasor measurement unit (PMU) based WAMS has been implemented in western Danish Power System to realize online security monitoring and assessment in power system control center. The proposed security monitoring system has been...
The dynamic state monitoring of bearings system
Directory of Open Access Journals (Sweden)
Marek Krynke
2015-03-01
Full Text Available The article discusses the methods of dynamic state monitoring of bearings system. A vibration signal contains important technical information about the machine condition and is currently the most frequently used in diagnostic bearings systems. One of the main ad-vantages of machine condition monitoring is identifying the cause of failure of the bearings and taking preventative measures, otherwise the operation of such a machine will lead to frequent replacement of the bearings. Monitoring changes in the course of the operation of machin-ery repair strategies allows keeping the conditioned state of dynamic failure conditioned preventive repairs and repairs after-failure time. In addition, the paper also presents the fundamental causes of bearing failure and identifies mechanisms related to the creation of any type of damage.
Environmental radiation monitoring system in nuclear power station
International Nuclear Information System (INIS)
Matsuoka, Sadazumi; Tadachi, Katsuo; Endo, Mamoru; Yuya, Hiroshi
1983-01-01
At the time of the construction of nuclear power stations, prior to their start of operation, the state of environmental radiation must be grasped. After the start of the power stations, based on those data, the system of environmental radiation monitoring is established. Along with the construction of Kashiwazaki-Kariwa Nuclear Power Station, The Tokyo Electric Power Co., Inc. jointly with Fujitsu Ltd. has developed a high-reliability, environmental radiation monitoring system, and adopted ''optical data highways'' using optical fiber cables for communication. It consists of a central monitoring station and 11 telemeter observation points, for collecting both radiation and meteorological data. The data sent to the central station through the highways are then outputted on a monitoring panel. They are analyzed with a central processor, and the results are printed out. (Mori, K.)
A systems approach to nuclear facility monitoring
International Nuclear Information System (INIS)
Argo, P.E.; Doak, J.E.; Howse, J.W.
1996-01-01
Sensor technology for use in nuclear facility monitoring has reached an advanced stage of development. Research on where to place these sensors in a facility and how to combine their outputs in a meaningful fashion does not appear to be keeping pace. In this paper, the authors take a global view of the problem where sensor technology is viewed as only one piece of a large puzzle. Other pieces of this puzzle include the optimal location and type of sensors used in a specific facility, the rate at which sensors record information, and the risk associated with the materials/processes at a facility. If the data are analyzed off-site, how will they be transmitted? Is real-time analysis necessary? Is one monitoring only the facility itself, or might one also monitor the processing that occurs there (e.g., tank levels and concentrations)? How is one going to combine the outputs from the various sensors to give us an accurate picture of the state of the facility? This paper will not try to answer all these questions, but rather it will attempt to stimulate thought in this area by formulating a systems approach to the problem demonstrated by a prototype system and a system proposed for an actual facility. The focus will be on the data analysis aspect of the problem. Future work in this area should focus on recommendations and guidelines for a monitoring system based upon the type of facility and processing that occurs there
Aoki, K.; Ohuchi, N.; Zong, Z.; Arimoto, Y.; Wang, X.; Yamaoka, H.; Kawai, M.; Kondou, Y.; Makida, Y.; Hirose, M.; Endou, T.; Iwasaki, M.; Nakamura, T.
2017-12-01
A remote monitoring system was developed based on the software infrastructure of the Experimental Physics and Industrial Control System (EPICS) for the cryogenic system of superconducting magnets in the interaction region of the SuperKEKB accelerator. The SuperKEKB has been constructed to conduct high-energy physics experiments at KEK. These superconducting magnets consist of three apparatuses, the Belle II detector solenoid, and QCSL and QCSR accelerator magnets. They are each contained in three cryostats cooled by dedicated helium cryogenic systems. The monitoring system was developed to read data of the EX-8000, which is an integrated instrumentation system to control all cryogenic components. The monitoring system uses the I/O control tools of EPICS software for TCP/IP, archiving techniques using a relational database, and easy human-computer interface. Using this monitoring system, it is possible to remotely monitor all real-time data of the superconducting magnets and cryogenic systems. It is also convenient to share data among multiple groups.
21 CFR 880.2420 - Electronic monitor for gravity flow infusion systems.
2010-04-01
... and Personal Use Monitoring Devices § 880.2420 Electronic monitor for gravity flow infusion systems. (a) Identification. An electronic monitor for gravity flow infusion systems is a device used to... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electronic monitor for gravity flow infusion...
Banking system and financial monitoring in Russian Federation
Directory of Open Access Journals (Sweden)
Osipov A.V.
2017-04-01
Full Text Available the article explores the definition of banking system and financial monitoring. Attention is emphasizes on role of internal control in aspect their relation to contraction to money laundering and financing of terrorism/ Internal control is analises from the point of view law, economic and management. Basic attention in the article author emphasizes on work of systems of financial monitoring in organizations.
Introducing radioactivity monitoring systems in the production of steel
International Nuclear Information System (INIS)
Sofilic, T.; Marjanovic, T.; Rastovcan-Mioc, A.
2005-01-01
Over the last twenty years, a significant number of cases of radioactive pollution has been recorded in metallurgical processes. However, it is not certain whether the pollution was caused by increased uncontrolled disposal of waste containing radionuclides or whether it was the result of increased radioactivity monitoring and control of metallic scrap. Many metal producers in the world have therefore implemented systematic monitoring of radioactivity in their production processes. Special attention was given to monitoring radioactivity in steel making processes, which is still the most applied construction material with an annual output of over billion tonnes all over the world. Drawing on the experience of the best known steel producers in Europe and world, Croatian steel mills find it necessary and justified to introduce radioactivity monitoring and control systems of radioactive elements in steel scrap, semi-finished and finished products. The aim of this paper is to point out the need to introduce the radioactivity monitoring and control in steel and steel-casting production, and to inform experts in Croatian steel mills and foundries about potential solutions and current systems. At the same time, we wanted to demonstrate how implementation of monitoring equipment can improve quality management and environmental management systems. This would render Croatian products competitive on the European market both in terms of physical and chemical properties and in terms of product quality certificates and radioactivity information. Since we lack our own standards and regulations to control both domestic and imported steel scrap, semi-finished products (crude steel, hot and cold rolled strip) and finished products, we need apply current international recommendations and guidelines, until we design our own monitoring system and adopt relevant legislation on the national level. This paper describes basic types of radioactivity monitoring and control systems, the most
Post-accident monitoring systems in Prototype Fast Breeder Reactor
International Nuclear Information System (INIS)
Suriya Murthy, N.; Sivasailanathan, Vidhya; Ananth, Allu; Roy, Kallol
2018-01-01
PFBR is a 500 MW(e) MOX fueled and sodium cooled fast reactor (SFR) under advanced stage of commissioning at Kalpakkam. Currently, the main vessel is preheated and sodium has been charged into two secondary loops that are operated in recirculation mode. In order to characterize the radiation field and contamination, the workplace monitoring is undertaken using installed monitors that are commissioned and made operational. This helps to ensure radiological protection during normal operating conditions. On the other hand, radiological monitoring in emergency conditions is quite different. For undertaking the mitigative accident management, a set of specialized nuclear instruments called post-accident monitoring systems (PAMS) which include radiation monitors are stipulated. The Fukushima Daiichi accident emphasized the importance and need for reliable accident monitoring instrumentation to indicate the safety functions during the progression and aftermath of accident in NPP. In PFBR, the PAMS are integrated with other monitoring systems in design stage itself to manage the measurements and indicating the safety functions for implementing EOP and SAMG
A design methodology for unattended monitoring systems
International Nuclear Information System (INIS)
SMITH, JAMES D.; DELAND, SHARON M.
