WorldWideScience

Sample records for bergstrom afb austin

  1. Bergstrom AFB, Austin, Texas. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1974-02-21

    9 8𔃿 9 8. 9 81 9 9 .( 99 . 9 9 .( 99W 99 9 9 .1 99 1 40U 87. 95.1 96.1 97. 98.498 . 98. 99. 99.1 99. 99.c 99. 99 . 99. U( t VDI 7 : 9 6. 97:1 V 98...1o0j 7 . 34 5,5k 7q.4 4,6~1. . Z.7,.8-20 20.1 13.1 . .0 9.4 7 j . . lo. .9 2,_f 𔃼l-2 340.5 8, 6 _ 0 3.o 4.1 4._ .1 2.4 11.9 3.2 2048 I , ! I I I

  2. Installation Restoration Program. Phase 2. Confirmation/Quantification Stage 1. Bergstrom AFB, Texas. Volume 2

    Science.gov (United States)

    1987-04-01

    it.fr CL SAtVOY CLAY ffm «aJlar *# «oo-y* CAttpt moist 1 afto-3o.1 ff <M J AQ21 ÄJJ 100 I 5 Of9 G-ftftVtL occr\\^ sr»J<<J, 5...r<. »* u«</ «<**#**/%* ***>4 ***" I>#K HaWat/e Jcvc-lvp*4<*t ä t/mflcfß»*cit a/*-*p 7 v-y-s *r l-S a 4-1*5 3b-?/-5 ck¥ ClAjf ffm ±il...Rick A. Belan Project Director RAB:sg Attachment H-120 ^«P^—iw^^,«--^-^*wg ATTACHMENT 1 H-121 mTS 6-: 1 I As -oi ^ acca - -03

  3. Estimating tree bole and log weights from green densities measured with the Bergstrom Xylodensimeter.

    Science.gov (United States)

    Dale R. Waddell; Michael B. Lambert; W.Y. Pong

    1984-01-01

    The performance of the Bergstrom xylodensimeter, designed to measure the green density of wood, was investigated and compared with a technique that derived green densities from wood disk samples. In addition, log and bole weights of old-growth Douglas-fir and western hemlock were calculated by various formulas and compared with lifted weights measured with a load cell...

  4. Austin's Urban Forest, 2014

    Science.gov (United States)

    David J. Nowak; Allison R. Bodine; Robert E. Hoehn; Christopher B. Edgar; Dudley R. Hartel; Tonya W. Lister; Thomas J. Brandeis

    2016-01-01

    An analysis of the urban forest in Austin, Texas, reveals that this area has an estimated 33.8 million trees with tree canopy that covers 30.8 percent of the city. The most common tree species are Ashe juniper, cedar elm, live oak, sugarberry, and Texas persimmon. Trees in Austin currently store about 1.9 million tons of carbon (7.0 million tons of carbon dioxide [CO...

  5. Water quality of Lake Austin and Town Lake, Austin, Texas

    Science.gov (United States)

    Andrews, Freeman L.; Wells, Frank C.; Shelby, Wanda J.; McPherson, Emma

    1988-01-01

    Lake Austin and Town Lake are located on the Colorado River in Travis County, central Texas, and serve as a source of water for municipal and industrial water supplies, electrical-power generation, and recreation for more than 500,000 people in the Austin metropolitan area. Lake Austin, located immediately downstream of Lake Travis, extends for more than 20 miles into the western edge of the city of Austin. Town Lake extends through the downtown area of the city of Austin for nearly 6 miles where the Colorado River is impounded by Longhorn Dam.

  6. Greening America's Capitals - Austin, TX

    Science.gov (United States)

    Report on the technical assistance project to help Austin, TX, develop a vision for the South Central Waterfront that incorporates green infrastructure to manage stormwater runoff, makes streets safer, and spurs investment.

  7. Results of Austin Moore replacement.

    Directory of Open Access Journals (Sweden)

    Jadhav A

    1996-04-01

    Full Text Available Forty cases of Austin Moore Replacement done for transcervical fractures of the femur in patients were reviewed after a period of 12 to 48 months postoperatively (mean 26 mth. 30 cases (75% had mild to severe pain of non-infective origin, starting as early as 6 months postoperatively. This was irrespective of the make, size or position (varus/valgus of the prosthesis. Though the Aufranc and Sweet clinical scoring was satisfactory in 65% cases, radiological evidence of complications like sinking, protrusion, etc. were seen in majority of the cases. Calcar resorption was seen in 34 cases (85% as early as 4 months postoperatively. Results of THR and bipolar replacement done for transcervical fractures in recent literature show 85% pain-free cases at 5 years. We feel that Austin Moore Replacement should be reserved for patients more than 65 years of age and those who are less active or debilitated because of other factors, because of increased acetabular wear with time in the younger individual. This is corroborated by unsatisfactory results in patients less than 65 years of age (p < 0.05.

  8. 75 FR 31677 - Amendment of Class E Airspace; Austin, TX

    Science.gov (United States)

    2010-06-04

    ...-1152; Airspace Docket No. 09-ASW-31] Amendment of Class E Airspace; Austin, TX AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Final rule. SUMMARY: This action amends Class E airspace for the Austin, TX... Procedures (SIAPs) at Austin Executive Airport, Austin, TX. The FAA is taking this action to enhance the...

  9. Lake Austin uranium deposit, Western Australia

    International Nuclear Information System (INIS)

    Heath, A.G.; Deutscher, R.L.; Butt, C.R.M.

    1984-01-01

    The Lake Austin uranium deposit is a calcrete type deposit in the Yilgarn Block, near Cue, in a catchment area of granitoids and greenstones. The uranium is in valley fill and the sediments of the Lake Austin playa. The mineralization occurs over 1 to 6 meter thickness close to the water table in calcrete overlying clays and/or weathered bedrock. The principal uranium mineral is carnotite. Waters in nearby channels have an uranium content of over 30 ppb. The chloride content of the water increases downstream in the nearby drainages, as does the uranium and vanadium content. (author)

  10. Cultivating Community Schools: Austin's Grassroots Effort

    Science.gov (United States)

    Dubin, Jennifer

    2015-01-01

    In 2007, Walter P. Webb Middle School faced a crisis. One evening in January, the superintendent at the time held a meeting at the school in Austin, Texas, to let students, parents, teachers, and community members know that at the end of the academic year, their school would close. Thanks to a new state law focused on accountability, the…

  11. Austin and Quine on the Dogmas

    Czech Academy of Sciences Publication Activity Database

    Tomeček, Marek

    2016-01-01

    Roč. 17, č. 1 (2016), s. 36-48 ISSN 1212-9097 R&D Projects: GA ČR(CZ) GAP401/11/0371 Institutional support: RVO:67985955 Keywords : analytic * a priori * Austin * Quine * reductionism * synthetic Subject RIV: AA - Philosophy ; Religion http://www.phil.muni.cz/journals/index.php/profil/article/view/1452

  12. Austin Community College Video Game Development Certificate

    Science.gov (United States)

    McGoldrick, Robert

    2008-01-01

    The Video Game Development program is designed and developed by leaders in the Austin video game development industry, under the direction of the ACC Video Game Advisory Board. Courses are taught by industry video game developers for those who want to become video game developers. The program offers a comprehensive approach towards learning what's…

  13. The Stephen F. Austin Experimental Forest

    Science.gov (United States)

    Cary C. Russell; Ronald E. Thill; David L. Kulhavy

    2002-01-01

    On December 14, 1944, the Seventy-Eighth United States Congress passed a bill that authorized the transfer of 2,560 acres in Nacogdoches County, Texas, to the research branch of the United States Forest Service (USFS). This land became the Stephen F. Austin Experimental Forest (SFAEF) on September 19. 1945. One of eighty-one federal experimental forests and ranges...

  14. Austin, Texas: Solar in Action (Brochure)

    Energy Technology Data Exchange (ETDEWEB)

    2011-10-01

    This brochure provides an overview of the challenges and successes of Austin, Texas, a 2007 Solar America City awardee, on the path toward becoming a solar-powered community. Accomplishments, case studies, key lessons learned, and local resource information are given.

  15. Environmental Assessment, Minuteman III and Peacekeeper Silo Elimination, Malmstrom AFB, Montana; F. E. Warren AFB, Wyoming; and Vandenberg AFB, California

    Science.gov (United States)

    2013-05-01

    Baccharis pilularis), California sagebrush (Artemisia californica), and poison hemlock ( Conium maculatum ) are common species in the area (Vandenberg AFB...spotted bat (Euderma maculatum ) and Preble’s shrew (Sorex preblei). Habitat for the spotted bat is most often in rough, rocky, semiarid, and arid

  16. Out of the Ordinary: Incorporating Limits with Austin and Derrida

    Science.gov (United States)

    Williams, Emma

    2014-01-01

    This article seeks to open up a re-examination of the relationship between thought and language by reference to two philosophers: John Austin and Jacques Derrida. While in traditional philosophical terms these thinkers stand far apart, recent work in the philosophy of education has highlighted the importance of Austin's work in a way that has…

  17. Community Solar Program Final Report for Austin Energy

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2013-02-10

    Austin Energy seeks to expand its portfolio of renewable programs with an innovative community solar program. The program provides an opportunity for Austin Energy's customers, who are unable or uninterested in installing solar on their own premises, to purchase solar power.

  18. Taking Art Personally: Austin, Performatives and Art

    Directory of Open Access Journals (Sweden)

    David Goldblatt

    2011-01-01

    Full Text Available This paper is an attempt to apply speech act theory to aesthetics. In particular, it purports to be a contribution to reception theory by drawing attention to certain similarities between the contextual structure of performatives and the structure of the reception of art. It hopes to locate the auditor or spectator of artworks in what J. L. Austin calls “the total context” to help explain how certain aspects of artworks can be taken personally, somehow being about and seemingly directed at “me.” It is one way the so-called paradox of fiction can be by-passed by showing how the emotive aspects of artworks are not primarily a matter of our caring about the fictional characters portrayed therein, but directly about members of the viewing or listening audience. Concentrating on the performatives of warnings and threats, this paper details the writings of Austin to help explain why some people can relate to characters or situations presented by art while others are barely moved.

  19. Preliminary studies of the biosynthesis of Austin

    International Nuclear Information System (INIS)

    Wicnienski, N.A.

    1979-01-01

    Aspergillus ustus is one of the most prevalent fungi in the soil. There are now two reports of the occurrence of toxin-producing strains of this fungus on stored foodstuffs. In addition, strains of A. ustus have been isolated along with Penicillium species from samples of South African cheeses. All A. ustus isolates tested were judged to be highly toxic to ducklings when grown on maize meal, however, the toxins involved were not isolated. Austin is the trivial name of one of the toxins made by the fungus found on stored food. Preliminary work to studying the biosynthesis of this compound using 13 C-labeled sodium acetate is reported here. The feasibility of the biosynthetic study was determined by feeding [1- 14 C]-sodium acetate to A. ustus cultures. The assignments made in the 13 C-nmr spectrum of Austin are shown. The lowest dilution factor obtained in [1- 14 C]-sodium acetate feeding experiments was 14. This dilution factor is sufficiently low to allow a successful feeding of [1,2- 13 C 2 ]-sodium acetate. A new metabolite of A. ustus, deacetylaustin, was isolated and identified. An alkaloid of unknown structure was also isolated from the fungus

  20. Quest Learning and Assessment, UT Austin

    Science.gov (United States)

    Lewis, Gerald; McDonald, Patsy; Hostetler, Rhonda

    2010-03-01

    Quest Learning & Assessment is an innovative web-based tool for instructors and students of math and science. Quest was created at The University of Texas at Austin to address educational challenges at one of the biggest universities in the country. It now serves a primary role in classes taught within UT's College of Natural Sciences. Quest covers subjects ranging from mathematics, chemistry, biology, physics, computer science and statistics. For instructors, Quest offers an easy way to create homework assignments, quizzes and exams with its extensive knowledge base. Since most questions have built-in variations Quest can create custom assignments for each student, which are automatically graded. Once solutions are available, students can read detailed explanations to questions and understand why their answer was correct or incorrect. Quest has graded over 30 million student responses and is now available to all education institutions.

  1. 75 FR 15360 - Proposed Amendment of Class E Airspace; Austin, TX

    Science.gov (United States)

    2010-03-29

    ...-1152; Airspace Docket No. 09-ASW-31] Proposed Amendment of Class E Airspace; Austin, TX AGENCY: Federal... proposes to amend Class E airspace in the Austin, TX area. Additional controlled airspace is necessary to accommodate new Standard Instrument Approach Procedures (SIAPs) at Austin Executive Airport, Austin, TX. The...

  2. 76 FR 73587 - Foreign-Trade Zone 183-Austin, Tx; Site Renumbering Notice

    Science.gov (United States)

    2011-11-29

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 183--Austin, Tx; Site... (Board Order 1366). FTZ 183 currently consists of 8 ``sites'' totaling some 2,818 acres in the Austin... Austin Enterprise Zone, located at Bolm Road and Gardner Road, Austin; Site 2 (50 acres)--Balcones...

  3. RadNet Air Data From Austin, TX

    Science.gov (United States)

    This page presents radiation air monitoring and air filter analysis data for Austin, TX from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.

  4. EnviroAtlas - Austin, TX - Ecosystem Services by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset presents environmental benefits of the urban forest in 750 block groups in Austin, Texas. Carbon attributes, temperature reduction,...

  5. Survey of Wastewater Discharge, Eielson AFB, Alaska, EHL(K) 73-24

    National Research Council Canada - National Science Library

    Thomas, Jerry F; Pauls, Chester F

    1973-01-01

    This report contains the results of a wastewater survey at Eielson AFB, Alaska, conducted by the USAF Environmental Health Laboratories, Kelly AFB, Texas and McClellan AFB, CA, between 22 and 27 June 1973...

  6. Level II Ergonomic Analyses, Dover AFB, DE

    Science.gov (United States)

    1999-02-01

    IERA-RS-BR-TR-1999-0002 UNITED STATES AIR FORCE IERA Level II Ergonomie Analyses, Dover AFB, DE Andrew Marcotte Marilyn Joyce The Joyce...Project (070401881, Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 4. TITLE AND SUBTITLE Level II Ergonomie Analyses, Dover...1.0 INTRODUCTION 1-1 1.1 Purpose Of The Level II Ergonomie Analyses : 1-1 1.2 Approach 1-1 1.2.1 Initial Shop Selection and Administration of the

  7. Ictal Ceretec studies - the Austin experience

    Energy Technology Data Exchange (ETDEWEB)

    Nerouppos, L.; Scott, A.M.; Parsons, K.; Mihalinac, D.S.; Munoz, P.; McKay, W.J. [Austin Hospital , Heidelberg, VIC (Australia). Departments of Nuclear Medicine and Neurology

    1998-06-01

    Full text: Ictal Ceretec studies play a major role in the patient work-up for surgery of focal epilepsy in the Comprehensive Epilepsy Program at the Austin Hospital. The validity of ictal Ceretec and the superior sensitivity of this technique for the detection of epileptic foci over post-ictal and inter-ictal studies are well documented. Over the past eight years our experience and close collaboration with the Comprehensive Epilepsy Program has led to the implementation of a streamlined program enabling ictal Ceretec to be performed on numerous patients. The patients on this program since October 1991 will be reviewed and quality assurance (QA) results will be addressed. Ceretec is stored in a special lead-lined container in the video monitoring rooms, together with a shielded syringe of freshly eluted pre-calibrated technetium. Once a seizure is detected, the medical staff prepare the Ceretec and inject the required volume, obtained from the pre-calibration sheet, through a previously inserted in-dwelling line. The ward staff record the time of injection, the estimated duration of the seizure, the clinical impression of the seizure and the suspected focus. The injection tray is brought to the department within thirty minutes, where the patient injected dose is determined and quality control is performed. The scan is performed on a triple-headed Trionix gamma camera and reported once EEG and video recordings obtained during the ictus confirm the nature of the seizure. The advantages of this program are numerous. Many modifications have been made to the program over the past three years, due to close inspection of the QA forms. Ward and nuclear medicine staff deal with problems promptly, ensuring an effective and efficient program

  8. Inverse IMRT workflow process at Austin health

    International Nuclear Information System (INIS)

    Rykers, K.; Fernando, W.; Grace, M.; Liu, G.; Rolfo, A.; Viotto, A.; Mantle, C.; Lawlor, M.; Au-Yeung, D.; Quong, G.; Feigen, M.; Lim-Joon, D.; Wada, M.

    2004-01-01

    Full text: The work presented here will review the strategies adopted at Austin Health to bring IMRT into clinical use. IMRT is delivered using step and shoot mode on an Elekta Precise machine with 40 pairs of 1cm wide MLC leaves. Planning is done using CMS Focus/XiO. A collaborative approach for RO's, Physicists and RTs from concept to implementation was adopted. An overview will be given of the workflow for the clinic, the equipment used, tolerance levels and the lessons learned. 1. Strategic Planning for IMRT 2. Training a. MSKCC (New York) b.ESTRO (Amsterdam) c.Elekta (US and UK) 3. Linac testing and data acquisition a. Equipment and software review and selection b. Linac reliability/geometric and mechanical checks c. Draft Patient QA procedure d. EPI Image matching checks and procedures 4. Planning system checks a. export of dose matrix (options) b. dose calculation choices 5. IMRT Research Initiatives a. IMRT Planning Studies, Stabilisation, On-line Imaging 6. Equipment Procurement and testing a. Physics and Linac Equipment, Hardware, Software/Licences, Stabilisation 7. Establishing a DICOM Environment a. Prescription sending, Image transfer for EPI checks b. QA Files 8. Physics QA (Pre-Treatment) a.Clinical plan review; DVH checks b. geometry; dosimetry checks; DICOM checks c. 2D Distance to agreement; mm difference reports; Gamma function index 9. Documentation a.Protocol Development i. ICRU 50/62 reporting and prescribing b. QA for Physics c. QA for RT's d. Generation of a report for RO/patient history. Copyright (2004) Australasian College of Physical Scientists and Engineers in Medicine

  9. 78 FR 40427 - Foreign-Trade Zone (FTZ) 183-Austin, Texas; Notification of Proposed Production Activity; Samsung...

    Science.gov (United States)

    2013-07-05

    ..., Texas; Notification of Proposed Production Activity; Samsung Austin Semiconductor, LLC (Semiconductors); Austin, Texas Samsung Austin Semiconductor, LLC (Samsung), operator of Subzone 183B, submitted a... June 26, 2013. Samsung currently has authority to produce semiconductor memory devices for export...

  10. 77 FR 52368 - Manufacturer of Controlled Substances; Notice of Registration; Austin Pharma, LLC.

    Science.gov (United States)

    2012-08-29

    ...; Notice of Registration; Austin Pharma, LLC. By Notice dated May 9, 2012, and published in the Federal Register on May 21, 2012, 77 FR 30027, Austin Pharma LLC., 811 Paloma Drive, Suite C, Round Rock, Texas... factors in 21 U.S.C. 823(a) and determined that the registration of Austin Pharma LLC., to manufacture the...

  11. 78 FR 64019 - Manufacturer of Controlled Substances, Notice of Registration, Austin Pharma, LLC.

    Science.gov (United States)

    2013-10-25

    ..., Notice of Registration, Austin Pharma, LLC. By Notice dated May 14, 2013, and published in the Federal Register on May 22, 2013, 78 FR 30332, Austin Pharma, LLC., 811 Paloma Drive, Suite C, Round Rock, Texas... this drug code is authorized for this registration. On August 9, 2013, Austin Pharma, LLC., withdrew...

  12. 40 CFR 81.134 - Austin-Waco Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Austin-Waco Intrastate Air Quality Control Region. 81.134 Section 81.134 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.134 Austin-Waco Intrastate Air Quality Control Region. The Austin-Waco...

  13. 76 FR 76810 - Public Notice for Waiver of Aeronautical Land-Use Assurance; Austin Straubel International...

    Science.gov (United States)

    2011-12-08

    ... Aeronautical Land-Use Assurance; Austin Straubel International Airport, Green Bay, WI AGENCY: Federal Aviation... the Austin Straubel International Airport, Green Bay, WI. Brown County, as sponsor of the airport, is... located on, or adjacent to, Austin Straubel International Airport. One parcel contains a roadway section...

  14. 78 FR 68814 - Subzone 183B; Authorization of Production Activity; Samsung Austin Semiconductor, LLC...

    Science.gov (United States)

    2013-11-15

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-70-2013] Subzone 183B; Authorization of Production Activity; Samsung Austin Semiconductor, LLC (Semiconductors); Austin, Texas On June 26, 2013, Samsung Austin Semiconductor, LLC submitted a notification of proposed export production activity to the...

  15. 75 FR 8742 - Notice of Inventory Completion: Stephen F. Austin State University, Nacogdoches, TX

    Science.gov (United States)

    2010-02-25

    ... DEPARTMENT OF THE INTERIOR National Park Service Notice of Inventory Completion: Stephen F. Austin... control of Stephen F. Austin State University, Nacogdoches, TX. The human remains and associated funerary..., which was under contract with Stephen F. Austin State University. In the early 1900s, human remains...

  16. Austin Community College District's P-16 Initiative Graduates America

    Science.gov (United States)

    Hensley, Mary; Madsen, Gary

    2010-01-01

    Austin Community College (ACC) District's P-16 Initiative supports partnerships with 30 school districts--reaching traditionally underserved students and bridging the gap between high school and college--so more Texas students can reach their educational goals. The P-16 Initiative is a constellation of efforts designed to provide broad-based…

  17. Making Health Easier: Active Living in Austin, TX PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2013-06-07

    A local Austin, Texas, woman started a walking group to make physical activity fun for herself and community.  Created: 6/7/2013 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 6/7/2013.

  18. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    International Nuclear Information System (INIS)

    Theumer, M.G.; Lopez, A.G.; Masih, D.T.; Chulze, S.N.; Rubinstein, H.R.

    2003-01-01

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H 2 O 2 , while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H 2 O 2 . These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins

  19. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Energy Technology Data Exchange (ETDEWEB)

    Theumer, M G; Lopez, A G; Masih, D T; Chulze, S N; Rubinstein, H R

    2003-04-15

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H{sub 2}O{sub 2}, while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H{sub 2}O{sub 2}. These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins.

  20. 77 FR 8806 - Foreign-Trade Zone 183-Austin, TX; Application for Reorganization Under the Alternative Site...

    Science.gov (United States)

    2012-02-15

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [Docket 8-2012] Foreign-Trade Zone 183--Austin... following sites: Site 1 (33 acres)--Interchange within the Austin Enterprise Zone, located at Bolm Road and Gardner Road, Austin; Site 2 (50 acres)--Balcones Research site located in north central Austin at the...

  1. AFB/open cycle gas turbine conceptual design study

    Science.gov (United States)

    Dickinson, T. W.; Tashjian, R.

    1983-09-01

    Applications of coal fired atmospheric fluidized bed gas turbine systems in industrial cogeneration are identified. Based on site-specific conceptual designs, the potential benefits of the AFB/gas turbine system were compared with an atmospheric fluidized design steam boiler/steam turbine system. The application of these cogeneration systems at four industrial plant sites is reviewed. A performance and benefit analysis was made along with a study of the representativeness of the sites both in regard to their own industry and compared to industry as a whole. A site was selected for the conceptual design, which included detailed site definition, AFB/gas turbine and AFB/steam turbine cogeneration system designs, detailed cost estimates, and comparative performance and benefit analysis. Market and benefit analyses identified the potential market penetration for the cogeneration technologies and quantified the potential benefits.

  2. A comprehensive worksite wellness program in Austin, Texas: partnership between Steps to a Healthier Austin and Capital Metropolitan Transportation Authority.

    Science.gov (United States)

    Davis, Lynn; Loyo, Karina; Glowka, Aerie; Schwertfeger, Rick; Danielson, Lisa; Brea, Cecily; Easton, Alyssa; Griffin-Blake, Shannon

    2009-04-01

    In 2003, Steps to a Healthier Austin was funded by the Centers for Disease Control and Prevention to implement chronic disease prevention and health promotion activities. We report Steps to a Healthier Austin's partnership with Health & Lifestyles Corporate Wellness, Inc (Health & Lifestyles), to provide a worksite wellness program for Capital Metropolitan Transportation Authority (Capital Metro), Austin's local transit authority. Capital Metro employs 1,282 people. In 2003, Health & Lifestyles was hired to help promote healthier lifestyles, increase employee morale, and combat rising health care costs and absenteeism rates. Health & Lifestyles provided consultations with wellness coaches and personal trainers, a 24-hour company fitness center, personalized health assessments, and preventive screenings. The program expanded to include healthier food options, cash incentives, health newsletters, workshops, dietary counseling, smoking cessation programs, and a second fitness center. Participants in the wellness program reported improvements in physical activity, healthy food consumption, weight loss, and blood pressure. Capital Metro's total health care costs increased by progressively smaller rates from 2003 to 2006 and then decreased from 2006 to 2007. Absenteeism has decreased by approximately 25% since the implementation of the program, and the overall return on the investment was calculated to be 2.43. Since the implementation of the wellness program in 2003, Capital Metro has seen a reduction in costs associated with employee health care and absenteeism.

  3. CloudSat Safety Operations at Vandenberg AFB

    Science.gov (United States)

    Greenberg, Steve

    2006-01-01

    CloudSat safety operations at Vendenberg AFB is given. The topics include: 1) CloudSat Project Overview; 2) Vandenberg Ground Operations; 3) Delta II Launch Vehicle; 4) The A-Train; 5) System Safety Management; 6) CALIPSO Hazards Assessment; 7) CALIPSO Supplemental Safeguards; 8) Joint System Safety Operations; 9) Extended Stand-down; 10) Launch Delay Safety Concerns; and 11) Lessons Learned.

  4. Environmental Assessment of Beale AFB Grazing Lease Program

    Science.gov (United States)

    2012-12-01

    Beale AFB will use livestock (cattle, sheep and goats ) on its properties throughout the year as needed for the control of noxious weeds, reduction...initiating a wildfire. California Farm Bureau Federation policy recognizes that grazing is the most practical and environmentally acceptable way to...Site Monitoring Well Installation and Annual Targeted Goat Grazing Project, Placer County, California. 21 September 2011.  

  5. Austin Children`s Museum ``Go Power`` project. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-10-01

    Go Power, was conceived as an interactive exhibit and related set of activities designed to promote in children and families an understanding and appreciation of energy concepts. Planned in 1990, the project culminated its first phase of activities with colorful, interactive exhibit about the pathways and transformations of energy, on display at the Austin Children`s Museum between February 5th and June 6th, 1993. The project was supported by the US Department of Energy, the National Science Foundation, the Lower Colorado River Authority and various local foundations and businesses. This report describes the process, product and outcomes of this project.

  6. Solid Freeform Fabrication Symposium Proceedings Held in Austin, Texas on August 9-11, 1993

    Science.gov (United States)

    1993-09-01

    di Produzione 1611 Headway Circle, Bldg 2 Austin TX 78712 Ed Economia DeirAzienda Austin TX 78754 Corso Duca Abruzzi 24 512 339-2922J fax: 512 339...Street Aeronautical Engineering & Mechanics Ed Economia DellAzienda Tucson AZ 85713 Troy NY 12180 Corso Duca Abruzzi 24 602 792-2616/ fax: 602 792

  7. 78 FR 30332 - Manufacturer of Controlled Substances, Notice of Application, Austin Pharma, Llc.

    Science.gov (United States)

    2013-05-22

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Manufacturer of Controlled Substances, Notice of Application, Austin Pharma, Llc. Pursuant to Sec. 1301.33(a), Title 21 of the Code of Federal Regulations (CFR), this is notice that on March 28, 2013, Austin Pharma, LLC., 811 Paloma Drive, Suite C...

  8. 77 FR 30027 - Manufacturer of Controlled Substances; Notice of Application; Austin Pharma, LLC.

    Science.gov (United States)

    2012-05-21

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Manufacturer of Controlled Substances; Notice of Application; Austin Pharma, LLC. Pursuant to Sec. 1301.33(a), Title 21 of the Code of Federal Regulations (CFR), this is notice that on April 11, 2012, Austin Pharma, LLC., 811 Paloma Drive, Suite C...

  9. 77 FR 44582 - Reorganization of Foreign-Trade Zone 183 Under Alternative Site Framework; Austin, TX

    Science.gov (United States)

    2012-07-30

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [Order No. 1843] Reorganization of Foreign-Trade Zone 183 Under Alternative Site Framework; Austin, TX Pursuant to its authority under the Foreign-Trade... Austin Customs and Border Protection port of entry, and FTZ 183's existing Sites 1 through 24 would be...

  10. The History of the Austin College Building and Old Main at Sam Houston State University

    Science.gov (United States)

    Singer, Erin; Shields, Samantha

    2017-01-01

    Austin Hall and Old Main serve as the heart of what is now Sam Houston State University. The buildings' rich histories help one to understand how Sam Houston State University and its proud teacher education heritage came to be. To begin with Austin Hall's story, the University's original building has a unique and interesting tale that journeys…

  11. 76 FR 16654 - Austin Western Railroad, L.L.C.-Lease and Operation Exemption-Capital Metropolitan Transportation...

    Science.gov (United States)

    2011-03-24

    ... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. FD 35456] Austin Western Railroad, L.L.C.--Lease and Operation Exemption-- Capital Metropolitan Transportation Authority Austin... be leased since 2007, pursuant to an operating agreement. See Austin W. R.R.--Operation Exemption...

  12. 77 FR 19521 - Prevailing Rate Systems; Redefinition of the Austin, TX and Waco, TX, Appropriated Fund Federal...

    Science.gov (United States)

    2012-04-02

    ... Austin, TX and Waco, TX, Appropriated Fund Federal Wage System Wage Areas AGENCY: U.S. Office of... final rule to redefine the geographic boundaries of the Austin, TX, and Waco, TX, appropriated fund... the Austin wage area to the Waco wage area. These changes are based on recent consensus...

  13. Designing Place-Based Interventions for Sustainability and Replicability: The Case of GO! Austin/VAMOS! Austin.

    Science.gov (United States)

    Hussaini, Aliya; Pulido, Carmen Llanes; Basu, Semonti; Ranjit, Nalini

    2018-01-01

    Place-based health efforts account for the role of the community environment in shaping decisions and circumstances that affect population well-being. Such efforts, rooted as they are in the theory that health is socially determined, mobilize resources for health promotion that are not typically used, and offer a more informed and robust way of promoting health outcomes within a community. Common criticisms of place-based work include the difficulty of replication , since engagement is so specific to a place, and limited sustainability of the work, in the absence of continued institutional structures, both within the community and supporting structures outside the community, to keep these initiatives resilient. This paper describes a place-based initiative, GO! Austin/VAMOS! Austin (GAVA), which was designed to harness the strengths of place-based work-namely, its specificity to place and community. From the start, the project was designed to balance this specificity with a focus on developing and utilizing a standardized set of evidence-informed implementation and evaluation approaches and tools that were flexible enough to be modified for specific settings. This was accompanied by an emphasis on leadership and capacity building within resident leaders, which provided for informed intervention and demand building capacity, but also for longevity as partners, philanthropic, and otherwise, moved in and out of the work.

  14. Designing Place-Based Interventions for Sustainability and Replicability: The Case of GO! Austin/VAMOS! Austin

    Directory of Open Access Journals (Sweden)

    Aliya Hussaini

    2018-03-01

    Full Text Available Place-based health efforts account for the role of the community environment in shaping decisions and circumstances that affect population well-being. Such efforts, rooted as they are in the theory that health is socially determined, mobilize resources for health promotion that are not typically used, and offer a more informed and robust way of promoting health outcomes within a community. Common criticisms of place-based work include the difficulty of replication, since engagement is so specific to a place, and limited sustainability of the work, in the absence of continued institutional structures, both within the community and supporting structures outside the community, to keep these initiatives resilient. This paper describes a place-based initiative, GO! Austin/VAMOS! Austin (GAVA, which was designed to harness the strengths of place-based work—namely, its specificity to place and community. From the start, the project was designed to balance this specificity with a focus on developing and utilizing a standardized set of evidence-informed implementation and evaluation approaches and tools that were flexible enough to be modified for specific settings. This was accompanied by an emphasis on leadership and capacity building within resident leaders, which provided for informed intervention and demand building capacity, but also for longevity as partners, philanthropic, and otherwise, moved in and out of the work.

  15. Building Energy Audit Report, for Hickam AFB, HI

    Energy Technology Data Exchange (ETDEWEB)

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.

    2010-09-30

    A building energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Hickam AFB, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This documents reports the results of that assessment.

