Human γ-globin genes silenced independently of other genes in the β-globin locus.

NARCIS (Netherlands)

N.O. Dillon (Niall); F.G. Grosveld (Frank)

1991-01-01

textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

Science.gov (United States)

Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

2018-03-01

There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Directory of Open Access Journals (Sweden)

Giulia Breveglieri

2015-01-01

Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Science.gov (United States)

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

Expression of human gamma-globin genes in human erythroleukemia (K562) cells.

Science.gov (United States)

Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A

1987-12-15

K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.

Molecular nature of alpha-globin genes in the Saudi population

Directory of Open Access Journals (Sweden)

J. Francis Borgio

2015-11-01

Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.

The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

NARCIS (Netherlands)

E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

1983-01-01

textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

OpenAIRE

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

Fate of a redundant gamma-globin gene in the atelid clade of New World monkeys: implications concerning fetal globin gene expression.

Science.gov (United States)

Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M

1995-01-01

Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927

Position-independent high level expression of the human β-globin gene in transgenic mice.

NARCIS (Netherlands)

F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)

1987-01-01

textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of

Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

International Nuclear Information System (INIS)

EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

2008-01-01

The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

Science.gov (United States)

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

Science.gov (United States)

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

Directory of Open Access Journals (Sweden)

Mir A Hossain

2016-01-01

Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells

Czech Academy of Sciences Publication Activity Database

Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav

2004-01-01

Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004

Characterization of beta-thalassemia mutations in patients from the state of Rio Grande do Norte, Brazil

Directory of Open Access Journals (Sweden)

Zama Messala Luna da Silveira

2011-01-01

Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

Science.gov (United States)

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Inactivation of human α-globin gene expression by a de novo deletion located upstream of the α-globin gene cluster

International Nuclear Information System (INIS)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.

1990-01-01

Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.

OpenAIRE

Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T

1983-01-01

We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...

In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

Directory of Open Access Journals (Sweden)

Mohammed Alanazi

Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

Science.gov (United States)

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Beta thalassemia - a review

Directory of Open Access Journals (Sweden)

R Jha

2014-09-01

Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: http://dx.doi.org/10.3126/jpn.v4i8.11609 Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus

Directory of Open Access Journals (Sweden)

Weiqun Lu

2011-01-01

Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia.

Science.gov (United States)

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-12-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

Science.gov (United States)

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

International Nuclear Information System (INIS)

Helder, J.; Deisseroth, A.

1987-01-01

The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

Science.gov (United States)

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

International Nuclear Information System (INIS)

Evans, T.; Reitman, M.; Felsenfeld, G.

1988-01-01

The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

Science.gov (United States)

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

Asynchronous DNA replication within the human β-globin gene locus

International Nuclear Information System (INIS)

Epner, E.; Forrester, W.C.; Groudine, M.

1988-01-01

The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

Directory of Open Access Journals (Sweden)

Elza Miyuki Kimura

2015-04-01

Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

Science.gov (United States)

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

Science.gov (United States)

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

Studies of globin gene expression in differentiating erythroid cells

International Nuclear Information System (INIS)

Sullivan, T.D.

1985-01-01

The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

Increased expression of alpha- and beta-globin mRNAs at the pituitary following exposure to estrogen during the critical period of neonatal sex differentiation in the rat

DEFF Research Database (Denmark)

Leffers, H; Navarro, V M; Nielsen, John E

2006-01-01

Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

Science.gov (United States)

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Importance of globin gene order for correct developmental expression.

NARCIS (Netherlands)

O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

1991-01-01

textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

Directory of Open Access Journals (Sweden)

Alexandra Agapidou

2018-01-01

Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

Science.gov (United States)

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

Science.gov (United States)

Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

2015-03-01

Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

NARCIS (Netherlands)

R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

1999-01-01

textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

Science.gov (United States)

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

Genome scan identifies a locus affecting gamma-globin expression in human beta-cluster YAC transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.

2000-03-01

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

Science.gov (United States)

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

International Nuclear Information System (INIS)

Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

1988-01-01

The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

Evaluation of the BeTha gene 1 kit for the qualitative detection of the eight most common Mediterranean beta-thalassemia mutations.

Science.gov (United States)

Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B

1998-11-01

We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the

Distinctive patterns of evolution of the δ-globin gene (HBD in primates.

Directory of Open Access Journals (Sweden)

Ana Moleirinho

Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates

Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

International Nuclear Information System (INIS)

Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

2004-01-01

The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

Science.gov (United States)

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

International Nuclear Information System (INIS)

Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

1988-01-01

The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

Directory of Open Access Journals (Sweden)

Rita de Cassia Mousinho-Ribeiro

2003-01-01

Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

International Nuclear Information System (INIS)

Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

1988-01-01

Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Science.gov (United States)

Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

1999-09-01

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

OpenAIRE

Liebhaber, S A; Cash, F E; Main, D M

1985-01-01

alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

Search for antisense copies of beta-globin mRNA in anemic mouse spleen

Directory of Open Access Journals (Sweden)

Taylor John M

2001-03-01

Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

Science.gov (United States)

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

Análise dos haplótipos do gene da betaS-globina no Ceará Analysis of betaS-globin gene haplotypes in Ceará, Brazil

Directory of Open Access Journals (Sweden)

Gentil Claudino de Galiza Neto

2005-10-01

Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.

In vivo protein-DNA interactions at the β-globin gene locus

International Nuclear Information System (INIS)

Tohru Ikuta; Yuet Wai Kan

1991-01-01

The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

Science.gov (United States)

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

Science.gov (United States)

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Chicken globin gene transcription is cell lineage specific during the time of the switch

International Nuclear Information System (INIS)

Lois, R.; Martinson, H.G.

1989-01-01

Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

International Nuclear Information System (INIS)

Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

1987-01-01

The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

Science.gov (United States)

Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

2016-01-01

We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

[Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

Science.gov (United States)

Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

2002-08-01

To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were

Synthetic review on the different anthropological aspects of ...

African Journals Online (AJOL)

Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.

Homologous expression of a mutated beta-tubulin gene does not confer benomyl resistance on Trichoderma virens.

Science.gov (United States)

Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A

2003-01-01

To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.

The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

DEFF Research Database (Denmark)

Riess, O; Noerremoelle, A; Weber, B

1992-01-01

The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons...

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

NARCIS (Netherlands)

Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

2018-01-01

textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

OpenAIRE

Babiss, L E; Friedman, J M; Darnell, J E

1986-01-01

In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.

Science.gov (United States)

Panja, Amrita; Chowdhury, Prosanto; Chakraborty, Sharmistha; Ghosh, Tapan Kumar; Basu, Anupam

2017-01-01

Thalassemia is a common autosomal recessive blood disorder, which is most prevalent in South East Asian and Mediterranean populations. It is considered as a major health burden in the Indian population. The aims of the present study were to investigate the common, as well as uncommon, mutations responsible for thalassemia in the Bengali population. The Bengali state was divided into four sampling zones. Mutation detection was done using Sanger sequencing of the HBB gene. A total of 14 different mutations were observed, including rare mutations IVS1-130(G>C), IVS1-129(A>C), -90(T>C), CD16(-C), -30(T>C), CD15(-T), and a novel mutation CD53(C>T). The frequencies of IVS1-5(G>C) and CD26(G>A) mutations were higher than other mutations. There were also some silent polymorphisms found in the studied group, CD3(T>C), CD10(C>A), IVSII-16(G>C), IVSII-74(T>G), -42(C>G). The present study is the first attempt to screen for β-thalassemia-causing mutations by direct sequencing in different districts of West Bengal. The information obtained from the present study may be helpful for thalassemia management and prenatal mutation detection.

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Dominant control region of the human β- like globin gene cluster

NARCIS (Netherlands)

Blom van Assendelft, Margaretha van

1989-01-01

The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

Science.gov (United States)

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

Thalassemia

Science.gov (United States)

Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...

Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease.

Science.gov (United States)

Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

2016-01-01

Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.

A phylogenomic profile of globins

Directory of Open Access Journals (Sweden)

Dewilde Sylvia

2006-04-01

Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.

Chromosome 11-linked determinant controls fetal globin expression and the fetal-to-adult globin switch

International Nuclear Information System (INIS)

Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.

1987-01-01

Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11

Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

Directory of Open Access Journals (Sweden)

Supachai Ekwattanakit

2012-01-01

Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

Science.gov (United States)

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

Science.gov (United States)

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

Brain alpha- and beta-globin expression after intracerebral hemorrhage

OpenAIRE

He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua

2010-01-01

Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

Directory of Open Access Journals (Sweden)

Türker Bilgen

2011-09-01

Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

Current and future alternative therapies for beta-thalassemia major

Directory of Open Access Journals (Sweden)

Edouard de Dreuzy

2016-02-01

Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

Science.gov (United States)

Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

2015-05-01

The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

Mutation Analysis of 16 Mucolipidosis II and III Alpha/Beta Chinese Children Revealed Genotype-Phenotype Correlations.

Directory of Open Access Journals (Sweden)

Shuang Liu

Full Text Available Mucolipidosis II and III alpha/beta are autosomal recessive diseases caused by mutations in the GNPTAB gene which encodes the α and β subunits of the N-acetylglucosamine-1-phosphotransferase. Clinically, mucolipidosis II (MLII is characterized by severe developmental delay, coarse facial features, skeletal deformities, and other systemic involvement. In contrast, MLIII alpha/beta is a much milder disorder, the symptoms of which include progressive joint stiffness, short stature, and scoliosis. To study the relationship between the genotypes and phenotypes of the MLII and MLIII alpha/beta patients, we analyzed the GNPTAB gene in 16 Chinese MLII and MLIII alpha/beta patients. We collected and analyzed the patients' available clinical data and all showed clinical features typical of MLII or MLIII alpha/beta. Moreover, the activity of several lysosomal enzymes was measured in the plasma and finally the GNPTAB gene was sequenced. We detected 30 mutant alleles out of 32 alleles in our patients. These include 10 new mutations (c.99delC, c.118-1G>A, c.523_524delAAinsG, c.1212C>G, c.2213C>A, c.2345C>T, c.2356C>T, c.2455G>T, c.2821dupA, and c.3136-2A>G and 5 previously reported mutations (c.1071G>A, c.1090C>T, c.2715+1G>A, c.2550_2554delGAAA, and c.3613C>T. The most frequent mutation was the splicing mutation c.2715+1G>A, which accounted for 28% of the mutations. The majority of the mutations reported in the Chinese patients (57% were located on exon 13 or in its intronic flanking regions.

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

Science.gov (United States)

Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

2010-05-16

Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

International Nuclear Information System (INIS)

Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

1991-01-01

The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

A nonsense mutation in the beta-carotene oxygenase 2 (BCO2 gene is tightly associated with accumulation of carotenoids in adipose tissue in sheep (Ovis aries

Directory of Open Access Journals (Sweden)

Boman Inger A

2010-02-01

Full Text Available Abstract Background Sheep carcasses with yellow fat are sporadically observed at Norwegian slaughter houses. This phenomenon is known to be inherited as a recessive trait, and is caused by accumulation of carotenoids in adipose tissue. Two enzymes are known to be important in carotenoid degradation in mammals, and are therefore potential candidate genes for this trait. These are beta-carotene 15,15'-monooxygenase 1 (BCMO1 and the beta-carotene oxygenase 2 (BCO2. Results In the present study the coding region of the BCMO1 and the BCO2 gene were sequenced in yellow fat individuals and compared to the corresponding sequences from control animals with white fat. In the yellow fat individuals a nonsense mutation was found in BCO2 nucleotide position 196 (c.196C>T, introducing a stop codon in amino acid position 66. The full length protein consists of 575 amino acids. In spite of a very low frequency of this mutation in the Norwegian AI-ram population, 16 out of 18 yellow fat lambs were found to be homozygous for this mutation. Conclusion In the present study a nonsense mutation (c.196C>T in the beta-carotene oxygenase 2 (BCO2 gene is found to strongly associate with the yellow fat phenotype in sheep. The existence of individuals lacking this mutation, but still demonstrating yellow fat, suggests that additional mutations may cause a similar phenotype in this population. The results demonstrate a quantitatively important role for BCO2 in carotenoid degradation, which might indicate a broad enzyme specificity for carotenoids. Animals homozygous for the mutation are not reported to suffer from any negative health or development traits, pointing towards a minor role of BCO2 in vitamin A formation. Genotyping AI rams for c.196C>T can now be actively used in selection against the yellow fat trait.

Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

Science.gov (United States)

Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

2012-01-01

Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations

NARCIS (Netherlands)

P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)

2012-01-01

textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.

Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

Science.gov (United States)

Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

2018-04-01

Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

Science.gov (United States)

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Pituitary resistance to thyroid hormone associated with a base mutation in the hormone-binding domain of the human 3, 5,3[prime]-triiodothyronine receptor-[beta

Energy Technology Data Exchange (ETDEWEB)

Sasaki, Shigekazu; Nakamura, Hirotoshi; Tagami, Tetsuya; Miyoshi, Yohzi; Nogimori, Tsuyoshi; Mitsuma, Terunori; Imura, Hiroo (Kyoto Univ. School of Medicine, Aichi (Japan))

1993-05-01

Point mutations in the human T[sub 3] receptor-[beta] (TR[beta]) gene causing single amino acid substitutions have been identified in several different kindred with generalized resistance to thyroid hormone. Until now, no study has been reported on the TR gene in cases of pituitary resistance (PRTH). In the present study, the authors analyzed the TR[beta] gene in a 30-yr-old Japanese female with PRTH. She exhibited clinical features of hyperthyroidism, elevated serum thyroid hormone levels accompanied by inappropriately increased secretion of TSH, mildly elevated basal metabolic rate, and increased urinary excretion of hydroxyproline. No pituitary tumor was detected. DNA fragments of exons 3-8 of the geonomic TR[beta] gene were generated by the polymerase chain reaction and analyzed by a single stranded conformation polymorphism method. Exon 7 of the patient's TR[beta] gene showed an abnormal band, suggesting the existence of mutation(s). By subcloning and sequencing the DNA, a point mutation was identified in one allele at nucleotide 1297 (C to T), which altered the 333rd amino acid, arginine, to tryptophan. Neither of her apparently normal parents had any mutations of the TR[beta] gene. In vitro translation products of the mutant TR[beta] gene showed remarkably decreased T[sub 3]-binding activity (K[sub a], 2.1 [times] 10[sup 8] M[sup [minus]1]; normal TR[beta] K[sub a], 1.1 [times] 10[sup 10] M[sup [minus]1]). Since the molecular defect detected in a patient with PRTH is similar to that seen in subjects with generalized resistance to thyroid hormone, both types of the syndrome may represent a continuous spectrum of the same etiological defect with variable tissue resistance to thyroid hormone.

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

Characterization of histone H3K27 modifications in the β-globin locus

International Nuclear Information System (INIS)

Kim, Yea Woon; Kim, AeRi

2011-01-01

Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.

Chromatin loops, gene positioning, and gene expression

NARCIS (Netherlands)

Holwerda, S.; de Laat, W.

2012-01-01

Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

Science.gov (United States)

Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

2016-10-19

Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

Hemoglobina C em homozigose e interação com talassemia beta Homozygous hemoglobin C and its interaction with beta thalassemia

Directory of Open Access Journals (Sweden)

Ivan L. Angulo

2009-01-01

Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood

Molecular analysis of the human β-globin locus activation region

International Nuclear Information System (INIS)

Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.

1989-01-01

Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed

Studies of the variability of the hepatocyte nuclear factor-1beta (HNF-1beta / TCF2) and the dimerization cofactor of HNF-1 (DcoH / PCBD) genes in relation to type 2 diabetes mellitus and beta-cell function

DEFF Research Database (Denmark)

Ek, J; Grarup, N; Urhammer, S A

2001-01-01

Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...... mutations in HNF-1 are implicated in the pathogenesis of MODY or late-onset diabetes with and without nephropathy in Danish Caucasians we examined the HNF-1beta (TCF2) and the dimerization cofactor of HNF-1 (DCoH, PCBD) genes for mutations in 11 MODY probands, 28 type 2 diabetic patients with nephropathy...... comprising the DCoH gene revealed a previously described A-->G polymorphism located in the 3' untranslated region, which was not investigated further. In conclusion, mutations in HNF-1beta and DCoH are not a major cause of MODY or late onset type 2 diabetes in Danish Caucasian subjects....

Gene Therapy Approaches to Hemoglobinopathies.

Science.gov (United States)

Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

2017-10-01

Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

alpha-thalassemia, HbS, and beta-globin gene cluster haplotypes in two Afro-Uruguayan sub-populations from northern and southern Uruguay

Directory of Open Access Journals (Sweden)

Julio A. da Luz

2006-01-01

Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.

Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

Directory of Open Access Journals (Sweden)

G.M. Mokhtar

2018-04-01

Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

First Case of a Compound Heterozygosity for Two Nondeletional α-Thalassemia mutations, Hb Constant Spring and Hb Quong Sze.

Science.gov (United States)

Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi

2016-06-01

Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

OpenAIRE

Selma Ünal; Günay Balta; Fatma Gümrük

2014-01-01

Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Manal Michel Wilson

2015-03-04

Mar 4, 2015 ... The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net ... RDB, a panel of probes (n = 22) using the beta globin strip assay was used ... (20 pmol) of primer R and 5 ll (100 ng) of genomic extracted. DNA.

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

Science.gov (United States)

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

Directory of Open Access Journals (Sweden)

Zulema Romero

Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

THYROID HORMONE RECEPTOR BETA GENE MUTATION (P453A) IN A TURKISH FAMILY PRODUCING RESISTANCE TO THYROID HORMONE

Science.gov (United States)

Bayraktaroglu, Taner; Noel, Janet; Mukaddes, Nahit Motavalli; Refetoff, Samuel

2018-01-01

Two members of a Turkish family, a mother and son, had thyroid function tests suggestive of resistance to thyroid hormone (RTH). The clinical presentation was, however, different. The mother (proposita) had palpitation, weakness, tiredness, nervousness, dry mouth and was misdiagnosed as having multinodular toxic goiter which was treated with antithyroid drugs and partial thyroidectomy. Her younger son had attention deficit hyperactivity disorder and primary encopresis, but normal intellectual quotient. Both had elevated serum iodothyronine levels with nonsuppressed thyrotropin. A mutation in one allele of the thyroid hormone receptor beta gene (P453A) was identified, providing a genetic confirmation for the diagnosis of RTH. PMID:18561095

17Beta-hydroxysteroid dehydrogenase-3 deficiency: diagnosis, phenotypic variability, population genetics, and worldwide distribution of ancient and de novo mutations

NARCIS (Netherlands)

A.L.M. Boehmer (Annemie); D.J.J. Halley (Dicky); P.E. de Ruiter (Petra); M.F. Niermeijer (Martinus); S. Andersson (Stefan); F.H. de Jong (Frank); H.H. Bode (Hans); S.L.S. Drop (Stenvert); H. Kayserili (Hülya); M.A. de Vroede; C. Rodrigues (Cidade); B.J. Otten (Barto); B.B. Mendonça (Berenice); H.A. Delemarre-van de Waal (Henriette); C.W. Rouwé (Catrienus); A.O. Brinkmann (Albert); L.A. Sandkuijl (Lodewijk)

1999-01-01

textabstract17Beta-hydroxysteroid dehydrogenase-3 (17betaHSD3) deficiency is an autosomal recessive form of male pseudohermaphroditism caused by mutations in the HSD17B3 gene. In a nationwide study on male pseudohermaphroditism among all pediatric endocrinologists and

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

Science.gov (United States)

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Expression of the benign HEXA mutations, Arg247Trp and Arg249Trp, associated with beta-hexosaminidase A pseudodeficiency

Energy Technology Data Exchange (ETDEWEB)

Cao, Z.; Petroulakis, E.; Salo, T. [Univ. of Manitoba (Canada)] [and others

1994-09-01

{beta}-Hexosaminidase (Hex A) is a heterodimer of {alpha} and {beta} subunits encoded by the HEXA and HEXB genes, respectively. Mutations in the HEXA gene typically cause Tay-Sachs disease or less severe forms of G{sub M2} gangliosidosis. However, two benign mutations (Arg247Trp and Arg249Trp) in the {alpha}-subunit of Hex A account for Hex A deficiency in {approximately}36% of non-Jewish enzyme-defined Tay-Sachs disease carriers. These mutations do not result in any apparent clinical phenotype in individuals who are genetic compounds with a second disease-causing mutation. We expressed the {alpha}-subunit harboring each of the benign mutations separately to study activity toward the synthetic substrate, 4-MUGS, for comparison to activity from enzymes containing mutations associated with other forms of G{sub M2} gangliosidosis. The C739T (Arg247Trp;benign), C745T (Arg 249Trp; benign), G805A (Gly269Ser; adult-onset), G749A (Gly250Asp; juvenile), and C508T (Arg170Trp; infantile) mutations were introduced into the {alpha}-subunit cDNA. These were transfected alone, or with the {beta}-subunit cDNA, to generate Hex S ({alpha}{alpha}) or Hex A ({alpha}{beta}), respectively. The activities were monitored using 4-MUGS, and the levels of {alpha}-subunit protein were assessed by Western blotting. Repeated experiments show that the benign mutations produce approximately 35% of normal Hex S and 40% of normal Hex A activity. This level is much higher than that of Hex A harbouring the Gly169Ser adult-onset mutation (12%). A sequential decrease in expressed Hex A activity is observed as mutations associated with more severe phenotypes are expressed. The benign mutations also result in lower levels of mature {alpha}-subunit protein compared to normal, and slightly reduced levels of {alpha}-subunit precursor protein. The Hex A deficiency resulting from benign mutations is not as great as that associated with disease-causing mutations.

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

Science.gov (United States)

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

NARCIS (Netherlands)

A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

1996-01-01

textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

Directory of Open Access Journals (Sweden)

M.R.S.C. Wenning

2000-09-01

Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies

OpenAIRE

Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias

2003-01-01

The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...

17 beta-hydroxysteroid dehydrogenase-3 deficiency : Diagnosis, phenotypic variability, population genetics, and worldwide distribution of ancient and de novo mutations

NARCIS (Netherlands)

Boehmer, ALM; Brinkmann, AO; Sandkuijl, LA; Halley, DJJ; Niermeijer, MF; Andersson, S; de Jong, FH; Kayserili, H; de Vroede, MA; Otten, BJ; Rouwe, CW; Mendonca, BB; Rodrigues, C; Bode, HH; de Ruiter, PE; Delemarre-van de Waal, HA; Drop, SLS

1999-01-01

17 beta-Hydroxysteroid dehydrogenase-3 (17 beta HSD3) deficiency is an autosomal recessive form of male pseudohermaphroditism caused by mutations in the HSD17B3 gene. In a nationwide study on male pseudohermaphroditism among all pediatric endocrinologists and clinical geneticists in The Netherlands,

A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

Directory of Open Access Journals (Sweden)

Claudia Gaspar

2009-07-01

Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

Some mutations of exon-7 in cytochrome P450 gene 3A4 and their effect on 6beta-hydroxylation of cortisol.