2000-01-01
The authors presented a high-level methodology for the design of unattended monitoring systems, focusing on a system to detect diversion of nuclear materials from a storage facility. The methodology is composed of seven, interrelated analyses: Facility Analysis, Vulnerability Analysis, Threat Assessment, Scenario Assessment, Design Analysis, Conceptual Design, and Performance Assessment. The design of the monitoring system is iteratively improved until it meets a set of pre-established performance criteria. The methodology presented here is based on other, well-established system analysis methodologies and hence they believe it can be adapted to other verification or compliance applications. In order to make this approach more generic, however, there needs to be more work on techniques for establishing evaluation criteria and associated performance metrics. They found that defining general-purpose evaluation criteria for verifying compliance with international agreements was a significant undertaking in itself. They finally focused on diversion of nuclear material in order to simplify the problem so that they could work out an overall approach for the design methodology. However, general guidelines for the development of evaluation criteria are critical for a general-purpose methodology. A poor choice in evaluation criteria could result in a monitoring system design that solves the wrong problem
Fun cube based brain gym cognitive function assessment system.
Zhang, Tao; Lin, Chung-Chih; Yu, Tsang-Chu; Sun, Jing; Hsu, Wen-Chuin; Wong, Alice May-Kuen
2017-05-01
The aim of this study is to design and develop a fun cube (FC) based brain gym (BG) cognitive function assessment system using the wireless sensor network and multimedia technologies. The system comprised (1) interaction devices, FCs and a workstation used as interactive tools for collecting and transferring data to the server, (2) a BG information management system responsible for managing the cognitive games and storing test results, and (3) a feedback system used for conducting the analysis of cognitive functions to assist caregivers in screening high risk groups with mild cognitive impairment. Three kinds of experiments were performed to evaluate the developed FC-based BG cognitive function assessment system. The experimental results showed that the Pearson correlation coefficient between the system's evaluation outcomes and the traditional Montreal Cognitive Assessment scores was 0.83. The average Technology Acceptance Model 2 score was close to six for 31 elderly subjects. Most subjects considered that the brain games are interesting and the FC human-machine interface is easy to learn and operate. The control group and the cognitive impairment group had statistically significant difference with respect to the accuracy of and the time taken for the brain cognitive function assessment games, including Animal Naming, Color Search, Trail Making Test, Change Blindness, and Forward / Backward Digit Span. Copyright © 2017 Elsevier Ltd. All rights reserved.
RTP Radiation Monitoring System
International Nuclear Information System (INIS)
Alfred, S.L.; Mohd Fairus Abdul Farid; Ahmad Nabil Abdul Rahim; Nurhayati Ramli
2015-01-01
Radiation Monitoring System aiming to limiting dose exposed to personnel to the lowest level referring to the concept of ALARA (As Low As Reasonably Achievable). Atomic Energy Licensing (Basic Safety Radiation Protection) Regulation 2010 (Act 304) is a baseline to control employee and public radiation protection program and guideline, as well as to meet the requirement of the Occupational Safety and Health 1994 (Act 514). (author)
Wireless data management system for environmental monitoring in livestock buildings
Directory of Open Access Journals (Sweden)
James Gray
2017-03-01
Full Text Available The impact of air quality on the health, welfare and productivity of livestock needs to be considered, especially when livestock are kept in enclosed buildings. The monitoring of such environmental factors allows for the development of appropriate strategies to reduce detrimental effects of sub-optimal air quality on the respiratory health of both livestock and farmers. In 2009, an environmental monitoring system was designed, developed and tested that allowed for the monitoring of a number of airborne pollutants. One limitation of the system was the manual collection of logged data from each unit. This paper identifies limitations of the current environmental monitoring system and suggests a range of networking technologies that can be used to increase usability. Consideration is taken for the networking of environmental monitoring units, as well as the collection of recorded data. Furthermore, the design and development of a software system that is used to collate and store recorded environmental data from multiple farms is explored. In order to design such a system, simplified software engineering processes and methodologies have been utilised. The main steps taken in order to complete the project were requirements elicitation with clients, requirements analysis, system design, implementation and finally testing. The outcome of the project provided a potential prototype for improving the environmental monitoring system and analysis informing the benefit of the implementation.
Wearable impedance monitoring system for dialysis patients.
Bonnet, S; Bourgerette, A; Gharbi, S; Rubeck, C; Arkouche, W; Massot, B; McAdams, E; Montalibet, A; Jallon, P
2016-08-01
This paper describes the development and the validation of a prototype wearable miniaturized impedance monitoring system for remote monitoring in home-based dialysis patients. This device is intended to assess the hydration status of dialysis patients using calf impedance measurements. The system is based on the low-power AD8302 component. The impedance calibration procedure is described together with the Cole parameter estimation and the hydric volume estimation. Results are given on a test cell to validate the design and on preliminary calf measurements showing Cole parameter variations during hemodialysis.
Design Scheme of Remote Monitoring System Based on Qt
Directory of Open Access Journals (Sweden)
Xu Dawei
2015-01-01
Full Text Available This paper introduces a design scheme of remote monitoring system based on Qt, the scheme of remote monitoring system based on S3C2410 and Qt, with the aid of cross platform development tools Qt and powerful ARM platform design and implementation. The development of remote video surveillance system based on embedded terminal has practical significance and value.