  16. Final Environmental Assessment: Replace Hanscom AFB Middle School

    Science.gov (United States)

    2012-04-01

    2012 iv RFTA Reserve Forces Training Area SAPS Satellite Accumulation Points SF Square feet SIP State Implementation Plan SO2 Sulfur dioxide...Restoration Program (IRP), now called the Environmental Restoration Program ( ERP ). Subsequent discoveries increased the number of sites to 22. Each...EPA under CERCLA or by the Commonwealth of Massachusetts. No sites listed in the ERP for Hanscom AFB are located on or near the existing Middle

  17. Profiles in medical courage: causation and Austin Bradford Hill

    Directory of Open Access Journals (Sweden)

    Robbins RA

    2012-09-01

    Full Text Available Austin Bradford Hill was a British epidemiologist and statistician who is best remembered for two landmark pulmonary studies. He was the statistician on the Medical Research Council Streptomycin in Tuberculosis Trial. This is regarded as the first randomized clinical trial. The second was the demonstration of the connection between cigarette smoking and lung cancer. However, Hill’s most lasting contribution may be his establishment of a group of conditions necessary to provide adequate evidence of a causal relationship between an incidence and a consequence, widely known as the Bradford Hill Criteria of Causation. In this profile of medical courage we examine his remarkable background that led to the epidemiological equivalent of Koch’s postulates.

  18. Three Plays by Austin Clarke and the Commedia Tradition

    Directory of Open Access Journals (Sweden)

    Christopher Murray

    2011-08-01

    Full Text Available Commedia dell’arte influenced theatrical production styles in many European countries, Ireland being no exception, assimilating the influence through pantomime during colonial times. The drama of Austin Clarke (1896-1974 is usually examined in the context of Yeats’s plays and modern poetic drama. But among his plays are three little-known experimental pieces, The Kiss, The Second Kiss and The Third Kiss, which make use of four characters from the wider commedia tradition, Harlequin, Columbine, Pierrot and Pierrette and also self-consciously exploit the possibilities of romance, mischief and the carnivalesque for Clarke’s own poetic purposes. The aim of this essay is to show how Clarke’s use for his Lyric Theatre of themes and techniques derived from commedia dell’arte represents both a tribute to a specific international form and a critique in satirical terms of hypocrisies underlying Irish bourgeois society in the 1940s and after.

  19. Austin: austenitic steel irradiation E 145-02 Irradiation Report

    International Nuclear Information System (INIS)

    Genet, F.; Konrad, J.

    1987-01-01

    Safety measures for nuclear reactors require that the energy which might be liberated in a reactor core during an accident should be contained within the reactor pressure vessel, even after very long irradiation periods. Hence the need to know the mechanical properties at high deformation velocity of structure materials that have received irradiation damage due to their utilization. The stainless steels used in the structures of reactors undergo damage by both thermal and fast neutrons, causing important changes in the mechanical properties of these materials. Various austenitic steels available as structural materials were irradiated or are under irradiation in various reactors in order to study the evolution of the mechanical properties at high deformation velocity as a function of the irradiation damage rate. The experiment called AUSTIN (AUstenitic STeel IrradiatioN) 02 was performed by the JRC Petten Establishment on behalf of Ispra in support of the reactor safety programme

  20. EnviroAtlas - Austin, TX - Meter-Scale Urban Land Cover (MULC) Data (2010)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Austin, TX EnviroAtlas One Meter-scale Urban Land Cover (MULC) Data were generated from United States Department of Agriculture (USDA) National Agricultural...

  1. EnviroAtlas - Austin, TX - BenMAP Results by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset demonstrates the effect of changes in pollution concentration on local populations in 750 block groups in Austin, Texas. The US EPA's...

  2. Trip internalization and mixed-use development : a case study of Austin Texas.

    Science.gov (United States)

    2009-12-01

    The Capital Area Metropolitan Planning Organization (CAMPO) in the Austin, TX region is incorporating : a new regional growth concept, the Activity Centers for its Long-Range Transportation Plan. The planned : Activity Centers would present such feat...

  3. Department of Defense Base Structure Report (A Summary of DoD’s Real Property Inventory) Fiscal Year 2007 Baseline

    Science.gov (United States)

    2007-01-01

    Active 0 0 Austin Memorial AFRC Camp Mabry 3 72,525 0 0 1311 14.1 357 16 0Army Reserve 0 0 Bergstrom - ( Abia ) Austin 0 0 7 170,221 700 52.5 566 62...AFRC Camp Mabry 3 72,525 0 0 1311 14.1 357 16 0Army Reserve 0 0 Bergstrom - ( Abia ) Austin 0 0 7 170,221 700 52.5 566 62 0Army Guard 0 0* Camp Bullis

  4. Disentangling the cognitive components supporting Austin Maze performance in left versus right temporal lobe epilepsy.

    Science.gov (United States)

    Hocking, Julia; Thomas, Hannah J; Dzafic, Ilvana; Williams, Rebecca J; Reutens, David C; Spooner, Donna M

    2013-12-01

    Neuropsychological tests requiring patients to find a path through a maze can be used to assess visuospatial memory performance in temporal lobe pathology, particularly in the hippocampus. Alternatively, they have been used as a task sensitive to executive function in patients with frontal lobe damage. We measured performance on the Austin Maze in patients with unilateral left and right temporal lobe epilepsy (TLE), with and without hippocampal sclerosis, compared to healthy controls. Performance was correlated with a number of other neuropsychological tests to identify the cognitive components that may be associated with poor Austin Maze performance. Patients with right TLE were significantly impaired on the Austin Maze task relative to patients with left TLE and controls, and error scores correlated with their performance on the Block Design task. The performance of patients with left TLE was also impaired relative to controls; however, errors correlated with performance on tests of executive function and delayed recall. The presence of hippocampal sclerosis did not have an impact on maze performance. A discriminant function analysis indicated that the Austin Maze alone correctly classified 73.5% of patients as having right TLE. In summary, impaired performance on the Austin Maze task is more suggestive of right than left TLE; however, impaired performance on this visuospatial task does not necessarily involve the hippocampus. The relationship of the Austin Maze task with other neuropsychological tests suggests that differential cognitive components may underlie performance decrements in right versus left TLE. © 2013.

  5. Analogy in causal inference: rethinking Austin Bradford Hill's neglected consideration.

    Science.gov (United States)

    Weed, Douglas L

    2018-05-01

    The purpose of this article was to rethink and resurrect Austin Bradford Hill's "criterion" of analogy as an important consideration in causal inference. In epidemiology today, analogy is either completely ignored (e.g., in many textbooks), or equated with biologic plausibility or coherence, or aligned with the scientist's imagination. None of these examples, however, captures Hill's description of analogy. His words suggest that there may be something gained by contrasting two bodies of evidence, one from an established causal relationship, the other not. Coupled with developments in the methods of systematic assessments of evidence-including but not limited to meta-analysis-analogy can be restructured as a key component in causal inference. This new approach will require that a collection-a library-of known cases of causal inference (i.e., bodies of evidence involving established causal relationships) be developed. This library would likely include causal assessments by organizations such as the International Agency for Research on Cancer, the National Toxicology Program, and the United States Environmental Protection Agency. In addition, a process for describing key features of a causal relationship would need to be developed along with what will be considered paradigm cases of causation. Finally, it will be important to develop ways to objectively compare a "new" body of evidence with the relevant paradigm case of causation. Analogy, along with all other existing methods and causal considerations, may improve our ability to identify causal relationships. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. EnviroAtlas - Austin, TX - Ecosystem Services by Block Group

    Science.gov (United States)

    This EnviroAtlas dataset presents environmental benefits of the urban forest in 750 block groups in Austin, Texas. Carbon attributes, temperature reduction, pollution removal and value, and runoff effects are calculated for each block group using i-Tree models (www.itreetools.org), local weather data, pollution data, EPA provided city boundary and land cover data, and U.S. Census derived block group boundary data. This dataset was produced by the US Forest Service to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).

  7. Integrated geophysical investigations of Main Barton Springs, Austin, Texas, USA

    Science.gov (United States)

    Saribudak, By Mustafa; Hauwert, Nico M.

    2017-03-01

    Barton Springs is a major discharge site for the Barton Springs Segment of the Edwards Aquifer and is located in Zilker Park, Austin, Texas. Barton Springs actually consists of at least four springs. The Main Barton Springs discharges into the Barton Springs pool from the Barton Springs fault and several outlets along a fault, from a cave, several fissures, and gravel-filled solution cavities on the floor of the pool west of the fault. Surface geophysical surveys [resistivity imaging, induced polarization (IP), self-potential (SP), seismic refraction, and ground penetrating radar (GPR)] were performed across the Barton Springs fault and at the vicinity of the Main Barton Springs in south Zilker Park. The purpose of the surveys was two-fold: 1) locate the precise location of submerged conduits (caves, voids) carrying flow to Main Barton Springs; and 2) characterize the geophysical signatures of the fault crossing Barton Springs pool. Geophysical results indicate significant anomalies to the south of the Barton Springs pool. A majority of these anomalies indicate a fault-like pattern, in front of the south entrance to the swimming pool. In addition, resistivity and SP results, in particular, suggest the presence of a large conduit in the southern part of Barton Springs pool. The groundwater flow-path to the Main Barton Springs could follow the locations of those resistivity and SP anomalies along the newly discovered fault, instead of along the Barton Springs fault, as previously thought.

  8. 33 CFR 334.1130 - Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones.

    Science.gov (United States)

    2010-07-01

    ... Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. 334.1130 Section 334.1130 Navigation and... RESTRICTED AREA REGULATIONS § 334.1130 Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB... (WSMC) at Vandenberg AFB, California. (3) The impacting of missile debris from launch operations will...

  9. AFB-NETT - business opportunities for European biomass industry

    International Nuclear Information System (INIS)

    Higham, I.

    1997-01-01

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  10. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I. [ETSU, Oxfordshire (United Kingdom)

    1997-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  11. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I [ETSU, Oxfordshire (United Kingdom)

    1998-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  12. Aerospace medicine at Brooks AFB, TX: hail and farewell.

    Science.gov (United States)

    Nunneley, Sarah A; Webb, James T

    2011-05-01

    With the impending termination of USAF operations at Brooks Air Force Base (AFB) in San Antonio, TX, it is time to consider its historic role in Aerospace Medicine. The base was established in 1917 as a flight training center for the U.S. Army Air Service and in 1926 became home to its School of Aviation Medicine. The school moved to San Antonio's Randolph Field in 1931, but in 1959 it returned to Brooks where it occupied new facilities to support its role as a national center for U.S. Air Force aerospace medicine, including teaching, clinical medicine, and research. The mission was then expanded to encompass support of U.S. military and civilian space programs. With the abrupt termination of the military space program in 1969, research at Brooks focused on clinical aviation medicine and support of advanced military aircraft while continuing close cooperation with NASA in support of orbital spaceflight and the journey to the Moon. Reorganization in the 1990s assigned all research functions at Brooks to the Human Systems Division and its successors, leaving to USAFSAM the missions related to clinical work and teaching. In 2002 the USAF and the city of San Antonio implemented shared operation of Brooks as a "City-Base" in the hope of deflecting threatened closure. Nevertheless, under continuing pressure to consolidate military facilities in the United States, the 2005 Base Closure and Realignment Commission ordered Brooks closed by 2011, with its aerospace medicine functions relocated to new facilities at Wright-Patterson AFB in Dayton, OH.

  13. Concentrations of Polycyclic Aromatic Hydrocarbons (PAHs) and Major and Trace Elements in Simulated Rainfall Runoff from Parking Lots, Austin, Texas, 2003

    National Research Council Canada - National Science Library

    Mahler, Barbara J; Van Metre, Peter C; Wilson, Jennifer T

    2004-01-01

    Samples of creek bed sediment collected near seal-coated parking lots in Austin, Texas, by the City of Austin during 2001-02 had unusually elevated concentrations of polycyclic aromatic hydrocarbons (PAHs...

  14. 75 FR 8741 - Notice of Intent to Repatriate Cultural Items: Stephen F. Austin State University, Nacogdoches, TX

    Science.gov (United States)

    2010-02-25

    ...: Stephen F. Austin State University, Nacogdoches, TX AGENCY: National Park Service, Interior. ACTION... Act (NAGPRA), 25 U.S.C. 3005, of the intent to repatriate cultural items in the control of Stephen F... of Oklahoma, which was under contract with Stephen F. Austin State University. In 1957, 15 cultural...

  15. Polycyclic aromatic hydrocarbons (PAHs) in Austin sediments after a ban on pavement sealers

    Energy Technology Data Exchange (ETDEWEB)

    DeMott, R.P.; Gauthier, T.D.; Wiersema, J.M.; Crenson, G. [ENVIRON International, Tampa, FL (USA)

    2010-07-01

    Polycyclic aromatic hydrocarbon (PAH) concentrations were measured in stream sediments collected before and after a municipal ban on the use of coal-tar-based pavement sealers in Austin, Texas. Samples were collected in October 2005, prior to the ban, and again in April, 2008, approximately 2 years after the ban. Differences in total PAH concentrations between samples collected before and after the ban show no net change in PAH levels in Austin stream sediments. Results of hydrocarbon fingerprinting reveal subtle differences in PAH profiles that appear to reflect the effects of weathering rather than a change in PAH sources.

  16. Unusual way of loosened total hip arthroplasty treatment with an Austin Moore endoprosthesis

    Directory of Open Access Journals (Sweden)

    M Erceg

    2014-01-01

    Full Text Available A 65-year-old female patient with aseptic loosening of total cemented hip endoprosthesis and pathologic fracture of the femur at the level of the stem of endoprosthesis was presented. As no appropriate endoprosthesis was available due to the war in Croatia and war priority, the problem was managed by femur osteosynthesis and implantation of a partial Austin Moore hip endoprosthesis. The endoprosthesis is still functioning well (for 20 years.To the best of the author′s knowledge, nobody has ever treated problem like this using this alternative, an unconventional method, with an Austin Moore endoprosthesis.

  17. Nuclear analytical techniques with neutron beams at the Univ. of Texas at Austin

    International Nuclear Information System (INIS)

    Uenlue, K.; Wehring, B.W.

    1996-01-01

    Neutron beams produced by nuclear research reactors can be used for analytical chemical analysis by measuring nuclear radiation produced by neutron capture. Prompt gamma activation analysis (PGAA) and neutron depth profiling (NDP) are two such analytical techniques. For the last three decades, these techniques have been applied at a number of research reactors around the world. Within the last 4 yr, we have developed NDP and PGAA facilities at The University of Texas at Austin research reactor, a 1-MW TRIGA Mark II reactor. Brief descriptions of the facilities and summaries of activities for these analytical techniques at the University of Texas at Austin are provided in this paper

  18. Unusual way of loosened total hip arthroplasty treatment with an Austin Moore endoprosthesis.

    Science.gov (United States)

    Erceg, M; Becic, K

    2014-01-01

    A 65-year-old female patient with aseptic loosening of total cemented hip endoprosthesis and pathologic fracture of the femur at the level of the stem of endoprosthesis was presented. As no appropriate endoprosthesis was available due to the war in Croatia and war priority, the problem was managed by femur osteosynthesis and implantation of a partial Austin Moore hip endoprosthesis. The endoprosthesis is still functioning well (for 20 years).To the best of the author's knowledge, nobody has ever treated problem like this using this alternative, an unconventional method, with an Austin Moore endoprosthesis.

  19. Very High-Performance Advanced Filter Bank Analog-to-Digital Converter (AFB ADC) Project

    National Research Council Canada - National Science Library

    Velazquez, Scott

    1999-01-01

    ... of the art by using a parallel array of individual commercial off the shelf converters. The significant performance improvements afforded by the Advanced Filter Bank Analog to Digital Converter (AFB ADC...

  20. 75 FR 76699 - The University of Texas at Austin, et al.; Notice of Decision on Applications for Duty-Free Entry...

    Science.gov (United States)

    2010-12-09

    ... DEPARTMENT OF COMMERCE International Trade Administration The University of Texas at Austin, et al..., NW., Washington, DC. Docket Number: 10-064. Applicant: The University of Texas at Austin, Center for Electromechanics, Pickle Research Campus, 10100 Burnet Road, Building 133, Austin, Texas 78758-4497. Instrument...

  1. Burrowing Owl and Other Migratory Bird Mitigation for a Runway Construction Project at Edwards AFB

    OpenAIRE

    Hoehn, Amber L.; Hagan, Mark; Bratton, Mark

    2009-01-01

    Edwards Air Force Base (AFB) scheduled the construction of a runway in the spring of 2007. The runway would be in an area that contained migratory birds and their habitat. The construction project would be near Edwards AFB main runway and had the potential not only to impact species protected under the Migratory Bird Treaty Act (MBTA), including the burrowing owl (Athene cunicularia), but also to increase bird and wildlife–aircraft strike hazards in the active flightline areas. To discourage ...

  2. 76 FR 12788 - Environmental Impact Statement for a Proposed Urban Rail system in Austin, TX

    Science.gov (United States)

    2011-03-08

    ... Conference Center (Classroom 103 on first floor), 1900 University Avenue, Austin, TX 78705, Telephone (512...'' (Executive Order 11991, of May 24, 1977). Transit projects may also generate environmental benefits; these... evaluated potential route, technology, and investment alternatives. The CATS is posted on the project Web...

  3. The Austin High School Girls' Band of Chicago, Illinois: 1925-1956

    Science.gov (United States)

    Hash, Phillip M.

    2018-01-01

    The purpose of this study was to examine the history of the Austin High School (AHS) Girls' Band (AHSGB) of Chicago, Illinois, which existed from 1925 to 1956. This research focused on the band's (a) organization and leadership, (b) activities within the school and community, (c) relationship to the AHS Boys Band, and (d) efforts to challenge and…

  4. Information Sharing during the University of Texas at Austin Active Shooter/Suicide Event

    Science.gov (United States)

    Egnoto, Michael J.; Griffin, Darrin J.; Svetieva, Elena; Winslow, Luke

    2016-01-01

    Emergency response systems can be improved by investigating the motives and manner in which people share information during an active shooter crisis. This article analyzed survey data collected from undergraduate participants at The University of Texas at Austin who were enrolled during the fall of 2010 when an active shooter event occurred on…

  5. Youngswick-Austin versus distal oblique osteotomy for the treatment of Hallux Rigidus.

    Science.gov (United States)

    Viladot, Antonio; Sodano, Luca; Marcellini, Lorenzo; Zamperetti, Marco; Hernandez, Elsa Sanchez; Perice, Ramon Viladot

    2017-08-01

    Hallux Rigidus is the most common degenerative joint pathology of the foot. Several procedures are described for the management of this deformity. In this prospective study we compared Youngswick-Austin and distal oblique osteotomy in the treatment of grade II Hallux Rigidus, in terms of clinical outcomes, efficacy and complications. Forty-six patients (50 feet) with moderate Hallux Rigidus (Regnauld grade II) were recruited and operated between March 2009 and December 2012. Surgical technique was Youngswick-Austin osteotomy (Group A) or distal oblique osteotomy (Group B). Mean follow-up was 42.7 ±12.2 (range, 24-70) months. Both groups achieved significant improvement of AOFAS score and first metatarsophalangeal joint range of motion (p value Austin and distal oblique osteotomies provides subjective patient improvement and increases the first metatarsophalangeal joint range of motion. The results of grade II Hallux Rigidus treatment were comparable when using a Youngswick-Austin or distal oblique osteotomy. Level II, prospective comparative study. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. On Research-Minded Practitioners: A Response to McBeath and Austin

    Science.gov (United States)

    Yaffe, Joanne

    2015-01-01

    McBeath and Austin define the concept of research-minded practitioners, describe the organizational contexts, structures, and strategies for supporting this type of practitioner. Further, the authors propose a research agenda to establish effective organizational development strategies to support research-minded practitioners, align their efforts…

  7. Equal Partners. Austin Teenagers Learn To Expect Respect in Dating Relationships.

    Science.gov (United States)

    Harrison, Mary M.

    1997-01-01

    Describes the Teen Dating Violence Project, a 24-week program in the Austin (Texas) schools that offers single sex support groups for young men and women involved in violent relationships. Learning to build equitable and respectful relationships often involves unlearning gender stereotypes, but the program shows that attitudes can change. (SLD)

  8. 76 FR 77245 - Attwater Prairie Chicken National Wildlife Refuge, Austin and Colorado Counties, TX...

    Science.gov (United States)

    2011-12-12

    ...-FF02R06000] Attwater Prairie Chicken National Wildlife Refuge, Austin and Colorado Counties, TX... (EA) for Attwater Prairie Chicken National Wildlife Refuge (Refuge, NWR), located approximately 60... Prairie Chicken NWR draft CCP and EA'' in the subject line of the message. Fax: Attn: Monica Kimbrough...

  9. Reservoir fracture mapping using microearthquakes: Austin chalk, Giddings field, TX and 76 field, Clinton Co., KY

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.S.; Rutledge, J.T.; Gardner, T.L. [SPE, Richardson, TX (United States); Fairbanks, T.D.; Miller, M.E.; Schuessler, B.K. [Los Alamos National Lab., NM (United States)

    1996-11-01

    Patterns of microearthquakes detected downhole defined fracture orientation and extent in the Austin chalk, Giddings field, TX and the 76 field, Clinton Co., KY. We collected over 480 and 770 microearthquakes during hydraulic stimulation at two sites in the Austin chalk, and over 3200 during primary production in Clinton Co. Data were of high enough quality that 20%, 31% and 53% of the events could be located, respectively. Reflected waves constrained microearthquakes to the stimulated depths at the base of the Austin chalk. In plan view, microearthquakes defined elongate fracture zones extending from the stimulation wells parallel to the regional fracture trend. However, widths of the stimulated zones differed by a factor of five between the two Austin chalk sites, indicating a large difference in the population of ancillary fractures. Post-stimulation production was much higher from the wider zone. At Clinton Co., microearthquakes defined low-angle, reverse-fault fracture zones above and below a producing zone. Associations with depleted production intervals indicated the mapped fractures had been previously drained. Drilling showed that the fractures currently contain brine. The seismic behavior was consistent with poroelastic models that predicted slight increases in compressive stress above and below the drained volume.

  10. β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

    Science.gov (United States)

    Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

    2014-06-01

    Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

  11. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  12. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  13. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  14. Environmental Assessment: Conversion of the 820th Security Forces Group at Moody AFB, Georgia to a Contingency Response Group

    Science.gov (United States)

    2003-08-01

    Contingency Response Group (CRG) at Moody Air Force Base (AFB), GA . DESCRIPTION OF THE PROPOSED ACTION AND ALTERNATIVES. The United States Air Force...sinkhole formation. 3.5.3.3 Soils Moody AFB Moody AFB is located in the Tifton Upland District of the Lower Coastal Plain. In general, soils on...base. Arsenic, barium, chromium, copper, iron, selenium, and zinc have been found to be naturally occurring in the area. Predominant soils are Tifton

  15. Archive of Geosample Data and Information from the University of Texas at Austin (UT) Institute of Geophysics

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Metadata describing piston cores curated by Institute of Geophysics of the University of Texas at Austin (UT) collected from 1976 to 1978 were coded and contributed...

  16. Creating Value in Nonprofit-business Collaborations: New Thinking and Practice, by Austin James E. and Seitanidi M. May

    DEFF Research Database (Denmark)

    Mongelli, Luca; Rullani, Francesco

    2017-01-01

    Book Review of: Creating Value in Nonprofit-business Collaborations: New Thinking and Practice, by Austin James E. and Seitanidi M. May . San Francisco: John Wiley and Sons, 2014. 320 pp. ISBN: 978-1118531136.......Book Review of: Creating Value in Nonprofit-business Collaborations: New Thinking and Practice, by Austin James E. and Seitanidi M. May . San Francisco: John Wiley and Sons, 2014. 320 pp. ISBN: 978-1118531136....

  17. Comparison of background gamma-ray spectra between Los Alamos, New Mexico and Austin, Texas

    International Nuclear Information System (INIS)

    Horne, S.; Jackman, K.R.; Landsberger, S.

    2013-01-01

    Background counts in gamma-ray spectrometry are caused by a variety of sources. Among these are naturally occurring radioactive materials (NORM) in the environment, interactions from cosmic radiation, and contamination within the laboratory. High-purity germanium detectors were used to acquire long background spectra in Los Alamos, NM (elevation ∼7,300 feet) and Austin, TX (elevation ∼500 feet). This difference in elevation has a sizeable effect on background spectra due to cosmic interactions, such as (n,n') and (n,γ). Los Alamos also has a fairly high NORM concentration in the soil relative to Austin, and this gives way to various spectral interferences. When analyzing nuclear forensics samples, these background sources can have non-trivial effects on detection limits of low-level fission products. By accurately determining the influence that elevation and environment have on background spectra, interferences within various laboratory environments can be more accurately characterized. (author)

  18. Siting Urban Agriculture as a Green Infrastructure Strategy for Land Use Planning in Austin, TX

    Directory of Open Access Journals (Sweden)

    Charles M. Rogers

    2016-04-01

    Full Text Available Green infrastructure refers to a type of land use design that mimics the natural water cycle by using the infiltration capacities of vegetation, soils, and other natural processes to mitigate stormwater runoff. As a multifunctional landscape, urban agriculture should be seen as a highly beneficial tool for urban planning not only because of its ability to function as a green stormwater management strategy, but also due to the multiple social and environmental benefits it provides. In 2012, the city of Austin adopted a major planning approach titled the “Imagine Austin Comprehensive Plan” (IACP outlining the city’s vision for future growth and land use up to 2039. The plan explicitly addresses the adoption of green infrastructure as a target for future land use with urban agriculture as a central component. Addressing this area of land use planning will require tools that can locate suitable areas within the city ideal for the development of green infrastructure. In this study, a process was developed to create a spatially explicit method of siting urban agriculture as a green infrastructure tool in hydrologically sensitive areas, or areas prone to runoff, in east Austin. The method uses geospatial software to spatially analyze open access datasets that include land use, a digital elevation model, and prime farmland soils. Through this method a spatial relationship can be made between areas of high surface runoff and where the priority placement of urban farms should be sited as a useful component of green infrastructure. Planners or geospatial analysts could use such information, along with other significant factors and community input, to aid decision makers in the placement of urban agriculture. This spatially explicit approach for siting potential urban farms, will support the integration of urban agriculture as part of the land use planning of Austin.

  19. Austin's urban FIA: seamless rural to urban resource monitoring in Texas

    Science.gov (United States)

    Chris Edgar; Burl. Carraway

    2015-01-01

    In 2014 Urban Forest Inventory and Analysis (Urban-FIA) was implemented for the first time ever in Austin, Texas. Work was accelerated and a full complement of plots in the city was measured in six months. In 2015 results are to be released in an FIA report and data made available in a publicly accessible database. In this presentation we discuss the importance of...

  20. Annual Report on Electronics Research at The University of Texas at Austin.

    Science.gov (United States)

    1983-05-15

    Dimensional Information from Image and Motion Analysis." University of Texas Austin, Texas October 6, 1982 M. Fink, " Schopenhauer , Quantum Mechanics...Nonlinear Interactions During Natural Transition of a Wake." xxix PUBLICATIONS, TECHNICAL PRESENTATIONS, LECTURES AND REPORTS Los Alamos National Laboratory...filters. In particular, they present fundamental results on the nature of time-variant digital filters; they discuss the properties of the responses in

  1. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Eglin AFB, Florida

    Science.gov (United States)

    1981-10-01

    Okaloosa Co. 3-12 Crestview South Quadrangle, Florida-Okaloosa Co. -13 Mossy ead Quadrangle, Florida-Walton Co 3-14 E-1 EGUN AFB 4,h aa V, WRAMATIO...I) Um AYPM hIN1DS SP * So". AM T 0 Tou A is a O I. h E-2 ES ENGINEERING -SCIENCE V%777-7NN7 .7-7 EGUN AFB 0.4 .m ... (1) WMg LAN DOSAMU *Y* CO u...r Oumm *p S(S Ann~ Il~~O 0*aAMa 2-3 ES ENGINEER ING - SCIENCE EGUN AFB %Tt MAR ESTHER * : . . - . - ~ - ~ r W R G H T L A N D F I L L 3 SITE 0296

  2. The Ethical Justification of the Thesis that Separates Law from Morality Through John Austin

    Directory of Open Access Journals (Sweden)

    Galvão Rabelo

    2015-12-01

    Full Text Available The british legal philosopher John Austin stands at the threshold of the evolution of the legal positivist tradition. His work, which dates back to the first half of the 19th century, was especially important to establish the basic elements of this school of legal understanding. Among his contributions to the legal positivist doctrine, lies the creation of the thesis that separates morality from law. Under an ethical context, however, John Austin was an ardent utilitarian who defended the use of the principle of utility as the only rational criteria for the unveiling of superior moral standards (divine laws. Considering both dimensions of his understanding, it has long been wondered if his utilitarian ethics have influenced, somehow, his legal theory, especially in regards to the separation thesis. Said thesis, which is in the center of the legal positivist tradition, has been interpreted in different ways in contemporary legal debate. A particular branch, called ethical positivism, opened new perspectives to the study of this tradition, defending the legal positivism theory as a morally satisfactory theoretical model for the contemporary legal systems. Hence, using the main premise of ethical positivism (which states that there are moral reasons to defend the separation thesis as an interprative and methodological tool, this paper plans on revisiting the link between John Austins legal and ethical convictions, in order to comprehend what were the moral reasons which led him to defend the separation of what law is and what it should be.

  3. Surface to 90 km winds for Kennedy Space Center, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Johnson, D. L.; Brown, S. C.

    1979-01-01

    Bivariate normal wind statistics for a 90 degree flight azimuth, from 0 through 90 km altitude, for Kennedy Space Center, Florida, and Vandenberg AFB, California are presented. Wind probability distributions and statistics for any rotation of axes can be computed from the five given parameters.

  4. Finding No Significant Impact: Aircraft Weather Shelter at Laughlin AFB, TX

    Science.gov (United States)

    2004-06-01

    surface water flow is southeast into the Ro Grande and down toward the Gulf of Mexico. Lake Amistad reservoir, located approximately 12 miles northwest...characterized Lake Amistad reservoir as having excellent water quality (USAF, 1997). Laughlin AFB contains a total of 19 acres of surface water

  5. Relocation of the Air National Guard 176th Wing to Elmendorf AFB, Alaska

    Science.gov (United States)

    2007-09-01

    Park. Between 20 and 70 moose are estimated by Alaska Fish and Game to live on Elmendorf AFB, depending on the time of year, as portions of the herd ...also supports populations of small mammals including beaver (Castor canadensis), muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red

  6. Unusual way of loosened total hip arthroplasty treatment with an Austin Moore endoprosthesis

    OpenAIRE

    M Erceg; K Becic

    2014-01-01

    A 65-year-old female patient with aseptic loosening of total cemented hip endoprosthesis and pathologic fracture of the femur at the level of the stem of endoprosthesis was presented. As no appropriate endoprosthesis was available due to the war in Croatia and war priority, the problem was managed by femur osteosynthesis and implantation of a partial Austin Moore hip endoprosthesis. The endoprosthesis is still functioning well (for 20 years).To the best of the author′s knowledge, nobody has e...

  7. Final Confirmation Sampling and Analysis Report for the POL Yard, Sites SS-06 and ST-40, Wurtsmith AFB, Michigan

    National Research Council Canada - National Science Library

    1999-01-01

    .... Wurtsmith AFBCA and AFCEE/ERT had no comments on the draft final report. This report represents the final contract deliverable for the AFCEE Extended Bioventing Project at the Wurtsmith AFB POL Yard...

  8. Geodatabase design and characteristics of geologic information for a geodatabase of selected wells penetrating the Austin Group in central Bexar County, Texas, 2010

    Science.gov (United States)

    Pedraza, Diana E.; Shah, Sachin D.

    2010-01-01

    The U.S. Geological Survey, in cooperation with the San Antonio Water System, developed a geodatabase of geologic and hydrogeologic information for selected wells penetrating the Austin Group in central Bexar County, Texas. The Austin Group functions as an upper confining unit to the Edwards aquifer and is the thickest and most permeable of the Edwards aquifer confining units. The geologic and hydrogeologic information pertains to a 377-square-mile study area that encompasses central Bexar County. Data were compiled primarily from drillers' and borehole geophysical logs from federal, State, and local agencies and published reports. Austin Group characteristics compiled for 523 unique wells are documented (if known), including year drilled, well depth, altitude of top and base of the Austin Group, and thickness of the Austin Group.

  9. Environmental Assessment Construction of a New Hazardous Cargo Pad Davis-Monthan AFB

    Science.gov (United States)

    2002-11-07

    PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 355th Civil Engineer Squadron (CES/CEVA),710 Third Street,Davis-Monthan AFB,AZ,85707 8. PERFORMING...agency for certain projects. Details of the preparation of this EA are mandated by the Council of Enviromental Quality (CEQ) in the series of...Base, Tucson, Arizona." October 1996. James M. Montgomery, Consulting Engineers for US army Corps of Engineers , Omaha Dist., Apri11990

  10. Williams AFB, Arizona Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-10-21

    N;I 1-L 9AL CLIMATOLOGY BRANCH ~.w~ .’ ETAC LJS. H A~(I EATV UMDT 2 f wEATHER SERVICE/MAC SEE FIRST HUMDIT 2 114 1 LLIAMS AFB AZ 69-70,73-80 JUL...4622 USAPETAC ’ol 0-87-5(01.A) , I roFql CL,-RAL CLIMATOLOGY BRANCH EATV 2 AFETAC SRVIE/ACATIVE UUTO HUMIDITY SEE FIRST PAGE Z Cl)4 AILLIAMS AFS AZ

  11. Burden's on U! the Impact of the "Fisher v. University of Texas at Austin" Decision on K-16 Admissions Policies

    Science.gov (United States)

    Nguyen, David H. K.