Science.gov (United States)

Shchepotina, E G; Vavilin, V A; Goreva, O B; Lyakhovich, V V

2006-06-01

Analysis of variants of exon 7 sequences in cytochrome P450 gene 3A4 in a sample of Caucasoid persons was carried out. The effect of these variants on activity of CYP3A was assessed by the level of cortisol 6beta-hydroxylation. Alleles CYP3A4*5 and *17 were not detected: probably, these mutations are rare and consequently they have little effect on the character of polymorphic distribution of CYP3A4 activity in this population. The incidence of CYP3A4*2 was 5.26%. The 6betaOH-cortisol/cortisol ratio in an individual with CYP3A4*2/*2 genotype was 7.408, which corresponded to "slow metabolizer" phenotype in this sample.

Mutations of maturity-onset diabetes of the young (MODY) genes in Thais with early-onset type 2 diabetes mellitus.

Science.gov (United States)

Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapaporn; Sriussadaporn, Sutin; Vannaseang, Sathit; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

2009-06-01

Six known genes responsible for maturity-onset diabetes of the young (MODY) were analysed to evaluate the prevalence of their mutations in Thai patients with MODY and early-onset type 2 diabetes. Fifty-one unrelated probands with early-onset type 2 diabetes, 21 of them fitted into classic MODY criteria, were analysed for nucleotide variations in promoters, exons, and exon-intron boundaries of six known MODY genes, including HNF-4alpha, GCK, HNF-1alpha, IPF-1, HNF-1beta, and NeuroD1/beta2, by the polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method followed by direct DNA sequencing. Missense mutations or mutations located in regulatory region, which were absent in 130 chromosomes of non-diabetic controls, were classified as potentially pathogenic mutations. We found that mutations of the six known MODY genes account for a small proportion of classic MODY (19%) and early-onset type 2 diabetes (10%) in Thais. Five of these mutations are novel including GCK R327H, HNF-1alpha P475L, HNF-1alphaG554fsX556, NeuroD1-1972 G > A and NeuroD1 A322N. Mutations of IPF-1 and HNF-1beta were not identified in the studied probands. Mutations of the six known MODY genes may not be a major cause of MODY and early-onset type 2 diabetes in Thais. Therefore, unidentified genes await discovery in a majority of Thai patients with MODY and early-onset type 2 diabetes.

Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

OpenAIRE

Liebhaber, S A; Kan, Y W

1981-01-01

The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Dilay Ciglidag Dungul

carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...

A membrane-bound vertebrate globin.

Directory of Open Access Journals (Sweden)

Miriam Blank

Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.

Effect of family counsellling on psychological distress among ...

African Journals Online (AJOL)

Background: Sickle Cell Anaemia (SCA) is a haematological disorder of red blood cells, caused by mutation in the beta globin gene. Caring for patients with the disorder poses a significant psychological burden on the sufferers, the caregivers and their families, thereby affecting their quality of life. Family counselling has ...

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

Science.gov (United States)

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

Magnetoresistive sensor for real-time single nucleotide polymorphism genotyping

DEFF Research Database (Denmark)

Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

2014-01-01

We demonstrate a magnetoresistive sensor platform that allows for the real-time detection of point mutations in DNA targets. Specifically, we detect point mutations at two sites in the human beta globin gene. For DNA detection, the present sensor technology has a detection limit of about 160p...... of magnetic beads, which enables real-time quantification of the specific binding of magnetic beads to the sensor surface under varying experimental conditions....

Identification of novel microsatellite markers preimplantation genetic diagnosis of beta-thalassemia.

Science.gov (United States)

Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S

2015-12-01

Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Ilham Saleh Abuljadayel

2006-01-01

Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

Beta-thalassemia

Directory of Open Access Journals (Sweden)

Origa Raffaella

2010-05-01

, deletions in the beta globin gene on chromosome 11, leading to reduced (beta+ or absent (beta0 synthesis of the beta chains of hemoglobin (Hb. Transmission is autosomal recessive; however, dominant mutations have also been reported. Diagnosis of thalassemia is based on hematologic and molecular genetic testing. Differential diagnosis is usually straightforward but may include genetic sideroblastic anemias, congenital dyserythropoietic anemias, and other conditions with high levels of HbF (such as juvenile myelomonocytic leukemia and aplastic anemia. Genetic counseling is recommended and prenatal diagnosis may be offered. Treatment of thalassemia major includes regular RBC transfusions, iron chelation and management of secondary complications of iron overload. In some circumstances, spleen removal may be required. Bone marrow transplantation remains the only definitive cure currently available. Individuals with thalassemia intermedia may require splenectomy, folic acid supplementation, treatment of extramedullary erythropoietic masses and leg ulcers, prevention and therapy of thromboembolic events. Prognosis for individuals with beta-thalassemia has improved substantially in the last 20 years following recent medical advances in transfusion, iron chelation and bone marrow transplantation therapy. However, cardiac disease remains the main cause of death in patients with iron overload.

Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

International Nuclear Information System (INIS)

Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-08-01

The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

Diverse pattern of gap junction beta-2 and gap junction beta-4 genes mutations and lack of contribution of DFNB21, DFNB24, DFNB29, and DFNB42 loci in autosomal recessive nonsyndromic hearing loss patients in Hormozgan, Iran

Directory of Open Access Journals (Sweden)

Masoud Akbarzadeh Laleh

2017-01-01

Full Text Available Background: We aimed to determine the contribution of four DFNB loci and mutation analysis of gap junction beta-2 (GJB2 and GJB4 genes in autosomal recessive nonsyndromic hearing loss (ARNSHL in South of Iran. Materials and Methods: A total of 36 large ARNSHL pedigrees with at least two affected subjects were enrolled in the current study. The GJB2 and GJB4 genes mutations were screened using direct sequencing method. The GJB2 and GJB4 negative families were analyzed for the linkage to DFNB21, DFNB24, DFNB29, and DFNB42 loci by genotyping the corresponding STR markers using polymerase chain reaction-PAGE method. Results: We found a homozygous nonsense mutation W77X and a homozygous missense mutation C169W in 5.55% of studied families in GJB2 and GJB4 genes, respectively. Five heterozygous mutations including V63G, A78T, and R127H in GJB2 gene, and R103C and R227W in GJB4 gene were detected. We identified two novel variations V63G in GJB2 and R227W in GJB4. In silico analysis predicted that both novel variations are deleterious mutations. We did not unveil any linkage between DFNB21, DFNB24, DFNB29, and DFNB42 loci and ARNSHL among studied families. Conclusion: This is the first report of GJB2 and GJB4 mutations from Hormozgan population. According to the previous publications regarding GJB2 and GJB4 mutations, the distribution of the mutations is different from other parts of Iran that should be considered in primary health-care programs. Further investigations are needed to evaluate the contribution of other loci in ARNSHL subjects in South of Iran.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

Science.gov (United States)

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

Directory of Open Access Journals (Sweden)

Čokić Vladan P.

2014-01-01

Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

Recent trends in the gene therapy of β-thalassemia

Science.gov (United States)

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Hemoglobin genetics: recent contributions of GWAS and gene editing

Science.gov (United States)

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

Beta-Binomial Model for the Detection of Rare Mutations in Pooled Next-Generation Sequencing Experiments.

Science.gov (United States)

Jakaitiene, Audrone; Avino, Mariano; Guarracino, Mario Rosario

2017-04-01

Against diminishing costs, next-generation sequencing (NGS) still remains expensive for studies with a large number of individuals. As cost saving, sequencing genome of pools containing multiple samples might be used. Currently, there are many software available for the detection of single-nucleotide polymorphisms (SNPs). Sensitivity and specificity depend on the model used and data analyzed, indicating that all software have space for improvement. We use beta-binomial model to detect rare mutations in untagged pooled NGS experiments. We propose a multireference framework for pooled data with ability being specific up to two patients affected by neuromuscular disorders (NMD). We assessed the results comparing with The Genome Analysis Toolkit (GATK), CRISP, SNVer, and FreeBayes. Our results show that the multireference approach applying beta-binomial model is accurate in predicting rare mutations at 0.01 fraction. Finally, we explored the concordance of mutations between the model and software, checking their involvement in any NMD-related gene. We detected seven novel SNPs, for which the functional analysis produced enriched terms related to locomotion and musculature.

Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

International Nuclear Information System (INIS)

Moon, A.M.; Ley, T.J.

1990-01-01

DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

Science.gov (United States)

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

GENETIC HETEROGENEITY OF BETA GLOBIN MUTATIONS AMONG ASIAN-INDIANS AND IMPORTANCE IN GENETIC COUNSELLING AND DIAGNOSIS

Directory of Open Access Journals (Sweden)

Ravindra Kumar

2013-01-01

Full Text Available There are an estimated 45 million carriers of β-thalassemia trait and about 12,000-15,000 infants with β-thalassemia major are born every year in India. The consanguinity rates are higher in India, and thalassemia major constitutes a significant burden on the health care system. In present study, β-thalassemia mutations were characterized in 300 thalassemia cases from 2007 to 2010 using ARMS-PCR and DNA sequencing. The five most common mutations accounted 79.3% of the studied chromosomes that includes IVS1-5(G>C, Cod 41-42(-TCTT, Cod8-9(+G, Cod16(-C and 619bp del. Though IVS1-5(G>C is most common mutation when all the communities were included, the percentage prevalence were calculated on sub caste basis and found that IVS1-5(G>C percentage prevalence varied from 25 to 60 in Aroras & Khatris and Thakur respectively. Interestingly Cod41-42(-TCTT mutation which is the second commonest among the mutations reported was totally absent in Kayasthas and Muslim community. These findings have implications for providing molecular diagnosis, genetic counseling and prenatal diagnosis to high risk couples of β-thalassemia.

Genotype phenotype correlations of cardiac beta-myosin heavy chain mutations in Indian patients with hypertrophic and dilated cardiomyopathy

DEFF Research Database (Denmark)

Rai, Taranjit Singh; Ahmad, Shamim; Bahl, Ajay

2009-01-01

The aim of the current study was to determine the frequency of mutations in the beta-myosin heavy chain gene (MYH7) in a cohort of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) and their families, and to investigate correlations between genotype and phenotype. About 130...... consecutive patients diagnosed with HCM or DCM (69 with HCM and 61 with DCM) attending the cardiology clinic of Post Graduate Institute of Medical Education and Research were screened for mutations in the MYH7 gene. The control group for genetic studies consisted of 100 healthy subjects. We report 14...... mutations in 6 probands (5 probands in HCM and 1 proband in DCM) and their family members. Out of these 6 mutations, 3 are new and are being reported for the first time. One known mutation (p.Gly716Arg) was found to be "de novo" which resulted in severe asymmetric septal hypertrophy (31 mm) and resulted...

Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

Science.gov (United States)

Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

2015-04-01

Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

Science.gov (United States)

Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

2014-06-01

Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

Science.gov (United States)

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

2014-05-13

Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

Science.gov (United States)

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-07-09

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

Variation in RNA-Seq transcriptome profiles of peripheral whole blood from healthy individuals with and without globin depletion.