Fuel failure monitoring system design approach for KALIMER
International Nuclear Information System (INIS)
Song, Soon Ja; Hwang, I. K.; Kwon, Kee Choon
1998-01-01
Fuel Failure Monitoring System (FFMS) detects fission gas and locates failed fuels in Liquid Metal Reactor. This system comprises three subsystems; delayed neutron monitoring, cover gas monitoring, and gas tagging. The purpose of this system is to improve the integrity and availability of the liquid metal plant. In this paper, FFMS was analyzed on detection method and compared with various existing liquid metal plants. Sampling and detecting methods were classified with specific plant types. Several technologies of them was recognized and used in most liquid metal reactors. Detection technology and analysis performance, however, must be improved because of new technology when liquid metal plant is built, but the FFMS design scheme will not be changed. Thereby this paper suggests the design to implement KALIMER(Korea Advanced LIquid MEtal Reactor) FFMS
Analysis of food radiation monitoring system in Belarus
International Nuclear Information System (INIS)
1992-01-01
Food radiation monitoring system in Belarus due to the Chernobyl accident is analysed. Structure of radiation monitoring network, instrumentation and modern developments. Information on permissible concentration levels in foodstuffs and water is presented and calculations of radionuclide intake for man are performed. Proposals on the creation of social centres of food radiation monitoring for Belarussian population are considered. 4 tabs
The monitoring system for macromolecular crystallography beamlines at BSRF
International Nuclear Information System (INIS)
Guo Xian; Chang Guangcai; Gan Quan; Shi Hong; Liu Peng; Sun Gongxing
2012-01-01
The monitoring system for macromolecular crystallography beamlines at BSRF (Beijing Synchrotron Radiation Facility) based on LabVIEW is introduced. In order to guarantee a safe, stable, and reliable running for the beamline devices, the system monitors the state of vacuum, cooling-water, optical components, beam, Liquid nitrogen in the beamlines in real time, detects faults and gives the alarm timely. System underlying uses the driver developed for the field devices for data acquisition, Data of collection is uploaded to the data-sharing platform makes it accessible via a network share. The upper system divides modules according to the actual function, and establishes the main interface of the monitoring system of beamline. To Facilitate data storage, management and inquiry, the system use LabSQL toolkit to achieve the interconnection with MySQL database which data of collection is sent to. (authors)
Experience with digital acoustic monitoring systems for PWRs and BWRs
International Nuclear Information System (INIS)
Olma, B.J.
1998-01-01
Substantial progress could be reached both in system technics and in application of digital acoustic monitoring systems for assessing mechanical integrity of reactor primary systems. For the surveillance of PWRs and BWRs during power operation of the plants, acoustic signals of Loose Parts Monitoring System sensors are continuously monitored for signal bursts associated with metallic impacts. ISTec/GRS experience with its digital systems MEDEA and RAMSES has shown that acoustic signature analysis is very successful for detecting component failures at an early stage. Methods for trending and classification of digital burst signals are shown, experience with their practical use will be presented. (author)
Muscular condition monitoring system using fiber bragg grating sensors
International Nuclear Information System (INIS)
Kim, Heon Young; Lee, Jin Hyuk; Kim, Dae Hyun
2014-01-01
Fiber optic sensors (FOS) have advantages such as electromagnetic interference (EMI) immunity, corrosion resistance and multiplexing capability. For these reasons, they are widely used in various condition monitoring systems (CMS). This study investigated a muscular condition monitoring system using fiber optic sensors (FOS). Generally, sensors for monitoring the condition of the human body are based on electro-magnetic devices. However, such an electrical system has several weaknesses, including the potential for electro-magnetic interference and distortion. Fiber Bragg grating (FBG) sensors overcome these weaknesses, along with simplifying the devices and increasing user convenience. To measure the level of muscle contraction and relaxation, which indicates the muscle condition, a belt-shaped FBG sensor module that makes it possible to monitor the movement of muscles in the radial and circumferential directions was fabricated in this study. In addition, a uniaxial tensile test was carried out in order to evaluate the applicability of this FBG sensor module. Based on the experimental results, a relationship was observed between the tensile stress and Bragg wavelength of the FBG sensors, which revealed the possibility of fabricating a muscular condition monitoring system based on FBG sensors.
Muscular condition monitoring system using fiber bragg grating sensors
Energy Technology Data Exchange (ETDEWEB)
Kim, Heon Young; Lee, Jin Hyuk; Kim, Dae Hyun [Seoul National University of Technology, Seoul (Korea, Republic of)
2014-10-15
Fiber optic sensors (FOS) have advantages such as electromagnetic interference (EMI) immunity, corrosion resistance and multiplexing capability. For these reasons, they are widely used in various condition monitoring systems (CMS). This study investigated a muscular condition monitoring system using fiber optic sensors (FOS). Generally, sensors for monitoring the condition of the human body are based on electro-magnetic devices. However, such an electrical system has several weaknesses, including the potential for electro-magnetic interference and distortion. Fiber Bragg grating (FBG) sensors overcome these weaknesses, along with simplifying the devices and increasing user convenience. To measure the level of muscle contraction and relaxation, which indicates the muscle condition, a belt-shaped FBG sensor module that makes it possible to monitor the movement of muscles in the radial and circumferential directions was fabricated in this study. In addition, a uniaxial tensile test was carried out in order to evaluate the applicability of this FBG sensor module. Based on the experimental results, a relationship was observed between the tensile stress and Bragg wavelength of the FBG sensors, which revealed the possibility of fabricating a muscular condition monitoring system based on FBG sensors.
Systems and method for lagrangian monitoring of flooding conditions
Claudel, Christian G.
2015-12-17
A traffic monitoring system and method for mapping traffic speed and density while preserving privacy. The system can include fixed stations that make up a network and mobile probes that are associated with vehicles. The system and method do not gather, store, or transmit any unique or identifying information, and thereby preserves the privacy of members of traffic. The system and method provide real-time traffic density and speed mapping. The system and method can further be integrated with a complementary flood monitoring system and method.
Web based remote monitoring and controlling system for vulnerable environments
Thomas, Aparna; George, Minu
2016-03-01
The two major areas of concern in industrial establishments are monitoring and security. The remote monitoring and controlling can be established with the help of Web technology. Managers can monitor and control the equipment in the remote area through a web browser. The targeted area includes all type of susceptible environment like gas filling station, research and development laboratories. The environmental parameters like temperature, light intensity, gas etc. can be monitored. Security is a very important factor in an industrial setup. So motion detection feature is added to the system to ensure the security. The remote monitoring and controlling system makes use of the latest, less power consumptive and fast working microcontroller like S3C2440. This system is based on ARM9 and Linux operating system. The ARM9 will collect the sensor data and establish real time video monitoring along with motion detection feature. These captured video data as well as environmental data is transmitted over internet using embedded web server which is integrated within the ARM9 board.