    2014-01-01

    Using race as a factor in admissions policies was contested in "Fisher v. University of Texas at Austin." Although the U.S. Supreme Court firmly held in "Grutter v. Bollinger" that race can be considered among many factors in admitting students, the recent decision in "Fisher" has posed many questions and challenges…

  12. The Nation's Report Card Reading 2009 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2010

    2010-01-01

    Each district that participated in the National Assessment of Educational Progress (NAEP) 2009 Trial Urban District Assessment in reading receives a one-page snapshot report that presents key findings and trends in a condensed format. This report presents the results for Austin Independent School District's student achievement in reading. In 2009,…

  13. Geologic models and evaluation of undiscovered conventional and continuous oil and gas resources: Upper Cretaceous Austin Chalk

    Science.gov (United States)

    Pearson, Krystal

    2012-01-01

    The Upper Cretaceous Austin Chalk forms a low-permeability, onshore Gulf of Mexico reservoir that produces oil and gas from major fractures oriented parallel to the underlying Lower Cretaceous shelf edge. Horizontal drilling links these fracture systems to create an interconnected network that drains the reservoir. Field and well locations along the production trend are controlled by fracture networks. Highly fractured chalk is present along both regional and local fault zones. Fractures are also genetically linked to movement of the underlying Jurassic Louann Salt with tensile fractures forming downdip of salt-related structures creating the most effective reservoirs. Undiscovered accumulations should also be associated with structure-controlled fracture systems because much of the Austin that overlies the Lower Cretaceous shelf edge remains unexplored. The Upper Cretaceous Eagle Ford Shale is the primary source rock for Austin Chalk hydrocarbons. This transgressive marine shale varies in thickness and lithology across the study area and contains both oil- and gas-prone kerogen. The Eagle Ford began generating oil and gas in the early Miocene, and vertical migration through fractures was sufficient to charge the Austin reservoirs.

  14. The Nation's Report Card Reading 2009 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2010

    2010-01-01

    Each district that participated in the National Assessment of Educational Progress (NAEP) 2009 Trial Urban District Assessment in reading receives a one-page snapshot report that presents key findings and trends in a condensed format. This report presents the results for Austin Independent School District's student achievement in reading. In 2009,…

  15. 76 FR 70365 - Prevailing Rate Systems; Redefinition of the Austin, TX and Waco, TX, Appropriated Fund Federal...

    Science.gov (United States)

    2011-11-14

    ... 3206-AM50 Prevailing Rate Systems; Redefinition of the Austin, TX and Waco, TX, Appropriated Fund... the Federal Prevailing Rate Advisory Committee to best match the counties proposed for redefinition to... Prevailing Rate Advisory Committee (FPRAC), the national labor-management committee responsible for advising...

  16. Minority Student Academic Performance under the Uniform Admission Law: Evidence from the University of Texas at Austin

    Science.gov (United States)

    Niu, Sunny X.; Tienda, Marta

    2010-01-01

    The University of Texas at Austin administrative data between 1990 and 2003 are used to evaluate claims that students granted automatic admission based on top 10% class rank underperform academically relative to lower ranked students who graduate from highly competitive high schools. Compared with White students ranked at or below the third…

  17. The TEAMS Report, 1987. The Texas Educational Assessment of Minimum Skills in the Austin Independent School District.

    Science.gov (United States)

    Mangino, Evangelina

    The Texas Assessment of Minimum Skills (TEAMS) is a mandated criterion-referenced test administered to students in grades 1, 3, 5, 7, 9, and 11 in Texas public schools. This report by the Austin Independent School District (AISD) contains an executive summary of TEAMS results, an analysis of performance, and attachments. Among the major findings…

  18. GIS applications in eco-logical grant projects : peer exchange summary report Austin, TX July 22-23, 2009

    Science.gov (United States)

    2009-10-31

    This report provides a summary of a 1.5-day peer exchange convened with select recipients of FHWA's first Eco-Logical grant. The purpose of the exchange, which was held in Austin, TX, in July 2009, was to allow grant recipients the opportunity to sha...

  19. Personal Reflections on Austin MacCormick's 1931 Correctional Education Book: The Integration of Vocational, Academic, and Social Education

    Science.gov (United States)

    Mattucci, Robert

    2006-01-01

    The purpose of this article is to connect theories Austin MacCormick discussed in his 1931 book "The Education of Adult Prisoners" with examples from modern correctional education practice. The author began teaching an institutional plumbing class in 2000, equipped with an undergraduate degree in elementary education and a master's…

  20. On the notion of causality in medicine: addressing Austin Bradford Hill and John L. Mackie

    Directory of Open Access Journals (Sweden)

    Luís Fernando S. C. de Araújo

    2014-03-01

    Full Text Available Almost 50 years ago appeared the seminal article by Austin Bradford Hill where he presented parameters for inferring causes from statistical associations, which became known as Hill’s causal criteria. This was a milestone for the renewal of the idea of cause in medicine. Our article revisits his contribution in light of the ideas from the Australian philosopher John L. Mackie, whose important works on causality reached an audience distinct from Hill’s. We suggest that both the British epidemiologist and the Australian philosopher share the purpose of articulating probabilistic determinism and multi-causality, the first with a predominantly probabilistic model and the second with an analytical approach. This article explores the possible consequences of addressing these authors jointly in regard to causal inferences in medicine, especially in respect to mental disorders.

  1. Effects of storm-water runoff on water quality of the Edwards Aquifer near Austin, Texas

    Science.gov (United States)

    Andrews, Freeman L.; Schertz, Terry L.; Slade, Raymond M.; Rawson, Jack

    1984-01-01

    Analyses of samples collected from Barton Springs at approximately weekly Intervals and from Barton Creek and five wells in the Austin area during selected storm-runoff periods generally show that recharge during storm runoff resulted in significant temporal and area! variations in the quality of ground water in the recharge zone of the Edwards aquifer. Recharge during storm runoff resulted in significant increases of bacterial densities in the ground water. Densities of fecal coliform bacteria in samples collected from Barton Springs, the major point of ground-water discharge, ranged from less than 1 colony per 100 milliliters during dry weather in November 1981 and January and August 1982 to 6,100 colonies per 100 milliliters during a storm in May 1982. Densities of fecal streptococcal bacteria ranged from 1 colony per 100 miniliters during dry weather in December 1981 to 11,000 colonies per 100 miniliters during a storm in May 1982.

  2. Construction and characterization of the redesigned PGAA facility at The University of Texas at Austin

    International Nuclear Information System (INIS)

    Revay, Zs.; Harrison, R.K.; Alvarez, E.; Biegalski, S.R.; Landsberger, S.

    2007-01-01

    The prompt gamma activation analysis (PGAA) facility at The University of Texas at Austin (UT) has been redesigned and reconstructed. As a result of the new shielding of the system, the neutron (at all energies) and gamma-ray backgrounds have been reduced by more than an order of magnitude, considerably improving the signal-to-noise ratio for the characteristic peaks. The prompt gamma peaks from the construction materials have also been decreased, providing better detection limits for elements. The calibration of the new system is shown in detail. All these efforts significantly improved the sensitivity and reliability of the chemical analyses performed in the facility. The characteristics of the improved PGAA system are also presented

  3. Cyclotron-produced radioisotopes and their clinical use at the Austin PET Centre

    Energy Technology Data Exchange (ETDEWEB)

    Tochon-Danguy, H.J. [Centre for PET, Melbourne, VIC (Australia). Austin and Repatriation Medical Centre

    1997-12-31

    A Centre for Positron Emission Tomography (PET) has been established within the Department of Nuclear Medicine at the Austin and Repatriation Medical Centre in Melbourne. PET is a non-invasive technique based on the use of biologically relevant compounds labelled with short-lived positron-emitting radionuclides such as carbon-11, nitrogen-13, oxygen-15 and fluorine-18. The basic equipment consists of a medical cyclotron (10 MeV proton and 5 MeV deuteron), six lead-shielded hot cells with associated radiochemistry facilities and a whole body PET scanner. During its first five years of operation, the Melbourne PET Centre, has pursued a strong radiolabelling development program, leading to an ambitious clinical program in neurology, oncology and cardiology. This presentation will describe the basic principles of the PET technique and review the cyclotron-produced radioisotopes and radiopharmaceuticals. Radiolabelling development programs and clinical applications are also addressed. 30 refs., 1 tab., 1 fig.

  4. Cyclotron-produced radioisotopes and their clinical use at the Austin PET Centre

    International Nuclear Information System (INIS)

    Tochon-Danguy, H.J.

    1997-01-01

    A Centre for Positron Emission Tomography (PET) has been established within the Department of Nuclear Medicine at the Austin and Repatriation Medical Centre in Melbourne. PET is a non-invasive technique based on the use of biologically relevant compounds labelled with short-lived positron-emitting radionuclides such as carbon-11, nitrogen-13, oxygen-15 and fluorine-18. The basic equipment consists of a medical cyclotron (10 MeV proton and 5 MeV deuteron), six lead-shielded hot cells with associated radiochemistry facilities and a whole body PET scanner. During its first five years of operation, the Melbourne PET Centre, has pursued a strong radiolabelling development program, leading to an ambitious clinical program in neurology, oncology and cardiology. This presentation will describe the basic principles of the PET technique and review the cyclotron-produced radioisotopes and radiopharmaceuticals. Radiolabelling development programs and clinical applications are also addressed

  5. Nutrient and carbon availability influences on denitrification in the regulated Lower Colorado River, Austin

    Science.gov (United States)

    Spector, J.

    2016-12-01

    The Lower Colorado River in Austin, Texas receives nitrogen-rich runoff and treated wastewater effluent and is subject to periodic water releases from the Longhorn Dam, which cause fluctuations in groundwater stage downstream. This research examined groundwater denitrification at the Hornsby Bend riparian area (located approximately 24 km downstream of downtown Austin) and characterized how dam-induced hyporheic exchange affects denitrification rates. Conductivity, temperature, water level, and dissolved oxygen concentrations were measured continuously throughout flood pulses for six months using dataloggers installed in a transect of seven monitoring wells on the river bank. Hourly samples were collected using an autosampler in one monitoring well (MW-5) during various flood conditions during the six month monitoring period. Water samples were analyzed for total organic carbon, total nitrogen, anions (NO3- and NO2-), NH4+ concentrations, alkalinity, and specific ultraviolet absorbance (SUVA) to characterize dissolved organic matter. Following large flood events (up to 4 m of water level stage increase), average conductivity increased 300 µs/centimeter in MW-5 as the water level receded. Analysis of water samples indicated that NO3- reduction occurred as conductivity and alkalinity increased. In addition, NH4+ concentrations increased during high conductivity periods. Increased denitrification activity corresponded with high SUVA. High conductivity and alkalinity increase the availability of electron donors (HCO3- and CO32-) and enhances denitrification potential. Higher SUVA values indicate increased dissolved organic carbon aromaticity and corresponding NO3- reduction. Additionally, changes in dissolved organic matter lability indicate the residence times of possible reactive organic carbon in the riparian area. This study has implications for determining advantageous geochemical conditions for hyporheic zone denitrification following large flood events.

  6. Sobre a noção de causalidade na medicina: aproximando Austin Bradford Hill e John L. MackieOn the notion of causality in medicine: addressing Austin Bradford Hill and John L. Mackie

    OpenAIRE

    Araújo, Luís Fernando S. C. de; Dalgalarrondo, Paulo; Banzato, Cláudio E. M.

    2014-01-01

    Almost 50 years ago appeared the seminal article by Austin Bradford Hill where he presented parameters for inferring causes from statistical associations, which became known as Hill’s causal criteria. This was a milestone for the renewal of the idea of cause in medicine. Our article revisits his contribution in light of the ideas from the Australian philosopher John L. Mackie, whose important works on causality reached an audience distinct from Hill’s. We suggest that both the Bri...

  7. Mineral Physics Research on Earth's Core and UTeach Outreach Activities at UT Austin

    Science.gov (United States)

    Lin, J.; Wheat, A. J.

    2011-12-01

    Comprehension of the alloying effects of major candidate light elements on the phase diagram and elasticity of iron addresses pressing issues on the composition, thermal structures, and seismic features of the Earth's core. Integrating this mineral physics research with the educational objectives of the CAREER award was facilitated by collaboration with the University of Texas at Austin's premier teaching program, UTeach. The UTeach summer outreach program hosts three one-week summer camps every year exposing K-12th graders to university level academia, emphasizing math and science initiatives and research. Each week of the camp either focuses on math, chemistry, or geology. Many of the students were underrepresented minorities and some required simultaneous translation; this is an effect of the demographics of the region, and caused some language barrier challenges. The students' opportunity to see first-hand what it is like to be on a university campus, as well as being in a research environment, such as the mineral physics lab, helps them to visualize themselves in academia in the future. A collection of displayable materials with information about deep-Earth research were made available to participating students and teachers to disseminate accurate scientific knowledge and enthusiasm. These items included a diamond anvil cell and diagrams of the diamond crystal structure, the layers of the Earth, and the phases of carbon to show that one element can have very different physical properties purely based on differences in structure. The students learned how advanced X-ray and optical laser spectroscopies are used to study properties of planetary materials in the diamond anvil cell. Stress was greatly placed on the basic mathematical relationship between force, area, and pressure, the fundamental principle involved with diamond anvil cell research. Undergraduate researchers from the lab participated in the presentations and hands-on experiments, and answered any

  8. La jurisprudence de John Austin : A propos de The Province of Jurisprudence Determined et The Use of the Study of Jurisprudence

    OpenAIRE

    Guigue, Alexandre

    2010-01-01

    International audience; Although he played a significant part in the history of legal positivism, John Austin is not very well known in France. Successively a lawyer, a professor of jurisprudence and a Royal commissionner, he only published one book during his life, based on his lectures. In The Province of Jurisprudence Determined, Austin develops a concept of law which is, although influenced by the greatest english philosophers, very peculiar for the time. By reducing the subject of jurisp...

  9. Narrating the Racialization of Space in Austin, Texas and Nashville, Tennessee

    Directory of Open Access Journals (Sweden)

    Martha Norkunas

    2015-12-01

    Full Text Available Narrating the Racialization of Space in Austin, Texas and Nashville, Tennessee People of color in the United States have been obligated to move through public space in particular ways, dictated by law and social custom. Narrators create cognitive maps of movement in the city shaped by racial codes of behavior. The maps change over time as law and social custom changes. The fluidity of the maps is also influenced by status, gender, class, and skin tone. This paper examines a rich body of oral narratives co-created with African Americans from 2004 to 2014 focusing on how men and women narrate their concepts of racialized space. It moves from narratives about the larger landscape — the city — to smaller, more personal public places — the sidewalk and the store — to intimate sites of contact in the public sphere. Many of the narratives describe complex flows of controlled movement dictated by racial boundaries in the context of capitalism. The narratives form an urban ethnography of the power relations inscribed on the landscape by racializing movement in space.   Narracje o urasowieniu przestrzeni w Austin (Teksas i Nashville (Tennessee Nie-Biali w Stanach Zjednoczonych byli zmuszeni do poruszania się w przestrzeni publicznej w szczególny sposób, określony przez prawo i zwyczaj społeczny. W swoich narracjach badani tworzą mapy kognitywne ruchu w mieście, kształtowane przez rasowe kody zachowania. Mapy te zmieniały się w czasie pod wpływem zmian prawnych i zwyczajowych. Na płynność tych map wpływały także status, płeć, klasa i odcień koloru skóry. W artykule przeanalizowano bogaty zbiór relacji ustnych tak zwanych Afroamerykanów, zbieranych w latach 2004-2014; uwaga skupia się na tym, jak mężczyźni i kobiety opowiadają o swoim widzeniu przestrzeni urasowionej. Omówiono narracje o szerszej przestrzeni miasta, jak i węższej, skoncentrowanej na bardziej osobistych miejscach publicznych, takich jak sklep. Wiele

  10. Home Performance with ENERGY STAR: Utility Bill Analysis on Homes Participating in Austin Energy's Program

    Energy Technology Data Exchange (ETDEWEB)

    Belzer, D.; Mosey, G.; Plympton, P.; Dagher, L.

    2007-07-01

    Home Performance with ENERGY STAR (HPwES) is a jointly managed program of the U.S. Department of Energy (DOE) and the U.S. Environmental Protection Agency (EPA). This program focuses on improving energy efficiency in existing homes via a whole-house approach to assessing and improving a home's energy performance, and helping to protect the environment. As one of HPwES's local sponsors, Austin Energy's HPwES program offers a complete home energy analysis and a list of recommendations for efficiency improvements, along with cost estimates. To determine the benefits of this program, the National Renewable Energy Laboratory (NREL) collaborated with the Pacific Northwest National Laboratory (PNNL) to conduct a statistical analysis using energy consumption data of HPwES homes provided by Austin Energy. This report provides preliminary estimates of average savings per home from the HPwES Loan Program for the period 1998 through 2006. The results from this preliminary analysis suggest that the HPwES program sponsored by Austin Energy had a very significant impact on reducing average cooling electricity for participating households. Overall, average savings were in the range of 25%-35%, and appear to be robust under various criteria for the number of households included in the analysis.

  11. Estimating Natural Environmental Characteristics of Subsidized Households: A Case Study of Austin, Texas

    Directory of Open Access Journals (Sweden)

    Young-Jae Kim

    2015-09-01

    Full Text Available Compared to the traditional public housing program, the Low-Income Housing Tax Credit (LIHTC program has been regarded as a better tool to ensure the quality of housing structure for subsidized households and the mixing of incomes in neighborhoods. Previous studies related to LIHTC developments have solely focused on the relationships between subsidized households and socioeconomic environments, such as income, race, poverty, etc. Beyond the socioeconomic environments where subsidized households are located, there is a limited understanding about whether subsidized households experience healthier natural environments in their neighborhoods. This study aims to investigate whether LIHTC-subsidized housing neighborhoods provide adequate natural environments to the subsidized households in Austin, Texas, compared to the public housing households. We employ comparison t-tests and binomial logistic regression models. The results show that LIHTC households are significantly exposed to unhealthy natural environmental settings such as a lack of green vegetation and steep slopes while no statistical evidence is reported for public housing neighborhoods. Findings from this study may help policymakers and planners improve their understanding of whether subsidized housing developments offer better natural environments for disadvantaged populations and help them develop effective environmental intervention strategies to improve the quality of life of subsidized households.

  12. Infrared observations of Comet Austin (1990 V) by the COBE/Diffuse Infrared Background Experiment

    Science.gov (United States)

    Lisse, C. M.; Freudenreich, H. T.; Hauser, M. G.; Kelsall, T.; Moseley, S. H.; Reach, W. T.; Silverberg, R. F.

    1994-01-01

    Comet Austin was observed by the Cosmic Background Explorer (COBE)/Diffuse Infrared Background Experiment (DIRBE) with broadband photometry at 1-240 micrometers during the comet's close passage by Earth in 1990 May. A 6 deg long (6 x 10(exp 6) km) dust tail was found at 12 and 25 micrometers, with detailed structure due to variations in particle properties and mass-loss rate. The spectrum of the central 42 x 42 sq arcmin pixel was found to agree with that of a graybody of temperature 309 +/- 5 K and optical depth 7.3 +/- 10(exp -8). Comparison with IUE and ground-based obervations indicates that particles of radius greater than 20 micrometers predominate by surface area. A mass-loss rate of 510 (+510/-205) kg/s and a total tail mass of 7 +/- 2 x 10(exp 10) kg was found for a model dust tail composed of Mie spheres with a differential particle mass distribution dn/d log m approx. m(exp -0.63) and 2:1 silicate:amorphous carbon composition by mass.

  13. Measuring Vulnerable Population’s Healthy and Unhealthy Food Access in Austin, Texas

    Directory of Open Access Journals (Sweden)

    Junfeng Jiao

    2016-09-01

    Full Text Available Food deserts—areas with a significant low-income population experiencing low accessibility to healthy food sources—have been well studied in terms of their connection to obesity and its related health outcomes. Measuring food accessibility is the key component in food desert research. However, previous studies often measured food accessibility based on large geographic units (e.g. census tract, zip code with few transportation modes (e.g. driving or taking public transit and limited vulnerable population measures. This paper aims to demonstrate a new method to measure food access for different vulnerable population groups at a smaller geographic scale with different transportation modes. In detail, this paper improves on previous studies from the following three perspectives: (1 Measuring food accessibility with a smaller geographic scale: block group vs. census track which on average includes 1000 people vs. 4000 people; (2 Measuring food accessibility with different transportation modes: walking, biking, transit, and driving vs. driving only; and (3 Measuring food accessibility for different vulnerable population groups. The proposed method was tested in the city of Austin, which is the capital of Texas and the 11th largest city in the US, and measured people’s accessibility to both healthy and unhealthy food sources within the city. The methods can be applied to address food accessibility issues in other cities or regions.

  14. Twenty Years of One Astronomy Teacher Professional Development - The EXES Teacher Associate Program at UT Austin

    Science.gov (United States)

    Finkelstein, Keely; Hemenway, Mary Kay; Sneden, Chris; Lacy, John; Richter, Matthew J.; EXES Teacher Associates

    2018-01-01

    The Astronomy Department and McDonald Observatory at the University of Texas at Austin has and continues to offer a suite of different astronomy based K-12 teacher professional development programs. One of our longest running, and most successful programs, is reaching its 20th anniversary, the EXES Teacher Associate Program, which was started in 1998. The EXES Teacher Associate program features sustained and continued professional development opportunities for K-12 science and math educators. It consists of 6 times per year day-long meetings, coupled with other professional development opportunities provided at various times. In total, there are approximately 30 active members of the group currently, but more than 90 teachers have participated in this group over its 20 year history. The program has had astronomy education as its focus throughout its history, but different partnerships and collaborations with other programs have supported the group and have allowed for a variety of professional development opportunities and themes for educators to engage in. We will give an overview of this program, present evaluation data and teacher feedback related to program success and student impact, and highlight a few specific program opportunities that are unique and have been shown to be most impactful for participants.

  15. Edwin Austin Abbey's The Passage of the Hours: Astronomy as History

    Science.gov (United States)

    Ricci, P. L.

    2016-01-01

    The Passage of the Hours (1909-1911) in the Pennsylvania State Capitol at Harrisburg is one of the most original and least known astronomical ceilings in the United States. Designed by the American artist Edwin Austin Abbey (1852-1911) to complement the Italian Renaissance style architecture of the House of Representatives, the mural combines two classical traditions of representing the night sky: a celestial map with the constellations of the zodiac and the personifications of the Hours. Set in a shallow dome twenty-four feet in diameter, Abbey's constellation figures float in a dazzling firmament where the Milky Way streams between the Sun and the Moon. The artist placed the Horae of Greek mythology around the dome's circumference in the position of the numbers on an astronomical clock. In the tradition of Italian Renaissance architecture, the celestial ceiling in the House of Representatives was part of an iconographic program affirming the cosmological origin of a polity. The astronomical theme relates to Abbey's murals in the House Chamber of the first public reading of the Declaration of Independence in 1776 from David Rittenhouse's observatory in Philadelphia, which the astronomer constructed to study the transit of Venus in 1769. The artist included a portrait of Rittenhouse holding his telescope among the worthies in the adjacent mural of The Apotheosis of Pennsylvania. Contemporary as well as historical events encouraged Abbey's use of astronomical imagery: the depiction of a comet may record the much-anticipated return of Halley's Comet in 1910.

  16. PART I: Bioventing Pilot Test Work Plan for Fire Protection Training Area Site FY-03, Charleston AFB, South Carolina. PART II: Draft Interim Pilot Test Results Report for Fire Protection Training Area Site FT-03, Charleston AFB, South Carolina

    National Research Council Canada - National Science Library

    1993-01-01

    This site-specific work plan presents the scope of a bioventing pilot test for in situ treatment of fuel contaminated soils at the Fire Protection Training Area designated as Site FT-O3, Charleston Air Force Base (AFB), South Carolina...

  17. City of Austin: Green habitat learning project. A green builder model home project

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-01

    The purpose of the Year 14 UCETF project was to design and construct a residential structure that could serve as a demonstration facility, training site, and testing and monitoring laboratory for issues related to the implementation of sustainable building practices and materials. The Model Home Project builds on the previous and existing efforts, partially funded by the UCETF, of the City of Austin Green Builder Program to incorporate sustainable building practices into mainstream building activities. The Green Builder Program uses the term {open_quotes}green{close_quotes} as a synonym for sustainability. In the research and analysis that was completed for our earlier reports in Years 12 and 13, we characterized specific elements that we associate with sustainability and, thus, green building. In general, we refer to a modified life cycle assessment to ascertain if {open_quotes}green{close_quotes} building options reflect similar positive cyclical patterns found in nature (i.e. recyclability, recycled content, renewable resources, etc.). We additionally consider economic, human health and synergistic ecological impacts associated with our building choices and characterize the best choices as {open_quotes}green.{close_quotes} Our ultimate goal is to identify and use those {open_quotes}green{close_quotes} materials and processes that provide well for us now and do not compromise similar benefits for future generations. The original partnership developed for this project shifted during the year from a project stressing advanced (many prototypical) {open_quotes}green{close_quotes} building materials and techniques in a research and demonstration context, to off-the-shelf but underutilized {open_quotes}green{close_quotes} materials in the practical social context of using {open_quotes}green{close_quotes} technologies for low income housing. That project, discussed in this report, is called the Green Habitat Learning Project.

  18. A modified Austin/chevron osteotomy for treatment of hallux valgus and hallux rigidus.

    Science.gov (United States)

    Vasso, Michele; Del Regno, Chiara; D'Amelio, Antonio; Schiavone Panni, Alfredo

    2016-03-01

    The purpose of this brief paper is to present the preliminary results of a modified Austin/chevron osteotomy for treatment of hallux valgus and hallux rigidus. In this procedure, the dorsal arm of the osteotomy is performed orthogonal to the horizontal plane of the first metatarsal, the main advantage being that this allows much easier and more accurate multiplanar correction of first metatarsal deformities. From 2010 to 2013, 184 consecutive patients with symptomatic hallux valgus and 48 patients with hallux rigidus without severe metatarsophalangeal joint degeneration underwent such modified chevron osteotomy. Mean patient age was 54.9 (range 21-70) years, and mean follow-up duration was 41.7 (range 24-56) months. Ninety-three percent of patients were satisfied with the surgery. Mean American Orthopaedic Foot and Ankle Society (AOFAS) score improved from 56.6 preoperatively to 90.6 at last follow-up, and mean visual analog scale (VAS) pain score decreased from 5.7 preoperatively to 1.6 at final follow-up (p hallux valgus, mean hallux valgus angle decreased from 34.1° preoperatively to 6.2° at final follow-up, and mean intermetatarsal angle decreased from 18.5° preoperatively to 4.1° at final follow-up (p < 0.05). One patient developed postoperative transfer metatarsalgia, treated successfully with second-time percutaneous osteotomy of the minor metatarsals, whilst one patient had wound infection that resolved with systemic antibiotics. Level IV.

  19. Quaternary geologic map of the Austin 4° x 6° quadrangle, United States

    Science.gov (United States)

    State compilations by Moore, David W.; Wermund, E.G.; edited and integrated by Moore, David W.; Richmond, Gerald Martin; Christiansen, Ann Coe; Bush, Charles A.

    1993-01-01

    This map is part of the Quaternary Geologic Atlas of the United States (I-1420). It was first published as a printed edition in 1993. The geologic data have now been captured digitally and are presented here along with images of the printed map sheet and component parts as PDF files. The Quaternary Geologic Map of the Austin 4° x 6° Quadrangle was mapped as part of the Quaternary Geologic Atlas of the United States. The atlas was begun as an effort to depict the areal distribution of surficial geologic deposits and other materials that accumulated or formed during the past 2+ million years, the period that includes all activities of the human species. These materials are at the surface of the Earth. They make up the ground on which we walk, the dirt in which we dig foundations, and the soil in which we grow crops. Most of our human activity is related in one way or another to these surface materials that are referred to collectively by many geologists as regolith, the mantle of fragmental and generally unconsolidated material that overlies the bedrock foundation of the continent. The maps were compiled at 1:1,000,000 scale. In recent years, surficial deposits and materials have become the focus of much interest by scientists, environmentalists, governmental agencies, and the general public. They are the foundations of ecosystems, the materials that support plant growth and animal habitat, and the materials through which travels much of the water required for our agriculture, our industry, and our general well being. They also are materials that easily can become contaminated by pesticides, fertilizers, and toxic wastes. In this context, the value of the surficial geologic map is evident.

  20. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1983-07-22

    PERCENTACE FREQUENCY Of WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) 7- 2650 EIELSON AF6 AK 73-8? *pp ALL WEATHER ISO -1 700 (KNEED I .3 4.6 7. 10...HOURLY OBSERVATIONS) 7 265C EIELSON AFB AX 73-82 DEC mn~y.. .y.rm,Io u ii. n~lu Sr.m ALL kEATHER ISO -1700 CLAm -- IL.S T.) SPEED i( MEA (KNTS) 1 - 3...fis r, i- &hS.2? q i- 7 &S2 kL%- &.S-2. fq 7Sf..7:p U8000 7Z.1 73. 73. 73. 73. ?6 73. 73. 38?8le 73.8 73.8 73.8 73.81 73., 27000 ’ ,i. L.bi~2~~ 800 I 8t

  1. VLA limits for comets Austin (1982 VI) and P/Crommelin (1983n) - evidence for a diffuse OH halo

    International Nuclear Information System (INIS)

    Schenewerk, M.S.; Palmer, P.; Snyder, L.E.; De Pater, I.; Chicago Univ., IL; Illinois Univ., Urbana; California Univ., Berkeley)

    1986-01-01

    Unsuccessful searches of Comet Austin (1982 VI = 1982g) and Comet P/Crommelin (1983n) for 18 cm wavelength OH emission or absorption and for continuum emission have been made with the VLA. The results of the OH searches of both comets and the 2 cm wavelength continuum search for Comet P/Crommelin are given here. The detection of OH emission and absorption in both comets with single-element telescopes and the nondetection of OH with the VLA are interpreted as evidence for a diffuse OH halo. The nondetection of continuum emission supports the growing body of observational evidence against the conventional icy-grain halo theory. 20 references

  2. Desde los actos de habla de Austin a los actos comunicativos. Perspectivas desde Searle, Habermas y CREA

    OpenAIRE

    Soler Gallart, Marta; Flecha, Ramón

    2010-01-01

    El concepto de acto de habla ha sido una gran aportación de la filosofía del lenguaje al estudio de los procesos de comunicación que está tomando mayor importancia con el actual giro dialógico de las sociedades y las propias ciencias sociales. El desarrollo posterior que hizo Searle de las contribuciones de Austin fue tomado como el punto de partida de la concepción de actos de habla y actos comunicativos que Ha-bermas consideró una de las bases de su teoría de la acción comunicativa. Sin emb...

  3. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico. Final Environmental Impact Statement. Volume III: Comment Letters and Responses to Comments

    National Research Council Canada - National Science Library

    1998-01-01

    The Final Environmental Impact Statement analyzed the potential environmental consequences from the proposal to beddown 30 additional German Air Force Tornado aircraft and 640 personnel at Holloman Air Force Base (AFB) New Mexico...

  4. Monoclonal antibody anti-AFB1: scale-up in vitro for biotools development Anticorpo monoclonal antiAFB1: produção in vitro visando desenvolvimento de bioferramentas

    Directory of Open Access Journals (Sweden)

    Eiko Nakagawa Itano

    2010-12-01

    Full Text Available Aflatoxin B1 (AFB1 is a mycotoxin classified as group 1 (human carcinogen by International Agency for Research on Cancer - IARC, causing hazardous contamination in a wide variety of food and feed, where the monitoring depends on precision and accuracy of analytical method. The culture of AFB1 specific monoclonal antibody (mAb secreting hybridoma was performed for further development of immunochemical methods. The growth of hybridoma AF2 was carried out in RPMI medium + 15 % fetal bovine serum (FBS, as well as the same medium gradually amended with H-SFM medium (25, 50, 75 and 100 % H-SFM. The protein concentration in the culture supernatant ranged from 1.80 to 10.88 mg/mL. The culture amended with FBS-free synthetic H-SFM medium reached production of reagent with higher degree of purity and lower risk, in addition to lower protein content (2.29 mg/mL reached with 100 % H-SFM, which approaches the real content of pure mAb. The indirect competitive enzyme-linked immunosorbent assay (ic-ELISA and SDS-polyacrylamide gel electrophoresis (SDS-PAGE showed anti-AFB1 activity and IgG corresponding bands, respectively, indicating feasible application of mAb produced in 100, 75 and 50 % H-SFM for further use in the development of AFB1 detecting biotools. This mAb production can be an initial step that can supply the self-sufficient immune-reagent in the rapid diagnosis at national condition, which is essential in the food quality and safety.Aflatoxina B1 (AFB1 é uma micotoxina classificada pela International Agency for Research on Cancer - IARC no Grupo 1 (carcinógeno ao humano, responsável pelo perigo de contaminação em ampla variedade de alimento e ração, cujo monitoramento depende de metodologia analítica precisa e exata. O trabalho visou cultivo do hibridoma secretor de anticorpo monoclonal (AcM específico para AFB1 visando desenvolvimento de métodos imunoquímicos. Hibridoma AF2 foi cultivado em meio RPMI + 15 % de soro fetal bovino (SFB

  5. Mortality disparities among groups participating in an East Africa surveying expedition: the Herbert Henry Austin expedition of 1900-1901.