Directory of Open Access Journals (Sweden)

Heesun Shin

Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

Science.gov (United States)

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

Science.gov (United States)

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

A second mutation associated with apparent [beta]-hexosaminidase A pseudodeficiency: Identification and frequency estimation

Energy Technology Data Exchange (ETDEWEB)

Cao, Z.; Chabot, T.; Triggs-Raine, B.L. (Univ. of Manitoba, Winnepeg (Canada)); Natowicz, M.R.; Prence, E.M. (Shriver Center for Mental Retardation, Waltham, MA (United States) Harvard Medical School, Boston, MA (United States)); Kaback, M.M.; Lim-Steele, S.T.; Brown, D. (Children' s Hospital, San Diego, CA (United States) Univ. of California, San Diego, CA (United States))

1993-12-01

Deficient activity of [beta]-hexosaminidase A (Hex A), resulting from mutations in the HEXA gene, typically causes Tay-Sachs disease. However, healthy individuals lacking Hex A activity against synthetic substrates (i.e., individuals who are pseudodeficient) have been described. Recently, an apparently benign C[sub 739]-to-T (Arg247Trp) mutation was found among individuals with Hex A levels indistinguishable from those of carriers of Tay-Sachs disease. This allele, when in compound heterozygosity with a second [open quotes]disease-causing[close quotes] allele, results in Hex A pseudodeficiency. The authors examined the HEXA gene of a healthy 42-year-old who was Hex A deficient but did not have the C[sub 739]-to-T mutation. The HEXA exons were PCR amplified, and the products were analyzed for mutations by using restriction-enzyme digestion or single-strand gel electrophoresis. A G[sub 805]-to-A (Gly269Ser) mutation associated with adult-onset G[sub m2] gangliosidosis was found on one chromosome. A new mutation, C[sub 745]-to-T (Arg 249Trp), was identified on the second chromosome. This mutation was detected in an additional 4/63 (6%) non-Jewish and 0/218 Ashkenazi Jewish enzyme-defined carriers. Although the Arg249Trp change may result in a late-onset form of G[sub M2] gangliosidosis, any phenotype must be very mild. This new mutation and the benign C[sub 739]-to-T mutation together account for [approximately]38% of non-Jewish enzyme-defined carriers. Because carriers of the C[sub 739]-to-T and C[sub 745]-to-T mutations cannot be differentiated from carriers of disease-causing alleles by using the classical biochemical screening approaches, DNA-based analyses for these mutations should be offered for non-Jewish enzyme-defined heterozygotes, before definitive counseling is provided. 46 refs., 5 figs., 2 tabs.

Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

International Nuclear Information System (INIS)

Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

2008-01-01

Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

Role of novel and rare nucleotide substitutions of the β-globin gene

Directory of Open Access Journals (Sweden)

Margherita Vinciguerra

2012-11-01

Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序，旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段：1）血液及血红蛋白数据；2）珠蛋白基因分子分析以及家族遗传研究（如有可能）。 自2003年以来，我们已对这类病例进行DNA序列分析：传统的分子方法无法给出完整的诊断响应，尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。 �

A five' splice-region G → C mutation in exon 1 of the human β-globin gene inhibits pre-mRNA splicing: A mechanism for β+-thalassemia

International Nuclear Information System (INIS)

Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.

1989-01-01

The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5

HFE gene: Structure, function, mutations, and associated iron abnormalities.

Science.gov (United States)

Barton, James C; Edwards, Corwin Q; Acton, Ronald T

2015-12-15

The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

International Nuclear Information System (INIS)

Studencki, A.B.; Wallace, R.B.

1984-01-01

The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

African Journals Online (AJOL)

Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

NARCIS (Netherlands)

A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

2003-01-01

textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

Monogenic diabetes associated with PAX4 gene mutations (MODY9: first description in Russia

Directory of Open Access Journals (Sweden)

Natalya A. Zubkova

2017-12-01

Full Text Available Maturity-onset diabetes of the young (MODY is a heterogeneous group of disorders characterised by autosomal dominant type of inheritance and caused by genetic defects leading to dysfunction of pancreatic beta-cells. To date, at least 13 subtypes of MODY have been described in the literature, the most frequent of which are MODY types 1–3. MODY2 and MODY3 are the most prevalent subtypes, and were previously described in our country, Russia. Several cases of rare MODY subtypes were subsequently described in the Russian literature. The current report is the first in the Russian literature to present clinical and molecular genetic characteristics of two cases of another rare MODY subtype—MODY9. This type of MODY is associated with mutations in the PAX4 gene, which encodes transcription factor PAX4, one of the factors essential for pancreatic beta-cell differentiation. Molecular genetic analysis was performed using next-generation sequencing, a new method recently applied to verify monogenic diseases and, in particular, MODY. This study reports a novel mutation in the PAX4 gene in MODY patients.

Effects of beta-lactamases and omp mutation on susceptibility to beta-lactam antibiotics in Escherichia coli.

Science.gov (United States)

Hiraoka, M; Okamoto, R; Inoue, M; Mitsuhashi, S

1989-01-01

Four types of beta-lactamases consisting of a penicillinase type I (TEM-1), a penicillinase type II (OXA-1), a cephalosporinase of Citrobacter freundii, and a cephalosporinase of Proteus vulgaris were introduced into Escherichia coli MC4100 and its omp mutants, MH1160 (MC4100 ompR1) and MH760 (MC4100 ompR2), by transformation. Effects of the combination of the omp mutations and these beta-lactamases on the susceptibility of E. coli strains were studied with 15 beta-lactam antibiotics including cephalosporins, cephamycins, penicillins, imipenem, and aztreonam. The ompR1 mutant, MH1160, lacks OmpF and OmpC, and it showed reduced susceptibility to 11 of the 15 beta-lactam agents. The reduction in susceptibility to cefoxitin, moxalactam, and flomoxef was much greater than reduction in susceptibility to the other agents. When the ompR1 mutant produced the cephalosporinase of C. freundii, the susceptibility of the mutant to 12 of the 15 beta-lactam antibiotics decreased. The reduction in susceptibility of MH1160 to 10 of the 12 agents affected by the enzyme was two- to fourfold greater than that observed in MC4100. Such a synergistic effect was also observed with the cephalosporinase of P. vulgaris and ompR1 mutation against six cephalosporins, moxalactam, and aztreonam. Images PMID:2658786

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Directory of Open Access Journals (Sweden)

Jackie A Pallister

Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Science.gov (United States)

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

Science.gov (United States)

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Investigation of benzo(a)pyrene-globin adducts

Energy Technology Data Exchange (ETDEWEB)

Wallin, H; Jeffre, A M; Santella, R M

1987-05-01

The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.

Molecular characterization of four beta-tubulin genes from dinitroaniline susceptible and resistant biotypes of Eleusine indica.

Science.gov (United States)

Yamamoto, E; Baird, W V

1999-01-01

Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.

Hb H disease resulting from the association of an αº-thalassemia allele [-(α20.5] with an unstable α-globin variant [Hb Icaria]: first report on the occurrence in Brazil

Directory of Open Access Journals (Sweden)

Elza M. Kimura

2009-01-01

Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.

Gene Therapy in Thalassemia and Hemoglobinopathies

OpenAIRE

Breda, Laura; Gambari, Roberto; Rivella, Stefano

2009-01-01

Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

International Nuclear Information System (INIS)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

1981-01-01

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

Gene expression analysis of interferon-beta treatment in multiple sclerosis

DEFF Research Database (Denmark)

Sellebjerg, F.; Datta, P.; Larsen, J.

2008-01-01

by treatment with IFN-beta. We use DNA microarrays to study gene expression in 10 multiple sclerosis (MS) patients who began de novo treatment with IFN-beta. After the first injection of IFN-beta, the expression of 74 out of 3428 genes changed at least two-fold and statistically significantly (after Bonferroni......Treatment with interferon-beta (IFN-beta) induces the expression of hundreds of genes in blood mononuclear cells, and the expression of several genes has been proposed as a marker of the effect of treatment with IFN-beta. However, to date no molecules have been identified that are stably induced...

GSK3 beta forms a tetrameric complex with endogenous PS1-CTF/NTF and beta-catenin. Effects of the D257/D385A and FAD-linked mutations.

Science.gov (United States)

Tesco, G; Tanzi, R E

2000-01-01

We have previously shown that the endogenous C-terminal fragment of presenilin 1 co-immunoprecipitates with endogenous beta-catenin. Since PS1 has been suggested to be involved in beta-catenin stabilization, we further investigated whether GSK3 beta, responsible for beta-catenin phosphorylation and degradation, is part of the PS1/beta-catenin complex. In naïve H4 and CHO cells, PS1 co-immunoprecipitated with both endogenous beta-catenin and GSK3 beta. In addition, GSK3 beta endogenously binds to the PS1-CTF/NTF complex and beta-catenin in naïve CHO cells. GSK3 beta also co-immunoprecipitated with PS1 full length in CHO cell lines overexpressing PS1 wild type. Given that it has been recently shown that PS1 mutations of aspartate 257 or 385 result in prevention of PS1 endoproteolysis and inhibition of gamma-secretase activity, we also tested whether PS1 endoproteolysis is required for beta-catenin/GSK3 beta/PS1 binding and whether PS1 FAD-linked mutations affect GSK3 beta recruitment in the PS1/beta-catenin complex. GSK3 beta was detected in PS1 immunoprecipitates from H4 cell lines overexpressing PS1 wild type, delta E10, A286E, L246V and in CHO cell lines overexpressing aspartate or M146L mutations. The latter data show that the absence of PS1 endoproteolysis (D257A/D385A and delta E10) or the presence of PS1-FAD mutations does not interfere with beta-catenin/GSK3 beta/PS1 complex formation.

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Common Β- Thalassaemia Mutations in

Directory of Open Access Journals (Sweden)

P Azarfam

2005-01-01

Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

[beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

Energy Technology Data Exchange (ETDEWEB)

Brown, C.A.; Mahuran, D.J. (Univ. of Toronto (Canada))

1993-08-01

In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

beta-catenin tyrosine 654 phosphorylation increases Wnt signalling and intestinal tumorigenesis

NARCIS (Netherlands)

van Veelen, Wendy; Le, Ngoc H.; Helvensteijn, Werner; Blonden, Lau; Theeuwes, Myrte; Bakker, Elvira R. M.; Franken, Patrick F.; van Gurp, Leon; Meijlink, Frits; van der Valk, Martin A.; Kuipers, Ernst J.; Fodde, Riccardo; Smits, Ron

Objective Deregulation of the Wnt signalling pathway by mutations in the Apc or beta-catenin genes underlies colorectal carcinogenesis. As a result, beta-catenin stabilises, translocates to the nucleus, and activates gene transcription. Intestinal tumours show a heterogeneous pattern of nuclear

beta-catenin tyrosine 654 phosphorylation increases Wnt signalling and intestinal tumorigenesis

NARCIS (Netherlands)

van Veelen, W.; Le, N.H.; Helvensteijn, W.; Blonden, L.; Theeuwes, M.; Bakker, E.R.; Franken, P.F.; van Gurp, L.; Meijlink, F.; van der Valk, M.A.; Kuipers, E.J.; Fodde, R.; Smits, R.E.H.M.