Glass badge dosimetry system for large scale personal monitoring
International Nuclear Information System (INIS)
Norimichi Juto
2002-01-01
Glass Badge using silver activated phosphate glass dosemeter was specially developed for large scale personal monitoring. And dosimetry systems such as an automatic leader and a dose equipment calculation algorithm were developed at once to achieve reasonable personal monitoring. In large scale personal monitoring, both of precision for dosimetry and confidence for lot of personal data handling become very important. The silver activated phosphate glass dosemeter has basically excellent characteristics for dosimetry such as homogeneous and stable sensitivity, negligible fading and so on. Glass Badge was designed to measure 10 keV - 10 MeV range of photon. 300 keV - 3 MeV range of beta, and 0.025 eV - 15 MeV range of neutron by included SSNTD. And developed Glass Badge dosimetry system has not only these basic characteristics but also lot of features to keep good precision for dosimetry and data handling. In this presentation, features of Glass Badge dosimetry systems and examples for practical personal monitoring systems will be presented. (Author)
Corrosion Rate Monitoring in District Heating Systems
DEFF Research Database (Denmark)
Hilbert, Lisbeth Rischel; Nielsen, Lars Vendelbo; Andersen, A.
2005-01-01
be applicable, and if on-line monitoring could improve the quality control. Water quality monitoring was applied as well as corrosion rate monitoring with linear polarization resistance (LPR), electrochemical impedance spectroscopy (EIS), electrical resistance (ER) technique, mass loss and a crevice corrosion......Quality control in district heating systems to keep uniform corrosion rates low and localized corrosion minimal is based on water quality control. Side-stream units equipped with carbon steel probes for online monitoring were mounted in district heating plants to investigate which techniques would...... cell for localized corrosion risk estimation. Important variations in corrosion rate due to changes in make-up water quality were detected with the continuous monitoring provided by ER and crevice cell, while LPR gave unreliable corrosion rates. The acquisition time of two-three days for EIS...
FREQUENCY OPTIMIZATION FOR SECURITY MONITORING OF COMPUTER SYSTEMS
Directory of Open Access Journals (Sweden)
Вogatyrev V.A.
2015-03-01
Full Text Available The subject areas of the proposed research are monitoring facilities for protection of computer systems exposed to destructive attacks of accidental and malicious nature. The interval optimization model of test monitoring for the detection of hazardous states of security breach caused by destructive attacks is proposed. Optimization function is to maximize profit in case of requests servicing in conditions of uncertainty, and intensity variance of the destructive attacks including penalties when servicing of requests is in dangerous conditions. The vector task of system availability maximization and minimization of probabilities for its downtime and dangerous conditions is proposed to be reduced to the scalar optimization problem based on the criterion of profit maximization from information services (service of requests that integrates these private criteria. Optimization variants are considered with the definition of the averaged periodic activities of monitoring and adapting of these periods to the changes in the intensity of destructive attacks. Adaptation efficiency of the monitoring frequency to changes in the activity of the destructive attacks is shown. The proposed solutions can find their application for optimization of test monitoring intervals to detect hazardous conditions of security breach that makes it possible to increase the system effectiveness, and specifically, to maximize the expected profit from information services.
A Self-Calibrating Remote Control Chemical Monitoring System
Energy Technology Data Exchange (ETDEWEB)
Jessica Croft
2007-06-01
The Susie Mine, part of the Upper Tenmile Mining Area, is located in Rimini, MT about 15 miles southwest of Helena, MT. The Upper Tenmile Creek Mining Area is an EPA Superfund site with 70 abandoned hard rock mines and several residential yards prioritized for clean up. Water from the Susie mine flows into Tenmile Creek from which the city of Helena draws part of its water supply. MSE Technology Applications in Butte, Montana was contracted by the EPA to build a treatment system for the Susie mine effluent and demonstrate a system capable of treating mine waste water in remote locations. The Idaho National Lab was contracted to design, build and demonstrate a low maintenance self-calibrating monitoring system that would monitor multiple sample points, allow remote two-way communications with the control software and allow access to the collected data through a web site. The Automated Chemical Analysis Monitoring (ACAM) system was installed in December 2006. This thesis documents the overall design of the hardware, control software and website, the data collected while MSE-TA’s system was operational, the data collected after MSE-TA’s system was shut down and suggested improvements to the existing system.
Systems and Sensors for Debris-flow Monitoring and Warning
Directory of Open Access Journals (Sweden)
Lorenzo Marchi
2008-04-01
Full Text Available Debris flows are a type of mass movement that occurs in mountain torrents. They consist of a high concentration of solid material in water that flows as a wave with a steep front. Debris flows can be considered a phenomenon intermediate between landslides and water floods. They are amongst the most hazardous natural processes in mountainous regions and may occur under different climatic conditions. Their destructiveness is due to different factors: their capability of transporting and depositing huge amounts of solid materials, which may also reach large sizes (boulders of several cubic meters are commonly transported by debris flows, their steep fronts, which may reach several meters of height and also their high velocities. The implementation of both structural and nonstructural control measures is often required when debris flows endanger routes, urban areas and other infrastructures. Sensor networks for debris-flow monitoring and warning play an important role amongst non-structural measures intended to reduce debris-flow risk. In particular, debris flow warning systems can be subdivided into two main classes: advance warning and event warning systems. These two classes employ different types of sensors. Advance warning systems are based on monitoring causative hydrometeorological processes (typically rainfall and aim to issue a warning before a possible debris flow is triggered. Event warning systems are based on detecting debris flows when these processes are in progress. They have a much smaller lead time than advance warning ones but are also less prone to false alarms. Advance warning for debris flows employs sensors and techniques typical of meteorology and hydrology, including measuring rainfall by means of rain gauges and weather radar and monitoring water discharge in headwater streams. Event warning systems use different types of sensors, encompassing ultrasonic or radar gauges, ground vibration sensors, videocameras, avalanche
Distributed Interplanetary Delay/Disruption Tolerant Network (DTN) Monitor and Control System
Wang, Shin-Ywan
2012-01-01
The main purpose of Distributed interplanetary Delay Tolerant Network Monitor and Control System as a DTN system network management implementation in JPL is defined to provide methods and tools that can monitor the DTN operation status, detect and resolve DTN operation failures in some automated style while either space network or some heterogeneous network is infused with DTN capability. In this paper, "DTN Monitor and Control system in Deep Space Network (DSN)" exemplifies a case how DTN Monitor and Control system can be adapted into a space network as it is DTN enabled.
Real-time personal exposure and health condition monitoring system
Energy Technology Data Exchange (ETDEWEB)
Saitou, Isamu; Kanda, Hiroaki; Asai, Akio; Takeishi, Naoki; Ota, Yoshito [Hitachi Aloka Medical, Ltd., Measuring Systems Engineering Dept., Tokyo (Japan); Hanawa, Nobuhiro; Ueda, Hisao; Kusunoki, Tsuyoshi; Ishitsuka, Etsuo; Kawamura, Hiroshi [Japan Atomic Energy Agency, Oarai Research and Development Center, Oarai, Ibaraki (Japan)
2012-03-15
JAEA (Japan Atomic Energy Agency) and HAM (Hitachi Aloka Medical, Ltd) have proposed novel monitoring system for workers of nuclear facility. In these facilities, exposure management for workers is mainly used access control and personal exposure recordings. This system is currently only for reports management but is not confirmative for surveillance when work in progress. Therefore, JAEA and HAM integrate access control and personal exposure recordings and two real-time monitoring systems which are position sensing and vital sign monitor. Furthermore change personal exposure management to real-time management, this system integration prevents workers from risk of accidents, and makes possible take appropriate action quickly. This novel system is going to start for tentative operation, using position sensing and real-time personal dosimeter with database in Apr. 2012. (author)
Development of the module inspection system for new standardized radiation monitoring modules
International Nuclear Information System (INIS)
Furukawa, Masami; Shimizu, Kazuaki; Hiruta, Toshihito; Mizugaki, Toshio; Ohi, Yoshihiro; Chida, Tooru.