    Science.gov (United States)

    Imperato, Pascal James; Imperato, Gavin H; Imperato, Austin C

    2013-10-01

    In the late nineteenth and early twentieth centuries, a number of European expeditions traveled to the region of Lake Rudolf, now largely in northern Kenya. Although diverse in intent, many of these were undertaken in the interests of furthering colonial territorial claims. In 1900-1901, Major Herbert Henry Austin led a British expedition down to the lake from Khartoum in the north. Of the 62 African, Arab, and European members of this expedition, only 18 (29 %) arrived at its final destination at Lake Baringo in Kenya. Because of a confluence of adverse climatic, social, and political conditions, the expedition ran short of food supplies when it arrived at the northern end of the lake in April 1901. For the next 4 months, the members of the expedition struggled down the west side of the lake and beyond. The greatest mortality (91 %) occurred among the 32 African transport drivers who were the most marginally nourished at the outset of the trip. The lowest mortality among the Africans on the expedition (15 %) occurred among the members of the Tenth Sudanese Rifles Battalion, who had an excellent nutritional status at the start of the expedition. Major Austin himself suffered from severe scurvy with retinal hemorrhages which left him partially blind in his right eye. An analysis of the mortality rates among the groups that participated in this expedition was undertaken. This revealed that poor nutritional status at the start of the trip was predictive of death from starvation.

  6. Evaluation of heavy metal uptake in micropterus salmoides (Largemouth Bass) of Lake Austin, TX by neutron activation analysis

    International Nuclear Information System (INIS)

    Weaver, J.; Wilson, W.H.; Biegalski, S.R.F.; O'Kelly, D.J.

    2009-01-01

    Neutron activation analysis was used to investigate and quantify the level of heavy metal uptake in the marine environment of Lake Austin in Austin, TX. Specifically, the samples studied were largemouth bass, or micropterus salmoides. The presence of heavy metals in the food chain presents multiple hazards, mostly as a food hazard for those species that ingest the fish, namely humans. To measure the concentrations of heavy metals in various fish samples, the nuclear analytical technique of neutron activation analysis (NAA) was used. Both epithermal and thermal irradiations were conducted for the NAA to look for short and long-lived radioisotopes, respectively. The samples themselves consisted of liver and tissue samples for each of the fish caught. Each sample was freeze-dried and homogenized before irradiation and spectrum acquisition. The results showed that all levels of heavy metals were not sufficient enough to make the fish unsafe for eating, with the highest levels being found for iron and zinc. Gold was found to be at much higher concentrations in the younger fish and virtually non-existent in the larger of the samples. (author)

  7. Transcriptome, antioxidant enzyme activity and histopathology analysis of hepatopancreas from the white shrimp Litopenaeus vannamei fed with aflatoxin B1(AFB1).

    Science.gov (United States)

    Zhao, Wei; Wang, Lei; Liu, Mei; Jiang, Keyong; Wang, Mengqiang; Yang, Guang; Qi, Cancan; Wang, Baojie

    2017-09-01

    Aflatoxin produced by Aspergillus flavus or Aspergillus parasiticus fungi during grain and feed processing and storage. Aflatoxins cause severe health problems reducing the yield and profitability of shrimp cultures. We sought to understand the interaction between shrimp immunity and aflatoxin B1 (AFB1), analyzing transcriptome expression, antioxidant enzyme activity, and histological features of the hepatopancreas of shrimp fed with AFB1. From over 4 million high-quality reads, de novo unigene assembly produced 103,644 fully annotated genes. A total of 1024 genes were differentially expressed in shrimp fed with AFB1, being involved in functions, such as peroxidase metabolism, signal transduction, transcriptional control, apoptosis, proteolysis, endocytosis, and cell adhesion and cell junction. Upon AFB1 challenge, there were severe histological alterations in shrimp hepatopancreas. AFB1 challenge increased the activity of several antioxidant enzymes. Our data contribute to improve the current understanding of host-AFB1 interaction, providing an abundant source for identification of novel genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.

    Science.gov (United States)

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad

    2014-01-01

    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p6.85pg/mg albumin) had significantly elevated level of total bilirubin (pMalaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in order to assess aflatoxin exposure in the general population of Malaysia. Copyright © 2013 Elsevier GmbH. All rights reserved.

  9. Response of Intestinal Bacterial Flora to the Long-term Feeding of Aflatoxin B1 (AFB1) in Mice.

    Science.gov (United States)

    Yang, Xiai; Liu, Liangliang; Chen, Jing; Xiao, Aiping

    2017-10-12

    In order to investigate the influence of aflatoxin B1 (AFB1) on intestinal bacterial flora, 24 Kunming mice (KM mice) were randomly placed into four groups, which were labeled as control, low-dose, medium-dose, and high-dose groups. They were fed intragastrically with 0.4 mL of 0 mg/L, 2.5 mg/L, 4 mg/L, or 10 mg/L of AFB1 solutions, twice a day for 2 months. The hypervariable region V3 + V4 on 16S rDNA of intestinal bacterial flora was sequenced by the use of a high-flux sequencing system on a Miseq Illumina platform; then, the obtained sequences were analyzed. The results showed that, when compared with the control group, both genera and phyla of intestinal bacteria in the three treatment groups decreased. About one third of the total genera and one half of the total phyla remained in the high-dose group. The dominant flora were Lactobacillus and Bacteroides in all groups. There were significant differences in the relative abundance of intestinal bacterial flora among groups. Most bacteria decreased as a whole from the control to the high-dose groups, but several beneficial and pathogenic bacterial species increased significantly with increasing dose of AFB1. Thus, the conclusion was that intragastric feeding with 2.5~10 mg/mL AFB1 for 2 months could decrease the majority of intestinal bacterial flora and induce the proliferation of some intestinal bacteria flora.

  10. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 1: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  11. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 4, Appendixes E and F: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  12. Test Review: Gilliam, J. E. (2015), "Attention-Deficit/Hyperactivity Disorder Test" (2nd Ed) [Assessment Instrument]. Austin, TX: Pro-Ed.

    Science.gov (United States)

    Perdue, Elizabeth A.

    2016-01-01

    The "Attention-Deficit/Hyperactivity Disorder Test-Second Edition" (ADHDT-2) is published through Pro-Ed in Austin, Texas. It was formally published in 2014, following critical revisions of the ADHDT, the reportedly popular initial version of this test that was published in 1995. The ADHDT-2 purports to act as a screener for individuals…

  13. Proceedings 10th International Workshop on the ACL2 theorem prover and its applications (ACL2 2011), Austin TX, USA, November 3-4, 2011

    NARCIS (Netherlands)

    Hardin, D.S.; Schmaltz, J.

    2011-01-01

    This volume contains the proceedings of ACL2 2011, the International Workshop on the ACL2 Theorem Prover and its Applications. The workshop was held in Austin, Texas, USA, on November 3-4 2011. ACL2 2011 is the tenth in a series of workshops on the ACL2 Theorem Prover and its Applications. The

  14. Developing a model for effects of climate change on human health and health-environment interactions: Heat stress in Austin, Texas presentation

    Science.gov (United States)

    Background/Question/Methods In December, 2010, a consortium of EPA, Centers for Disease Control, and state and local health officials convened in Austin, Texas for a “participatory modeling workshop” on climate change effects on human health and health-environment int...

  15. Developing a model for effects of climate change on human health and health-environment interactions: Heat stress in Austin, Texas

    Science.gov (United States)

    Background/Question/Methods In December, 2010, a consortium of EPA, Centers for Disease Control, and state and local health officials convened in Austin, Texas for a “participatory modeling workshop” on climate change effects on human health and health-environment interactions. ...

  16. The University of Texas at Austin's Defense of Affirmative Action in "Fisher v. University of Texas": Lessons for Institutional Policies and Practices

    Science.gov (United States)

    Garces, Liliana M.

    2015-01-01

    In "Fisher v. University of Texas at Austin" (2013), the U.S. Supreme Court most recently recognized the right of universities to pursue a mission-centered interest in the educational benefits of student body diversity. The decision, however, also reminded institutions of the limited ways they are allowed to consider race in admissions…

  17. Transformación de la aflatoxina B1 de alimentos, en el cancerígeno humano, aducto AFB1-ADN

    Directory of Open Access Journals (Sweden)

    Magda Carvajal

    2013-01-01

    Full Text Available Las aflatoxinas (AF son metabolitos secundarios tóxicos principalmente de los hongos Aspergillus flavus y A. parasiticus, son potentes mutágenos y cancerígenos de alimentos y la exposición del hombre a ellas es continuo. Las AF se ligan al ADN, ARN y proteínas formando aductos AFB1-ADN que se acumulan por años y dañan desde los virus hasta el hombre. Es importante identificar y cuantificar estos aductos como biomarcadores de largo tiempo de riesgo de enfermedad, ya que originan mutaciones y cáncer, y están validados en animales y humanos. Las AF se activan en presencia del citocromo P450 como una molécula inestable 8,9 epóxido AFB1, que se liga al N7 de la guanina, y se transforma en los cancerígenos activos o aductos AFB1-Gua y, finalmente, en los aductos AFB1-FAPY y son una medida objetiva de la exposición humana a cancerígenos ambientales. Los aductos representan la exposición, absorción, distribución, metabolismo, reparación del ADN y cambio celular. Los temas tratados aquí son la formación de aductos AFB1-ADN, estudios in vitro e in vivo, exposición a una dieta con AFB1, efectos, desarrollo de cáncer y mutaciones en el gen supresor p53, rutas de exposición, vitaminas, tipos de aducto AFB1-ADN, metodología y su control.

  18. PAH concentrations in lake sediment decline following ban on coal-tar-based pavement sealants in Austin, Texas

    Science.gov (United States)

    Van Metre, Peter C.; Mahler, Barbara J.

    2013-01-01

    Recent studies have concluded that coal-tar-based pavement sealants are a major source of polycyclic aromatic hydrocarbons (PAHs) in urban settings in large parts of the United States. In 2006, Austin, TX, became the first jurisdiction in the U.S. to ban the use of coal-tar sealants. We evaluated the effect of Austin’s ban by analyzing PAHs in sediment cores and bottom-sediment samples collected in 1998, 2000, 2001, 2012, and 2014 from Lady Bird Lake, the principal receiving water body for Austin urban runoff. The sum concentration of the 16 EPA Priority Pollutant PAHs (∑PAH16) in dated core intervals and surficial bottom-sediment samples collected from sites in the lower lake declined about 44% from 1998–2005 to 2006–2014 (means of 7980 and 4500 μg kg–1, respectively), and by 2012–2014, the decline was about 58% (mean of 3320 μg kg–1). Concentrations of ∑PAH16 in bottom sediment from two of three mid-lake sites decreased by about 71 and 35% from 2001 to 2014. Concentrations at a third site increased by about 14% from 2001 to 2014. The decreases since 2006 reverse a 40-year (1959–1998) upward trend. Despite declines in PAH concentrations, PAH profiles and source-receptor modeling results indicate that coal-tar sealants remain the largest PAH source to the lake, implying that PAH concentrations likely will continue to decline as stocks of previously applied sealant gradually become depleted.

  19. [Austin's horizontal V-shaped sliding osteotomy of the metatarsal head [Chevron-osteotomy) in the treatment of hallux valgus].

    Science.gov (United States)

    Steinböck, G

    1996-08-01

    From 1983 to 1995, 1587 patients suffering from hallux abductovalgus were treated with the Austin bunionectomy. The operation consists of a medial exostosis removal, a V-shaped laterally directed displacement osteotomy of the metatarsal head, lateral release and medial reefing of the capsulo-ligamentous structures. Lateral transposition is facilitated by performing a sufficient lateral release consisting of dissection of the lateral metatarsophalangeal ligament and separation of the adductor tendon from the base of the phalanx and the lateral sesamoid. In the case of intermetatarsal angles greater than 15 degrees, the metatarsal-sesamoid ligament is also severed just above the lateral sesamoid. The periosteum is stripped in a limited fashion dorsally and toward the plantar, leaving its insertion at the metatarsal head intact. After this procedure, reposition of the metatarsal head onto the sesamoids is usually possible and is maintained by reconstruction of the medial metatarsal-sesamoid ligament. In the author's own research material, metatarsophalangeal angles larger than 50 degrees and intermetatarsal angles of over 20 degrees could be corrected. Pronation of the toe is usually corrected by tenotomy of the abductor tendon near the base of the phalanx. Avascular necrosis is extremely rare with a careful operative technique. In our extensive research material, four cases of AVN were recognized. Provided there is free motion of the joint (60-0-20), mild radiological signs of osteoarthritis are no contraindication for the operation. Even in the aged, good results can be achieved provided there are no trophic problems. The Austin bunionectomy has proved to be a versatile method for treating bunion problems. The possibility of transposing the metatarsal head laterally, toward the plantar, proximally and distally by altering the direction of the osteotomy, as well as tilting it medially or laterally, has made this osteotomy an invaluable tool for addressing various

  20. Radiopharmaceuticals in positron emission tomography: Radioisotope productions and radiolabelling procedures at the Austin and Repatriation Medical Centre

    Energy Technology Data Exchange (ETDEWEB)

    Tochon-Danguy, H.J.; Sachinidis, J.I.; Chan, J.G.; Cook, M. [Austin and Repatriation Medical Centre, Melbourne, VIC (Australia). Centre for Positron Emission Tomography

    1997-10-01

    Positron Emission Tomography (PET) is a technique that utilizes positron-emitting radiopharmaceuticals to map the physiology, biochemistry and pharmacology of the human body. Positron-emitting radioisotopes produced in a medical cyclotron are incorporated into compounds that are biologically active in the body. A scanner measures radioactivity emitted from a patient`s body and provides cross-sectional images of the distribution of these radiolabelled compounds in the body. It is the purpose of this paper to review the variety of PET radiopharmaceuticals currently produced at the Austin and Repatriation Medical Centre in Melbourne. Radioisotope production, radiolabelling of molecules and quality control of radiopharmaceuticals will be discussed. A few examples of their clinical applications will be shown as well. During the last five years we achieved a reliable routine production of various radiopharmaceuticals labelled with the four most important positron-emitters: oxygen-15 (t,{sub 1/2}=2min), nitrogen-13 (t{sub 1/2}= 10 min), carbon-11 (t{sub 1/2}=20 min) and fluorine-18 (t{sub 1/2}= 110 min). These radiopharmaceuticals include [{sup 15}O]oxygen, [{sup 15}O]carbon monoxide, [{sup 15}O]carbon dioxide, [{sup 15}O]water, [{sup 13}N]ammonia, [{sup 11}C]flumazenil, [{sup 11}C]SCH23390, [{sup 18}F]fluoromisonidazole and [{sup 18}F]fluoro-deoxy-glucose ([{sup 18}F]FDG). In addition, since the half life of [{sup 18}F] is almost two hours, regional distribution can be done, and the Austin and Repatriation Medical Centre is currently supplying [{sup 18}F]FDG in routine to other hospitals. Future new radiopharmaceuticals development include a [{sup 18}F]thymidine analog to measure cell proliferation and a [{sup 11}C]pyrroloisoquinoline to visualize serotonergic neuron abnormalities. (authors) 23 refs., 2 tabs.

  1. Radiopharmaceuticals in positron emission tomography: Radioisotope productions and radiolabelling procedures at the Austin and Repatriation Medical Centre

    International Nuclear Information System (INIS)

    Tochon-Danguy, H.J.; Sachinidis, J.I.; Chan, J.G.; Cook, M.

    1997-01-01

    Positron Emission Tomography (PET) is a technique that utilizes positron-emitting radiopharmaceuticals to map the physiology, biochemistry and pharmacology of the human body. Positron-emitting radioisotopes produced in a medical cyclotron are incorporated into compounds that are biologically active in the body. A scanner measures radioactivity emitted from a patient's body and provides cross-sectional images of the distribution of these radiolabelled compounds in the body. It is the purpose of this paper to review the variety of PET radiopharmaceuticals currently produced at the Austin and Repatriation Medical Centre in Melbourne. Radioisotope production, radiolabelling of molecules and quality control of radiopharmaceuticals will be discussed. A few examples of their clinical applications will be shown as well. During the last five years we achieved a reliable routine production of various radiopharmaceuticals labelled with the four most important positron-emitters: oxygen-15 (t, 1/2 =2min), nitrogen-13 (t 1/2 = 10 min), carbon-11 (t 1/2 =20 min) and fluorine-18 (t 1/2 = 110 min). These radiopharmaceuticals include [ 15 O]oxygen, [ 15 O]carbon monoxide, [ 15 O]carbon dioxide, [ 15 O]water, [ 13 N]ammonia, [ 11 C]flumazenil, [ 11 C]SCH23390, [ 18 F]fluoromisonidazole and [ 18 F]fluoro-deoxy-glucose ([ 18 F]FDG). In addition, since the half life of [ 18 F] is almost two hours, regional distribution can be done, and the Austin and Repatriation Medical Centre is currently supplying [ 18 F]FDG in routine to other hospitals. Future new radiopharmaceuticals development include a [ 18 F]thymidine analog to measure cell proliferation and a [ 11 C]pyrroloisoquinoline to visualize serotonergic neuron abnormalities. (authors)

  2. Evaluation of bromide mass discharge in a sandy aquifer at Vandenberg AFB, CA

    Science.gov (United States)

    Mackay, D. M.; Rasa, E.; Einarson, M.; Kaiser, P.; Chakraborty, I.; Scow, K. M.

    2009-12-01

    Side-by-side experiments were conducted by UC Davis research team at a former fuel station at Vandenberg Air Force Base (AFB) to evaluate the rate of transformation of methyl tert-butyl ether (MTBE) to tert-butyl alcohol (TBA) impacted by ethanol and to investigate evidence of TBA degradation under sulfate reducing conditions. On one side we injected groundwater amended with ethanol and MTBE. In the other lane we injected groundwater amended with TBA. On both sides, injected ground water was spiked with bromide tracer to provide estimates of groundwater flow direction variations, flow velocity, dispersion, and mobile mass loss resulting from diffusive sequestration into aquitards. 162 monitoring wells were aligned into seven transects located downgradient of the injection wells. The mass discharge approach was used to evaluate the natural attenuation of the injected constituents. In this talk we will focus on calculations of mass discharge of the bromide tracer at each of the seven monitoring well transects. The amount of bromide mass discharged through each transect was calculated for any sampling time using field measurements of break through curves. Cumulative mass discharges were estimated and, by iteration based on mass balance, the flow properties of the aquifer were estimated. The calibration process resulted in subtle but quantitatively important changes in our assumptions regarding key physical properties of the aquifer (thickness, porosity) which could be only approximately estimated by standard methods (coring, CPT, etc.). On the basis of this calibration, a more robust approach was devised for evaluating the source and fate of TBA in the aquifer.

  3. Frequency of sputum positive AFB cases among patients of pulmonary tuberculosis in tertiary care hospitals of northern Pakistan

    International Nuclear Information System (INIS)

    Khattak, M.I.; Zaman, M.; Ihsanullah; Muhammad, A.; Khan, N.

    2010-01-01

    Objective: This study was aimed to find out the frequency of sputum positive Acid Fast Bacilli (AFB) cases among pulmonary tuberculosis patients and to determine those patients who are the potential source of transmitting infection. Methods: This study was conducted in four medical units of Khyber Teaching Hospital, Peshawar and Chest Unit, Ayub Teaching Hospital, Abbottabad in collaboration with the pathology unit of Khyber Teaching Hospital, Peshawar, and Kohat Institute of Medical Sciences, Kohat. Three specimens of sputum were collected for three consecutive days in the morning and were transported immediately to the laboratory along with full details of the patients. Results: Out of two hundred total patients studied, 104 patients (52%) were sputum AFB positive. Among the 104 patients 60 patients (57.4%) were females. Sixty-four (61.52%) individuals were between 20-50 years. Majority of the patients were from poor, deprived and lower social class. Fifty-two (50%) patients had monthly income of less than Rs. 4,000; only 8 patients (7.67%) had monthly income of more than Rs. 12,000). Forty-eight patients <46.12% were house wives, 10 patients (9.61%) were unemployed. Most of the patients were under weight for their age and height. 24 patients (23.06%) were below 42 kg. The maximum (53.84%) number of patients was in weight range of 43-50 kg. Conclusion: Sputum AFB positive pulmonary tuberculosis is more in individuals of low socioeconomic group and in females. The patients put their children and family members at risk of tuberculosis infection. For the control of this disease early diagnosis of active disease and their treatment under supervision is important. (author)

  4. Pope AFB, Fayetteville, North Carolina Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-06-01

    SERVICE/HAC T23030 POPE AFB NC 7[-81111 STAT ION STATION lNA&Ayl MSSgll’ TemN. WIT SULS TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 1.2 3 - 5 - 1- 19...STATINASha T PAGE 1 TWET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL * (F) 0 1.2 3-4 3-6 7-8 9.10 11-12113-14 15.16 17-1 19-.20 21.22123-24 25.2627.3 29.n 30 l

  5. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element

    Directory of Open Access Journals (Sweden)

    Özlem Ertekin

    2016-08-01

    Full Text Available This study introduces the use of an IgA isotype aflatoxin (AF specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl carbodiimide/N-hydroxy succinimide (EDC/NHS method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1.

  6. Groundwater levels and water-quality observations pertaining to the Austin Group, Bexar County, Texas, 2009-11

    Science.gov (United States)

    Banta, J.R.; Clark, Allan K.

    2012-01-01

    The U.S. Geological Survey, in cooperation with the San Antonio Water System, examined groundwater-level altitudes (groundwater levels) and water-quality data pertaining to the Austin Group in Bexar County, Texas, during 2009–11. Hydrologic data collected included daily mean groundwater levels collected at seven sites in the study area. Water-quality samples were collected at six sites in the study area and analyzed for major ions, nutrients, trace elements, organic carbon, and stable isotopes. The resulting datasets were examined for similarities between sites as well as similarities to data from the Edwards aquifer in Bexar County, Tex. Similarities in the groundwater levels between sites completed in the Austin Group and site J (State well AY-68-37-203; hereafter referred to as the “Bexar County index well”) which is completed in the Edwards aquifer might be indicative of groundwater interactions between the two hydrologic units as a result of nearby faulting or conduit flow. The groundwater levels measured at the sites in the study area exhibited varying degrees of similarity to the Bexar County index well. Groundwater levels at site A (State well AY-68-36-136) exhibited similar patterns as those at the Bexar County index well, but the hydrographs of groundwater levels were different in shape and magnitude in response to precipitation and groundwater pumping, and at times slightly offset in time. The groundwater level patterns measured at sites C, D, and E (State wells AY-68-29-513, AY-68-29-514, and AY-68-29-512, respectively) were not similar to those measured at the Bexar County index well. Groundwater levels at site F (State well AY-68-29-819) exhibited general similarities as those observed at the Bexar County index well; however, there were several periods of notable groundwater-level drawdowns at site F that were not evident at the Bexar County index well. These drawdowns were likely because of pumping from the well at site F. The groundwater

  7. Occupational radiation exposure at the self-shielded IBA CYCLONE 10/5, cyclotron of the Austin and Repatriation Medical Centre, Melbourne, Australia

    International Nuclear Information System (INIS)

    Tochon-Danguy, H.; Sachinidis, J.I.; U, P.; Egan, G.; Mukherjee, B.

    1999-01-01

    A series of health physics measurements was carried out at the IBA CYCLONE 10/5 Medical Cyclotron of the Austin and Repatriation Medical Centre, Melbourne. The neutron attenuation factor of the cyclotron shielding was estimated using the Superheated Bubble dosimeters. The neutron and gamma dose rates at various public access and radiation worker's area in the vicinity of the cyclotron facility were evaluated during the 11 C, 18 F, 13 N and 15 O production conditions. (authors)

  8. Activities of the Department of Astronomy and McDonald Observatory of the University of Texas at Austin

    Science.gov (United States)

    Smith, H. J.

    1986-01-01

    McDonald Observatory of the University of Texas at Austin reports on its activities during the period 1 Jan. 1986 to 30 June 1986. Extensive observations of Halley's Comet were obtained. The comet exhibited large variability; moreover, its variability was much more rapid than can be accounted for by water vaporization as the sole controller of activity. Jupiter satellite Io's atmosphere was found to be distended by more than the equilibrium scale height but less than for unimpeded streaming into space. The atmosphere is at least temporarily bound to IO. Uranus' (3-0) H2 quadrupole line shapes require a modification of Baines and Bergstralh's standard model which incorporates at high altitude absorbing haze in addition to the lower haze layer. A fraction of normal H2 equal to 0.25 + or 0.10 is derived, in good agreement with the standard model. This result is unchanged when the preliminary temperature structure derived by the Voyager Radio Occultation Experiment is used instead of Appleby's model c. Out of the six Pluto-Charon mutual events observed this year, data were obtained on four. Preliminary analysis is yielding improved estimates for the diameters, masses, densities, and albedos of these objects.

  9. Environmental Assessment Preparation for Air Force Test Mission in the 21st Century: Upgrade and Improve the Test Capability at the Edwards AFB Test Complex

    Science.gov (United States)

    2015-04-01

    waste NAA Nonattainment Area NAAQS National Ambient Air Quality Standards NAGPRA Native American Graves Protection and Repatriation Act NDMA N...nitrate, and N- Nitrosodimethylamine ( NDMA ) plumes exist in these OUs. Locations of groundwater plumes at Edwards AFB are indicated by their respective

  10. Pure neuritic leprosy: Resolving diagnostic issues in acid fast bacilli (AFB)-negative nerve biopsies: A single centre experience from South India.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Megha S; Challa, Sundaram; Meena, A K; Kaul, Subhash

    2015-01-01

    Demonstration of lepra bacilli is essential for definite or unequivocal diagnosis of pure neuritic leprosy (PNL) on nerve biopsy. However, nerves always do not show bacilli owing to the changes of previous therapy or due to low bacillary load in tuberculoid forms. In absence of granuloma or lepra bacilli, other morphologic changes in endoneurium and perineurium can be of help in making a probable diagnosis of PNL and treating the patient with multidrug therapy. Forty-six biopsies of PNL were retrospectively reviewed and histologic findings were compared with 25 biopsies of non leprosy neuropathies (NLN) including vasculitic neuropathy and chronic inflammatory demyelinating polyneuropathy (CIDP). The distribution of endoneurial infiltrate and fibrosis, perineurial thickening, and myelin abnormalities were compared between PNL and NLN biopsies and analyzed by Chi-square test. Out of 46 PNL casses, 24 (52.17 %) biopsies were negative for acid fast bacilli (AFB). In these cases, the features which favor a diagnosis of AFB-negative PNL were endoneurial infiltrate (51.1%), endoneurial fibrosis (54.2%), perineurial thickening (70.8%), and reduced number of myelinated nerve fibers (75%). Nerve biopsy is an efficient tool to diagnose PNL and differentiate it from other causes of NLN. In absence of AFB, the diagnosis of PNL is challenging. In this article, we have satisfactorily evaluated the various hisopthological features and found that endoneurial inflammation, dense fibrosis, and reduction in the number of myelinated nerve fibers are strong supportive indicators of PNL regardless of AFB positivity.

  11. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    Science.gov (United States)

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    De Guzman, Zenaida M. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Cervancia, Cleofas R. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Feliciano, Chitho P., E-mail: cpfeliciano@pnri.dost.gov.ph [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City (Philippines)

    2011-10-15

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a {sup 60}Co source. Surviving spores were counted and used to estimate the decimal reduction (D{sub 10}) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10{sup 5}-9x10{sup 3} spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D{sub min}) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to {gamma}-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: > We characterized Paenibacillus larvae and determined its radiation sensitivity. > We investigated the effectiveness of gamma rays in inactivating P. larvae. > Gamma radiation inactivates P. larvae. > 15 kGy is effective for the sterilization of P. larvae-infected hives. > Irradiation produces no visible changes in the hives' body, waxes and frames.

  13. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    International Nuclear Information System (INIS)

    De Guzman, Zenaida M.; Cervancia, Cleofas R.; Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C.; Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C.; Feliciano, Chitho P.

    2011-01-01

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a 60 Co source. Surviving spores were counted and used to estimate the decimal reduction (D 10 ) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10 5 -9x10 3 spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D min ) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to γ-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: → We characterized Paenibacillus larvae and determined its radiation sensitivity. → We investigated the effectiveness of gamma rays in inactivating P. larvae. → Gamma radiation inactivates P. larvae. → 15 kGy is effective for the sterilization of P. larvae-infected hives. → Irradiation produces no visible changes in the hives' body, waxes and frames.

  14. Quantity and quality of runoff reduction and recharge enhancement from constructed rain gardens and vegetated retention ponds in Austin, Texas

    Science.gov (United States)

    Eljuri, A. G.; Moffett, K. B.

    2013-12-01

    Rain gardens and retention ponds are intended to reduce storm water and pollutant runoff to rivers and streams, rain gardens by enhancing infiltration and retention ponds by promoting evaporation. The City of Austin, Texas is actively investing money and time into these storm water management solutions, but there are no data comparing their effectiveness. In particular, comparisons of rain gardens against control plots and new wetland-vegetated retention pond designs against traditional grassy pond designs are lacking. This study quantifies the quantity and quality of storm runoff to and from five sites: three engineered sites, two rain gardens receiving direct runoff from the same residential roof and a planted retention pond receiving municipal parking lot runoff, and two control sites, a mulched residential lawn receiving direct roof runoff and a grassy municipal retention pond receiving parking lot runoff. A locally installed rain gauge monitors precipitation rates and we collect and analyze rainwater chemistry. Each site is instrumented with bottles to collect direct runoff samples and suction lysimeters within and below the root zone, at 10 cm and 40 cm depth, from which to collect soil water. Soil moisture sensors at 5 cm, 25 cm, and 50 cm depth are used to monitor changes in soil moisture profiles over time. Evapotranspiration rates were determined using local meteorological data and stomatal conductance measurements at the sites. Infiltrometer tests, soil characterizations, and vegetation surveys were also conducted at each site. The soil at the rain gardens are highly mixed with pebbles at the top and become a more uniform soil towards the bottom of the root zone. This differs from the control site where the soil is uniform except for the thin layer of wood chips at the surface. The water samples were analyzed for pH, dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), and cations (incl. cadmium, iron, zinc, and lead) and anions (incl

  15. Quick-Reaction Report on the Audit of the Army Contract with the University of Texas at Austin Institute for Advanced Technology

    Science.gov (United States)

    1992-10-27

    AD-A27O 238 T Of DTIC ELECTE 8OCT 06 1993 E O F F ICE OF THE 1NSPECTOR GENERAL QUICK REAC.7ION REPORT ON THE AUDIT OF THE ARMY CONTRACT WITH THE...ENGINEERING INSPECTOR GENERAL, DEPARTMENT OF TH, ARMY SUBJECT: Quick-Reaction Report on the Audit of the Army Contract with the University of Texas at Austin...comments on Recommendation 3. by November 27, 1992. The courtesies extended to the audit staff are appreciated. If you have any questions on this final

  16. Time to Detection in Culture Supports Prediction of Low Transmissibility of Tuberculosis and Discontinuation of Isolation for Low-Risk Patients With A Single AFB-Negative and NAAT-Negative Respiratory Specimen.

    Science.gov (United States)

    Khan, Saahir; Nakasone, Audrey; Ghajar, Minoo; Zhowandai, Mariam; Prabhu, Sunita; Alexander, Rick; Low, Julie; Peterson, Ellena; Thrupp, Lauri

    2018-05-01

    For 94 patients with culture-positive pulmonary tuberculosis, time-to-detection (TTD), acid-fast bacilli (AFB) smear, and nucleic acid amplification test (NAAT) results were reviewed. All 12 patients whose first specimen was negative by AFB smear and NAAT had prolonged TTD, indicating low transmissibility and supporting discontinuing isolation for low-risk patients.Infect Control Hosp Epidemiol 2018;39:619-621.

  17. Investigating Strategies to Increase Persistence and Success Rates among Anatomy & Physiology Students: A Case Study at Austin Community College District

    Science.gov (United States)

    Vedartham, Padmaja B.