2011-01-01

Objective Deregulation of the Wnt signalling pathway by mutations in the Apc or beta-catenin genes underlies colorectal carcinogenesis. As a result, beta-catenin stabilises, translocates to the nucleus, and activates gene transcription. Intestinal tumours show a heterogeneous pattern of nuclear

Detection of mutations using microarrays of poly(C)10-poly(T)10 modified DNA probes immobilized on agarose films

DEFF Research Database (Denmark)

Dufva, Hans Martin; Petersen, Jesper; Stoltenborg, M.

2006-01-01

Allele-specific hybridization to a DNA microarray call be a useful method for genotyping patient DNA. In this article, we demonstrate that 13- to 17-base oligonucleotides tagged with a poly(T)10-poly(C)10 tail (TC tag), but otherwise unmodified, can be crosslinked by UV light irradiation to an ag......Allele-specific hybridization to a DNA microarray call be a useful method for genotyping patient DNA. In this article, we demonstrate that 13- to 17-base oligonucleotides tagged with a poly(T)10-poly(C)10 tail (TC tag), but otherwise unmodified, can be crosslinked by UV light irradiation...... to an agarose film grafted onto unmodified glass. Microarrays of TC-tagged probes immobilized on the agarose film can be used to diagnose Mutations in the human P-globin gene, which encodes the beta-chains in hemoglobin. Although the probes differed widely regarding inciting point temperature (similar to 20...... degrees C), a single stringency wash still gave sufficiently high discrimination signals between perfect match and mismatch probes to allow robust mutation detection. In all, 270 genotypings were performed on patient materials, and no genotype was incorrectly classified. Quality control experiments...

Mutated genes as research tool

International Nuclear Information System (INIS)

1981-01-01

Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice

DEFF Research Database (Denmark)

Runck, Amy M; Weber, Roy E.; Fago, Angela

2010-01-01

exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

Science.gov (United States)

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

A mutation in the {beta}-myosin rod associated with hypertrophic cardiomyopathy has an unexpected molecular phenotype

Energy Technology Data Exchange (ETDEWEB)

Armel, Thomas Z. [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States); Leinwand, Leslie A., E-mail: leslie.leinwand@colorado.edu [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States)

2010-01-01

Hypertrophic cardiomyopathy (HCM) is a common, autosomal dominant disorder primarily characterized by left ventricular hypertrophy and is the leading cause of sudden cardiac death in youth. HCM is caused by mutations in several sarcomeric proteins, with mutations in MYH7, encoding {beta}-MyHC, being the most common. While many mutations in the globular head region of the protein have been reported and studied, analysis of HCM-causing mutations in the {beta}-MyHC rod domain has not yet been reported. To address this question, we performed an array of biochemical and biophysical assays to determine how the HCM-causing E1356K mutation affects the structure, stability, and function of the {beta}-MyHC rod. Surprisingly, the E1356K mutation appears to thermodynamically destabilize the protein, rather than alter the charge profile know to be essential for muscle filament assembly. This thermodynamic instability appears to be responsible for the decreased ability of the protein to form filaments and may be responsible for the HCM phenotype seen in patients.

Best practices for transfusion for patients with sickle cell disease

OpenAIRE

Ted Wun; Kathryn Hassell

2010-01-01

The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with S...

Immunodeficiency associated with a nonsense mutation of IKBKB

DEFF Research Database (Denmark)

Nielsen, Christian; Jakobsen, Marianne A; Larsen, Martin Jakob

2014-01-01

We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory insufficie......We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory...... no explanation before whole exome sequencing revealed a novel mutation abrogating signaling through the canonical NF-κB pathway....

Recurrent APC gene mutations in Polish FAP families

Directory of Open Access Journals (Sweden)

Pławski Andrzej

2007-12-01

Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

Science.gov (United States)

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

Energy Technology Data Exchange (ETDEWEB)

Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

1990-08-28

The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

Anaesthesia for a patient with beta thalassaemia major

African Journals Online (AJOL)

Creative Commons License [CC BY-NC-ND 4.0] ... monitoring and management instituted. The first arterial blood ... thalassaemia is a defect of the beta globin chains of the ... Decreased supply due to anaemia, chronic infections and frequent ...

beta. -Amyloid gene dosage in Alzheimer's disease

Energy Technology Data Exchange (ETDEWEB)

Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E

1988-01-11

The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.

Familial Alzheimer's disease mutations in presenilin 1 do not alter levels of the secreted amyloid-beta protein precursor generated by beta-secretase cleavage.

Science.gov (United States)

Zhang, Can; Browne, Andrew; Kim, Doo Yeon; Tanzi, Rudolph E

2010-02-01

Alzheimer's disease (AD) is an insidious and progressive disease with a genetically complex and heterogenous etiology. More than 200 fully penetrant mutations in the amyloid beta-protein precursor (APP), presenilin 1 (or PSEN1), and presenilin 2 (PSEN2) have been linked to early-onset familial AD (FAD). 177 PSEN1 FAD mutations have been identified so far and account for more than approximately 80% of all FAD mutations. All PSEN1 FAD mutations can increase the Abeta42:Abeta40 ratio with seemingly different and incompletely understood mechanisms. A recent study has shown that the 286 amino acid N-terminal fragment of APP (N-APP), a proteolytic product of beta-secretase-derived secreted form of APP (sAPPbeta), could bind the death receptor, DR6, and lead to neurodegeneration. Here we asked whether PSEN1 FAD mutations lead to neurodegeneration by modulating sAPPbeta levels. All four different PSEN1 FAD mutations tested (in three mammalian cell lines) did not alter sAPPbeta levels. Therefore PS1 mutations do not appear to contribute to AD pathogenesis via altered production of sAPPbeta.

Hb A2 Episkopi - a novel δ-globin chain variant [HBD:c.428C>T] in a family of mixed Cypriot-Lebanese descent.

Science.gov (United States)

Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina

2017-06-01

Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

Science.gov (United States)

Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

2003-01-01

To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

[Study of gene mutation in 62 hemophilia A children].

Science.gov (United States)

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

Science.gov (United States)

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Structure modeling and mutational analysis of gap junction beta 2 ...

African Journals Online (AJOL)

Yomi

2012-04-03

Apr 3, 2012 ... Three dimensional (3 D) structure is very useful for understanding biological functions. Gap junction beta 2 (GJB2), human gene encoding for gap junction beta 2 protein is involved in ... Research in deafness became real.

Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

LYU Tingxia

2016-08-01

Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

Directory of Open Access Journals (Sweden)

Soudabeh Heidari

2013-09-01

Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

Science.gov (United States)

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2.

Science.gov (United States)

Huizing, Marjan; Scher, Charles D; Strovel, Erin; Fitzpatrick, Diana L; Hartnell, Lisa M; Anikster, Yair; Gahl, William A

2002-02-01

Hermansky-Pudlak syndrome (HPS) is an autosomal recessive disease consisting of oculocutaneous albinism and a storage pool deficiency resulting from absent platelet dense bodies. The disorder is genetically heterogeneous. The majority of patients, including members of a large genetic isolate in northwest Puerto Rico, have mutations in HPS1. Another gene, ADTB3A, was shown to cause HPS-2 in two brothers having compound heterozygous mutations that allowed for residual production of the gene product, the beta3A subunit of adaptor complex-3 (AP-3). This heterotetrameric complex serves as a coat protein-mediating formation of intracellular vesicles, e.g. the melanosome and platelet dense body, from membranes of the trans-Golgi network. We determined the genomic organization of the human ADTB3A gene, with intron/exon boundaries, and describe a third patient with beta3A deficiency. This 5-y-old boy has two nonsense mutations, C1578T (R-->X) and G2028T (E-->X), which produce no ADTB3A mRNA and no beta3A protein. The associated mu3 subunit of AP-3 is also entirely absent. In fibroblasts, the cell biologic concomitant of this deficiency is robust and aberrant trafficking through the plasma membrane of LAMP-3, an integral lysosomal membrane protein normally carried directly to the lysosome. The clinical concomitant is a severe, G-CSF-responsive neutropenia in addition to oculocutaneous albinism and platelet storage pool deficiency. Our findings expand the molecular, cellular, and clinical spectrum of HPS-2 and call for an increased index of suspicion for this diagnosis among patients with features of albinism, bleeding, and neutropenia.

Hb taradale [beta82(EF6)Lys-->Arg]: a novel mutation at a 2,3-diphosphoglycerate binding site.

Science.gov (United States)

Brennan, Stephen O; Sheen, Campbell; Chan, Tim; George, Peter M

2005-01-01

Hb Taradale [beta82(EF6)Lys-->Arg] was initially detected as a split Hb A0 peak on Hb A1c, monitoring. Red cell parameters, hemoglobin (Hb) electrophoresis and stability tests were normal. Mass spectrometry (ms) clearly identified a variant beta chain with a mass increase of 28 Da and peptide mapping located the mutation site to peptide betaT-9. DNA sequencing confirmed the presence of a novel beta82(EF6)Lys-->Arg mutation. This conservative substitution at a 2,3-diphosphoglycerate (2,3-DPG) binding site did not, however, appear to affect the P50 for oxygen binding.

Hereditary cancer genes are highly susceptible to splicing mutations

Science.gov (United States)

Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

2018-01-01

Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

Hereditary cancer genes are highly susceptible to splicing mutations.

Directory of Open Access Journals (Sweden)

Christy L Rhine

2018-03-01

Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

Science.gov (United States)

Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

1995-01-01

Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

Oxygen Association-Dissociation and Stability Analysis on Mouse Hemoglobins with Mutant α- and β-Globins

Science.gov (United States)

D'Surney, S. J.; Popp, R. A.

1992-01-01

Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042

Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

DEFF Research Database (Denmark)

Martens, Geert A; Jiang, Lei; Hellemans, Karine H

2011-01-01

The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...... microdissected beta cells, monitor adaptations of the beta cell phenotype to fasting, and retrieve possible conserved transcriptional regulators....

No muscle involvement in myoclonus-dystonia caused by epsilon-sarcoglycan gene mutations1

DEFF Research Database (Denmark)

Hjermind, L.E.; Vissing, J.; Asmus, F.

2008-01-01

Mutations in the epsilon-sarcoglycan gene (SGCE) can cause autosomal dominant inherited myoclonus-dystonia (M-D). Defects in other sarcoglycans; alpha-, beta-, gamma-, and delta can cause autosomal recessive inherited limb girdle muscular dystrophies. epsilon- and alpha-sarcoglycans are very...... strength and mass showed no difference between M-D patients and controls. Our findings indicate that patients with M-D have no signs or symptoms of muscle disease. This suggests a different role of the sarcoglycan complex epsilonbetagammadelta versus alphabetagammadelta complex in humans, as earlier...