1994-10-01
This report mentions about the module inspection system which does the maintenance check of the monitoring modules adapted the new monitoring standard, as well as the result of the verification of the modules. The module inspection system is the automatic measurement system with the computer. The system can perform the functional and the characteristic examination of the monitoring modules, the calibration with radiation source and inspection report. In the verification of the monitoring module, three major items were tested, the adaptability for the new monitoring standard, the module functions and each characteristics. All items met the new monitoring standard. (author)
GSM and web-based flood monitoring system
International Nuclear Information System (INIS)
Pagatpat, J C; Arellano, A C; Gerasta, O J
2015-01-01
The purpose of this project is to develop a local real-time river flood monitoring and warning system for the selected communities near Mandulog River. This study focuses only on the detection and early warning alert system (via website and/or cell phone text messages) that alerts local subscribers of potential flood events. Furthermore, this system is interactive wherein all non-registered subscribers could inquire the actual water level of the desired area location they want to monitor. An estimated time a particular river waterway will overflow is also included in the analyses. The hardware used in the design is split into several parts namely: the water level detector, GSM module, and microcontroller development board. (paper)
Design of safety monitor system for operation sintering furnace ME-06
International Nuclear Information System (INIS)
Sugeng Rianto; Triarjo; Djoko Kisworo; Agus Sartono
2013-01-01
Design of safety monitoring system for safety operation of sinter furnace ME-06 has been done. Parameters monitored during this operation include: temperature, gas pressure, flow rate of gas, voltage and current furnace. For sintering furnace temperature system that monitored were the temperature of the furnace temperature, the temperature of the cooling water system inlet and outlet, temperature of flow hydrogen gas inlet and outlet. For pressure system and flow rate gas sinter furnace which monitored the pressure and flow rate of hydrogen gas inlet and outlet. The system also monitors current and voltage applied to the sinter furnace heating system. Monitor system hardware consists of: the system temperature sensor, pressure, rate and data acquisition systems. While software systems using the labview driver interface that connects the hard and software systems. Function test results during sintering operation for setting the temperature 1700 °C sintering temperature increases the ramp function by 250 °C/hour average measurements obtained when the sintering time 1707.016 °C with a standard deviation of 0.38 °C. The maximum temperature of the hydrogen gas temperature 35.4 °C. The maximum temperature of the cooling water system 27.4 °C. The maximum pressure of 1,911 bar Gas Inlet and outlet of 0,051 bar. Maximum inlet gas flow 12.996 L / min and outlet 14.086 L / min. (author)
Microcontroller based multi-channel ultrasonic level monitoring system
International Nuclear Information System (INIS)
Ambastha, K.P.; Chaudhari, Y.V.; Singh, Inder Jeet; Chadda, V.K.
2004-01-01
Microcontroller based Multi-channel Ultrasonic Level Monitoring System developed by Computer Division is based on echo ranging techniques to monitor level. The transmitter directs an ultrasonic burst towards the liquid, which gets reflected from the top of the liquid surface. The time taken for ultrasound to travel from the transmitter to the top of liquid surface is measured and used to calculate the liquid level. The system provides for temperature compensation for accurate measurement as the ultrasound velocity depends on the ambient temperature. It can measure liquid level up to 5 meters. A single monitor can be used to measure level in 6 tanks. PC connectivity has been provided via RS 232 and RS 485 for remote operation and data logging of level. A GUI program developed using LABVIEW package displays level on PC monitor. The program provides for pictorial as well as numerical display for level and temperature in the front panel on the PC monitor. A user can monitor level for any or all tanks from the PC. One unit is installed at CIRUS for measuring level in Acid/ Alkali tanks and one is installed at APSARA for measuring water level in the reactor pool. (author)
Automatic acoustic and vibration monitoring system for nuclear power plants
International Nuclear Information System (INIS)
Tothmatyas, Istvan; Illenyi, Andras; Kiss, Jozsef; Komaromi, Tibor; Nagy, Istvan; Olchvary, Geza
1990-01-01
A diagnostic system for nuclear power plant monitoring is described. Acoustic and vibration diagnostics can be applied to monitor various reactor components and auxiliary equipment including primary circuit machinery, leak detection, integrity of reactor vessel, loose parts monitoring. A noise diagnostic system has been developed for the Paks Nuclear Power Plant, to supervise the vibration state of primary circuit machinery. An automatic data acquisition and processing system is described for digitalizing and analysing diagnostic signals. (R.P.) 3 figs
Development of gas-sampling device for 13N monitoring system
International Nuclear Information System (INIS)
Zhao Lihong; Gong Xueyu
2003-01-01
The 13 N monitoring system is used in the monitoring of the rate of leakage of the primary coolant circuit in nuclear power stations. The author introduces a gas-sampling device of the 13 Nmonitoring system. It is with a close-loop flow control system with intelligent control of Single Chip Micyoco (SCM), and has the ability to monitor and replace the filter paper automatically, to increase the automation of the device and stable operation in long time
A GPS-based Real-time Road Traffic Monitoring System
Tanti, Kamal Kumar
In recent years, monitoring systems are astonishingly inclined towards ever more automatic; reliably interconnected, distributed and autonomous operation. Specifically, the measurement, logging, data processing and interpretation activities may be carried out by separate units at different locations in near real-time. The recent evolution of mobile communication devices and communication technologies has fostered a growing interest in the GIS & GPS-based location-aware systems and services. This paper describes a real-time road traffic monitoring system based on integrated mobile field devices (GPS/GSM/IOs) working in tandem with advanced GIS-based application software providing on-the-fly authentications for real-time monitoring and security enhancement. The described system is developed as a fully automated, continuous, real-time monitoring system that employs GPS sensors and Ethernet and/or serial port communication techniques are used to transfer data between GPS receivers at target points and a central processing computer. The data can be processed locally or remotely based on the requirements of client’s satisfaction. Due to the modular architecture of the system, other sensor types may be supported with minimal effort. Data on the distributed network & measurements are transmitted via cellular SIM cards to a Control Unit, which provides for post-processing and network management. The Control Unit may be remotely accessed via an Internet connection. The new system will not only provide more consistent data about the road traffic conditions but also will provide methods for integrating with other Intelligent Transportation Systems (ITS). For communication between the mobile device and central monitoring service GSM technology is used. The resulting system is characterized by autonomy, reliability and a high degree of automation.