    Community colleges train 60% of healthcare workers nationwide. Human anatomy and physiology (A&P) courses are considered prerequisite courses for all students who aspire to enter health-related programs. The attrition rates for A&P students at community colleges nationally are close to 50%. Community colleges with open-door policies admit nontraditional students who have historically been educationally and economically disadvantaged and are labeled at risk. At-risk students offer a challenge to the colleges and in particular to allied health programs with their mathematical and science oriented requirements. This case study was designed to determine the strategies used to increase the success rates and retention rates among A&P students at Austin Community College District (ACC) in Texas. Data show that ACC has almost 100% retention and higher success rates among A&P students as compared to other colleges. Qualitative data were collected from eight full-time faculty, three administrators, three administrative staff, one director, and two advisors. The findings linked both academic and nonacademic variables to high retention and success rates. The key strategies that helped the A&P students to overcome the challenges to persist and succeed were an assessment test, two preparatory biology courses, technology, and teaching strategies. Taking an assessment test before being permitted to access the class helped students prepare themselves for the rigors of A&P. These strategies provided the students with the foundation of knowledge in the basic biological principles and processes, study skills, and time management skills that would prepare them for the material presented in A&P courses and later in the allied health programs. The principle themes identified in this research--namely requiring students to take the assessment test, providing materials (BIOL.1308, CE4000, and online modules) to prepare students for taking the test, a $2 million grant awarded by the

  18. Leucemias y radiación: juicio causal según los criterios de SIR Austin Bradford Hill

    Directory of Open Access Journals (Sweden)

    Octavio Martínez Betancur

    2010-07-01

    Full Text Available El cometido del presente trabajo es la lectura interpretativa con base en la propuesta de inferencia causal de Austin Bradford Hill, del documento Radiation-related leukemia in Hiroshima and Nagasaki, 1946-1964. I. Distribution, incidence and appearance time. El documento informado por el comité de las víctimas de la bomba atómica cumple con la totalidad de los nueve “criterios” propuesto por Hill, y entre las limitaciones se cuentan la presunciones de homogeneidad genética de los sujetos expuestos y linealidad de los efectos de las radiaciones en la leucemia, además del hecho de sólo considerar la edad como variable confusora. Por otra parte, el número de muertes por leucemia, patrón de oro de la sensibilidad y la especificidad del sistema de vigilancia del estudio de duración de la vida, fue 61 muertes por leucemia entre los supervivientes situados dentro de 1500 metros del epicentro de la explosión y 25 muertes en el grupo que recibió radiación estando entre 1501 y 10000 metros, lo que habla de posible subregistro de casos y de sobrediagnóstico por la sumatoria de criterios empleados. Los “criterios” de Hill no son reglas lógicas sino metodológicas, que ayudan en el proceso de decisión sobre la inferencia causal en epidemiología. Se apartan de la discusión de si las inferencias a partir de ellos se ajustan a la lógica inductiva o a la deductiva, y deben entenderse pragmáticamente como “inferencias de la mejor explicación” en el contexto de la abducción. La única conclusión permitida dentro del marco de la “inferencia de la mejor explicación”, es que se tienen buenas razones para considerar seriamente la hipótesis que la asociación estadística que se estudia, es una relación causal.

  19. Statistical analysis of ground-water contamination at the alert apron and northern landfill areas of Wurtsmith AFB, Michigan. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, P.; Naber, S.; Verducci, J.

    1988-07-01

    Two plumes of contamination are analyzed to determine their extent, composition, and movement. The large number of ground-water monitoring wells sampled over the past eight years at Wurtsmith AFB allow this analysis to be performed directly from empirical data, with minimal assumptions about solute transport mechanisms. Conclusions are drawn about the likely sources of contamination in the two plumes, the adequacy of the data for making risk assessments, and the likely consequences of alternative programs of remediation.

  20. Environmental Assessment Addressing FTFA07-1174, Repair Approach Lighting System at the North End of Runway 01/19 at Eglin AFB, Florida

    Science.gov (United States)

    2013-05-01

    Hyla andersonii Mammals American beaver Castor canadensis Florida black bear2 Ursus americanus floridanus Raccoon Procyon lotor Source: Eglin...water at a frequency and duration to support, and that under normal circumstances do support, a prevalence of vegetation typically adapted to life...virginiana American Beaver Castor canadensis Redbay Persea borbonia Little Blue Heron Egretta caerulea Source: USAF 2006 E-3 E.2 Eglin AFB

  1. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus.

    Science.gov (United States)

    Xing, Fuguo; Wang, Limin; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Yan; Zhao, Yueju; Liu, Yang

    2017-09-01

    Twenty Aspergillus niger strains were isolated from peanuts and 14 strains were able to completely inhibit AFB 1 production with co-cultivation. By using a Spin-X centrifuge system, it was confirmed that there are some soluble signal molecules or antibiotics involved in the inhibition by A. niger, although they are absent during the initial 24h of A. flavus growth when it is sensitive to inhibition. In A. flavus, 19 of 20 aflatoxin biosynthetic genes were down-regulated by A. niger. Importantly, the expression of aflS was significantly down-regulated, resulting in a reduction of AflS/AflR ratio. The results suggest that A. niger could directly inhibit AFB 1 biosynthesis through reducing the abundance of aflS to aflR mRNAs. Interestingly, atoxigenic A. flavus JZ2 and GZ15 effectively degrade AFB 1 . Two new metabolites were identified and the key toxic lactone and furofuran rings both were destroyed and hydrogenated, meaning that lactonase and reductase might be involved in the degradation process. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Factors which contributed for low quality sputum smears for the detection of acid fast bacilli (AFB) at selected health centers in Ethiopia: A quality control perspective.

    Science.gov (United States)

    Mekonen, Ayehu; Ayele, Yeshi; Berhan, Yifru; Woldeyohannes, Desalegn; Erku, Woldaregay; Sisay, Solomon

    2018-01-01

    Quality of tuberculosis (TB) microscopy diagnosis is not a guarantee despite implementation of External Quality Assurance (EQA) service in all laboratories of health facilities. Hence, we aimed at evaluating the technical quality and the findings of sputum smear microscopy for acid fast bacilli (AFB) at health centers in Hararge Zone, Oromia Region, Ethiopia. A cross-sectional study was carried out between July 8, 2014 and July 7, 2015.A pre-tested structured questionnaire was used to collect data. Lot Quality Assurance Sampling (LQAS) method was put into practice for collecting all necessary sample slides. Data were analyzed by using SPSS (Statistical Package for Social Sciences) version 20 software. P-value quality, smear size, smear thickness, staining and evenness were indicated in 40 (72.7%), 39 (70.9%), 37 (67.3%), 27(49.1%) and 37 (67.3%) of the collected samples, respectively. False negative AFB findings were significantly associated with lack of Internal Quality Control (IQC) measures (AOR (Adjusted Odds Ratio): 2.90 (95% CI (Confidence Interval): 1.25,6.75) and poor staining procedures (AOR: 2.16(95% CI: 1.01, 5.11). The qualities of AFB smear microscopy reading and smearing were low in most of the laboratories of the health centers. Therefore, it is essential to strength EQA program through building the capacity of laboratory professionals.

  3. FLOODPLAIN, AUSTIN COUNTY, TEXAS

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classificatinos used are the...

  4. Vector wind and vector wind shear models 0 to 27 km altitude for Cape Kennedy, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Smith, O. E.

    1976-01-01

    The techniques are presented to derive several statistical wind models. The techniques are from the properties of the multivariate normal probability function. Assuming that the winds can be considered as bivariate normally distributed, then (1) the wind components and conditional wind components are univariate normally distributed, (2) the wind speed is Rayleigh distributed, (3) the conditional distribution of wind speed given a wind direction is Rayleigh distributed, and (4) the frequency of wind direction can be derived. All of these distributions are derived from the 5-sample parameter of wind for the bivariate normal distribution. By further assuming that the winds at two altitudes are quadravariate normally distributed, then the vector wind shear is bivariate normally distributed and the modulus of the vector wind shear is Rayleigh distributed. The conditional probability of wind component shears given a wind component is normally distributed. Examples of these and other properties of the multivariate normal probability distribution function as applied to Cape Kennedy, Florida, and Vandenberg AFB, California, wind data samples are given. A technique to develop a synthetic vector wind profile model of interest to aerospace vehicle applications is presented.

  5. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 3, Appendixes B, C, and D: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  6. A COMMUNITY-BASED COLLEGE STUDY ON ADHERENCE TO DOTS AND RELATED DIAGNOSTIC INNOVATIONS ON AFB STAINING METHOD

    Directory of Open Access Journals (Sweden)

    Nilotpal Banerjee

    2016-10-01

    Full Text Available BACKGROUND The geographically isolated underdeveloped state, Tripura of north-eastern region of India has been facing multidimensional problems like unemployment, lack of hygiene, illiteracy, lack of industrialisation, etc. So, it was intended to study the magnitude of reported tuberculosis in the community around the Tripura Medical College through RNTCP. MATERIALS AND METHODS Questionnaire, interrogative methods was primarily adopted. Inspection to different villages around and direct interrogation was done on awareness about the programme. Self-modified innovative method was also adopted to compare scientific reproducibility along with conventional method for AFB staining. RESULTS Analysis of results reveal 28% of people interrogated knew about RNTC programme. 16% of people had seen and heard about the TB staff. 56% of people said that no health staff enquired on other factors like drinking water, mosquito and hygiene, etc. The innovative method of staining proved 100% successful, which was also easier, cheaper and more rapid. CONCLUSION DMC and DOTs services had been quite good as evident from document records and on interrogation to the attendees. 80% of attendees said that they would complete the course of treatment. 83% were happy with the provisions of DOTs and DMC.

  7. External quality assessment of AFB smear microscopy performances and its associated factors in selected private health facilities in Addis Ababa, Ethiopia.

    Science.gov (United States)

    Mosissa, Lemi; Kebede, Abebaw; Mindaye, Tedla; Getahun, Muluwork; Tulu, Sisay; Desta, Kassu

    2016-01-01

    Tuberculosis (TB) is still a public health problem in sub Saharan African countries. In resource-limited settings, TB diagnosis relies on sputum smear microscopy, with low and variable sensitivities, especially in paucibacillary pediatric and HIV-associated TB patients. Tuberculosis microscopy centers have several weaknesses like overworking, insufficiently trained personnel, inconsistent reagent supplies, and poorly maintained equipments; thus, there is a critical need for investments in laboratory infrastructure, capacity building, and quality assurance schemes. The performance of TB microscopy centers in the private health facilities in Addis Ababa is not known so far. The main objective of the study was to assess laboratory performance of acid fast bacilli (AFB) smear microscopy and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. A cross-sectional study was conducted in 33 selected private health facilities of Addis Ababa, Ethiopia comprising 7 hospitals, 2 NGO health centers, 23 higher clinics and 1 diagnostic laboratory that provide AFB smear microscopy services. The study was conducted from January to April 2014. A total of 283 stained sputum smears were randomly collected from participant laboratories for blinded rechecking, 320 panel slides were sent to 32 microscopy centers to evaluate their performance on AFB reading, staining and reporting. Checklists were used to assess quality issues of laboratories. Data were captured, cleaned, and analyzed using SPSS version 16.0; χ(2) tests, kappa statistics were used for comparison purpose. P value laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test performance. There were 10 (3.15%) major errors and 121 (37.8%) minor errors. The sensitivity, specificity, PPV and NPV of panel reading by microscopy centers were 89%, 96%, 96%, and 90% respectively. Out of 283 randomly selected slides for blind rechecking, 11 (3.9%) slides

  8. Correlates of walking to school and implications for public policies: survey results from parents of elementary school children in Austin, Texas.

    Science.gov (United States)

    Zhu, Xuemei; Lee, Chanam

    2009-01-01

    Walking can be a healthy, sustainable, and equitable mode of transportation, but is not widely used for children's school travel. This study identifies multi-level correlates of walking to/from school and relevant policy implications. We surveyed parents/guardians of 2,695 students from 19 elementary schools in Austin, Texas, which featured diverse sociodemographic and environmental characteristics. Among the personal and social factors, negative correlates were parents' education, car ownership, personal barriers, and school bus availability; positive correlates were parents' and children's positive attitude and regular walking behavior, and supportive peer influences. Of physical environmental factors, the strongest negative correlates were distance and safety concerns, followed by the presence of highways/freeways, convenience stores, office buildings, and bus stops en route. Our findings suggest that society should give high priority to lower socioeconomic status populations and to multi-agency policy interventions that facilitate environmental changes, safety improvements, and educational programs targeting both parents and children.

  9. The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop.

    Science.gov (United States)

    Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine

    2017-12-01

    Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

  10. Dollar Summary of Prime Contract Awards by State, Place, and Contractor, FY84, Part 5, (Ashton, Rhode Island-Sinclair, Wyoming).

    Science.gov (United States)

    1984-01-01

    BERGSTROM AIR FORCE CITY OF AUSTIN 4,745 4,745 CPT CORPORATION 66 66 CSR CONTRACTING INC 554 554 DAILEY...317 STARBUCK INDUSTRIAL PUMP SALES COM 147 147 RIDGE CONSTRUCTION CO INC 240 240 SIUSLAW CONSTRUCTION 352 352 SPOONER MECHANICAL CONTRS 226 226 TOTAL... STARBUCK 965 965 STEVENSON BLOCH LUMBER COMPANY 44 44 SUMNER SPACE TECH ENGINEERING INC 762 762 SUNNYSIDE INDEPENDENT FOOD PROCSSRS CORP 86 66 TACOMA

  11. Installation Restoration Program Records Search for Bergstrom Air Force Base, Texas.

    Science.gov (United States)

    1983-07-01

    When the bowser was full, a spreader arm was attached and waste oils were sprayed over unim- proved roads in the landfill area. The majority of...control spray booth is a waterfall type facility. The water, which collects airborne paint particles, is continuously recycled during operation. The...dispensed from a spreader bar on the back of a 250-to 500-gallon bowser. It has been estimated that approximately two times per year up to 300

  12. Disposal and Reuse of Bergstrom Air Force Base, Texas. Final Environmental Impact Statement.

    Science.gov (United States)

    1993-07-01

    Engelmannia bipinnatifida), wild honeysuckles ( Gaura spp.), mouse-eared chickweeds (Cerastium spp.), stork’s-bills (Erodium spp.), and plantains (Plantago spp...mesquite, other prominent vegetation includes Roosevelt weed (Baccharis neglecta), prickly pear (Opuntia lindheimeri ) and pencil cacti (0. leptocarpis

  13. Risk assessment of aflatoxins B1 (AFB1) in corn arepas in Colombia and chemical risk assessment case study mercury in Fish

    International Nuclear Information System (INIS)

    Correa Lizarazo, D.

    2013-01-01

    The power point presentation is about: Identify the pair substrate (corn, wheat and rice) - mycotoxin (DON, AFB1) higher risk for the Colombian population, based on the exposure assessment and mercury in freshwater fish from Colombia. This report answer some the following questions: what are the most consumed products in the country, which may create a risk for the Colombian population, what are the prevention and control recommendations to reduce potential contamination of the products selected, what are economic activities and their impact areas that contribute most to the incorporation of of mercury in freshwater fish from Colombia,what are the species that may pose greater accumulation of mercury and methylmercury identified , what is the risk associated with the consumption of the species, what are the preventive measures to minimize exposure from consumption of fish with mercury and methylmercury and possible intervention strategies

  14. Interaction of mammary bovine ABCG2 with AFB1 and its metabolites and regulation by PCB 126 in a MDCKII in vitro model.

    Science.gov (United States)

    Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C

    2017-12-01

    The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.

  15. Integrating urban recharge uncertainty into standard groundwater modeling practice: A case study on water main break predictions for the Barton Springs segment of the Edwards Aquifer, Austin, Texas

    Science.gov (United States)

    Sinner, K.; Teasley, R. L.

    2016-12-01

    Groundwater models serve as integral tools for understanding flow processes and informing stakeholders and policy makers in management decisions. Historically, these models tended towards a deterministic nature, relying on historical data to predict and inform future decisions based on model outputs. This research works towards developing a stochastic method of modeling recharge inputs from pipe main break predictions in an existing groundwater model, which subsequently generates desired outputs incorporating future uncertainty rather than deterministic data. The case study for this research is the Barton Springs segment of the Edwards Aquifer near Austin, Texas. Researchers and water resource professionals have modeled the Edwards Aquifer for decades due to its high water quality, fragile ecosystem, and stakeholder interest. The original case study and model that this research is built upon was developed as a co-design problem with regional stakeholders and the model outcomes are generated specifically for communication with policy makers and managers. Recently, research in the Barton Springs segment demonstrated a significant contribution of urban, or anthropogenic, recharge to the aquifer, particularly during dry period, using deterministic data sets. Due to social and ecological importance of urban water loss to recharge, this study develops an evaluation method to help predicted pipe breaks and their related recharge contribution within the Barton Springs segment of the Edwards Aquifer. To benefit groundwater management decision processes, the performance measures captured in the model results, such as springflow, head levels, storage, and others, were determined by previous work in elicitation of problem framing to determine stakeholder interests and concerns. The results of the previous deterministic model and the stochastic model are compared to determine gains to stakeholder knowledge through the additional modeling

  16. Production, administration and disposal of cyclotron produced shortlived radioactive gases for positron emission tomography studies at the Austin Repatriation Medical Centre, Melbourne

    Energy Technology Data Exchange (ETDEWEB)

    Egan, G.F.; O`Keefe, G. [Austin Hospital, Heidelberg, VIC (Australia); Tochon-Danguy, H.J.; Midgley, S.; Phana, K.S.; Sachinidis, J.; Chan, J.G. [Melbourne Univ., Parkville, VIC (Australia). School of Physics

    1995-01-01

    Positron Emission Tomography (PET) Centre is operational at the Austin Repatriation Medical Centre, Melbourne. The major equipment consists of a 10 MeV cyclotron and a whole body PET scanner. Radioactive gases produced and used directly in clinical studies include [{sup 15}O]O{sub 2}, [{sup 15}O]CO, and [{sup 15}O]CO{sub 2}, whilst [{sup 11}C]CO{sub 2} is also produced for use in radiochemistry syntheses. Radioactivity delivery rates of 3.7, 3.3, and 1.6 GBq/min to the scanner suite have been achieved for [{sup 15}O]O{sub 2}, [{sup 15}O]CO{sub 2}, and [{sup 15}O]CO respectively, and batch productions of 36.3 GBq of [{sup 11}C]CO{sub 2} have been produced. The production. patient administration and disposal of the short-lived radioactive gases has been achieved in compliance with radiation protection principles. Radioactive gas doses of 1.7 GBq are administered to patients with less than 0.02 MBq/m{sup 3} leakage into the scanner suite. Less than 13 MBq of [ {sup 15}O]-labelled gases are released into the environment per patient study at a concentration of 0.018 MBq/m{sup 3}. Annually less than 2 GBq is expected to be released into the environment. The centre design and first four months` experience of radioactive gas production, administration and disposal is presented. 5 refs., 4 tab., 1 fig.

  17. Smear-positive pulmonary tuberculosis and AFB examination practices according to the standard checklist of WHO's tuberculosis laboratory assessment tool in three governmental hospitals, Eastern Ethiopia.

    Science.gov (United States)

    Mekonnen, Abiyu

    2014-05-13

    Using the Directly Observed Treatment-Short course (DOTS) program the World Health Organization's global target was to detect 70% of new sputum-smear positive PTB cases. Smear positive PTB cases are more infectious than the smear negative cases. The TB case detection rate remains very low in Ethiopia, but there are increases in smear-negative PTB diagnosis which could be attributed to several factors including poor quality of sputum smear-microscopy. A five years retrospective record review of data between September, 2007 and August, 2012 and an in-depth assessment of AFB staining practices of sputum smear using a standard checklist were made. The proportion of smear positive cases relative to overall Acid Fast Bacilli (AFB) screened was determined over a five year period to indicate the overall prevalence and the trend. Odds ratio with 95 percent confidence interval was calculated for categorical variables using multivariate Logistic Regression model to assess the strength of association. A total of 1266 individuals' data were reviewed. The majority of the study participants were male, 704 (55.6%), and rural residents, 690 (54.5%). The overall prevalence rate of smear positive PTB was 21.6%. Age categories between 15-24 and 25-34 years were independent predictors of smear positive PTB with adjusted odds ratio of 2.246 [95% CI (1.098-4.597)] and 2.267 [95% CI (1.107-4.642)], respectively. More males were affected by PTB than females with an adjusted odds ratio of 1.426 [95% CI (1.083-1.879)]. An in-depth interview with the respective laboratory chiefs showed that quality control measures for sputum smear microscopy were used at different levels of the testing activities; however, equipment function verification as a quality control measure was not accomplished regularly in all of the study hospital laboratories. The smear positive PTB case detection rate indicated in this study is significantly lower than the countries which met the 70% target of the World Health

  18. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  19. Evaluación de adsorbentes para la reducción de aflatoxina M1 en leche de vacas alimentadas con dietas contaminadas artificialmente con AFB

    Directory of Open Access Journals (Sweden)

    Federico Rojo

    2014-01-01

    Full Text Available Los adsorbentes han sido utilizados ampliamente para prevenir las micotoxicosis y la transferencia d e toxinas o sus metabolitos dentro de la cadena alimentaria. Particularmente, se unen a las aflatoxinas dentro del tracto gastrointestinal de los rumiantes, disminuyendo su biodisponibilidad y la transferencia de aflatoxin a M 1 (AFM 1 a la leche. El presente estudio se desarrolló para evaluar dos métodos de exposición a aflatoxina B 1 en vacas Holstein y monitorear la transferencia AFM 1 a la leche. Adicionalmente, se analizó el potencial de tres adsorbentes de aflatoxinas en ambos experimentos. Los resultados mostraron una tasa de trasferencia de AFB 1 a AFM 1 / día de 3.35 y 1.8 % en los dos experimentos respectivamente. La transferencia estimada de AFM 1 en la leche observada en el segundo método fue cercana a las obtenidas de vacas alimentadas con alimentos natura lmente contaminados con aflatoxinas. A diferencia de los glucomananos de paredes cel ulares de levaduras, ambos adsorbentes de aluminosilicatos disminuyeron significativamente los niveles de AFM 1 en la leche ( P <0.05.

  20. Police Deprivation of Third Parties’ Liberty – A Field of Tension between National Police Law and the European Convention on Human Rights, as illustrated by Austin & Others v the United Kingdom

    Directory of Open Access Journals (Sweden)

    Steinar Fredriksen

    2015-07-01

    Full Text Available In Austin & Others v the United Kingdom The European Court of Human Rights came to the conclusion that the use of a police cordon, also known as “kettling”, where approximately 2000 people were forced to remain inside the cordon for up to eight hours, did not amount to deprivation of liberty under Article 5 (1 of the European Convention on Human Rights. This conclusion was reached by way of restrictive interpretation of the term “deprivation”. Previous case law establishes a set of criteria to be used when deciding if an infringement on the physical liberty to move from place to place constitutes a deprivation of this liberty, or merely a restriction upon it. These criteria were upheld in Austin, but were found to give room for taking into account the context and circumstances in which the police cordon was used. The previous view of the Court that the grounds justifying deprivations of liberty listed in Article 5 (1 (a-f are exhaustive, was also upheld. In this article the starting point is the close relationship between national police law regarding the maintenance of security and public order on one hand, and the principle of necessity on the other. It is emphasised that “necessity”-based norms in national police law can make police measures directed against innocent third parties legal, deprivations of liberty included, but that this possibility would have been absent in Article 5 (1 of the Convention without the aforementioned restrictive interpretation of the term “deprivation”. An attempt is made to show that this interpretation is in fact based on central elements of the principle of necessity. Furthermore, it is attempted to show that the restrictive interpretation can be seen as a reflection of the need acknowledged in national police law, as well as in other articles of the Convention, to direct police measures against innocent third parties.

  1. Ergonomic Survey, Hill AFB, UT

    Science.gov (United States)

    1991-03-01

    Hygiene NIOSH a. CAPT Roger Jensen, Division of Safety Research b. LCDR Patricia Schnitzer, Division of Safety Research c. GS-14 Vern Putz-Anderson... Patricia Schnitzer was provided a current listing (October 1988-October 1990) of the CTD cases from the PHOENIX data base for review. There were a...MOTIVE AERO-MOTIVE U.K. LTD. RO. Box 2678 1090 Brevik Place Rassau Industrial Estate Kalamazoo, M1 49003 Mississauga, Ontario Ebbw Vale Gwent NP3 5SD Ph

  2. AFB Directory of Services Listings

    Science.gov (United States)

    ... radio-talking-book/index.jsp Minnesota STAR Program Centennial Office Building Room 358 658 Cedar Street St. ... and Human Services Nebraska State Office Building 301 Centennial Mall South Lincoln, NE 68508 http://www.adrcnebraska. ...

  3. GPS Measurements at Vandenberg, AFB

    Science.gov (United States)

    1993-02-22

    friorov, S A Ahic Aia.. SSSR DoAf US9. Ill𔃺 1113 I Iughison. J I (ec O Clmate chirie The 07CC scientific Assessment (Cambridge ni~v Pressý 16 snez. MC... Change or Climate (Wolo~ng GrOAI Viii eHefta Comm’ents 14 Timerev A A & Egorov S A A4lereotof G&droi lo 7 50-56 e91e .r condied 13 A A TsonoS...Complex. might easily be recovering from the mainshock accelerations An examination of the station displacements indicates that Comparing the changing

  4. The Conference Proceedings of the 1998 Air Transport Research Group (ATRG) of the WCTR Society. Volume 2

    Science.gov (United States)

    Oum, Tae Hoon (Editor); Bowen, Brent D. (Editor)

    1998-01-01

    Contents include the following: Airport choice in a multiple airport region: an empirical analysis for the San Francisco bay area. Liberalization of the westeuropian aviation: choice of a new hub airport for an airline. Austin Bergstrom airport traffic control tower establishment of a major activity level tower. A study to optimize the environmental capacity of Amsterdam airport schiphol.Airport performance in stakeholder involvement and communication strategies: a comparison of major Australian and North American air carrier and general aviation airports. Airport planning and location.Location of international airport and regional development. A simulation technique for analysis of Brasilian airport passanger terminal building.Multimodal airport access in Japan. Planning surface access provision at major airports Airline economics and the inclusion of environmental costs on airport hub pricing: a theoretical analysis. Airport financing and user charge systems in the USA. Optimal demand for operating lease of aircraft. Aircraft leasing industry and social welfare.The development of performance indicators for airports: a management perspective. Study about operational effect of the "security check-in" implantation in Brasilian international airports.Austin Bergstrom west loop cable system.and Optimal resource allocation model for airport passanger terminals.

  5. Potential Impacts Related to the Air Training Command Realignments. Institutional Characteristics, Transportation, Civilian Community Utilities, Land Use for Craig AFB, Alabama, Webb AFB, Texas, Columbus AFB, Mississippi, Laughlin AFB, Texas, Reese AFB, Texas, Vance AFB, Oklahoma

    Science.gov (United States)

    1976-12-30

    response and 70.4 percent civilian response, extend to 100 percent population, 1975; Counity Census Data, General Social =0 Economic Characteristics. 25...transportation problems exist and the alternative action is not txpected to disturb the situation in the future. 86 On-Base (AFERN 4.4.1.3) No major problema of...values could increase in specific residential areas that are perceived as meeting certain economic and social needs where current 7acancies are minimal

  6. Baseline Noise Measurements at Vandenberg AFB, California.

    Science.gov (United States)

    1988-01-01

    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v rm--0ow.in .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  7. Severe Weather Forecasting for Laughlin AFB, TX

    National Research Council Canada - National Science Library

    Cercone, Eric J

    2007-01-01

    .... Indices, including convective available potential energy (CAPE) and mean layer CAPE (MLCAPE), along with sounding parameters and combinations of such as 0-2 and 0-6 km bulk shear, 700-500 mb lapse rate, lifted condensation level...

  8. Historic Landscape Survey, Randolph AFB, Texas

    Science.gov (United States)

    2013-09-01

    listed men. Throughout 1930 and 1931, construction at the base was steady in spite of the nation’s depressed economy.22 Figure 3. The road... centennial year of 1932, during which patriotic societies planted trees throughout the country in honor of the first president. During the next year, the

  9. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland AFB, White Sands Missile Range/ Holloman AFB, New Mexico; Edwards AFB, Vandenberg AFB, California

    Science.gov (United States)

    2003-06-01

    Sneed pincushion cactus T Kuen_zler hedgehog cactus - Sacramento oricklv ooppy - I Sacramento Mountains checkerspot - ! butterfly . . Federal Status E...caiifomicus Coho salmon ~_j_Pncorhynchus kisutch , Unarmoured three- spined 1 C~asterosleus aculeatus- ----: stickleback , wi/liamsoni 1 E T E...septentrionalis) Kuenzler hedgehog cachts (Echinocereus fendleri var. kuenzleri) THREATENED Bald eagle (Haliaeetus /.:ucocephalus) Mexican spotted owl (Strix

  10. Herbicide Orange Site Characterization Study, Eglin AFB

    Science.gov (United States)

    1987-01-01

    F THIS PAGE Availabilit o this r is sp f o.n" the reverse of fo cove* . - .’.r. 717 CSAT CO ES ’SU JEC TE MS Coninu onrevrseif ece~ar an idntiy b...of Hardstand 7 and Surface Water Drainages ......... 4 3 Hardstand 7 Herbicide Oran&e Storage Locations .............. 5 4 Concentrations (in ppb) of...insoluble in water . The formula contained an approximate 50/50 mixture of the herbicides 2,4-dichlorophenoxyacetic acid (2,4,-D) and 2,4,5

  11. Historic Landscape Survey, Maxwell AFB, Alabama

    Science.gov (United States)

    2013-08-01

    signifies Maxwell AFB’s historic landscapes. 2.1 The pre-military landscape Prehistory in the southeastern United States is generally designated as...the period of Native American occupation before Spanish explorers made contact in the fifteenth and sixteenth centuries. In Alabama, the prehistory ... prehistory or history is made clear.56 A historic property is determined to be either significant or not significant by applying standardized National

  12. Dover AFB Catchment Area TRICARE Marketing Plan, 436th Medical Group, Dover AFB, Delaware,

    Science.gov (United States)

    1997-06-01

    cosmetic changes (Nadiu, Kleimenhagen, and Pillari 1992). Berkowitz classifies the debate in terms of eras. During the production era, the function was to...facilities in Smyrna and Fenton , Delaware. KGH has aggressive marketing and community education programs which include classes on: cardiopulmonary

  13. EnviroAtlas - Austin, TX - Near Road Block Group Summary

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset addresses the tree buffer along heavily traveled roads. The roads are interstates, arterials, and collectors within the EnviroAtlas...

  14. Region 6: Texas Austin Adequate Letter (11/23/2016)

    Science.gov (United States)

    EPA letter approves the Motor Vehicle Emissions Budgets contained in the latest revision to Dallas/Fort Worth 2008 8-hour Ozone State Implementation Plan, finding them adequate for transportation conformity purposes to be announced in the Federal Register.

  15. Dr. Austin's Lab – C231 BNSN

    Data.gov (United States)

    Federal Laboratory Consortium — GC-MS (Gas Chromatography Mass Spectrometer) - This machine is a combination of two instruments (GC and MS). It uses gas chromatography to separate samples and then...

  16. EnviroAtlas - Austin, TX - Land Cover by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset describes the percentage of each block group that is classified as impervious, forest, green space, and agriculture. Forest is defined as...

  17. EnviroAtlas - Austin, TX - Near Road Tree Buffer

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset addresses the tree buffer along heavily traveled roads. The roads are interstates, arterials, and collectors within the EnviroAtlas...

  18. Sustainable systems rating program: Marketing ``Green`` Building in Austin, Texas

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    Four major resource issues for home construction were identified: water, energy, materials, and waste. A systems flow model was then developed that tracked the resource issues through interactive matrices in the areas of sourcing, processing, using, and disposing or recycling. This model served as the basis for a rating system used in an educational and marketing tool called the Eco-Home Guide.

  19. EnviroAtlas - Austin, TX - Green Space Proximity Gradient

    Data.gov (United States)

    U.S. Environmental Protection Agency — In any given 1-square meter point in this EnviroAtlas dataset, the value shown gives the percentage of square meters of greenspace within 1/4 square kilometer...