BENIGN EPITHELIAL NEOPLASIA ASSOCIATED WITH BETA-HUMAN PAPILLOMA VIRUS

Directory of Open Access Journals (Sweden)

V. A. Molochkov

2014-01-01

Full Text Available Aim: To study an association between acrochordon and human papilloma virus (HPV using quantitative analysis of viral desoxyribonucleic acid (DNA; to detect different phenotypes of beta-HPV. Materials and methods: We examined 52  patients (22 immuno-suppressed patients and 30 immunocompetent subjects in the Dermatovenereology and Dermato-Oncology Department and Chronic Dialysis and Kidney Transplantation Department of the Moscow Regional Research and Clinical Institute (MONIKI. Control group included 49 healthy donors. Burr biopsy samples (micro-samples of acrochordon and intact skin (apper arm were collected in sterile conditions. After sample procession and DNA isolation using DNK-sorb-C kit (Central Research Institute for Epidemiology – CRIE, polymerase chain reaction for HPV was performed with real-time fluorescent hybridization detection. For DNA amplification and detection we used RotorGene 3000 analyzer (Corbett Research, Australia. In the beta-HPV assay, recombinant plasmids were used as positive controls and control human beta-globin gene fragments (CRIE. 4 oligo-nucleotide systems (group-specific primers and probes were used for the detection of beta-HPV DNA. Results: Preliminary data indicated that acrochordons of open and covered skin regions were common in renal transplant recipients. Beta-HPV DNA was more frequent in acrochordons and intact skin (64% and 54% of renal transplant recipients compared to healthy donors (47%. 57% of renal transplant recipients demonstrated mixed infection in acrochordons. Conclusion: HPV DNA was frequently detected in acrochordons and intact skin of renal transplant recipients. In immunocompetent patients prevalence of HPV DNA in acrochordons was significantly higher compared to intact skin.

A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

Energy Technology Data Exchange (ETDEWEB)

Ainsworth, P.J. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada)); Coulter-Mackie, M.B. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada) Children' s Psychiatric Research Institute, London, Ontario (Canada))

1992-10-01

The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[sub 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.

beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0].

Science.gov (United States)

Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R

1981-01-01

Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.

Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

DEFF Research Database (Denmark)

Martens, Geert A; Jiang, Lei; Hellemans, Karine H

2011-01-01

The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...

HFE gene mutations and Wilson's disease in Sardinia.

Science.gov (United States)

Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

2010-03-01

Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

Mutational robustness of gene regulatory networks.

Directory of Open Access Journals (Sweden)

Aalt D J van Dijk

Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

Successful every-other-day liothyronine therapy for severe resistance to thyroid hormone beta with a novel THRB mutation; case report.

Science.gov (United States)

Maruo, Yoshihiro; Mori, Asami; Morioka, Yoriko; Sawai, Chihiro; Mimura, Yu; Matui, Katsuyuki; Takeuchi, Yoshihiro

2016-01-12

Resistance to thyroid hormone beta (RTHβ) is a rare and usually dominantly inherited syndrome caused by mutations of the thyroid hormone receptor β gene (THRB). In severe cases, it is rarely challenging to control manifestations using daily therapeutic replacement of thyroid hormone. The present case study concerns an 8-year-old Japanese girl with a severe phenotype of RTH (TSH, fT3, and fT4 were 34.0 mU/L, >25.0 pg/mL and, >8.0 ng/dL, respectively), caused by a novel heterozygous frameshift mutation in exon 10 of the thyroid hormone receptor beta gene (THRB), c.1347-1357 del actcttccccc : p.E449DfsX11. RTH was detected at the neonatal screening program. At 4 years of age, the patient continued to suffer from mental retardation, hyperactivity, insomnia, and reduced resting energy expenditure (REE), despite daily thyroxine (L-T4) therapy. Every-other-day high-dose liothyronine (L-T3) therapy improved her symptoms and increased her REE, without thyrotoxicosis. In a case of severe RTH, every-other-day L-T3 administration enhanced REE and psychomotor development, without promoting symptoms of thyrotoxicosis. Every-other-day L-T3 administration may be an effective strategy for the treatment of severe RTH.

TGF-beta Sma/Mab signaling mutations uncouple reproductive aging from somatic aging.

Directory of Open Access Journals (Sweden)

Shijing Luo

2009-12-01

Full Text Available Female reproductive cessation is one of the earliest age-related declines humans experience, occurring in mid-adulthood. Similarly, Caenorhabditis elegans' reproductive span is short relative to its total life span, with reproduction ceasing about a third into its 15-20 day adulthood. All of the known mutations and treatments that extend C. elegans' reproductive period also regulate longevity, suggesting that reproductive span is normally linked to life span. C. elegans has two canonical TGF-beta signaling pathways. We recently found that the TGF-beta Dauer pathway regulates longevity through the Insulin/IGF-1 Signaling (IIS pathway; here we show that this pathway has a moderate effect on reproductive span. By contrast, TGF-beta Sma/Mab signaling mutants exhibit a substantially extended reproductive period, more than doubling reproductive span in some cases. Sma/Mab mutations extend reproductive span disproportionately to life span and act independently of known regulators of somatic aging, such as Insulin/IGF-1 Signaling and Dietary Restriction. This is the first discovery of a pathway that regulates reproductive span independently of longevity and the first identification of the TGF-beta Sma/Mab pathway as a regulator of reproductive aging. Our results suggest that longevity and reproductive span regulation can be uncoupled, although they appear to normally be linked through regulatory pathways.

Mutation update for the PORCN gene

DEFF Research Database (Denmark)

Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

2011-01-01

Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

Factor IX gene haplotypes in Amerindians.

Science.gov (United States)

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Glucokinase gene mutations (MODY 2) in Asian Indians.

Science.gov (United States)

Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

2014-03-01

Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

Directory of Open Access Journals (Sweden)

Claudia R. Bonini-Domingos

2003-06-01

Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

Science.gov (United States)

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

Science.gov (United States)

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Use of a multi-thermal washer for DNA microarrays simplifies probe design and gives robust genotyping assays

DEFF Research Database (Denmark)

Petersen, J.; Poulsen, Lena; Petronis, S.

2008-01-01

is called a multi-thermal array washer (MTAW), and it has eight individually controlled heating zones, each of which corresponds to the location of a subarray on a slide. Allele-specific oligonucleotide probes for nine mutations in the beta-globin gene were spotted in eight identical subarrays at positions......DNA microarrays are generally operated at a single condition, which severely limits the freedom of designing probes for allele-specific hybridization assays. Here, we demonstrate a fluidic device for multi-stringency posthybridization washing of microarrays on microscope slides. This device...

Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

Energy Technology Data Exchange (ETDEWEB)

Ross, J

1976-09-15

In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

Science.gov (United States)

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

NARCIS (Netherlands)

M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

1992-01-01

textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin

Hereditary mixed polyposis syndrome due to a BMPR1A mutation.

LENUS (Irish Health Repository)

O'Riordan, J M

2010-06-01

The conditions Juvenile Polyposis Syndrome (JPS) and Hereditary Mixed Polyposis Syndrome (HMPS) are associated with an increased risk of colorectal carcinoma. The genetic mechanisms which explain these conditions have until recently been poorly understood. Recent interest has focused on the transforming growth factor (TGF)-beta signalling pathway and, in particular, on mutations in the SMAD4 gene. However, not all cases of JPS and HMPS have mutations in SMAD4 and focus has now shifted to other components of the TGF-beta pathway to clarify the genetic mechanisms involved in these conditions. In this report, we describe the significance of a bone morphogenetic protein receptor type 1A gene mutation in an Irish family.

[FANCA gene mutation analysis in Fanconi anemia patients].

Science.gov (United States)

Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

2005-10-01

To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

Directory of Open Access Journals (Sweden)

Quan Li

Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

Mutated Genes in Schizophrenia Map to Brain Networks

Science.gov (United States)

... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

Spectrin interactions with globin chains in the presence of ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.

EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

Directory of Open Access Journals (Sweden)

Anita Nadkarni

2013-02-01

Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

The Role of KCNQ1 Mutations and Maternal Beta Blocker Use During Pregnancy in the Growth of Children With Long QT Syndrome

Directory of Open Access Journals (Sweden)

Heta Huttunen

2018-04-01

Full Text Available ObjectiveTwo missense mutations in KCNQ1, an imprinted gene that encodes the alpha subunit of the voltage-gated potassium channel Kv7.1, cause autosomal dominant growth hormone deficiency and maternally inherited gingival fibromatosis. We evaluated endocrine features, birth size, and subsequent somatic growth of patients with long QT syndrome 1 (LQT1 due to loss-of-function mutations in KCNQ1.DesignMedical records of 104 patients with LQT1 in a single tertiary care center between 1995 and 2015 were retrospectively reviewed.MethodsClinical and endocrine data of the LQT1 patients were included in the analyses.ResultsAt birth, patients with a maternally inherited mutation (n = 52 were shorter than those with paternal inheritance of the mutation (n = 29 (birth length, −0.70 ± 1.1 SDS vs. −0.2 ± 1.0 SDS, P < 0.05. Further analyses showed, however, that only newborns (n = 19 of mothers who had received beta blockers during pregnancy were shorter and lighter at birth than those with paternal inheritance of the mutation (n = 29 (−0.89 ± 1.0 SDS vs. −0.20 ± 1.0 SDS, P < 0.05; and 3,173 ± 469 vs. 3,515 ± 466 g, P < 0.05. Maternal beta blocker treatment during the pregnancy was also associated with lower cord blood TSH levels (P = 0.011 and significant catch-up growth during the first year of life (Δ0.08 SDS/month, P = 0.004. Later, childhood growth of the patients was unremarkable.ConclusionLoss-of-function mutations in KCNQ1 are not associated with abnormalities in growth, whereas maternal beta blocker use during pregnancy seems to modify prenatal growth of LQT1 patients—a phenomenon followed by catch-up growth after birth.

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

Directory of Open Access Journals (Sweden)

Najmaddin Saki

2013-09-01

Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

Effects of ultrasound on Transforming Growth Factor-beta genes in bone cells

Directory of Open Access Journals (Sweden)

J Harle

2005-12-01

Full Text Available Therapeutic ultrasound (US is a widely used form of biophysical stimulation that is increasingly applied to promote fracture healing. Transforming growth factor-beta (TGF-beta, which is encoded by three related but different genes, is known to play a major part in bone growth and repair. However, the effects of US on the expression of the TGF-beta genes and the physical acoustic mechanisms involved in initiating changes in gene expression in vitro, are not yet known. The present study demonstrates that US had a differential effect on these TGF-beta isoforms in a human osteoblast cell line, with the highest dose eliciting the most pronounced up-regulation of both TGF-beta1 and TGF-beta3 at 1 hour after treatment and thereafter declining. In contrast, US had no effect on TGF-beta2 expression. Fluid streaming rather than thermal effects or cavitation was found to be the most likely explanation for the gene responses observed in vitro.

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

Science.gov (United States)

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Diverse growth hormone receptor gene mutations in Laron syndrome.

Science.gov (United States)

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

Hb Presbyterian (HBB: c.327C>G) in a Nicaraguan Family.

Science.gov (United States)

Pernudy-Ubau, Allan; Salinas-Molina, Jaslyn; Requenez, Yaneris; Ortiz-Lopez, Marianela; Puller, Ann-Christin; García-Rosales, Kenia; Rodríguez-Estrada, Anaishelle; Rodríguez-Romero, Walter; Mejía-Baltodano, Gerardo; Luo, Hong-Yuan; Chui, David H K

2017-01-01

Hemoglobin (Hb) is the protein responsible for oxygen transportation. It is a tetrameric protein comprising two α- and two β-globin subunits. In the literature, a large number of mutations in the α- and β-globin genes have been documented. Among these mutations, Hb Presbyterian (HBB: c.327 C>G), is a naturally occurring mutant exerting low oxygen affinity. The C to G exchange (AAC>AAG) at codon 108 of the β-globin gene results in the substitution of asparagine by lysine. Here, we document the identification of HBB: c.327 C>G in a 6-year-old female patient and her father from Nicaragua and Cuba, respectively. The presence of the abnormal Hb was confirmed by cellulose acetate electrophoresis, high performance liquid chromatography (HPLC) and genomic DNA sequencing. The β-globin gene sequences for both, father and daughter, disclosed the heterozygous mutation at codon 108 to be Hb Presbyterian or HBB: c.327 C>G. The mutant Hb was previously reported in four families from North America, Germany, Japan and Spain, respectively. This is the fifth family carrying HBB: c.327 C>G described to date and the first report from Latin America.

Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Eitan Fibach

2017-12-01

Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression

Energy Technology Data Exchange (ETDEWEB)

Wang, Ming; Trim, Carol M.; Gullick, William J., E-mail: w.j.gullick@kent.ac.uk

2011-02-15

Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.

The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

Science.gov (United States)

Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

1996-09-01

To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

Gene mutations in children with chronic pancreatitis.

Science.gov (United States)

Witt, H

2001-01-01

In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

CTCF-mediated transcriptional regulation through cell type-specific chromosome organization in the β-globin locus

OpenAIRE

Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann

2012-01-01

International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...

Recent trends in the gene therapy of β-thalassemia

Directory of Open Access Journals (Sweden)

Finotti A

2015-02-01

Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

Mutation scanning of peach floral genes

Directory of Open Access Journals (Sweden)

Wilde H Dayton

2011-05-01

Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

Mutation update for the PORCN gene

NARCIS (Netherlands)

Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

2011-01-01

Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

Biochemical and molecular investigations on qualitative and quantitative Hb polymorphism in the river buffalo (Bubalus bubalis L. population reared in Southern Italy

Directory of Open Access Journals (Sweden)

Mario Iorio

2004-01-01

Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.

MUTATIONS IN CALMODULIN GENES

DEFF Research Database (Denmark)

2013-01-01

The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

Mutations of the Norrie gene in Korean ROP infants.

Science.gov (United States)

Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

2002-12-01

The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

Neonatal diabetes mellitus: description of two Puerto Rican children with KCNJ11 activating gene mutation.

Science.gov (United States)

Nieves-Rivera, Francisco; González-Pijem, Lilliam

2011-06-01

Neonatal diabetes mellitus (NDM) is a rare disorder. A one-month-old boy presented with vomiting, hyperglycemia (968 mg/dl [53.8 mmol/L]), severe acetonemia, and metabolic acidosis (pH 6.95, HCO3-4.2 mmol/L). A second child (three months of age) presented with upper respiratory tract symptoms and a plasma glucose level of 835 mg/dl, without acetonemia or acidosis. Both were hospitalized and managed with intravenous fluids and then discharged on insulin. Genetic testing identified the presence of the de nova V59M and E322K activating mutations in the KCNJ11 gene encoding the sulphonylurea/potassium channel (Kir6.2 subunit) of the insulin beta cell. Both patients were switched to glibenclamide and remain off insulin. To our knowledge, these are the first children in Puerto Rico identified with NDM secondary to a KCNJ11 activating mutation. We conclude that NDM secondary to KCNJ11/Kir6.2 activating mutations, although unusual, should be considered in similar cases since patients with these mutations could come off insulin.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

Science.gov (United States)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Gene mutations in hepatocellular adenomas

DEFF Research Database (Denmark)

Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

2015-01-01

is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

Insulin gene mutations resulting in early-onset diabetes: marked differences in clinical presentation, metabolic status, and pathogenic effect through endoplasmic reticulum retention

DEFF Research Database (Denmark)

Meur, Gargi; Simon, Albane; Harun, Nasret

2009-01-01

OBJECTIVE: Heterozygous mutations in the human preproinsulin (INS) gene are a cause of nonsyndromic neonatal or early-infancy diabetes. Here, we sought to identify INS mutations associated with maturity-onset diabetes of the young (MODY) or nonautoimmune diabetes in mid-adult life, and to explore...... the molecular mechanisms involved. RESEARCH DESIGN AND METHODS: The INS gene was sequenced in 16 French probands with unexplained MODY, 95 patients with nonautoimmune early-onset diabetes (diagnosed at ... with early-onset diabetes whose clinical presentation is compatible with MODY. These led to the production of (pre)proinsulin molecules with markedly different trafficking properties and effects on ER stress, demonstrating a range of molecular defects in the beta-cell....

DRUMS: a human disease related unique gene mutation search engine.

Science.gov (United States)

Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

2011-10-01

With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

Ancient genes establish stress-induced mutation as a hallmark of cancer.

Science.gov (United States)

Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

Screening for mutations in two exons of FANCG gene in Pakistani population.

Science.gov (United States)

Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

2017-06-01

Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

A Trp474Cys mutation in the alpha-subunit of beta-hexosaminidase causes a subacute encephalopathic form of G{sub M2} gangliosidosis, type 1

Energy Technology Data Exchange (ETDEWEB)

Petroulakis, E.; Cao, Z.; Salo, T. [Univ. of Manitoba, Winnipeg (Canada)] [and others

1994-09-01

Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affected brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.

Ins1 Cre knock-in mice for beta cell-specific gene recombination

OpenAIRE

Thorens Bernard; Tarussio David; Maestro Miguel Angel; Maestro Miguel Angel; Rovira Meritxell; Rovira Meritxell; Heikkilä Eija; Ferrer Jorge; Ferrer Jorge; Ferrer Jorge

2013-01-01

Aims/hypothesis Pancreatic beta cells play a central role in the control of glucose homeostasis by secreting insulin to stimulate glucose uptake by peripheral tissues. Understanding the molecular mechanisms that control beta cell function and plasticity has critical implications for the pathophysiology and therapy of major forms of diabetes. Selective gene inactivation in pancreatic beta cells, using the Cre-lox system, is a powerful approach to assess the role of particular genes in beta cel...

Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

Science.gov (United States)

Nakazawa, M; Wada, Y; Tamai, M

1998-04-01

To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

Science.gov (United States)

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

Mutations in the Norrie disease gene.

Science.gov (United States)

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

Directory of Open Access Journals (Sweden)

Takahashi Takashi

2007-04-01

Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy

Directory of Open Access Journals (Sweden)

Toshio Kahara

2012-01-01

Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.

Disulfiram generates a stable N,N-diethylcarbamoyl adduct on Cys-125 of rat hemoglobin beta-chains in vivo

DEFF Research Database (Denmark)

Erve, J C; Jensen, Ole Nørregaard; Valentine, H S

2000-01-01

residues each. MALDI-TOF MS analysis of two new globin species from DSF-treated rats collected by HPLC revealed increments of 99 Da above the mass of the unmodified chains (beta-2 and beta-3). In a separate experiment, the globin mixture was digested for 2 h with Glu-C and reanalyzed by MALDI-TOF MS....... Results showed a peptide at m/z 2716.3 having a mass 99 Da higher than a known Cys-containing peptide. Subsequently, the Glu-C digest was analyzed using Q-TOF tandem MS, enabling observation of the +4 charge state of the peptide with m/z 2716.3. This peptide was fragmented to produce y-sequence ions...

Advances in sarcoma gene mutations and therapeutic targets.

Science.gov (United States)

Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

2018-01-01

Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

Science.gov (United States)

Kim, Myeong Hee; Kang, So Young; Lee, Woo In

2017-05-01

The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

Science.gov (United States)

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks

Directory of Open Access Journals (Sweden)

Marcelo M. Santoro

2010-10-01

Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.

Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues

International Nuclear Information System (INIS)

Shakin, S.H.; Liebhaber, S.A.

1987-01-01

The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation

Elevated Hb A₂ Levels in a Patient with a Compound Heterozygosity for the (β⁺) -31 (A > G) and (β⁰) Codon 17 (A > T) Mutations Together with a Single α-Globin Gene.

Science.gov (United States)

Panyasai, Sitthichai; Jaiping, Kanokwan; Pornprasert, Sakorn

2015-01-01

We report the molecular and hematological feature of a Thai woman who had clinical diagnosis of β-thalassemia intermedia (β-TI). Hemoglobin (Hb) high performance liquid chromatography (HPLC) analysis identified Hb A (64.4%), Hb F (12.3%) and Hb A2/E (15.9%) with small peaks of Hb Bart's (γ4) and Hb H (β4). She was initially diagnosed as EA Bart's disease, which occurs from combination of Hb H disease and Hb E (HBB: c.79G > A) trait. However, the Hb analysis using capillary electrophoresis (CE) demonstrated no Hb E, 68.5% Hb A, 15.5% Hb F and 16.0% Hb A2. DNA analysis showed a compound heterozygosity for (β(+)) -31 (A > G) (HBB: c.-81A > G) and (β(0)) codon 17 (A > T) (HBB: c.52A > T) mutations and deletional Hb H (- -(SEA)/-α(3.7)). Thus, she was finally diagnosed with a combination of Hb H disease and compound heterozygosity of β(+)/β(0)-thalassemia (β(+)/β(0)-thal). The β-globin mutations could affect not only hematological parameters but also elevate the Hb A2 levels. These effects could not be ameliorated by the coinheritance of Hb H disease. Therefore, a better understanding of the effects of this combination on hematological analysis data will be useful for providing accurate diagnosis, genetic counseling, prevention and control programs of β-thalassemia major (β-TM).

Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

Directory of Open Access Journals (Sweden)

Fernanda Veronese Oliveira

2014-01-01

Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

Mutation analysis of the NRXN1 gene in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Onay H

2016-12-01

Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

Update of the androgen receptor gene mutations database.

Science.gov (United States)

Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

1999-01-01

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

Science.gov (United States)

Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

2005-04-01

The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

Science.gov (United States)

Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

2015-12-01

Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

Science.gov (United States)

Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

2017-01-01

Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

Science.gov (United States)

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

Clinical study of DMD gene point mutation causing Becker muscular dystrophy

Directory of Open Access Journals (Sweden)

Ji-qing CAO

2015-07-01

Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

Directory of Open Access Journals (Sweden)

D. S. Mikhaylenko

2016-01-01

Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

Science.gov (United States)

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Mutational analysis of the HGO gene in Finnish alkaptonuria patients

Science.gov (United States)

de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

1999-01-01

Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)

2011-09-10

Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

Association between nucleotide mutation of eNOS gene and serum ...

African Journals Online (AJOL)

Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

Gene mutation-based and specific therapies in precision medicine.

Science.gov (United States)

Wang, Xiangdong

2016-04-01

Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

Science.gov (United States)

Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

2013-01-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular identification of TEM-116 beta-lactamase gene in isolates ...

African Journals Online (AJOL)

Purpose: Purpose: To determine TEM-116 beta-lactamase gene prevalence in drug-resistant Pseudomonas aeruginosa isolates from Pakistan. Methods: Sequence analysis of TEM beta-lactamase isolates and their antibiotic susceptibility patterns were carried out. Quantitative bacteriostatic concentrations for commonly ...

Prenatal diagnosis of beta-thalassaemia: experience in a developing country.

Science.gov (United States)

Saxena, R; Jain, P K; Thomas, E; Verma, I C

1998-01-01

We present our experience with the amplification refractory mutation system (ARMS) for the prenatal diagnosis of beta-thalassaemia in 415 pregnancies of 360 women. Five mutations of the beta-thalassaemia gene common in Asian Indians accounted for 89.2 per cent and rare mutations for 7.2 per cent of all mutant chromosomes, while 3.3 per cent of chromosomes remained uncharacterized. Identical mutations were present in both parents in 43.2 per cent of cases, due to caste-based marriages in India. A confirmed diagnosis was given in 401 (98.3 per cent) cases, of which a complete diagnosis (whether the fetus was normal, a carrier, or homozygous) was possible in 391 (94.2 per cent) of the cases. In 15 couples, the mutation was identified in only one parent. In nine of these, the identified mutation was not present in the fetus, predicting normal/carrier status, while in five the identified mutation was present in the fetus, suggesting carrier/affected status. The abortion rate was 3.9 per cent. Pitfalls in diagnosis were failure of oligonucleotides to work, maternal contamination, and false paternity. The ARMS provides an inexpensive, robust and non-isotopic method for the prenatal diagnosis of beta-thalassaemia in India. Recommendations are outlined for establishing a prenatal diagnostic service in developing countries.