Calibration method of radiation monitoring system at TQNPC
International Nuclear Information System (INIS)
Liu Zhengshan; Zhang Qingli; Liu Jinjin; Miao Yuxing; Geng Lixin; Zhuang Yun; Dong Jianfeng; He Change
2009-04-01
The calibration methods and calibration device for standard monitor of radioactive particulate, iodine, noble gas and so on are not yet set up at home. On consideration of the present situation of the radiation monitoring system at the Third Qinshan Nuclear Power Co. Ltd., we have studied the calibration method of these radiation monitoring instruments used for measuring the waste liquid, particulate, iodine and noble gas produced during the operation of nuclear reactor. Through the check against these instruments during the No. 202 and No. 103 overhaul, we got initially the method of the calibration and obtained the transfer coefficient of calibration when secondary solid sources are used for calibration. Through the testing and calibration, the credibility of the radiation monitoring system is enhanced. And at the same time, the problems existing in the calibration are discussed. (authors)
Kostyukov, V. N.; Naumenko, A. P.
2017-08-01
The paper dwells upon urgent issues of evaluating impact of actions conducted by complex technological systems operators on their safe operation considering application of condition monitoring systems for elements and sub-systems of petrochemical production facilities. The main task for the research is to distinguish factors and criteria of monitoring system properties description, which would allow to evaluate impact of errors made by personnel on operation of real-time condition monitoring and diagnostic systems for machinery of petrochemical facilities, and find and objective criteria for monitoring system class, considering a human factor. On the basis of real-time condition monitoring concepts of sudden failure skipping risk, static and dynamic error, monitoring systems, one may solve a task of evaluation of impact that personnel's qualification has on monitoring system operation in terms of error in personnel or operators' actions while receiving information from monitoring systems and operating a technological system. Operator is considered as a part of the technological system. Although, personnel's behavior is usually a combination of the following parameters: input signal - information perceiving, reaction - decision making, response - decision implementing. Based on several researches on behavior of nuclear powers station operators in USA, Italy and other countries, as well as on researches conducted by Russian scientists, required data on operator's reliability were selected for analysis of operator's behavior at technological facilities diagnostics and monitoring systems. The calculations revealed that for the monitoring system selected as an example, the failure skipping risk for the set values of static (less than 0.01) and dynamic (less than 0.001) errors considering all related factors of data on reliability of information perception, decision-making, and reaction fulfilled is 0.037, in case when all the facilities and error probability are under
Architectures of Remote Monitoring Systems for a Nuclear Power Plant
International Nuclear Information System (INIS)
Choi, Yoo Rark; Lee, Jae Cheol; Kim, Jae Hee
2006-01-01
Aina(Artificial Intelligence for Nuclear Applications) have developed remote monitoring systems since the 1990's. We have been interested in the safety of reactor vessel, steam generator, pipes, valves and pumps. We have developed several remote inspection systems and will develop some remote care systems for a nuclear power plant. There were critical problems for building remote monitoring systems for mass data processing and remote user interface techniques in the middle of the 1990's. The network capacity wasn't sufficient to transfer the monitoring data to a remote computer. Various computer operating systems require various remote user interfaces. Java provides convenient and powerful interface facilities and the network transfer speed was increased greatly in the 2000's. Java is a good solution for a remote user interface but it can't work standalone in remote monitoring applications. The restrictions of Java make it impossible to build real time based applications. We use Java and a traditional language to improve this problem. We separate the remote user interface and the monitoring application
Modeling delayed neutron monitoring systems for fast breeder reactors
International Nuclear Information System (INIS)
Bunch, W.L.; Tang, E.L.
1983-10-01
The purpose of the present work was to develop a general expression relating the count rate of a delayed neutron monitoring system to the introduction rate of fission fragments into the sodium coolant of a fast breeder reactor. Most fast breeder reactors include a system for detecting the presence of breached fuel that permits contact between the sodium coolant and the mixed oxide fuel. These systems monitor for the presence of fission fragments in the sodium that emit delayed neutrons. For operational reasons, the goal is to relate the count rate of the delayed neutron monitor to the condition of the breach in order that appropriate action might be taken
Monitoring with new microprocessor cuts cost of control system
Energy Technology Data Exchange (ETDEWEB)
Maehling, K L
1985-08-01
Programmable logic controllers (PLC) were originally developed as an alternative to relays, counters and timers for sequential and interlock control systems. They are now also used as part of distributive control systems which include diagnostic monitoring functions. The paper describes how a wiring scheme can be simplified and installation costs reduced by incorporating a newly-developed microprocessor-based monitoring device as an interface between remote devices and a PLC. An industrial application, the 400 tph coal handling facility at Bowater Southern Paper Co's mill in Calhoun, Tennessee, is considered. The control system design is outlined, the micro-monitor is described and the benefits of simplicity are stated in the paper.
Wearable Health Monitoring Systems, Phase I
National Aeronautics and Space Administration — The objective of this proposal is to demonstrate the feasibility of producing a wearable health monitoring system for the human body that is functional, comfortable,...
Wearable Health Monitoring Systems, Phase II
National Aeronautics and Space Administration — The objective of this proposal is to demonstrate the feasibility of producing a wearable health monitoring system for the human body that is functional, comfortable,...
Application of GPRS in the remote X γ radiation monitoring system
International Nuclear Information System (INIS)
Wang Yanliang; Su Xiaohui; Jin Yu; Li Zhengcai; Wang Yuhong; Zhang Wentao
2008-01-01
This paper introduces a system sending radiation monitoring data wirelessly by GPRS network. Monitor terminal in this system can send the measured data to the monitor computer wirelessly by GPRS, then managing program of the monitor computer can process the data. When data is abnormal, there is an alarm, workers can deal with it on time. (authors)
Liquid Effluent Monitoring Information System (LEMIS) System Construction
International Nuclear Information System (INIS)
Adams, R.T.
1994-01-01
The liquid effluent sampling program is part of the effort to minimize adverse environmental impact during the cleanup operation at the Hanford Site. Of the 33 Phase I and Phase II liquid effluents, all streams actively discharged to the soil column will be sampled. The Liquid Effluent Monitoring Information System (LEMIS) is being developed as the organized information repository facility in support of the liquid effluent monitoring requirements of the Tri-Party Agreement. It is necessary to provide an automated repository into which the results from liquid effluent sampling will be placed. This repository must provide for effective retention, review, and retrieval of selected sample data by authorized persons and organizations. This System Construction document is the aggregation of the DMR P+ methodology project management deliverables. Together they represent a description of the project and its plan through four Releases, corresponding to the definition and prioritization of requirements defined by the user
Automated Intelligent Monitoring and the Controlling Software System for Solar Panels
Nalamwar, H. S.; Ivanov, M. A.; Baidali, S. A.