  20. Catherine Austin Fitts: kõike ei tohi teha kasumi nimel / Catherine Austin Fitts ; intervjueerinud Külli-Riin Tigasson

    Index Scriptorium Estoniae

    Austin Fitts, Catherine

    2009-01-01

    Firma Solari Inc juht peab praegu toimuvas süüdlaseks seda, et pangad ja valitsused vaatasid ohtudest mööda; lasti kasvada kinnisvaramullil. Ta kutsuks inimesi üles omavahelisele raharinglusele, jättes kulukad vahendajad kõrvale

  1. Terminal Forecast Reference Notebook (TFRN) for Luke AFB, Arizona,

    Science.gov (United States)

    1980-06-02

    due west of the base; the Sierra Estrella , 4,512 feet, about 12 miles to the south; the Phoenix Mountains, 2,740 feet, about 20 miles to the east...from any other direction will usually miss the base by more than 5 nautical miles because of the steering effect of the Sierra Estrella and the White...does the Sierra Estrella between 152 and 210 degrees. Most radar signal blocking can be eliminated, with the exception of the White Tanks, by raising

  2. Perseus B over Edwards AFB on a Development Flight

    Science.gov (United States)

    1998-01-01

    A long, slender wing and a pusher propeller at the rear characterize the Perseus B remotely-piloted research aircraft, seen here during a test flight in April1998. Perseus B is a remotely piloted aircraft developed as a design-performance testbed under NASA's Environmental Research Aircraft and Sensor Technology (ERAST) project. Perseus is one of several flight vehicles involved in the ERAST project. A piston engine, propeller-powered aircraft, Perseus was designed and built by Aurora Flight Sciences Corporation, Manassas, Virginia. The objectives of Perseus B's ERAST flight tests have been to reach and maintain horizontal flight above altitudes of 60,000 feet and demonstrate the capability to fly missions lasting from 8 to 24 hours, depending on payload and altitude requirements. The Perseus B aircraft established an unofficial altitude record for a single-engine, propeller-driven, remotely piloted aircraft on June 27, 1998. It reached an altitude of 60,280 feet. In 1999, several modifications were made to the Perseus aircraft including engine, avionics, and flight-control-system improvements. These improvements were evaluated in a series of operational readiness and test missions at the Dryden Flight Research Center, Edwards, California. Perseus is a high-wing monoplane with a conventional tail design. Its narrow, straight, high-aspect-ratio wing is mounted atop the fuselage. The aircraft is pusher-designed with the propeller mounted in the rear. This design allows for interchangeable scientific-instrument payloads to be placed in the forward fuselage. The design also allows for unobstructed airflow to the sensors and other devices mounted in the payload compartment. The Perseus B that underwent test and development in 1999 was the third generation of the Perseus design, which began with the Perseus Proof-Of-Concept aircraft. Perseus was initially developed as part of NASA's Small High-Altitude Science Aircraft (SHASA) program, which later evolved into the ERAST project. The Perseus Proof-Of-Concept aircraft first flew in November 1991 and made three low-altitude flights within a month to validate the Perseus aerodynamic model and flight control systems. Next came the redesigned Perseus A, which incorporated a closed-cycle combustion system that mixed oxygen carried aboard the aircraft with engine exhaust to compensate for the thin air at high altitudes. The Perseus A was towed into the air by a ground vehicle and its engine started after it became airborne. Prior to landing, the engine was stopped, the propeller locked in horizontal position, and the Perseus A glided to a landing on its unique bicycle-type landing gear. Two Perseus A aircraft were built and made 21 flights in 1993-1994. One of the Perseus A aircraft reached over 50,000 feet in altitude on its third test flight. Although one of the Perseus A aircraft was destroyed in a crash after a vertical gyroscope failed in flight, the other aircraft completed its test program and remains on display at Aurora's facility in Manassas. Perseus B first flew Oct. 7, 1994, and made two flights in 1996 before being damaged in a hard landing on the dry lakebed after a propeller shaft failure. After a number of improvements and upgrades-including extending the original 58.5-foot wingspan to 71.5 feet to enhance high-altitude performance--the Perseus B returned to Dryden in the spring of 1998 for a series of four flights. Thereafter, a series of modifications were made including external fuel pods on the wing that more than doubled the fuel capacity to 100 gallons. Engine power was increased by more than 20 percent by boosting the turbocharger output. Fuel consumption was reduced with fuel control modifications and a leaner fuel-air mixture that did not compromise power. The aircraft again crashed on Oct. 1, 1999, near Barstow, California, suffering moderate damage to the aircraft but no property damage, fire, or injuries in the area of the crash. Perseus B is flown remotely by a pilot from a mobile flight control station on the ground. A Global Positioning System (GPS) unit provides navigation data for continuous and precise location during flight. The ground control station features dual independent consoles for aircraft control and systems monitoring. A flight termination system, required for all remotely piloted aircraft being flown in military-restricted airspace, includes a parachute system deployed on command plus a C-Band radar beacon and a Mode-C transponder to aid in location. Dryden has provided hanger and office space for the Perseus B aircraft and for the flight test development team when on site for flight or ground testing. NASA's ERAST project is developing aeronautical technologies for a new generation of remotely piloted and autonomous aircraft for a variety of upper-atmospheric science missions and commercial applications. Dryden is the lead center in NASA for ERAST management and operations. Perseus B is approximately 25 feet long, has a wingspan of 71.5 feet, and stands 12 feet high. Perseus B is powered by a Rotax 914, four-cylinder piston engine mounted in the mid-fuselage area and integrated with an Aurora-designed three-stage turbocharger, connected to a lightweight two-blade propeller.

  3. Results and Lessons Learned Interim Report: Altus AFB Site

    National Research Council Canada - National Science Library

    McHugh, Thomas

    2005-01-01

    ...) to address the critical groundwater-to-indoor-air vapor intrusion pathway. By increasing our understanding of this critical pathway, guidelines can be improved, thereby better focusing Department of Defense (DoD...

  4. Surface Observation Climatic Summaries for McChord AFB Washington

    Science.gov (United States)

    1989-07-01

    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  5. Dicty_cDB: AFB241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available esis elongation factor 1-alpha (tef2) gene, partial cds. 682 0.0 2 AF157274 |AF157274.1 Phascolomyces arti...culosus translation elongation factor 1-alpha (EF-1alpha) gene, partial cds. 105 2e

  6. Surface Observation Climatic Summaries for Richards-Gebaur AFB, Missouri

    Science.gov (United States)

    1991-04-01

    SUPERSEDES: N/A APR 91 LST TOUTC 406 I MONTH IJAN I FEB I MAR IAP IMAY I JUN I JUL IAUG ISEP IOCT INOV I DEC IANN IYOR- EXTRN MAX TERP(F) 71 82 85 92 94 104...ANDVSBILIT *JN I FEB IAR IM I JUN I JUL IAUG IsEP I OCT I V I DEC I YOR LST 00 - 02 10 03 - 05 10 CIG 06 - 08 23.8 31.5 31.0 22.1 24.0 15.0 12.7 17.4

  7. Waste Analysis Plan and Waste Characterization Survey, Barksdale AFB, Louisiana

    Science.gov (United States)

    1991-03-01

    4C ;J4 c Ia’) La C; c) 0C\\Jc 8 "= "A -’O ’ 04 CŔ" c C’j C-J CAJe~ .- 44 C’) 0% C% 40w 0 l0 O LCD LA O L O 0 0 -IT~ LA 0 00- -T 0 0 0 0 rC 0 0 1- -C (D...r" 3flP1 7, r, ’. hrm Ai IP mn- 3f 1 f r1~r~~ r*NP m r.4 . 4 .-1- 1n i ito NP Mn.’ 3 12fl n 4f c;I rn’." ’, rfi 3I A’. 7 7?A I (>nd ht ~ HIM S)A R46 S

  8. Proposed Closure of Myrtle Beach AFB, South Carolina

    Science.gov (United States)

    1990-07-01

    royal fern (Osmunda regalis), poison ivy (Toxicodendron radicans), and cane (Arundinaria gigantea). Common vines are yellow jasmine (Gelsemium... Ledbetter , Major, U.S. Air Force, Attorney, AFRCE-BMS/DES B.S., 1973, Mathematics, University of Georgia. Athens M.A., 1978, 1 ublic Administration...Richard Garthe F. Lee Howell Murray Geddes Sharon F. Howell Peggy J. Geddes Gary Hoyve Fred G. Gerty Greg Hucks C-5 Jeannine Hucks Jessie R. Lee Lacy K

  9. NOAA-L satellite arrives at Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    Outside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., a crated National Oceanic and Atmospheric Administration (NOAA-L) satellite is lowered to the ground before being moved inside. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Installation Restoration Program. Phase 1. Records Search, Scott AFB, Illinois

    Science.gov (United States)

    1985-04-01

    mission of defense of the United States, has long been engaged in a wide variety of opera- tions dealing with toxic and hazardous materials. Federal...Histopathology-Cytology Sewer Dental Clinic/Laboratory 1680 Yes Yes DPDO, Sanitary Sewer, Medical Logistics Radiology/X-Ray 1680 Yes Yes DPDO, Sanitary...disintegrate. HALOGEN: The class of chemical elements including fluorine , chlorine, i bromine, and iodine. HALON 1211: A fire extinguishing agent

  10. Surface Observation Climatic Summaries (SOCS) For Mather AFB, California

    Science.gov (United States)

    1992-02-01

    1100 SPEND (RTS) CE14 GEIS GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS CATEGORY A 1.7 .5 .1 930 1.6 .6 .1 930 1.6 .4 930 3.4 1.0...ITS) GE14 0E18 GE25 ORS GE14 GEIS GE25 OS GE14 GEl8 GE25 OBS GE14 GE18 GE25 OBS CATEGORY A 5.7 2.4 930 5.2 1.3 .2 930 1.7 .5 .2 930 1.5 .5 .1 930...TIME (LST) 0600 - 2000 ALL HOURS SPEED K75 GE14 GEl8 GE25 OBS GE14 GEl8 UE25 OS CAT Y A 3.5 1.1 .1 4650 2.8 .9

  11. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

    Science.gov (United States)

    1985-02-01

    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  12. Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California. Supplement.

    Science.gov (United States)

    1983-07-01

    2 of the Northern Channel Islands, have been motivated in part by concerns identified through interaction between the Air Force and the Coastal...ofA.SrZ 64 0 /OC 2SS - So#e.e. V, f-rrAq ~ WA~oJsie4,e~4 A-I 4&Ajt4 A fLA1//.t"lJAde~ R-SeI~u- dw rwy. £A4Pcr SL3*p~j* ps4 .Prm Al-fdc6k -5)’-ArFkAJ /7

  13. Installation Restoration Program. Phase I. Records Search, Brooks AFB, Texas

    Science.gov (United States)

    1985-03-01

    decay of the cadavers occurred. The waste was packaged in plastic bags, placed in seven 55-gallon drums and buried in a hole 7 to 8 feet deep. The drums...Receptors subscore (I x factor score subtotal/maximm score subtotal) 44 - II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity...subtotal) 44 II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity, the degree of hazard, and the confidence level of the

  14. Installation Restoration Program. Phase I. Records. Loring AFB, Maine.

    Science.gov (United States)

    1984-01-01

    periphyton from rivers and streams. Publications Dr. Knight has authored several technical papers on ecosystem metabolism, phytoplankton ecology, and...should be made of glacial till and esker (ice contact) deposits along with the calcareous bedrock (Carys Mills Formation) as they relate to the base...material defects of aircraft struc- tures, component parts, and related ground equipment. Wastes generated by the processes involved include PD-680

  15. Dicty_cDB: AFB514 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TCACTGTTCATCCAAAATTCTTAACAACAAGAAGAAGCGGAACCAAGAACAAGAAGA ACA sequence update 2001. 6. 1 Translated Amino Acid sequence ---atsnnqlmip...skg*ihchrfshc*nq*treristsl rfirsnsreiclyf*fh*tnc*wycrqcfhlkii*cylsl*nhl*rchgyvqenhgkdlv ltvhpkflttrrsgtknkkn Frame B: ---atsnnqlmips

  16. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland Air Force Base (AFB) and White Sands Missile Range/Holloman AFB, NM, and Edwards AFB and Vandenberg AFB, CA

    Science.gov (United States)

    2003-06-01

    californicus- _" -~ T ~ - 1" T - E I T Coho salmon Unarmoured three- spined stickleback I Tidewater goby 1 Eucyclogobius n e w b e p i ,.I...ENDANGERED Black-footed ferret (Mustela nigripes)"" Northern aplomado falcon (Falcofemoralis septentrionalis) Kuenzler hedgehog cachls (Echi...Empidonax traillii ertimus) Kuenzler hedgehog cactus (Echinocer~.~rendleri var. kuenzleri) Todsen’s pennyroyal (Hedeoma fodsenii) Sacramento

  17. Dicty_cDB: AFB744 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lqhpkripplpfsfxixrxyanfc*xlfxgktiplever***h*kcqsqnprqrry spxstxfhfxw*tixxwpxsl*lqhpkxipxpfsxxikrwxanxcknlxwx...xhxigsxrf **hxkcxxqnsxqxrysxrstxinfxwxtixxwxxxx*lqxskgixxpfsxxikrwxanx c*nfnr*nxpxgsxr***x*kc*sqxprqxrxspxst

  18. Wastewater Characterization and Hazardous Waste Survey, Hickam AFB, Hawaii.

    Science.gov (United States)

    1987-05-01

    5200 20 Jan Bldg 2178 7.6 26 4400 20 Jan Lift Station 1A 7.2 26 9000 2" Jan Bldg 2045 6.5 26 12000 2’ Jan Bldg 358A 7.4 24 27000 21 Jan Lift Station 12...8217679b Toluene n/a 6850-00- 281-2002 Alum Alodine n/a 8030-00-779-4699 Methyl Iso Ketone n/a 6810-00-286-3785 Thinner MIL 81772 8010-O0-181-8080 1055 15

  19. AFB (Acid-Fast Bacillus) Smear and Culture

    Science.gov (United States)

    ... of Conditions Not Listed? Not Listed? Acidosis and Alkalosis Adrenal Insufficiency and Addison Disease Alcoholism Allergies Alzheimer ... to produce sputum, a health practitioner may collect respiratory samples using a procedure called a bronchoscopy. Bronchoscopy ...

  1. Dicty_cDB: AFB336 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available A009G02 of library BC0AA from strain CBS 767 of Debaryomyces hansenii. 48 3e-11 4 AA550135 |AA550135.1 1237m...3 gmbPfHB3.1, G. Roman Reddy Plasmodium falciparum genomic clone 1237m, DNA sequence. 60 3e-06 2 BP134604 |B

  2. Mercury and Silver in Clinic Wastewater Goodfellow AFB, Texas

    Science.gov (United States)

    1989-07-01

    SE(JrTY CLASSIFICATION 1b RESTRICTIVE MARINGSuncfassi I ed N/A 2a SCRITY CLASSIFICATION AUTHORITY 3 DISTRIBUTION / AVAiLABILIT OF REPORT N/A Approved...Material suctioned from teeth restoration are collected in a central separator/collection tank. The tank is automatically cleaned by rinsing it with water ...insoluble or sparingly soluble in water . In neutral or alkaline solutions, mercury is oxidized directly to the mercuric state with the formatin of

  3. Environmental Assessment Tent City at Grand Forks AFB, North Dakota

    Science.gov (United States)

    2004-11-15

    animals such as sponges, flatworms, nematode worms, segmented worms, snails, clams, and immature and adult insects , fish, amphibians, turtles, and... nettle (Laportea canadensis), stinging nettle (Urtica dioica), beggars’ ticks (Bidens frondosa), and waterleaf (Hydrophyllum viginianum) are

  4. Performance Monitoring of the Permeable Reactive Barrier at Dover AFB

    National Research Council Canada - National Science Library

    1999-01-01

    Based on column tests conducted between February and June 1997, NERL recommended that in terms of effectiveness in achieving cleanup standards and kinetics, a pyrite-iron combination ranked as the best reactive medium (EPA, 1997...

  5. Installation Restoration Program. Phase 1 - Records Search, Robins AFB, Georgia.

    Science.gov (United States)

    1982-04-01

    Environmental Biology , University of Florida, Gainesville, Florida Business Administration, Georgia State University Professional Affiliations 04 American Water...slay Irn IA lii a aswo vets* 16 40 saw. ben IT 11 Cad"~ L2 U . 5 clay.Sft W 10 isgwk 12 07 10 -ZA coeseedu osi tW streaks of 2W 0 coal" 12 S Koala lo

  6. Environmental Assessment: Space Innovation and Development Center Schriever AFB, Colorado

    Science.gov (United States)

    2006-03-01

    coloradensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least tern (interior population) .A Sterna antillarum E Mexican spotted owl Strix...Haliaeetus leucocephalus T Boreal toad Bufo boreas boreas c Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least...T CUSTER Bald eagle IIaliaeetus leucocephalus T Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Mexican

  7. Water and Wastewater Characterization Survey, Williams AFB AZ

    Science.gov (United States)

    1991-03-01

    effluent discharges. Most industrial effluent originates from the flight line operations. The WWTP includes primary sedimentation , trickling filters...final sedimentation , plug-flow chlorine contact basin, and a stabilization pond. Samples were collected at the influent and effluent of the plant...Stispcndcd Solido ~ 60) 31 pit wvithll 6.0 to 90- *1 1*0 is Totil toxic 0, plan:*’ aq (leCiitc(l at .i10 (1 R Pitt 4133. 5 (IIIL)RINE REOPENEP T1 his permit

  8. External quality assessment of AFB smear microscopy performances ...

    African Journals Online (AJOL)

    Data were captured, cleaned, and analyzed using SPSS version 16.0; χ2 tests, kappa statistics were used for comparison purpose. P value < 0.05 considered statistically significant. Among the 32 participant laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test ...

  9. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 4, Grissom AFB Indiana.

    Science.gov (United States)

    1988-03-01

    the absolute value of the flow angle taken at each traverse point must be less than or equal to 20 degrees. The flow angle in the bypass stack averaged...are permitted: with the test include a zero and span cedures approved by the Board or the (I) Fires celebrating Twelfth Night calibration check at the...HUMIDITY DATA ALL TEMPS INPUT IN DEGREES FARENHEIT AND CONVERTED TO DEG. K. AMBIENT DRY BULB (K) = 279.2611 AMBIENT WET BULB (K) = 276.4833 - SOURCE

  10. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1988-06-01

    run, a flue gas sample for orsat analysis (measures oxygen, and carbon dioxide for stack gas molecular weight determination and emissions correction...was taken. Orsat sampling and analysis equipment are shown in Figures 5 and 6. Flue gas moisture content, also needed for determination of gas molecular ...where applicable) background a-e (B) Visible emisions shall not exceed is not limited to, monitoring results, opac- recorded on a field data sheet at

  11. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3, 4, and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1989-06-01

    Occupational and Environmental Health Laboratory (AFSC) Human Systems Division Brooks Air Force Base, Texas 78235-5501 89 8 28 48 UNCLASSIFIED SE(t"cr...IIiZ .nQ ,P %.6 PO 9𔃼 TOTA I’A53O0 1~~jy &~J7 52c’ f.-~O Qri,_00i -Loc o I I or 0QQ~i -5mcI) 0 c 4003 -5 3 -00o ) Ivf 2 ’?00 13, 1-4I __ -0-31. rA4...The laboratory data sheets were not suitable for reproduction ; therefore, the coal analysis results are presented in the following table. AS RECEIVED

  12. Intervjuu American Wind Symphony Orchestra dirigendi Robert Austin Boudreau'ga = Interview with Mr. Robert Austin Boudreau, director of the American Wind Symphony Orchestra / Robert Austin Boudreau ; interv. Heli Ojamaa

    Index Scriptorium Estoniae

    Boudreau, Robert Austin

    2007-01-01

    11. IV 2007. a. tehtud telefoniintervjuu Robert A. Boudreau'ga, kellele arhitekt Louis I. Kahn disainis kontserdilaevad Point Counterpoint I (valmis 1961) ja Point Counterppoint II (kavandamist alustati 1966, valmis 1975). Louis I. Kahnist, koostööst arhitektiga ja laevadest. Selgitav kaaskiri arhitekt Heli Ojamaalt. Ill.: I laeva makett, II laeva joonised ja 4 värv. fotot

  13. Flying Training Capacity Model: Initial Results

    National Research Council Canada - National Science Library

    Lynch, Susan

    2005-01-01

    OBJECTIVE: (1) Determine the flying training capacity for 6 bases: * Sheppard AFB * Randolph AFB * Moody AFB * Columbus AFB * Laughlin AFB * Vance AFB * (2) Develop versatile flying training capacity simulation model for AETC...

  14. EnviroAtlas - Austin, TX - Estimated Percent Tree Cover Along Walkable Roads

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset estimates tree cover along walkable roads. The road width is estimated for each road and percent tree cover is calculated in a 8.5 meter...

  15. Web-based radiochemistry training at the University of Texas at Austin

    International Nuclear Information System (INIS)

    Landsberger, S.; Strassberg, E.; Schnmidt, K.

    2005-01-01

    Outline of a comprehensive website based offering of a basic graduate level or senior undergraduate level course in nuclear and radiochemistry is presented. This password protected course follows classical pedagogical treatment of the subject. However, it has been augmented by the implementation of Flash animations to better teach basic nuclear and radiochemistry concepts. As well, the website is linked to many Internet related resources. All lectures and problems are presented in Microsoft Power Point format with Flash animations incorporated. A series of six experiments in radiochemistry, also offered in the course is available in a downloadable Microsoft Word format. (author)

  16. Beta decay of hyperons. Lectures in mathematics and physics at the University of Texas at Austin

    Energy Technology Data Exchange (ETDEWEB)

    Bohm, A.; Garcia, A.; Kielanowski, P.

    1985-01-01

    This book is an introduction to the physics of the semileptonic decay of hyperons. After a general introduction and a description of the experimental results the Cabibbo theory is introduced for the theoretical description of these results. Then radiative and other corrections are discussed. Finally this decay is considered in the framework of broken SU(3). This book applies to graduate students and other ''non-specialists'' who want to get some insight into the physics of weak interactions. (HSI).

  17. HOW SMART IS THE SMART GROWTH INITIATIVE? A CASE STUDY IN AUSTIN, TEXAS. (R827582)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  18. Solid-fuel cook stoves: Fuel efficiency and emissions testing--Austin

    Science.gov (United States)

    The World Health Organization estimates that approximately 1.6 million people prematurely die each year due to exposure to air pollutants from burning solid fuels for residential cooking and heating (WHO, 2010). Residential solid-fuel use accounts for approximately 25 percent of ...

  19. Pulling the Parent Trigger--Forum. "Education Next" Talks with Ben Austin and Michael J. Petrilli

    Science.gov (United States)

    Austin, Ben; Petrilli, Michael J.

    2013-01-01

    Championed by California-based Parent Revolution, and adopted first by California in early 2010, more than a half-dozen states now have parent trigger laws. The parent trigger, which allows a majority of parents at a low-performing school to vote to seize control from the local district, has been wielded at four California schools. Is the parent…

  20. Rapport: IEEE 1997 International Symposium on Electromagnetic Compatibility, 18.-22. august 1997, Austin, Texas

    DEFF Research Database (Denmark)

    Baltsen, Knud A.; Mandrup, Lars

    1997-01-01

    EMC -gruppen er en del af TUR Netværket Elektronik og Informationstekno¬logi. EMC-gruppen har som formål at iværksætte et fagligt udviklingsarbejde inden for EMC-området med henblik på at styrke og forny undervisningen i EMC på de enkelte diplomingeniøruddan¬nelsesinstitutioner. Ud fra en erkende...

  1. EnviroAtlas - Austin, TX - Historic Places by Census Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset portrays the total number of historic places located within each Census Block Group (CBG). The historic places data were compiled from the...

  2. Results from Accelerator Driven TRIGA Reactor Experiments at The University of Texas at Austin

    International Nuclear Information System (INIS)

    O'Kelly, S.; Braisted, J.; Krause, M.; Welch, L.

    2008-01-01

    Accelerator Driven Transmutation of High-Level Waste (ATW) is one possible solution to the fuel reprocessing back-end problem for the disposal of high level waste such as minor actinides (Am, Np or Cm) and long-lived fission products. International programs continue to support research towards the eventual construction and operation of a proton accelerator driven spallation neutron source coupled to a subcritical 'neutron amplifier' for more efficient HLW transmutation. This project was performed under DOE AFCI Reactor-Accelerator Coupling Experiments (RACE). A 20 MeV Electron Linac was installed in the BP no 5 cave placing neutron source adjacent to an offset reactor core to maximize neutron coupling with available systems. Asymmetric neutron injection 'wasted' neutrons due to high leakage but sufficient neutrons were available to raise reactor power to ∼100 watts. The Linac provided approximately 100 mA but only 50% reached target. The Linac cooling system could not prevent overheating at frequencies over 200 Hz. The Linac electron beam had harmonics of primary frequency and periodic low frequency pulse intensity changes. Neutron detection using fission chambers in current mode eliminated saturation dead time and produced better sensitivity. The Operation of 'dual shielded' fission chambers reduced electron noise from linac. Benchmark criticality calculation using start-up data showed that the MCNPX model overestimates reactivity. TRIGA core was loaded to just slightly supercritical by adding graphite elements and measuring reactivity of $0.037. MCNPX modeled TRIGA core with and without graphite to arrive at 'true' measured subcritical multiplication of 0.998733± 0.00069. Thus, Alpha for the UT-RACE TRIGA core was approximately 155.99 s -1 . The Stochastic Feynman-Alpha Method (SFM) accuracy was evaluated during transients and reactivity changes. SFM was shown to be a potential real-time method of reactivity determination in future ADSS but requires stable accelerator performance for near real-time measurements. MCNX code would only simulate single pulse neutron transport but provided information about overall TRIGA response to linac neutron pulse. In conclusion, the UT-RACE TRIGA project is a successful model of a full scale ADSS demonstrating several unique characteristics expected to be seen in future high-power, high frequency systems. Gamma flash problems were corrected and data collected by operating the fission chambers in current mode

  3. The Unintended Consequences of World War II and the Victory Corps on Austin High School

    Science.gov (United States)

    Blankenship, Whitney

    2016-01-01

    Within two weeks of the bombing of Pearl Harbor, the U.S. Office of Education Wartime Commission was formed to provide guidance to institutions of higher learning and public schools for the duration of the war. The goals set for the commission included: (1) facilitating the adjustment of education agencies to war needs; (2) informing government…

  4. La nozione di performatività: un confronto tra Judith Butler e John L. Austin

    OpenAIRE

    Ginocchietti, Marianna

    2012-01-01

    Judith Butler’s investigation of gender identities – and of their being socially and culturally constructed – is grounded on the concept of performativity. In this paper I outline Butler’s elaboration of gender performativity in connection with John L. Austin’s analysis of performative utterances. The aim of this paper is to highlight the gap between these two elaborations of the notion of perfomativity which are usually understood as constituting a theoretical continuum.

  5. Annual Report on Electronics Research at The University of Texas at Austin.

    Science.gov (United States)

    1982-05-15

    erence laser is a Mark-Tech Model 5800 Lamb -dip stabilized He-Ne laser. Not yet implemented is a scheme for providing tunability of the reference...NJ 0701 ATTN . DRSEL-FU-M (Mr. John Walker) AT"M, STEWS -ID0-D (DR. Al L. Gilbert) Fort Monm,th. N.J 07703 White lendsSMissile Range. Ism $0002 Director

  6. Annual Report on Electronics Research at the University of Texas at Austin.

    Science.gov (United States)

    1985-05-15

    changes. The goal of this program is to determine non-destructively where a particular sample is on its life curve or where its damage threshold is at a...EleLtOsios Iaboratory Deoty Director taford Uiversity sesearch and Teohnology Division Stanford. CA 94305 Offirs o Aeronutic. and Spare Tech. NASA

  7. 78 FR 51327 - Endangered and Threatened Wildlife and Plants; Designation of Critical Habitat for the Austin...

    Science.gov (United States)

    2013-08-20

    ...). Any additional tools or supporting information that we may develop for this critical habitat.... We think those benefits include educational and regulatory benefits afforded to all of our critical... Service 50 CFR Part 17 Endangered and Threatened Wildlife and Plants; Designation of Critical Habitat for...

  8. 75 FR 52016 - Notice of Inventory Completion: Texas Parks and Wildlife Department, Austin, TX

    Science.gov (United States)

    2010-08-24

    ... Texas Parks and Wildlife Department professional staff in consultation with representatives of the... 1700. Similar cooking pots continue to be used today by native groups in Central and South America...

  9. Changing Teacher Practices: Proceedings of a National Conference (Austin, Texas, October 1981).

    Science.gov (United States)

    Defino, Maria E., Ed.; Carter, Heather, Ed.

    In this report of a working conference, experts in the teacher education field considered the adequacy of current research on teaching practices and obstacles in the implementation of changes based on research findings. In "How Useful Are the Findings from the Research on Teaching," Jane A. Stallings discussed findings from research on teaching…

  10. EnviroAtlas - Austin, TX - Estimated Percent Green Space Along Walkable Roads

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset estimates green space along walkable roads. Green space within 25 meters of the road centerline is included and the percentage is based on...

  11. EnviroAtlas - Austin, TX - People and Land Cover in Floodplains by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset describes the total counts and percentage of population, land area, and impervious surface in the 1% Annual Chance Flood Hazard area or 0.2%...

  12. 75 FR 9438 - Samsung Austin Semiconductor, LLC, DRAM Fab 1, a Subsidiary of Samsung Electronics Corporation...

    Science.gov (United States)

    2010-03-02

    ... Semiconductor, LLC, DRAM Fab 1, a Subsidiary of Samsung Electronics Corporation, Including On-Site Leased... Semiconductor, LLC, a subsidiary of Samsung Electronics Corporation, DRAM Fab 1, including on-site leased.... The workers are engaged in activities related to the production of DRAM chips for use in electronics...

  13. Microsimulation of household and firm behaviors: anticipation of greenhouse gas emissions for Austin, Texas.

    Science.gov (United States)

    2009-05-01

    Anthropogenic greenhouse gas (GHG) emissions can be attributed to household and firm travel and : building decisions. This study demonstrates the development and application of a microsimulation model : for household and firm evolution and location c...

  14. EnviroAtlas - Austin, TX - Tree Cover Configuration and Connectivity, Water Background

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset categorizes forest land cover into structural elements (e.g. core, edge, connector, etc.). In this community, Forest is defined as Trees...

  15. EnviroAtlas - Austin, TX - Potential Window Views of Water by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset describes the block group population and the percentage of the block group population that has potential views of water bodies. A potential...

  16. Joint Services Electronics Program. Electronics Research at the University of Texas at Austin.

    Science.gov (United States)

    1986-09-30

    White, Physics Kyoung II Kim , ECE John White, Aerospace Tae Sung Kim , ECE Murray Wolinsky, Physics Taiho Koh, ECE * L.A. Wu, Physics Tom Koonce...on Acutc.SpehadSignal Processing, Vol. 1, March 1984, San Diego, California, pp. - ’ -’.,"" 27. Kyoung 11 Kim and Edward J. Powers, "Digital Estimation...Craig Farley, ECE, M.S., May 1985, "The Migration and Activation of Impurities in Ion- Implanted Semiconductors." Dae Yong Kim , ECE, M.S., May 1985

  17. 78 FR 60248 - Foreign-Trade Zone (FTZ) 183-Austin, Texas; Notification of Proposed Production Activity...

    Science.gov (United States)

    2013-10-01

    ... shroud assemblies; mechanism bases; storage; busbars; button dim links; electromagnetic interference fans...; connector brackets; frames; holders; insulators; link torsion; manifold exhausts; stiffeners; subassemblies; thermal pads; insert mold torsion bars; torsion springs; vapor chambers; power supplies; housing magnets...

  18. Nuclear Analytical Techniques and Nonproliferation Studies at the University of Texas at Austin

    International Nuclear Information System (INIS)

    Landsberger, S.; Biegalski, S.; Schneider, E.; Foltz-Biegalski, K.

    2014-01-01

    The faculty members in the Nuclear and Radiation Engineering Program have made significant contributions to the placing of PhD and MS students in various programs at the national laboratories and US government. The success and foundation of the program is based on a strong collaboration with staff members at these various laboratories, per-reviewed publications, and continued financial support

  19. 77 FR 47660 - Attwater Prairie Chicken National Wildlife Refuge, Austin and Colorado Counties, TX; Final...

    Science.gov (United States)

    2012-08-09

    ...) (40 CFR 1506.6(b)) requirements. We completed a thorough analysis of impacts on the human environment...; evaluate and remove services roads where necessary. Facilities Issue 2: Development Administrative... at three public libraries in surrounding communities. A public open house meeting was held on January...

  20. EnviroAtlas - Austin, TX - 51m Riparian Buffer Vegetated Cover

    Science.gov (United States)

    This EnviroAtlas dataset describes the percentage of a 51-m riparian buffer that is vegetated. Vegetated cover is defined as Trees & Forest and Grass & Herbaceous. There is a potential for decreased water quality in areas where the riparian buffer is less vegetated. The displayed line represents the center of the analyzed riparian buffer. The water bodies analyzed include hydrologically connected streams, rivers, connectors, reservoirs, lakes/ponds, ice masses, washes, locks, and rapids within the EnviroAtlas community area. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).

  1. EnviroAtlas - Austin, TX - 51m Riparian Buffer Forest Cover

    Science.gov (United States)

    This EnviroAtlas dataset describes the percentage of a 51-m riparian buffer that is forested. Forest is defined as Trees & Forest. There is a potential for decreased water quality in areas where the riparian buffer is less forested. The displayed line represents the center of the analyzed riparian buffer. The water bodies analyzed include hydrologically connected streams, rivers, connectors, reservoirs, lakes/ponds, ice masses, washes, locks, and rapids within the EnviroAtlas community area. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).

  2. 139 Patriarchy, Marriage and the Rights of Widows in Nigeria Austin ...