One-Step Biallelic and Scarless Correction of a β-Thalassemia Mutation in Patient-Specific iPSCs without Drug Selection

Directory of Open Access Journals (Sweden)

Yali Liu

2017-03-01

Full Text Available Monogenic disorders (MGDs, which are caused by single gene mutations, have a serious effect on human health. Among these, β-thalassemia (β-thal represents one of the most common hereditary hematological diseases caused by mutations in the human hemoglobin β (HBB gene. The technologies of induced pluripotent stem cells (iPSCs and genetic correction provide insights into the treatments for MGDs, including β-thal. However, traditional approaches for correcting mutations have a low efficiency and leave a residual footprint, which leads to some safety concerns in clinical applications. As a proof of concept, we utilized single-strand oligodeoxynucleotides (ssODNs, high-fidelity CRISPR/Cas9 nuclease, and small molecules to achieve a seamless correction of the β-41/42 (TCTT deletion mutation in β thalassemia patient-specific iPSCs with remarkable efficiency. Additionally, off-target analysis and whole-exome sequencing results revealed that corrected cells exhibited a minimal mutational load and no off-target mutagenesis. When differentiated into hematopoietic progenitor cells (HPCs and then further to erythroblasts, the genetically corrected cells expressed normal β-globin transcripts. Our studies provide the most efficient and safe approach for the genetic correction of the β-41/42 (TCTT deletion in iPSCs for further potential cell therapy of β-thal, which represents a potential therapeutic avenue for the gene correction of MGD-associated mutants in patient-specific iPSCs.

Novel mutations in the USH1C gene in Usher syndrome patients.

Science.gov (United States)

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

Science.gov (United States)

Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

2007-11-01

Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

A novel mutation of the fibrillin gene causing Ectopia lentis

Energy Technology Data Exchange (ETDEWEB)

Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

1994-02-01

Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

Science.gov (United States)

D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

2011-01-01

The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

New Mutation Identified in the SRY Gene High Mobility Group (HMG

Directory of Open Access Journals (Sweden)

Feride İffet Şahin

2013-06-01

Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

Energy Technology Data Exchange (ETDEWEB)

Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

1995-12-01

T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

Directory of Open Access Journals (Sweden)

Maryam Taghdiri

2017-08-01

Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

Science.gov (United States)

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

Science.gov (United States)

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

[Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

Science.gov (United States)

Mazur, G; Braunitzer, G

1984-09-01

The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

DNA mutation motifs in the genes associated with inherited diseases.

Directory of Open Access Journals (Sweden)

Michal Růžička

Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Science.gov (United States)

2010-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

Nanoparticles for Site Specific Genome Editing

Science.gov (United States)

McNeer, Nicole Ali

Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to

APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

NARCIS (Netherlands)

Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

1997-01-01

Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

Thalassemia and related hemoglobinopathies.

Science.gov (United States)

Sarnaik, Sharada A

2005-04-01

Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

Characterization of two Turkish beta-hexosaminidase mutations causing Tay-Sachs disease.

Science.gov (United States)

Ozkara, Hatice Asuman; Sandhoff, Konrad

2003-04-01

Two homoallelic mutations have recently been identified in the alpha-subunit of hexosaminidase A (EC 3.2.1.52) causing the infantile form of Tay-Sachs disease in Turkish patients. Both of these mutations, a 12 bp deletion (1096-1107 or 1098-1108 or 1099-1109) in exon 10 and a point mutation (G1362 to A, Gly454 to Asp) in exon 12, are located in the catalytic domain of the hexosaminidase alpha-chain. In order to determine whether these mutations affect the function of the catalytic domain or result in an instable protein, both mutant cDNAs were overexpressed in COS-1 cells. As judged by Western blotting, transfections of wild-type cDNA produced pro-alpha-chain and mature alpha-chain in parallel with a fivefold increase in cellular hexosaminidase activity using the synthetic substrate 4-methylumbelliferyl beta-N-acetylglucosamine 6-sulfate (MUGS). However, both mutants produced only pro-alpha-chains, although no mature form or detectable hexosaminidase activity towards two different synthetic substrates was observed. These data are consistent with the biochemical phenotype of infantile Tay-Sachs disease. We conclude that the overexpressed mutant pro-alpha-chains were misfolded and could not undergo further proteolytic processing to the active form of the enzyme in the lysosome.

Three novel and two known androgen receptor gene mutations ...

Indian Academy of Sciences (India)

gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

Law-medicine interfacing: patenting of human genes and mutations.

Science.gov (United States)

Fialho, Arsenio M; Chakrabarty, Ananda M

2011-08-01

Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

Science.gov (United States)

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

Science.gov (United States)

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

Science.gov (United States)

Jia, Peilin; Zhao, Zhongming

2014-02-01

A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

Science.gov (United States)

Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

2000-08-01

We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Regional and temporal differences in gene expression of LH(BETA)T(AG) retinoblastoma tumors.

Science.gov (United States)

Houston, Samuel K; Pina, Yolanda; Clarke, Jennifer; Koru-Sengul, Tulay; Scott, William K; Nathanson, Lubov; Schefler, Amy C; Murray, Timothy G

2011-07-23

The purpose of this study was to evaluate by microarray the hypothesis that LH(BETA)T(AG) retinoblastoma tumors exhibit regional and temporal variations in gene expression. LH(BETA)T(AG) mice aged 12, 16, and 20 weeks were euthanatized (n = 9). Specimens were taken from five tumor areas (apex, anterior lateral, center, base, and posterior lateral). Samples were hybridized to gene microarrays. The data were preprocessed and analyzed, and genes with a P 2.5 were considered to be differentially expressed. Differentially expressed genes were analyzed for overlap with known networks by using pathway analysis tools. There were significant temporal (P regional differences in gene expression for LH(BETA)T(AG) retinoblastoma tumors. At P 2.5, there were significant changes in gene expression of 190 genes apically, 84 genes anterolaterally, 126 genes posteriorly, 56 genes centrally, and 134 genes at the base. Differentially expressed genes overlapped with known networks, with significant involvement in regulation of cellular proliferation and growth, response to oxygen levels and hypoxia, regulation of cellular processes, cellular signaling cascades, and angiogenesis. There are significant temporal and regional variations in the LH(BETA)T(AG) retinoblastoma model. Differentially expressed genes overlap with key pathways that may play pivotal roles in murine retinoblastoma development. These findings suggest the mechanisms involved in tumor growth and progression in murine retinoblastoma tumors and identify pathways for analysis at a functional level, to determine significance in human retinoblastoma. Microarray analysis of LH(BETA)T(AG) retinal tumors showed significant regional and temporal variations in gene expression, including dysregulation of genes involved in hypoxic responses and angiogenesis.

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

Science.gov (United States)

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

The crtS gene of Xanthophyllomyces dendrorhous encodes a novel cytochrome-P450 hydroxylase involved in the conversion of beta-carotene into astaxanthin and other xanthophylls.

Science.gov (United States)

Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis

2006-04-01

The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to

A practical platform for blood biomarker study by using global gene expression profiling of peripheral whole blood.

Directory of Open Access Journals (Sweden)

Ze Tian

Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.

TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

Directory of Open Access Journals (Sweden)

T. W. Hoffman

2016-01-01

Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

Deep learning of mutation-gene-drug relations from the literature.

Science.gov (United States)

Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

2018-01-25

Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be

Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

NARCIS (Netherlands)

Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

2001-01-01

Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

International Nuclear Information System (INIS)

Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

1988-01-01

In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

Heterozygous ABCC8 mutations are a cause of MODY.

Science.gov (United States)

Bowman, P; Flanagan, S E; Edghill, E L; Damhuis, A; Shepherd, M H; Paisey, R; Hattersley, A T; Ellard, S

2012-01-01

The ABCC8 gene encodes the sulfonylurea receptor 1 (SUR1) subunit of the pancreatic beta cell ATP-sensitive potassium (K(ATP)) channel. Inactivating mutations cause congenital hyperinsulinism (CHI) and activating mutations cause transient neonatal diabetes (TNDM) or permanent neonatal diabetes (PNDM) that can usually be treated with sulfonylureas. Sulfonylurea sensitivity is also a feature of HNF1A and HNF4A MODY, but patients referred for genetic testing with clinical features of these types of diabetes do not always have mutations in the HNF1A/4A genes. Our aim was to establish whether mutations in the ABCC8 gene cause MODY that is responsive to sulfonylurea therapy. We sequenced the ABCC8 gene in 85 patients with a BMI MODY criteria, with two diagnosed after 25 years and one patient, who had no family history of diabetes, as a result of a proven de novo mutation. ABCC8 mutations can cause MODY in patients whose clinical features are similar to those with HNF1A/4A MODY. Therefore, sequencing of ABCC8 in addition to the known MODY genes should be considered if such features are present, to facilitate optimal clinical management of these patients.

Testes and brain gene expression in precocious male and adult maturing Atlantic salmon (Salmo salar

Directory of Open Access Journals (Sweden)

Houeix Benoit

2010-03-01

Full Text Available Abstract Background The male Atlantic salmon generally matures in fresh water upon returning after one or several years at sea. Some fast-growing male parr develop an alternative life strategy where they sexually mature before migrating to the oceans. These so called 'precocious' parr or 'sneakers' can successfully fertilise adult female eggs and so perpetuate their line. We have used a custom-built cDNA microarray to investigate gene expression changes occurring in the salmon gonad and brain associated with precocious maturation. The microarray has been populated with genes selected specifically for involvement in sexual maturation (precocious and adult and in the parr-smolt transformation. Results Immature and mature parr collected from a hatchery-reared stock in January were significantly different in weight, length and condition factor. Changes in brain expression were small - never more than 2-fold on the microarray, and down-regulation of genes was much more pronounced than up-regulation. Significantly changing genes included isotocin, vasotocin, cathepsin D, anamorsin and apolipoprotein E. Much greater changes in expression were seen in the testes. Among those genes in the testis with the most significant changes in expression were anti-Mullerian hormone, collagen 1A, and zinc finger protein (Zic1, which were down-regulated in precocity and apolipoproteins E and C-1, lipoprotein lipase and anti-leukoproteinase precursor which were up-regulated in precocity. Expression changes of several genes were confirmed in individual fish by quantitative PCR and several genes (anti-Mullerian hormone, collagen 1A, beta-globin and guanine nucleotide binding protein (G protein beta polypeptide 2-like 1 (GNB2L1 were also examined in adult maturing testes. Down-regulation of anti-Mullerian hormone was judged to be greater than 160-fold for precocious males and greater than 230-fold for November adult testes in comparison to July testes by this method. For

The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

OpenAIRE

Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

2014-01-01

As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

Science.gov (United States)

Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

2018-03-01

The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

Mutational analysis of the promoter and the coding region of the 5-HT1A gene

Energy Technology Data Exchange (ETDEWEB)

Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

1994-09-01

Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

Science.gov (United States)

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells

Directory of Open Access Journals (Sweden)