2017-01-01
The inspection of the solar panels on a periodic basis is important to improve longevity and ensure performance of the solar system. To get the most solar potential of the photovoltaic (PV) system is possible through an intelligent monitoring & controlling system. The monitoring & controlling system has rapidly increased its popularity because of its user-friendly graphical interface for data acquisition, monitoring, controlling and measurements. In order to monitor the performance of the system especially for renewable energy source application such as solar photovoltaic (PV), data-acquisition systems had been used to collect all the data regarding the installed system. In this paper the development of a smart automated monitoring & controlling system for the solar panel is described, the core idea is based on IoT (the Internet of Things). The measurements of data are made using sensors, block management data acquisition modules, and a software system. Then, all the real-time data collection of the electrical output parameters of the PV plant such as voltage, current and generated electricity is displayed and stored in the block management. The proposed system is smart enough to make suggestions if the panel is not working properly, to display errors, to remind about maintenance of the system through email or SMS, and to rotate panels according to a sun position using the Ephemeral table that stored in the system. The advantages of the system are the performance of the solar panel system which can be monitored and analyzed.
Wireless remote monitoring system for sleep apnea
Oh, Sechang; Kwon, Hyeokjun; Varadan, Vijay K.
2011-04-01
Sleep plays the important role of rejuvenating the body, especially the central nervous system. However, more than thirty million people suffer from sleep disorders and sleep deprivation. That can cause serious health consequences by increasing the risk of hypertension, diabetes, heart attack and so on. Apart from the physical health risk, sleep disorders can lead to social problems when sleep disorders are not diagnosed and treated. Currently, sleep disorders are diagnosed through sleep study in a sleep laboratory overnight. This involves large expenses in addition to the inconvenience of overnight hospitalization and disruption of daily life activities. Although some systems provide home based diagnosis, most of systems record the sleep data in a memory card, the patient has to face the inconvenience of sending the memory card to a doctor for diagnosis. To solve the problem, we propose a wireless sensor system for sleep apnea, which enables remote monitoring while the patient is at home. The system has 5 channels to measure ECG, Nasal airflow, body position, abdominal/chest efforts and oxygen saturation. A wireless transmitter unit transmits signals with Zigbee and a receiver unit which has two RF modules, Zigbee and Wi-Fi, receives signals from the transmitter unit and retransmits signals to the remote monitoring system with Zigbee and Wi-Fi, respectively. By using both Zigbee and Wi-Fi, the wireless sensor system can achieve a low power consumption and wide range coverage. The system's features are presented, as well as continuous monitoring results of vital signals.
Tanenberg, Robert J; Hardee, Sandra; Rothermel, Caitlin; Drake, Almond J
2017-03-01
Inpatient hyperglycemia, hypoglycemia, and glucose variability are associated with increased mortality. The use of an electronic glucose management system (eGMS) to guide intravenous (IV) insulin infusion has been found to significantly improve blood glucose (BG) control. This retrospective observational study evaluated the 7-year (January 2009-December 2015) impact of the EndoTool ® eGMS in intensive and intermediate units at Vidant Medical Center, a 900-bed tertiary teaching hospital. Patients assigned to eGMS had indications for IV insulin infusion, including uncontrolled diabetes, stress hyperglycemia, and/or postoperative BG levels >140 mg/dL. This study evaluated time required to achieve BG control (180 mg/dL after control attained); and the impact of eGMS on hospital-acquired condition (HAC)-8 rates. Data were available for all treated patients (492,078 BG readings from 16,850 patients). With eGMS, BG levels were brought to target within 1.5 to 2.3 hours (4.5 to 4.8 hours for cardiovascular patients). Minimal hypoglycemia was observed (BG values 180 mg/dL once control was attained). HAC-8 rates were reduced from 0.083 per 1,000 patients (2008) to 0.032 per 1,000 patients (2011). The use of eGMS resulted in rapid, effective control of inpatient BG levels, including significantly reduced hypoglycemia rates. BG = blood glucose CMS = Centers for Medicare and Medicaid Services CV = coefficient of variation CV% = coefficient of variation percentage eGMS = electronic glucose management system GV = glycemic variability HAC = Hospital-Acquired Condition ICU = intensive care unit IU = intermediate unit IV = intravenous LOS = length of stay VMC = Vidant Medical Center.
Development and seismic evaluation of the seismic monitoring analysis system for HANARO
International Nuclear Information System (INIS)
Ryu, J. S.; Youn, D. B.; Kim, H. G.; Woo, J. S.
2003-01-01
Since the start of operation, the seismic monitoring system has been utilized for monitoring an earthquake at the HANARO site. The existing seismic monitoring system consists of field sensors and monitoring panel. The analog-type monitoring system with magnetic tape recorder is out-of-date model. In addition, the disadvantage of the existing system is that it does not include signal-analyzing equipment. Therefore, we have improved the analog seismic monitoring system except the field sensors into a new digital Seismic Monitoring Analysis System(SMAS) that can monitor and analyze earthquake signals. To achieve this objective for HANARO, the digital type hardware of the SMAS has been developed. The seismic monitoring and analysis programs that can provide rapid and precise information for an earthquake were developed. After the installation of the SMAS, we carried out the Site Acceptance Test (SAT) to confirm the functional capability of the newly developed system. The results of the SAT satisfy the requirements of the fabrication technical specifications. In addition, the seismic characteristics and structural integrity of the SMAS were evaluated. The results show that the cabinet of SMAS can withstand the effects of seismic loads and remain functional. This new SMAS is operating in the HANARO instrument room to acquire and analyze the signal of an earthquake
International Nuclear Information System (INIS)
Kadmon, Y.; Gabovitch, A.; Tirosh, D.; Ellenbogen, M.; Mazor, T.; Barak, D.