    African Journals Online (AJOL)

    Ike Odimegwu

    victimization (including sexual) and other forms of human rights violations. ... have conceived and described the world as 'men's world'. Women can only play the second ..... sometimes, culminate in sexual harassment. Nowadays, sometimes ...

  3. Bulletin of the Texas Archeological Society, Volume 71 (2000, Austin, Paper.

    Directory of Open Access Journals (Sweden)

    Larry D. Banks

    2000-11-01

    Full Text Available This annual bulletin of the Texas Archeological Society is a unique contribution specifically focused upon the history of Texas archaeology in a format that no others have done previously. The volume contains 150 pages, the majority of which consists of interviews (146 pages conducted by the first State Archaeologist of Texas, Curtis Tunnell. In 1968 Tunnell conceived of the idea of obtaining personal interviews from individuals whom he considered his heroes for their pioneering efforts in Texas archeology. This volume entails the first publication of such information, but more will certainly follow. The remaining four pages comprise two different reviews of other publications important in their own right to those interested in Southern Plains archeology of Texas. These two reviews by Timothy K Pertulla and David T. Hughes, respectively, are of The Coronado Expedition to Tierra Nueva: The 1540·1542 Route Across the Southwest by Richard Flint and Shirley Cushing flint, and GaffCreek: Artifact Collection Strategy and Occupation Prehistory on the Southern High Plains, Texas County. Oklahoma. The section by Tunnell titled "In Their Own Words: Stories from Some Pioneer Texas Archeologists" contains numerous previously unpublished photographs of people, sites and artifacts referred to the texts.

  4. Solid Freeform Fabrication Proceedings (9th) Held in Austin, Texas on August 10-12 1998

    Science.gov (United States)

    1998-08-01

    through a CaFl viewport in the LENS glovebox using a 12 bit digital camera equipped with a telephoto lens and 650nm broad band filter. A total of 2048 ...SLS of investment casting shells - rapidly to metal parts 5 References König, W. (1990) Fertigungsverfahren Band 4, Massivumformung, VDI -Verlag

  5. EnviroAtlas - Austin, TX - Estimated Intersection Density of Walkable Roads

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset estimates the intersection density of walkable roads within a 750 meter radius of any given 10 meter pixel in the community. Intersections...

  6. Construction and installation of travel time signs on I-35 in Austin.

    Science.gov (United States)

    2016-08-01

    Dynamic travel time signs (DTTS) provide current travel times to a specific destination via one or more : routes. These signs aid motorists in making route choice decisions en route. Through this project, three : DTTS were fabricated and installed on...

  7. Completion of construction and installation of travel time signs on I-35 in Austin : project summary.

    Science.gov (United States)

    2015-08-31

    Drivers desire real-time information when : traveling in order to make route choice : decisions. One type of information that can be : provided is current (dynamic) travel times on : two possible routes that serve a common : destination. In this way,...

  8. Sustainable systems rating program: Marketing Green'' Building in Austin, Texas

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    Four major resource issues for home construction were identified: water, energy, materials, and waste. A systems flow model was then developed that tracked the resource issues through interactive matrices in the areas of sourcing, processing, using, and disposing or recycling. This model served as the basis for a rating system used in an educational and marketing tool called the Eco-Home Guide.

  9. EnviroAtlas - Austin, TX - Greenspace Around Schools by Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas data set shows the number of schools in each block group in the EnviroAtlas community boundary as well as the number of schools where less than 25%...

  10. UMass Amherst and UT Austin @ The TREC 2009 Relevance Feedback Track

    Science.gov (United States)

    2009-11-01

    number of terms to select com- pared to our case. We chose AdaRank [Xu and Li, 2007] for the following reasons . It directly optimizes retrieval performance...and the number of topics containing at least one relevant document. query car parts dinosaurs espn sports atari cell phone hoboken dogs adoption auto...infraorder disney activision ringtone nj puppy body bird abc sega forum ny pet lowest extinct channel hardware wireless brook rottweiler cost

  11. DIGITAL FLOOD INSURANCE RATE MAP DATABASE, AUSTIN COUNTY, TEXAS (AND INCORPORATED AREAS)

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Digital Flood Insurance Rate Map (DFIRM) Database depicts flood risk information and supporting data used to develop the risk data. The primary risk...

  12. Installation Restoration Program (IRP) Stage 7, Remedial Investigation/ Feasibility Study Comprehensive CERCLA Work PLan for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1991-07-01

    Systems Audits ; Preventive Maintenance; Data Assessment Procedures; Corrective Action; Quality Assurance Reports; and Site Management. General Data Quality...for verification and quality control audits . A copy of the QAPP will be in the possession of field sampling teams for all sampling efforts...L cc- acca C wi w-C P-3-- C I- usu 2; - at C4~~2 Q (( c ccc c-c C- 0L U -C 3- au S - - C3 . - acu tr - -a CL.43 C LU -C2 -C ul 0it S w- -C u Ocw - z i

  13. Installation Restoration Program (IRP) Stage 3, Operable Unit B engineering Evaluation/Cost Analysis - Environmental Assessment for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1990-12-01

    U U U � o 0. .. . .. .. . ..0 C f 88 11 g 88 2= c c= 61 =" l w oA ID - f mW CD 0 x P.- I- W x- hi 8I fmd /06ETLO/V’dI V0 0 a 1 -,, C 22 2t ? i2...aa a a I I I 1 a a a a U a fta a a a a a a a a a a a a a * a a a a a a a a a * a a a I a a a a ft a a a I * a a a a * a aa I* a I a a a ac~ a a a ft a...Ba J.Ja ’-ft a -. aB I a a fta a Oa a ~ afla ft a 0-aQa a ft * * a * ~ d aa OaeO B a* - a a SIa I ft a a ma a £ a a ~a 3 -di I a a saga a ft a a ~SJI

  14. Final Environmental Assessment for Minuteman III Modification

    National Research Council Canada - National Science Library

    Huynh, Thomas; Kriz, Joseph; Lindman, Terry; Ramanujam, Ram

    2004-01-01

    .... The locations covered in this EA include: FE Warren Air Force Base (AFB), WY; Hill AFB, UT; Malmstrom AFB, MT; Minot AFB, ND; Vandenberg AFB, CA; and US Army Kwajalein Atoll, Republic of the Marshall Islands.

  15. Myrtle Beach AFB South Carolina. Revised Uniform Summary of Surface Weather Observations. Parts A-F

    Science.gov (United States)

    1975-07-03

    5 252--447 A-S ____ L53 !a7..9.. 42/ 41 .J . .4 * ~ ~ ~ -- 5198, 2,17066I 64881 __ __ 71____ 4j43637:~ :~:~ d ~______5132 15 64*2 Element (X’ z j x...1.I7 119o- 20i.21 .22123 24[25_262 2 29 30 3 D.6 W.B. tD ,, .1bIW,IBulb Dew Poin 70 ’, 1.J3 . . 1[Z . l l 1III , 2j2920 ’ -243 29-31---3 -Ja l -1s 𔄁-7

  16. Sewart AFB, Smyrna, Tennessee. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1967-07-10

    0 100.0 3.2 TOTAL NUMBER 0F OBSERVATIONS 2138 i i210 WS Uo o,4 0.8.5 (OL . 1) ,Rmvous tD ,5,o0 or ?His rO5 ARE OB0OLET ,0 0, all X;... • "N ,,I% t...2 TOTAL 2.8oL815-2-12.1 9.51 8*o? 6°4 3.21 2.1 e *2 .01 L53 11 6.2 I ____ Ele en (XI _ _X’ Elmn X°Z( _______x No. Obs Meon No ol Hours with

  17. Final Environmental Impact Statement, Peacekeeper in Minuteman Silos, F.E. Warren AFB, Wyoming. Volume 1.

    Science.gov (United States)

    1984-01-01

    Services and Facilities • .......... Uti I .ties. . % ? Energy Resources - - 0 Transportati on * 0) • ::::: ’:’::::’ ::::: Land Use - - :::~: i...RNs, 31 LPNs, 31 nurses aides, 3 pharmacists , 2 dieticians, 3 physical therapists, and 18 specialized technicians. The physician staff levels of

  18. Environmental Impact Analysis Process. Supplement to Final Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California

    Science.gov (United States)

    1983-07-01

    access roads to industrial parks and areas, public tourism facilities and vocational schools. Eligible applicants include states, cities, coun- ties...Fill tum f~rm tmkszc tUV&, stege pcopelintu, and supply pcopaL1ans to Smm aiattia whica at the mmo Pa. * Ibims - prape1int pumps, vapt boil-off

  19. Environmental Assessment: Replace Sanitary Sewer from Building 801 to Lagoons at Grand Forks AFB, North Dakota

    Science.gov (United States)

    2010-09-01

    emergent marsh (PEM) wetlands are characterized by erect, rooted , herbaceous hydrophytes, excluding mosses and lichens. This vegetation is present...species), chokecherry and wood rose (Rosa woodsii) are common in the under story in this area. Wood nettle (Laportea canadensis), stinging nettle ...minimized. In areas where excavation is not proposed but vegetation removal is necessary, vegetation should be cut at the ground level, leaving roots

  20. Final Environmental Assessment for Aerial Spraying for Invasive Species Control MacDill AFB, Florida

    Science.gov (United States)

    2007-09-01

    EYE PROTECTION: Chemical resistant gloves made of any waterproof material. Chemical goggles recommended. Shoes l!_lus socks. PRODUCT NAME...resistant coveralls, waterproof gloves, waterproof boots and face/eye protection. If dusting occurs, use NIOSH approved respirator protection. Initial...this product. Applicators and other handlers must wear: Long-sleeved shirt and long pants. Shoes plus socks. Follow manufacturer’s instructions for

  1. Justification for Closure for the Base Exchange Service Station (Site ST019), Randolph AFB, Texas

    National Research Council Canada - National Science Library

    1998-01-01

    .... In the summer of 1996, an abandoned aviation gasoline (AVGAS) line was severed during Base construction activities, resulting in the release of an unknown quantity of fuel to the subsurface (see Exhibit...

  2. Environmental Assessment, Construction of 315th Airlift Wing War Readiness Material Warehouse, Charleston AFB, South Carolina

    Science.gov (United States)

    2003-12-08

    INDOOR AND OUTDOOR NOISE SOURCES COMMON OUTDOOR NOISE LEVEL COMMON INDOOR NOISE LEVELS (dBA) NOISE LEVELS - ~ 110 Rock Band - r- 100 Gas Lawn Mower at...Shouting at 3 ft. Gas Lawn Mower at 100 ft. Vacuum Cleaner et 10ft. - ~ 70 Commercial Area Normal Speech at 3 ft. Heavy Traffic at 300 ft

  3. An Evaluation of the Limited Contract Warrant Experiment at March AFB.

    Science.gov (United States)

    1986-09-01

    than $1,000, and these account for only 4.5% of the total dollars expended (23). Statistics for the entire Air Force reflect a similar situation. In FY...sent with the workbook for the person administering the course.(2 1:1) The subjects covered in the coursebook are: Introduction to Defense Small...7 course as statistics are maintained by each of the 112 chapters separately. (56) There are some private consultants who provide training in this

  4. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Kirtland AFB, New Mexico

    Science.gov (United States)

    1981-11-01

    hikers, skiers and snowmobilers. 1960TH COMMUNICATIONS SQUADRON Mission: Provides operation and maintenance of common-user communications facilities for...public and private records, interviews with knowledgeable parties and site visits. G- 1 -- 1 a)0 o4 i.) U ~ -0 w0.u 4-I (0 00) 0 4J -4 ).$4d 4.) 4-4 0 04

  5. Chanute AFB, Rantoul, Illinois. Revised Uniform Summary of Surfae Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1972-10-27

    ILLTNUS/RAN~fjUL -NV STATION STATION NAE YEARS MONTH PAGE 2 ALL....- -iOdR-5 (L. S. T.) Tcnmp WET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 -2 3...flC STATION S TIO NAME YAHS MONTH PAGE I O009-02O0 HOUR3 (L. S. T-p WET BULb TEMPERA’ URE DEPRESSIO . (F) ]- TOTAL TOTAL (F 1 0 -21 4T 5- 7 9. 10

  6. Plattsburgh, AFB, New York. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-01-24

    GLOCAL CLIMATOLOGY 3RANCH LSAFETAC SURFACE WINDS 410 wrATHER SERVICE/MAC PERCENTAGE FREQUENCY OF WIND...oeux1I, . .p 4. A i € * GLOcAL CLIMATCLOGY RANCH L’AFETAC CEILING VERSUS VISIBILITY AIP ’-EATHFR SRVlCE/MAC 72(7Z_ PLATTSBURSH AFS NV 74-97 *A

  7. Beale AFB, Marysville, California Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-08-19

    GLOCAL CLIMATOLO0Y BRANCH USAFETAC SURFACE WINDS A14 4EATHFk SERVICE/MAC PERCENTAGE FREQUENCY OF WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) " ;F...930 F £ USAFETAC 0-8.S (OL.A) PSEVWOUS EDITIONS 0 THIs PONM AS O Nso~ITI - V--. .1 I j GLOCAL CLIMATOLOGY BRANCH uS AFETAC SURFACE WINDS ATR W EATHER

  8. Holloman AFB, New Mexico. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1982-04-12

    A RC ..... sl6 3i4 ~ N0 A.o 0 o2 *I A3 05 .7 0 to TRACE A 5S :S TRAC .29 .0.0 *2.. *,.j st16 &TRC T ACt la S4 :01 o Ŕ TRAC risAc *4 ?P.TAC *I .0 .02...2l 046 t.2 145 .14 TRACE TRACI T*A TRI 004....~ 60 A001. sOJa .. , 46 .31 .04 .01 6 at .0 .2 .10 47 1_ 1_ - -A .121 __ 48 1.2 .61 .0 TRAC 2.9 l.9 al...r - sea--vu 6s 23.6 *7.6 20 1 9 26 1.9 7 02__1 wo 10mS 0 .5 02U*1*7 9 w 91 "m,. om .4FVC%. LA ~im wm ul 19 292 Ze* ~ U -A- GLiCBAL CLIMATOLOGY

  9. Environmental Assessment for Proposed Royal Saudi Air Force F-15SA Beddown, Mountain Home AFB

    Science.gov (United States)

    2012-08-01

    Whichever is higher) \\ / . " ~ \\ ’ ·’i’ o\\’!1’\\’!1 ~ i. ~ \\ 12.5 25 Mih \\ ,~.’!10 ~’ ,........-- > ~ / . _.:. ~~. / ..,..,\\~~ 25 50 Kilometers SAU

  10. Extended Bioventing Testing Results at the BX Service Station Site, Patrick AFB, Florida

    National Research Council Canada - National Science Library

    Marchand, Ed

    1997-01-01

    .... Soil gas samples were collected, and in situ respiration testing was performed by Parsons ES from 8 to 14 November 1996 to assess the extent of remediation completed during approximately 3 months...

  11. Environmental Assessment for the Construction of Eielson AFB Youth Center Eielson Air Force Base, Alaska

    Science.gov (United States)

    2010-09-01

    5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S...AND ADDRESS(ES) Bestech,1040 Lorne Street unit 3,Sudbury, Ontario P3C 4R9, 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING...athletic activities, including soccer, baseball, softball , t-ball, football, cheerleading, junior wrestling, and basketball. Instructional programs

  12. Loring AFB, Maine. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1983-08-12

    8217rHE ( S.9V1CE/-At "- 7-c L-) T’ AFR ME 73-62 J A’, PERCENTAGE FREQUENCY OF OCCURRENCE 1 , ?-17’ FROM HOURLY OBSERVATIONS) iso S. <A’- ’fVE 1. , 39.1...142976_ 33977 3A.9 5.5 90 S O 22.1 02? 9 ? W.8.b 0P56 3~3~33~7.786 898 41013 go *~O..669019 22619 ZS.21tV.521 69 .51 68.3 : ,-Ni V4 7 L AL CL IMA TOLCu...8217 I f4 64 4/ e .’ .1 .2 1 .3 .2 .21 C 93 93’ S. 4 1 .11 .2 . , .4 . .1 ISO 1513 -f 79 1 .’ .7 .6’ :6 *5 . 7’ *1 I 256 256 ’ 7, / 77 .0 .2 .Q .91 .8 .e

  13. Tracals Evaluation Report. Communications Initial Evaluation Report, Keesler AFB, Mississippi, 10-15 March 1980.

    Science.gov (United States)

    1980-05-15

    antenna platform . Moving 320.1 MHz from antenna B to antenna G at the GATR site would reduce the lobing structure for this frequency and provide more...uniform coverage. Providing increased antenna separation by spacing only four antennas along the east and west sides of the antenna platform would also...E~ 0 / C4 Is- / It /;/ ,iK 4 I’~ / / ~;~:;’/if ~4Co j0 I i0 - - - -L C4- j Wix L -,> 3-4 = x GZ li i Iz 3 0 Cc -, A25-4 L Attachment 25 ooLa I.- 0

  14. NOAA-L satellite is mated to Apogee Kick Motor at Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    Inside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., workers oversee the mating of the Apogee Kick Motor (below) to the National Oceanic and Atmospheric Administration (NOAA-L) satellite above. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. CS-10 Verification Survey at Former McClellan AFB, Sacramento, CA

    Science.gov (United States)

    2013-09-26

    8217!11C’D ./ -k~>olY 3ə ’-Af" 4 \\I Olt te’o Q__li~\\ (G"d.07y r ,~ ’illi’ 󈧏󈧓 ’>, - c;;¥a’f’’i c""" I 16 Distribution A: Approved for public release

  15. Final Environmental Assessment- Air Traffic Control Tower and Fire Station Pope AFB, NC

    Science.gov (United States)

    2004-06-01

    depressions on the landscape, and between water and dry land along the edges of streams, rivers, lakes, and coastlines. Inland wetlands receive water from...bladderwort c May-July Vaccinium macrocarpon Cranberry c April-June Utricularia olivacea Dwarf bladderwort T Sept-Oct Warea cuneifolia Carolina

  16. Environmental Assessment: Base Realignment and Closure (BRAC) 2005 Mission Realignments to Vandenberg AFB

    Science.gov (United States)

    2007-02-01

    implied by altered connective tissue metabolism and altered pulmonary morphology in animals after long-term exposures and pulmonary function...addition to the wildlife found in chaparral, other species include mammals like Heerman’s kangaroo rat (Dipodomys heermanni), Broad-footed mole (Scapanus

  17. George AFB Victorville, California. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1977-08-05

    CA/VICTORVILLE juL. SAINSTATION NAME YEARS MOTH 1’ PERCENTAGE FREQUENCY nF O~cU i:;,,CF pF WFATIIER CONDITIONS FROM HOURLY LUqSRVA+ICNS MNH HOURS TUDR...NAME YEARS - -M*- P3ERCENITAGE FeREQUENCY OF ucc’jRPENCF OF WEAT’HER CoNOTTIONS FRum HOtJRL7 0A!lc9VATjCNS MNH HOURS ITHUNDER. .RAIN FREEZING SNOW...YEARS 24 H(OUR AIIOuNTS IN INLHES MNH JAN FEB. MAR APR, MAY JUN JU AUG SEP OCT NOV DEC ’ MNH YEAR~ M ONTIHS𔃺 74 13 -i 1~2 D :21 .0() .72 .I36 75 00A

  18. In Situ Soil Venting - Full Scale Test, Hill AFB. Volume 3. Guidance Document, Literature Review

    Science.gov (United States)

    1991-08-01

    calculations of hydrocarbon removal efficiency ( Section V.J). 2. Aurea Becncath Tank Excavation The area bcncath the tank excavation was subdivided into...Capt. Michael Elliott, Mr. Doug Downey, and Capt. Edward Marchand. Section V.E. of this document consists of the text of ’Enhanced Biodegrzdation...Environics Division (The reverse of this page is blank) TABLE OF CONTENTS Section Title Page I INTRODUCTION ......................................... 1 A

  19. 111 original article prevalence of hiv/sputum afb positivity among

    African Journals Online (AJOL)

    boaz

    Correspondence: Dr. Iyoha Osaretin, Department of Medical Microbiology, University of Benin, ... d'âges 40 – 49 et 50 – 59 avait la plus forte Co - infection de TB/HIV (2,5%). ..... not be unconnected with the increased awareness of ... tourist centres [48].

  1. Environmental Assessment for Enhanced Use Leasing West Side Development, Phase I South, Hill AFB, Utah

    National Research Council Canada - National Science Library

    Winn, Kay

    2006-01-01

    This document presents potential environmental and socioeconomic consequences associated with the proposed project called the West Side Development, Phase 1 South, developing approximately 44 acres...

  2. Baseline Hazardous Waste Stream Characterization Survey at the 21st Tactical Fighter Wing Elmendorf AFB, Alaska

    Science.gov (United States)

    1991-11-01

    CES/DEEV). The Defense Reutilization and Marketing Office (DRMO) is responsible for contractual removal of hazardous waste. BES supports the program...RGNT HOSP ELMEŕDORFGGEPB Test Results ~ Utnit- "-R~one LCL ucg L wosnLCL uq L FP in LCL mci L irwtn Ter~rrn ride LLL miYL 9.1 crot -ne LF mqzL

  3. Environmental Assessment: Access Roads and An Associated Interior Road, Centennial Estates Lease, Ellsworth AFB, SD

    Science.gov (United States)

    2012-05-01

    Near jet plane at takeoff 140 Gun muzzle blast 140 Threshold of pain 120 Loud music 115 Car horn 115 Thunder 110 Chainsaw 100 Lawn...Swainson’s hawk and the silver-haired bat do not occur in the areas of the Proposed Action. 15 Habitat for the burrowing owl includes prairie dog colonies...that are reportedly present near the proposed 16 Tower Road and Legion Boulevard. Burrowing owls generally use abandoned prairie dog burrows and 17

  4. Environmental Assessment for Restoration and Stabilization of Eastern Shoreline MacDill AFB, Florida

    Science.gov (United States)

    2005-12-01

    heal stress , and machinery injuries. Construction would not involve any unique hazards and all construction methods would comply with Occupational...slips, heat stress , and machinery injuries. Construction would not involve any unique hazards, and all construction methods would comply with OSHA...Chloropropane, Benzene, Cumine , Naphthalene, benzo(b)flouranthene, toluene Soils: Benzo(a)pyrene, dibenzo(a,h)anthracene, Pb, naphthalene, toluene Surface

  5. Remedial Investigation/Feasibility Study, Operable Unit 5, Elmendorf AFB, Anchorage, Alaska. Volume 1. Text

    Science.gov (United States)

    1994-03-04

    the protective steel casing to hold it in place and proec the surface seal. Protective steel boilards set in concrete were installed around monitorig ...banks, high watermarks, channel morphology, and canopy cover (Appendix J, Table 1.3). Weather Comdltlaos This assessment included approximate cloud

  6. Recent advances in AFB biomass gasification pilot plant with catalytic reactors in a downstream slip flow

    Energy Technology Data Exchange (ETDEWEB)

    Aznar, M P; Gil, J; Martin, J A; Frances, E; Olivares, A; Caballero, M A; Perez, P [Saragossa Univ. (Spain). Dept. of Chemistry and Environment; Corella, J [Madrid Univ. (Spain)

    1997-12-31

    A new 3rd generation pilot plant is being used for hot catalytic raw gas cleaning. It is based on a 15 cm. i.d. fluidized bed with biomass throughputs of 400-650 kg/h.m{sup 2}. Gasification is performed using mixtures of steam and oxygen. The produced gas is passed in a slip flow by two reactors in series containing a calcined dolomite and a commercial reforming catalyst. Tars are periodically sampled and analysed after the three reactors. Tar conversions of 99.99 % and a 300 % increase of the hydrogen content in the gas are obtained. (author) (2 refs.)

  7. Winning with Green Remediation Practices at the Former McClellan AFB, Sacramento CA

    Science.gov (United States)

    2011-05-12

    PCE)  Metals (lead, cadmium, chromium)  Fuels (gas and diesel )  Radiological (Radium 226)  Largest cleanup effort in the Air Force  318 sites...Existing pump and treat system replaced with sustainable in-situ bioremediation (passive vegetable oil injection)  Cost to complete reduced by $15,000,000

  8. Survey Analysis of Military Parishes: The Wright-Patterson AFB Catholic Parish Example.

    Science.gov (United States)

    1980-08-01

    had scores which varied from mass to mass--sense of prayerfulness, singing, sense of community, and performance of guitar group--shown in Table 14. 17...significance is that the 1980 ratings were better than the 1978 ratings for all liturgy planning areas. An overall average liturgy planning score was...calculated for each indi- vidual who rated any of the topics. Those scores indicate generally positive perceptions of the liturgies. Eighty-six

  9. Environmental Assessment for Construction of a 20-Slip Boat Dock Structure MacDill AFB, Florida

    Science.gov (United States)

    2008-01-01

    practice CAA Clean Air Act CCA chromated copper arsenate CEQ Council on Environmental Quality CES Civil Engineering Squadron CEV Environmental...newspaper advertisement in the April 10, 2007 edition of the Tampa Tribune announcing the availability of the Draft EA for public review at the John F...chlorine, freon, paints, thinners, oils, lubricants, compressed gases, pesticides, herbicides, nitrates, and chromates . A detailed tracking and accounting

  10. Environmental Assessment for Construction of Multiple Roadway Improvement Projects MacDill AFB, Florida

    Science.gov (United States)

    2011-01-01

    chlorine, freon, paints, thinners, oils, lubricants, compressed gases, pesticides, herbicides, nitrates, and chromates . A detailed tracking and...prolific beneficiaries of tl1e earmark system. In the three years since pub- lic disclosure of earmark LEGAL ADVERTISEMENT . PUBLIC NOTICE - UN~TED...ago: AI Gc legal fight to expand r Otic om GN (all bet ’fl?is offer i of your hem certified LEGAl. ADVERTISE ~ lENT ~ ,.._J) PUBLIC NOTICE

  11. Maxwell AFB, Alabama. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1982-08-24

    DECE4M________ I ?A- ’,ss7 M1IL AnlAAN1 STATION L0CATIO*1Af’ MSWINT’ M !t ATION HISTORY 1 Maxwell Fld, AlIabama -"r 4~m 37 Dee 41 5 132.-.23 It ON 21 1.72 175 A4...Station History at front of book and observation counts in each summsry to evaluate the smounts of data missing. (2) Rail vas included in snowfall...a~t I-l113 ,dl > low0 67. 93. 96. 96 9. 96. 96. 96.9 96.6 96.6 946 96.6 96.6 96.6 96.6 946 1500 47 94 9i .2 lbA Aka 96, -ma IkEa hi iIL IA -9Ŗ 02 4

  12. Castle AFB, Merced, California. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1981-02-27

    5 1. 1 .3 1 .o4 930 -12-141 ...... 8 1.8 __B .81 1.9 930 15-171 ISO 0 :: __ 1.2 1.2 930 I8- o . 1.2 - 1 .3 .9 .1 1.3 930 1 3 1 3 930II l ___ 1...67.667.769.4 71. 1800 28. 43.2 48.o 52. 56.1 57.7 59.4 63.2 64.4 66.3 67.4 67.5 68.3 68.4 69.0 71.9 i Iso 28. 43. 48.1 5 :* 5b. 584 609O 63.9 .51 67. 68...7 9. 0 8. 34,2 84- 85*4 B5* 85.6 8583 .5.7 8 5.8 -16 Sbal 1oo 647 80. 81 3 i85. 87. 88, 89 9, 899 90.0 9000 900.1 9 1. 2 9o.3 "I 0. >3500 666. 82. 85

  13. Installation Restoration Program. Phase 2. Confirmation McClellan AFB, California. Volume 1

    Science.gov (United States)

    1983-06-01

    testing in accordance with ASTH C 828-78 and in conformance with CAL/ OSHA safety orders and ES Industrial Sewer Entry Procedures. Indi- viduals entering...Liquid Palm Cil Wastes," Proceedings: Asia Acuatech, Singapore, Malaysia , March 1980 (Coauthors R. White and C. Ponniah). "Surface Impoundment of

  14. Experimental Evaluation of the Flight Line Food Service Facility at Travis AFB

    Science.gov (United States)

    1974-06-01

    Potatoes/ Mixed Vegetables TUE - Baked Ham/Home Fries/Peas & Carrots and Fried Chicken /Dotato Puffs/ Mexican Corn WED - Roast Pork...8217emm^^mmi - TABLE 1 DINNER MENU SOUPS DAILY Chili Con Came, Chicken Noodle Soup, Vegetable Soup, Cream of Tomato Soup MON - Vegetable-Beef...Soup TUE - Cream of Chicken Soup WED - Minestrone Soup THU - Beef Noodle Soup FRI - Clam Chowder SAT - Chicken Rice Soup SUN

  15. Environmental Impact Analysis Process. Environmental Impact Statement Space Shuttle Program Vandenberg AFB, California

    Science.gov (United States)

    1978-01-01

    MAIMIEOIR, NATIUM L FEATURES TO BE ALTERED: Nost applicable. EMISSIONS: .• Operational: Space Shuttle main eagin. and SolidRocket Roast r exhaust. 414...symptom. (50) (2) From animal studies" (a) Bobwhite quail and domestic chicken eggs displayed a 50 percent mortality rate upon a single 15-minute exposure...t In another planned study (as opposed to casual observation) chicken eggs were exposed to about 30 sonic booms per day during incubation; median

  16. Final Environmental Assessment and Finding of No Significant Impact Proposed Running Track Hanscom AFB, Bedford, Massachusetts

    Science.gov (United States)

    2004-09-01

    agency response letters are included in Appendix B. Mr. Robert W. GoUedge, Jr. Commissioner, MADEP: No Comment Mr. Garry C. Waldeck MADEP...Headquarters: -Requested copy of Environmental Assessment ( No comment ). Mr. David Shakespeare MADEP - BWSC: No Comment Mr. James Sprague , ·. MADEP, NERO...Division of Watershed Management - Wetlands Program: No Comment · Mr. John Zajac MADEP, NERO Division ofWatershed Management: No Comment Mr. Todd

  17. Edwards AFB, California. Limited Surface Observations Climatic Summary (LISOCS). Parts A, C-F.

    Science.gov (United States)

    1984-12-01

    ORp AND OR HAIL OBS WITH FOG AND OR SLOWING N RWTHOS OO STOR.S SNO W ADO IHOS OOPDRIZZLE DRIZZLE SLEET FRECIF HAZE SAND TO VISION Gas . S_...S--I- ___ IF L1 A--- - - - - -- TOTAL NUMIEI OP OSSEIVATIONSS T USAFETAC 0-8-5,0L-A, pivoos rO),O.$ Or tRIS porno ARE oSsoLE’S

  18. Installation Restoration Program. Phase 1. Records Search, Charleston AFB, South Carolina

    Science.gov (United States)

    1983-10-01

    and plastics plants. Conducted industrial waste surveys, landfill design, and planning for plant environmental protection programs; evaluated air...management study for a major plastics manufacturing company. Responsibilitites included identification and investigation of a number of operating...61 aste Caracteristics 68 Pathways 69 Total 198 divided by 3 = 63 3ross total sc,:re B. Aooly factor for waste containment from waste manaement

  19. Military Housing Privatization Initiative (MHPI), Eglin AFB, Florida and Hurlburt Field, Florida. Final Environmental Impact Statement

    Science.gov (United States)

    2011-05-01

    Gene G. Sanderson George E. Cox Gerald A. Rush* Gerald Goodson Ginny Graybiel Glenda L. Glover Gordon Eldridge Gordon Goodin Greg Artabasy Greg... Fanc ~np. Thank you very much. COLONEL CUMBIE: Thank you, sir. !Vlr. Robert Larson . MR. LARSON: My name is Robert Larson . The Military Housing

  20. Uniform Summary of Surface Weather Observations (RUSSWO), Edwards AFB, Lancaster, California (Revised)

    Science.gov (United States)

    1979-02-09

    EARSONT -P-rCENTAGF FI’ UEN(Y r-F u-ckJR~NCE- OF WEATHER CONDITI2NS FRUW HOURLY JBSERVATIONS HOURS THUNDER- PAIN FREEZING SNOW 1 O1 SMOKE DUST X OF...o..,s o, L.,s ,o ., MI, oSSOUI 99 .. polg ?’ 10.1100ok Qooa.9 o . ol911- 4-’ . . . .- I >1k - -v ---. ---- - -- -- 2 ~ GL0l3t.L CLIMATOUurf’ BRA"C

  1. Draft Environmental Impact Statement: F-15E Beddown at Seymour Johnson AFB, North Carolina

    Science.gov (United States)

    1988-03-01

    destruction, stunted growth, necrosis ( killing of plant tissue), chlorosis (loss or reduction in plant chlorophyll), leaf abscission (dropping of leaves...occasionally run, fly, or crowd when exposed to sonic booms. In a field and laboratory study, Mourning Doves, Mockingbirds , Cardinals, Lark Sparrows, and

  2. Tyndall AFB, Florida. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1982-12-03

    8.. 4𔃾. o.0I 44 ’ ’O 󈧤 I6F .3 16 .J PSYCHROMETRIC SUMMARY T-WET BULB TEM4PERATURE DEPRESION JF) TOTAL TOTAL F 0 1 2 3 4 5 6 8 9 T10 12 13 ]A 15 6...STATION VATON AM.3 WET BULB TEMPERATURE DEPRESION F1 TOTAL TOTAL (F) 0 1-2 3-4 5-6 7-. 9 10 11. 2 13 14 151. 6 17 1 19 20 21 22 23 24.25-26.27 2.29 30 31

  3. Homestead AFB, Florida Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-09-01

    TEMPERATURE DEPRESION (P) _ TOTAL. TOTAL IF) 0 1.2 3-4 1 5- 7.6 19-10 11-1 12 -14 IS- 10 17 -i8 It-20121-22 23-24 2S.3627. S 294-01 hJ3-02W.U- o,,m61b Wo...I 1ll91 T.pWIT SULIS TIMPURATURN DEPRESION (F) TOTAL TOTAL (F) 0 1.2 3.-4 15.6 7. - 0- 0 132Oi $.16212223-24 25 2 S 2 . 2- .31 .AdW11. My O 11S.IbfvWS

  4. Clark AFB, Philippines. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-02-01

    34---- . - - 0 -- Web S Lr’: L ’LT tTnLOGY 9 PANCH𔃼, ETA C SURFACE WINDS * EAT S VI C /~E PERCENTAGE FREQUENCY OF WIND DIRECTION AND...CEILING VERSUS VISIBILITY Alp *.ATH’P Srv~cr/V , c 9E’-7- LLAPK AFFP 73-8’ Ncv * PERCENTAGE FREQUENCY OF OCCURRENCE ALL FROM HOURLY OBSERVATIONS) 50a... NCV PERCENTAGE FREQUENCY OF OCCURRENCE 7.i -7l1. (FROM HOURLY OBSERVATIONS) % Sl8l,Tl $IATiTE MILES >10 :6 t5 >4 3 >2 -2 6 ’ !c - I 𔄀 4F~,’ 4 9.7 49.8

  5. George AFB, Victorville, Caifornia Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A -F.

    Science.gov (United States)

    1981-09-14

    722 6.21 ; WeB &b 958.j11 25971 36.) 5.77 22 22.5 4 m Do-. 6 44564 20 512 2P.Q 9.261 122 .7 58.4 ,4 • . ,. - 6 1 ...,. , ., . I . . t - GL -!- AL CLI.1A...PSYCHROMETRIC SUMMARY ,E’_ . ",L ,F- C/ P’-773-3- NCV STATION STATION NAME YEARS MONT" NOURS IL. S. T.I Te.p. WET BULB TEMPERATURE DEPRESSION (F) TOTAL

  6. Final Environmental Assessment (EA) for the Revitalization of Military Family Housing Keesler AFB, MS

    Science.gov (United States)

    2006-03-01

    12,000 square feet each). An Olympic-size swimming pool (approximately 71 feet by 164 feet). Twelve covered bus stops. A skateboard park...11,644 Covered Bus Stop 100 12 1,200 Skateboard Park 10,890 1 10,890 Storage Unit 100 534 53,400 Total N/A N/A 125,134 Location to be determined...Olympic-size Swimming Pool 1 1 Covered Bus Stop 5 4 3 12 Skateboard Park 1 1 Storage Unit 0 294 160 80 534 2.6 ALTERNATIVE 1 (IMMEDIATE

  7. Recent advances in AFB biomass gasification pilot plant with catalytic reactors in a downstream slip flow

    Energy Technology Data Exchange (ETDEWEB)

    Aznar, M.P.; Gil, J.; Martin, J.A.; Frances, E.; Olivares, A.; Caballero, M.A.; Perez, P. [Saragossa Univ. (Spain). Dept. of Chemistry and Environment; Corella, J. [Madrid Univ. (Spain)

    1996-12-31

    A new 3rd generation pilot plant is being used for hot catalytic raw gas cleaning. It is based on a 15 cm. i.d. fluidized bed with biomass throughputs of 400-650 kg/h.m{sup 2}. Gasification is performed using mixtures of steam and oxygen. The produced gas is passed in a slip flow by two reactors in series containing a calcined dolomite and a commercial reforming catalyst. Tars are periodically sampled and analysed after the three reactors. Tar conversions of 99.99 % and a 300 % increase of the hydrogen content in the gas are obtained. (author) (2 refs.)