1997-01-01
A complete system for tracking, mapping, and performing a composition analysis of a radioactive plume and contaminated area was developed at the NRCN. The system includes two major units : An airborne unit for monitoring and a ground station for analyzing. The airborne unit is mounted on a helicopter and includes file following. Four radiation sensor, two 2'' x 2'' Nal (Tl) sensors horizontally separated by lead shield for mapping and spectroscopy, and two Geiger Mueller (GM) tubes as part of the safety system. A multichannel analyzer card is used for spectroscopy. A navigation system, based on GPS and a barometric altitude meter, is used to locate the plume or ground data. The telemetry system, consisting of a transceiver and a modem, transfers all the data in real time to the ground station. An industrial PC (Field Works) runs a dedicated C++ Windows application to manage the acquired data. An independent microprocessor based backup system includes a recorder, display, and key pad. The ground station is based on an industrial PC, a telemetry system, a color printer and a modem to communicate with automatic meteorology stations in the relevant area. A special software controls the ground station. Measurement results are analyzed in the ground station to estimate plume parameters including motion, location, size, velocity, and perform risk assessment. (authors)
Real-time flood monitoring and warning system
Directory of Open Access Journals (Sweden)
Jirapon Sunkpho
2011-04-01
Full Text Available Flooding is one of the major disasters occurring in various parts of the world. The system for real-time monitoring ofwater conditions: water level; flow; and precipitation level, was developed to be employed in monitoring flood in Nakhon SiThammarat, a southern province in Thailand. The two main objectives of the developed system is to serve 1 as informationchannel for flooding between the involved authorities and experts to enhance their responsibilities and collaboration and2 as a web based information source for the public, responding to their need for information on water condition and flooding.The developed system is composed of three major components: sensor network, processing/transmission unit, and database/application server. These real-time data of water condition can be monitored remotely by utilizing wireless sensors networkthat utilizes the mobile General Packet Radio Service (GPRS communication in order to transmit measured data to theapplication server. We implemented a so-called VirtualCOM, a middleware that enables application server to communicatewith the remote sensors connected to a GPRS data unit (GDU. With VirtualCOM, a GDU behaves as if it is a cable directlyconnected the remote sensors to the application server. The application server is a web-based system implemented usingPHP and JAVA as the web application and MySQL as its relational database. Users can view real-time water conditionas well as the forecasting of the water condition directly from the web via web browser or via WAP. The developed systemhas demonstrated the applicability of today’s sensors in wirelessly monitor real-time water conditions.
International Nuclear Information System (INIS)
Deokar, U.V.; Kulkarni, V.V.; Mathew, P.; Khot, A.R.; Singh, K.K.; Kamlesh; Deshpande, M.D.; Kulkarni, Y.
2010-01-01
Advanced Vitrification System (AVS) is commissioned for vitrification of high level waste (HLW) by using Joule heated ceramic melter first time in India. The HLW is generated in fuel reprocessing plant. For radiological surveillance of plant, Health Physics Unit (HPU) had installed 37 Area Gamma Monitors (AGM), 7 Continuous Air Monitors (CAM) and all types of personal contamination monitors. Exposure control is a major concern in operating plant. Therefore in addition to installed monitors, we have developed online remote radiation monitoring system to minimize exposures to the surveyor and operator. This also helped in volume reduction of secondary waste. The reliability and accuracy of the online monitoring system is confirmed by calibrating the system by comparing TLD and DRD readings and by theoretical analysis. In addition some modifications were carried in HP instruments to make them user friendly. This paper summarizes different kinds of remote radiological monitoring systems installed for online monitoring of Melter off Gas (MOG) filter, Hood filter, three exhaust filter banks, annulus air sampling and over pack monitoring in AVS. Our online remote monitoring system has helped the plant management to plan in advance for replacement of these filters, which resulted in considerable saving of collective dose. (author)
Evaluation of BEACON-COLSS Core Monitoring System Benefits
International Nuclear Information System (INIS)
Kim, Joon Sung; Park, Young Ho; Morita, Toshio; Book, Michael A.
2005-01-01
In Korean Standard Nuclear Power Plant COLSS (Core Operating Limit Supervisory System) is used to monitor the DNBR Power Operating Limit (DNBRPOL) and Linear Heat Rate POL (KWPFPOL). Westinghouse and KNFC have developed an upgraded core monitoring system by combining the BEACON TM core monitoring system 1 (Best Estimate Analyzer for Core Operation . Nuclear) and COLSS into an integrated product that is called BEACON-COLSS. BEACON-COLSS generates the 3-D power distribution corrected by the in-core detectors measurements. The 3-D core power distribution methodology in BEACON-COLSS is significantly better than the synthesis methodology in COLSS. BEACONCOLSS uses the CETOP-D 2 thermal hydraulic code instead of CETOP-1. CETOP-D is a multi-channel thermal hydraulics code that will provide more accurate DNBR calculations than the DNBR calculators currently used in COLSS
Information Security Monitoring Process Research in Russian Federation Banking System Organization
Directory of Open Access Journals (Sweden)
Anton Sergeevich Zaytsev
2013-09-01
Full Text Available In this article the author considers documents and scientific articles that should be used to configure monitoring and information security incident management process in an organization of banking system of Russia. Also key principles of monitoring configuration were marked up and a technique of monitoring configuration was proposed. Principles of monitoring system configuration were defined and a set of documents used to legitimate monitoring and information incident management process was considered.
Performance Health Monitoring of Large-Scale Systems
Energy Technology Data Exchange (ETDEWEB)
Rajamony, Ram [IBM Research, Austin, TX (United States)
2014-11-20
This report details the progress made on the ASCR funded project Performance Health Monitoring for Large Scale Systems. A large-scale application may not achieve its full performance potential due to degraded performance of even a single subsystem. Detecting performance faults, isolating them, and taking remedial action is critical for the scale of systems on the horizon. PHM aims to develop techniques and tools that can be used to identify and mitigate such performance problems. We accomplish this through two main aspects. The PHM framework encompasses diagnostics, system monitoring, fault isolation, and performance evaluation capabilities that indicates when a performance fault has been detected, either due to an anomaly present in the system itself or due to contention for shared resources between concurrently executing jobs. Software components called the PHM Control system then build upon the capabilities provided by the PHM framework to mitigate degradation caused by performance problems.
International Nuclear Information System (INIS)
Ghorai, Tanmay K.; Biswas, Soumya K.; Pramanik, Panchanan
2008-01-01
The nano-structured Fe(III)-doped TiO 2 photocatalysts with anatase phase have been developed for the oxidation of non-biodegradable different organic dyes like methyl orange (MO), rhodamine B (RB), thymol blue (TB) and bromocresol green (BG) using UV-Hg-lamp. The different compositions of Fe x Ti 1-x O 2 (x = 0.005, 0.01, 0.05, and 0.1) nanocatalysts synthesized by chemical method (CM), have been characterized by X-ray diffraction (XRD), UV-vis diffuse reflectance spectra, specific surface area (BET), transmission electronic microscopy (TEM) analysis, XPS, ESR and zeta potential. From XRD analysis, the results indicate that all the compositions of Fe(III) doped in TiO 2 catalysts gives only anatase phase not rutile phase. For complete degradation of all the solutions of the dyes (MO, RB, TB, and BG), the composition with x = 0.005 is more photoactive compared all other compositions of Fe x Ti 1-x O 2 , and degussa P25. The decolorization rate of different dyes decreases as Fe(III) concentration in TiO 2 increases. The energy band gap of Fe(III)-doped TiO 2 is found to be 2.38 eV. The oxidation state of iron has been found to be 3+ from XPS and ESR show that Fe 3+ is in low spin state