  8. Moody AFB, Georgia. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1982-05-21

    626 626 3oo ŕ 8IlL AL3 3 16 . 4o 8.4 84,] 89.1 841. - 100 21. .1 86 0 6S 7. So0 $S .O S .1 08.0 ISO 6S.? S . 8 6350 ? $S0 2 00 21. 57. 66. jT Ii &Tel...0 71. 762 72@ . 72. 72.. 72a 72a 72C 72, 72. 72, m 8000 32. 75 75. 75. 75o 75. 76. 76o 76. 2 76. 2 76.2 76. Z 76.2 76.2 76.2 7a. 27000 327 -76J 760b...79 7,. Ti 76.• I .7.7 76.7 76. 76. 6.7 76T.7 76. >1o4000 15.1 72.1 77.1 78. 74. 78 78.5 78.5 78.5 78.* 78.5 78.5 78.5 78.5 78.5 78.5>2000o Iso 73+ 781

  9. Minot AFB, North Dakota. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1983-04-01

    DEC I I. T! 8.61 57.9 6 1.5 21.1 1.3 19.8 37.9 71 TO~S8.3 2c.7t 2.1 26.8 .~5G* 18.A 1.? 8.% . 25. 8 43 USAFETAC 0 10 SIOL Al, P,.f usl 0-O .S n...N ih T m.p w.ato r. R[ .I. T0 F 32 F 6 F 73 IF 8 R P *93 F 1 ,To - Dry Bulb 4 W., SoIl 51 . -- - - -- - -- - - - - - ~ --- ----D..- - -~ GLOBAL

  10. Asymmetric fan beams (AFB) for improvement of the craniocaudal dose distribution in helical tomotherapy delivery

    International Nuclear Information System (INIS)

    Gladwish, Adam; Kron, Tomas; McNiven, Andrea; Bauman, Glenn; Van Dyk, Jake

    2004-01-01

    Helical tomotherapy (HT) is a novel radiotherapy technique that utilizes intensity modulated fan beams that deliver highly conformal dose distributions in a helical beam trajectory. The most significant limitation in dose delivery with a constant fan beam thickness (FBT) is the penumbra width of the dose distribution in the craniocaudal direction, which is equivalent to the FBT. We propose to employ a half-blocked fan beam at start and stop location to reduce the penumbra width by half. By opening the jaw slowly during the helical delivery until the desired FBT is achieved it is possible to create a sharper edge in the superior and inferior direction from the target. The technique was studied using a tomotherapy beam model implemented on a commercial treatment planning system (Theraplan Plus V3.0). It was demonstrated that the dose distribution delivered using a 25 mm fan beam can be improved significantly, to reduce the dose to normal structures located superiorly and inferiorly of the target. Dosimetry for this technique is straightforward down to a FBT of 15 mm and implementation should be simple as no changes in couch movement are required compared to a standard HT delivery. We conclude that the use of asymmetric collimated fan beams for the start and stop of the helical tomotherapeutic dose delivery has the potential of significantly improving the dose distribution in helical tomotherapy

  11. Maxwell AFB, Montgomery, Alabama. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1974-09-19

    VISION GAS . MAY 00-02 09 3,8 90 3,8 499 7,7 .1 11.6 3150 ___03.05, 1.1 4,0 1__ __ 4t, 15t6 139, *1 24#7 3188 0o.o13l ,5 397 __ 3t7 10,8 17,6 1__ 1 2497...WINDDIRECTION AND SPEED i (FROM HOURLY OBSERVATIONS) i ( ..1AXWELL AF B A-AA/HMM15C)MIRY 37m,72 sr-P STA TIONl STATIO lolUNK Tgllil "Ol N CLADA NOPAll (IS T

  12. Environmental Assessment for Management of South End of Runway Wetlands, Moody AFB, Georgia

    Science.gov (United States)

    2010-11-01

    livestock within wetland areas, wildlife dispersal techniques and harassment, nest destruction of cattle egrets nests, destruction and oiling of cattle...practices (BMPs) to protect against potential oil or fuel spills. Accordingly, a detailed discussion of hazardous waste is not included in this EA...Regulus calendula ); brown thrasher (Toxostoma rufum); gray catbird, white-eyed vireo, and red-eyed vireo (Vireo olivaceus); northern parula (Parula

  13. Final Environmental Impact Statement. F-15E Beddown at Seymour Johnson AFB, North Carolina

    Science.gov (United States)

    1988-11-18

    ulc.rs, c:lotis, asthma , and headaches; I ncreased risX of disease irom general lowering of resistance rel.ted to the fatigue effect, oi noise exposure...tern, gray bat, Indiana bat, Kemp’s (atlantic) ridley sea I turtle, leatherback sea turtle, and the recently proposed endangered northeastern beach tiger ...Fish and Wildlife Service’s Raleigh Field Office. There would be no construction activity in the habitats of the shrew and tiger beetle and the Iong

  14. Hickam AFB, Hawaii Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1985-04-01

    ZkAN~,I EATV A. TO RELATIVE HUMIDITY -- EAT’E~SE; VIC /MAL I.I 2n 4CK A A F H---- 74-337 STATION STATION NAME PERIOD CUMULATIVE PERCENTAGE FREQUENCY...AL 1 li 9 o G l O 1 0 . 1; 99 .9 7 92 -6 71.2 4 1’_.1 l S 1 67 . 72 2- ] USAFETAC F 0.87-5 (OL A) ....... -LCAIAL CL!’"ATCL3Y -sRANCM EATV - c L r TAC

  15. Grissom AFB, Indiana. Revised Uniform Summary of Surface Weather Observations. Parts A-F.

    Science.gov (United States)

    1987-11-01

    PERIOD OF RECORD: 78-B7 MONTH: MAR HOUSILSTI: ISO -1700 CE ILIOO V|SIBIL1TV IN SIATUTE MILES IN I GE GE GE GE GE GE GE GE GE GE GE GE GE GC GE GE FEET I...77.9 77.9 77.9 77.9 77.9 77.9 77.9 GE200:52 14 748 7.3 7. 79:1 79.4 79.4 79.6 79:7 79:7 79:7 79.7 79.7 79.7 79.74E 27001 25. 7 T4.7 78.2, 91.1 62.4...82175. ’.1. 1 *- I. p ’X k,’ 33U-CS I SD 13.712 15.2?’. 51.51. 10 09? 1k I-j6; b.Z* b.6i k.450,~ 9 Ia..’ I * ISO ? 0S1 921 646 #;v 9: 𔄃 $0 49 vs t7 * P LAN

  16. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1987-12-01

    26/ 609 111 301 13/ 369 13O 271 1 301 281 60 j I :7T 239 259 9/ 309 1lt 271 41 299 29 309 26/ 231 26/ 311 26/ 229 261 281 29O 629 271 61 271 6 ?I I ISO ... 27001 90.9 93. 9 98.8 95.2 96.8 96.9 96.1 96.3 96.6 96.6 96.6 96.6 96.6 96.6 96.6 96.6 b E 1803o 91.1 94.2 95.1 95.8 96.6 96.6 96.8 97.0 97.2 97.2...91.9 91.6 91.6 91.6 91.9 91.9 91.9 92.0 92.0 92.0 92.0 2.0 92.0 92.0 6E 27001 67.0 92.0 92.6 92.9 93.3 93.3 93.3 93.3 93.3 93.0 93.9 91.4 93.0 93.4

  17. Operations and Maintenance Manual for Expanded Bioventing System Site FC-2 Kelly AFB, Texas

    National Research Council Canada - National Science Library

    1996-01-01

    This Operations and Maintenance Manual has been created as a guide for monitoring and maintaining the performance of the bioventing blower and vent well plumbing at the Fire Training Area (Site FC-2...

  18. Randolph AFB, San Antonio, Texas. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1976-03-19

    S700 62.0 70.9 73t5 74.9 76,1 76.3 76.7 77.0 77.1 77.4 77.6 77.6 7 8.u 78.2 78,5 78.8 >_ 600 62.4 72.0 74.8 76,4 77.8 77.8e9I7 78.9 7 795 7 L; 8o r, n...8 .1a - 5 6 8._5 6 8 . 9 -9 8 ,,8 &196.o8 90 1.3 80,0 61,,U 81.6 e2 2 82.4 R2#7 2.9 82.8 32,9 83oU 83911 3.1 83.-1 83,1 83:21 S700 74.6 $4.8 86,u...93.0 9398 91 .4 94.8 9 4,9_ 9_ 5.5 95.5 95 _59 955I._9 A 95.595595.5 S700 88.2 93,5 94,3 9,.9 95o4 95.5 9L." 96.3 96,3 96.4 96.4! 96,4 96.4 96.4 96,4 96

  19. McChord AFB, Tacoma, Washington. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1974-03-19

    83o3 3,9 86,1 87.1 87s2 88,1 88,4 89,4 90,6 a 800 44,1 62,9 68,6 72,1 76,2 77.8 81,4 84,O 84,6 86,9, 87,9 8891 89,1 89#4 90#491,6 S700 44#1 63o1 68,8...9702 97,#2 97,3 S700 59o-- 7 7-,- 86𔃾.- 89*4 93.6 9f4*o4� 97#0 97,1 97,5 970’ 91,7 97971 9707 9707 97o7 600o 59,6 77,9 84*2 89,7 94,0 94#8 󈨤@9

  20. Elmendorf AFB, Anchorage, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1979-09-17

    66.5 67.0 67.5 6b.3 68.5 66.7 69.4 69,j 69.9 S700 64.8 67.3 67.81 .7.9 6 8, 3 68,5 6A.9 69.1 69.7 70.? 11) I 1.71.4 72..n 72.2 72.6 6 8000 67.4 69,9...o4.1 64.1 04.1 64.1 64.3 S700 6? .6 65.4 65.5 05.5 65.5 65O; 4,.r 6 6.’ 1 66.6 6,.7 67.., (7,4 .7.t. 4 67.,4 67.6 6 65.0 b.4 68,6 68.6 68.o 68 .8 6.i...97o4; 97. Z; S700 84.5 88.1 89.4 90.8 91.18 92.6 93.4 95.𔃺 95 .6 96.11 96.7 97. 97.7 97.8 97. 97.9 6 8’.7 d8.6 89.9 91.3 92.3 .i q.8 95.4 96. 1 9A6

  1. Malmstrom AFB, Great Falls, Montana. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1978-06-12

    97,5 97,5 97,6 97.6 8 94 1o 1. 91.9 .23294;2 9 .!7;0Q 97i 8 9±3 9 .3 98. 98. 98i4 96.5.2s±’ S700 601 89 5 9,6 92.0 93.4 94*4 95.5 97.2 98.1198.5 9,.5...88,7 99,4 90L8 09 .t..’ 7 .94-.94.. 0.#. Al.. 994.. -g.. S700 59.1 86.5 88,4 89.0 90.8 91,1 92.8 93.2 93,9 94.5 95.1 95,2 95. 95. 95. 95.’ 60 59g8.7

  2. Davis Monthan AFB Tucson, Arizona. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1976-07-01

    00.0 ’e 800 94?.91 99.9i)0~.0.0100olo.01O.O1Xit.010.0J00.0Iol.010,oooi0.000 000.0 06:0100..) S700 99.9 99.900.030.0100. f00.5130..0100.0100.0100...92.7 92.8 92.6 92,8 92. 92. 92.e 92.8 92:8 92.8 S700 93,6 93.7 93.7 Q3#7 93.7 91*7 Qi,7 93, 93o8 93,9 93.9 93, 93.9 93.9 93.9 93.9 a 6oG 96.5 96.0 9.7

  3. Luke AFB, Phoenix, Arizona. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1974-03-13

    cELIN R: ~16 ::5 -:4 26.3 861 86.8 86,8 KlZ 516 >. > NOCIIN_ 65_67___80 6386e8#88q 86.S8 86.8 86.8 86#8j 86#8 86.8j 86@ 88 2: 20 - 9. 12A . IL a L...60.91 7, 5 R 1 4,2 .3! 2.*4 26_1 _.S 3.0 2’s 3 6.2 2’ 0 1.1 11 - USAFETAC t’ook 09. O -) teu DION fti IJl I O511Jul 64 31 21 O . . .. . . . . I i

  4. Consolidated Site (CS) 024 Verification Survey at Former McClellan AFB, Sacramento, California

    Science.gov (United States)

    2015-03-31

    than 26981 counts per minute ( cpm )]. Yellow dots correspond to data points between 2 and 3 SD above the mean (between 26988 and 28649 cpm ). Red...dots represent all data points above 3 SD (greater than 28650 cpm ). Survey personnel expect higher concentrations in areas marked in red. The color...collected for the trench was dirt. Consequently, the background counts observed in this location are different from the trench, approximately 6100 cpm

  5. Consolidated Site (CS) 022 Verification Survey at Former McClellan AFB, Sacramento, California

    Science.gov (United States)

    2015-03-31

    green dots represent all measured activity points below 1.5 standard deviations (SD) above the mean value [less than 26568 counts per minute ( cpm ...Yellow dots correspond to data points between 0.5 and 1.5 SD above the mean (between 26569 and 29972 cpm ). Orange dots correspond to data points...between 1.5 and 2.5 SD above the mean (between 29973 and 33377 cpm ). Red dots represent all data points above 2.5 SD (greater than 33378 cpm

  6. Environmental Assessment: Demolition of Munitions Storage Area Facilities at Ellsworth AFB, South Dakota

    Science.gov (United States)

    2009-11-01

    CEQ Council on Environmental Quality CFR Code of Federal Regulations CO Carbon Monoxide cpm Counts per Minute CRM Cultural Resource Manager...newspaper advertisement in the Rapid City Journal announcing the availability of the Draft EA for a 30-day public and agency review to facilitate...Ellsworth Air Force Base Munitions Storage Area Environmental Assessment Page 2-5 public involvement in the project. This advertisement was published one

  7. Installation Restoration Program. Phase I - Records Search 92nd Bombardment Wing (Heavy), Fairchild AFB, Washington.

    Science.gov (United States)

    1985-01-01

    a pavillion with a snack bar, six cabins, eight recreational vehicle camping sites with electrical -- hookup only, a covered picnic area, and a small...solidification. Lava: The material extruded by a volcano which consists of molten or part- molten silicate material. Leachate: A solution resulting from

  8. Environmental Assessment for the Expansion of the Elmendorf AFB Gravel Pit

    Science.gov (United States)

    2008-04-01

    portions of the herd migrate off base in fall and winter. To help reduce moose numbers on military lands, Fort Richardson held annual hunts. The...muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red squirrel (Tamiasciurus hudsonicus), snowshoe hare, river otter (Lutra canadensis

  9. 75 FR 29195 - Changes in Flood Elevation Determinations

    Science.gov (United States)

    2010-05-25

    ..., City of Lubbock, Lubbock Avalanche- P.O. Box 2000, Lubbock, Journal. TX 79457. Travis City of Austin..., Mayor, City Austin American of Austin, P.O. Box Statesman. 1088, Austin, TX 78767. Virginia: City of...

  10. 75 FR 72873 - Privacy Act Of 1974; System of Records

    Science.gov (United States)

    2010-11-26

    ... Addiction Severity Index Veterans Affairs Medical Center 7180 Highland Drive Pittsburgh, Pennsylvania 15206. Bidirectional Health Information Austin Information Technology Exchange. Center 1615 Woodward Street Austin... Case Registries Austin Information Technology Center 1615 Woodward Street Austin, Texas 78772. CMOP...

  11. Proceedings of the Solid Freeform Fabrication Symposium (3rd) Held in Austin, Texas on 3-5 August 1992

    Science.gov (United States)

    1992-09-01

    to accept; Manufacturing the desk could be only a very small facility for manufacturing Instant In every manufacturing process Manufacturing will be...produced " instant " parts Layer Characterized most, but not all Manufacturing of the new principles Material Deposit Includes the geometrical...using the NOODLES CAD environment [4]. Next, the CAD model is sliced, and the slices are used to generate files that control the laser mask cutting

  12. Joint Services Electronics Program: Basic Research in Electronics (JSEP) at the University of Texas at Austin. Appendix.

    Science.gov (United States)

    1986-12-31

    applications in tration on the temperature response, an effect also found the processing of Si and III-V compound semiconductors in silicon by Seidel et al. (5...Dannefaer, B. Hogg, and D. Kerr, "Defect Characterization in V. Ckil mo and Cofmment Gallium Arsenide By Positron Annihilation ," in Thirteenth We...unnecessary In "A ’I.I %’ S. 4 Brower et l. A schematic of the experimental arrangement emplSyed for application of the homodyne spectroscopy technique to

  13. U.S. National Congress of Applied Mechanics, 10th, University of Texas, Austin, June 16-20, 1986, Proceedings

    International Nuclear Information System (INIS)

    Lamb, J.P.

    1987-01-01

    Recent advances in applied mechanics are addressed in reviews and reports of theoretical and experimental investigations. Topics examined include cellular biomechanics, computational fluid mechanics, continuum damage mechanics, dispersed systems, the dynamic stability of structures, experimental methods in mechanics, and fluid mechanics in material processing. Consideration is given to manufacturing processes, material modeling for fracture, the mechanics of particulate media, NDE, space structures, stability and the transition to turbulence, temporal and spatial chaos, and unsteady aerodynamics

  14. EnviroAtlas - Austin, TX - Domestic Water Use per Day by U.S. Census Block Group

    Data.gov (United States)

    U.S. Environmental Protection Agency — As included in this EnviroAtlas dataset, the community level domestic water use is calculated using locally available water use data per capita in gallons of water...

  15. Hypervelocity Impact: Proceedings of the 1992 Symposium Held in Austin, Texas on 17-19 November 1992

    Science.gov (United States)

    1993-10-01

    hardening of the impact surface. The metals, copper and aluminum, are both represented in a wealth of impact data obtained in macroscopic impacts at...both theoretical and computational modeling of deformation physics. We have obtained a wealth of impact data in the form of cratered targets, many still...Lawrence Livermore National Laboratory Nellis, William J. Lawrence Livermore Naitonal Laboratory Normandia, Dr. Michael J. Kaman Sciences Corporation

  16. Annual Report on Electronics Research at the University of Texas at Austin. Appendix-JSEP Sponsored Publications

    Science.gov (United States)

    1993-02-14

    and M. 0, Scully. Phys. Rev A 2. 1170 (T1970) several hundreds of ohms at threshold, will cancel the neg- ’P. Lett, w Christian . S Singh. and L Mandel...Agullo- rueda , L. L. Chang and L. Esaki, "Observation of Tamm States’ in Superlattices," Phys. Rev. Lett., vol. 64, pp. 2555-2558, May 1990. 4. Maria...Proc. DARPA ImageUnderstanding Workshop, Los Angeles . California, images. Hence. the search space is reduced from the pp. 227-233, February (1987

  17. The Nation's Report Card Reading 2013 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2013

    2013-01-01

    The National Assessment of Educational Progress (NAEP), in partnership with the National Assessment Governing Board and the Council of the Great City Schools (CGCS), created the Trial Urban District Assessment (TUDA) in 2002 to support the improvement of student achievement in the nation's large urban districts. NAEP TUDA results in mathematics…

  18. How to Do Things with Mouse Clicks: Applying Austin's Speech Act Theory to Explain Learning in Virtual Worlds

    Science.gov (United States)

    Loke, Swee-Kin; Golding, Clinton

    2016-01-01

    This article addresses learning in desktop virtual worlds where students role play for professional education. When students role play in such virtual worlds, they can learn some knowledge and skills that are useful in the physical world. However, existing learning theories do not provide a plausible explanation of how performing non-verbal…

  19. The Nation's Report Card Mathematics 2011 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    This one-page report presents overall results, achievement level percentages and average score results, scores at selected percentiles, average scores for district and large cities, results for student groups (school race, gender, and eligibility for National School Lunch Program) in 2011, and score gaps for student groups. In 2011, the average…

  20. The Nation's Report Card Reading 2011 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    This one-page report presents overall results, achievement level percentages and average score results, scores at selected percentiles, average scores for district and large cities, results for student groups (school race, gender, and eligibility for National School Lunch Program) in 2011, and score gaps for student groups. In 2011, the average…

  1. The Nation's Report Card Mathematics 2011 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    This one-page report presents overall results, achievement level percentages and average score results, scores at selected percentiles, average scores for district and large cities, results for student groups (school race, gender, and eligibility for National School Lunch Program) in 2011, and score gaps for student groups. In 2011, the average…

  2. The Nation's Report Card Science 2009 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    Guided by a new framework, the National Assessment of Educational Progress (NAEP) science assessment was updated in 2009 to keep the content current with key developments in science, curriculum standards, assessments, and research. The 2009 framework organizes science content into three broad content areas. Physical science includes concepts…

  3. The Nation's Report Card Mathematics 2013 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2013

    2013-01-01

    The National Assessment of Educational Progress (NAEP), in partnership with the National Assessment Governing Board and the Council of the Great City Schools (CGCS), created the Trial Urban District Assessment (TUDA) in 2002 to support the improvement of student achievement in the nation's large urban districts. NAEP TUDA results in mathematics…

  4. Austin, Texas: An Educator/Business Collaboration in Support of Teacher Compensation Reform. Teacher Compensation and Teacher Quality: Policy Brief

    Science.gov (United States)

    Committee for Economic Development, 2013

    2013-01-01

    In its 2009 report "Teacher Compensation and Teacher Quality," the Committee for Economic Development urged business leaders to be active participants in school district deliberations about teacher compensation policies. The Committee for Economic Development (CED) noted that "business leaders can make the case to the public that…

  5. The Nation's Report Card Mathematics 2013 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2013

    2013-01-01

    The National Assessment of Educational Progress (NAEP), in partnership with the National Assessment Governing Board and the Council of the Great City Schools (CGCS), created the Trial Urban District Assessment (TUDA) in 2002 to support the improvement of student achievement in the nation's large urban districts. NAEP TUDA results in mathematics…

  6. The Nation's Report Card Reading 2013 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2013

    2013-01-01

    The National Assessment of Educational Progress (NAEP), in partnership with the National Assessment Governing Board and the Council of the Great City Schools (CGCS), created the Trial Urban District Assessment (TUDA) in 2002 to support the improvement of student achievement in the nation's large urban districts. NAEP TUDA results in mathematics…

  7. The Nation's Report Card Science 2009 Trial Urban District Snapshot Report. Austin Independent School District. Grade 4, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    Guided by a new framework, the National Assessment of Educational Progress (NAEP) science assessment was updated in 2009 to keep the content current with key developments in science, curriculum standards, assessments, and research. The 2009 framework organizes science content into three broad content areas. Physical science includes concepts…

  8. Uses of Extra-Legal Sources in "Amicus Curiae" Briefs Submitted in "Fisher v. University of Texas at Austin"

    Science.gov (United States)

    Marin, Patricia; Horn, Catherine L.; Miksch, Karen; Garces, Liliana M.; Yun, John T.

    2018-01-01

    As the political arena becomes increasingly polarized, the legal arena is playing a more important role in the creation of education policy in the United States. One critical stage in the legal process for such efforts is at briefing where "amici curiae," or friends-of-the-court, may introduce additional arguments for the court to…

  9. The Nation's Report Card Reading 2011 Trial Urban District Snapshot Report. Austin Independent School District. Grade 8, Public Schools

    Science.gov (United States)

    National Center for Education Statistics, 2011

    2011-01-01

    This one-page report presents overall results, achievement level percentages and average score results, scores at selected percentiles, average scores for district and large cities, results for student groups (school race, gender, and eligibility for National School Lunch Program) in 2011, and score gaps for student groups. In 2011, the average…

  10. Proceedings of the International Conference (7th) on Machine Learning Held in Austin, Texas on 21-23 June 1990

    Science.gov (United States)

    1990-06-23

    condition part Cardiovascular Systen, the Skin Signs and of a rule, the positive and negative evidence pro- tlte Renal System of the patient [9]. Based on...multilinear thresh- in the for-loop of perceptron.update procedure can be old funcion has many representations. We will con- multiplied by some constant cj E R

  11. Austin Straubel Apt, Green Bay, Wisconsin. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1982-03-15

    78 80 . 81. 8le 82,1 82.1 82,1 82.1 82 82.1 82.2 82o2 82.2 82&2 5 00 73o. i 83 as as as8. 8 8 5 8583 85:3𔃻 85.3 85&4 6504 8504 85o4 > 4500 714: 79. 82...1 .7. 31 31 1a a 54/ 53 .1 3 1 , 1.0 1c .1 31 31 35 19 5 2 / 51 1 S _.10 ISo s n 25 13 SSO/ 49 1:4 loq lO 296 1o3 53 53 42 20 50/49 3 .1 2.6148/ 47

  12. Test Reviews: Reynolds, C., & Voress, J. K. (2007). "Test of Memory and Learning: Second Edition." Austin, TX: PRO-ED

    Science.gov (United States)

    Schmitt, Ara J.; Decker, Scott L.

    2009-01-01

    This article reviews the Test of Memory and Learning: Second Edition (TOMAL-2), published by PRO-ED, which constitutes a recent revision of the Test of Memory and Learning (TOMAL; Reynolds & Bigler, 1994). Advertised as the "single most comprehensive memory battery available for the entire age range of 5 years through 59 years of age", the TOMAL-2…

  13. Comparison of Austin Research Associates and Los Alamos Scientific Laboratory loop-drive boundary conditions. Informal report

    International Nuclear Information System (INIS)

    Shanahan, W.R.

    1979-02-01

    A comparison of two different models for boundary conditions appropriate to the resonant-loop-drive slow-wave structure is presented. The first model is based on a low-frequency approximation in which a capacitive field--current relationship is invoked. The second model is essentially a rigorous field theory approach in which no such low-frequency assumption is made. Significantly lower growth rates are obtained from the latter approach than from the former. Reasons for this difference are sought in an examination of the radial eigenfunctions of the azimuthal electric field. 3 figures

  14. Test Reviews: Ginsburg, H., & Baroody, A. (2003). "Test of Early Mathematics Ability--Third Edition." Austin, TX: Pro-Ed

    Science.gov (United States)

    Bliss, Stacy

    2006-01-01

    The Test of Early Mathematics Ability--Third Edition (TEMA-3) is a norm-referenced parallel forms test intended to identify the level of mathematical ability for children aged 3 years 0 months through 8 years 11 months. According to the authors, the instrument can also be used as a criterion referenced or diagnostic tool for older students who are…

  15. International Conference on Environmental Ergonomics (4th) Held in Austin, Texas on 1-5 October 1990

    Science.gov (United States)

    1991-01-15

    tennis players , marathon runners, joggers, walkers and hikers. Yet over the last 100 years there has been a paucity of literature examining this most...50 to 350 C, in each region. CONCLUSIONS A development effort has resulted in the successful construction of a series of THTS’s. The design approach...work time (85 mins) in AC irrespective of CBA and there was a small (not significant) reduction in work time in NBA if CBA was worn (71.5 and 62.6 mins

  16. Collaboration Between Astronomers at UT Austin and K-12 Teachers: Connecting the Experience of Observing and Research with the Classroom

    Science.gov (United States)

    Finkelstein, Keely D.; Sneden, Christopher; Hemenway, Mary Kay; Preston, Sandra; EXES Teachers Associate Program

    2015-01-01

    McDonald Observatory has a long history of providing teacher professional development (PD), and recently we have developed a new workshop model for more advanced participants. By choosing a select group of middle and high school teachers from those previously involved in our past PD programs, we have created a joint workshop / observing run program for them. After traveling to the observatory, the teachers participate in an actual observing run with a research astronomer. The teachers are trained first-hand how to take observations, operate the telescope, set up the instrument, and monitor observing conditions. The teachers are fully put in the role of observer. They are also given background information before and during the workshop related to the science and data they are helping to collect. The teachers work in teams to both perform the nightly observations with an astronomer, but to also perform new interactive classroom activities with education staff, and use other telescopes on the mountain. This is a unique experience for teachers since it allows them to take the resources and experiences directly back to their classrooms and students. They can directly relate to their students what skills for specific careers in STEM fields are needed. Evaluation from these workshops shows that there is: increased content knowledge among participants, greater impact that will be passed on to their students, and an authentic research experience that can't be replicated in other PD settings. In addition, not only is this program beneficial to the teachers, but this group is benefit to the education program of McDonald Observatory. Building on an existing PD program (with a 16 year history) we have the opportunity to test out new products and new education endeavors with this devoted group of well-trained teachers before bringing them to wider teacher and student audiences. This program is currently supported by the NSF grant AST-1211585 (PI Sneden).

  17. Progress report on research program in elementary particle theory, 1979-1980. [Univ. of Texas at Austin

    Energy Technology Data Exchange (ETDEWEB)

    Sudarshan, E.C.G.; Ne' eman, Y.

    1980-01-01

    A qualitative description is given of research in the following areas: particle physics in relativistic astrophysics and cosmology; phenomenology of weak and electromagnetic interactions; strong interaction physics and quark-parton physics; quantum mechanics, quantum field theory, and fundamental problems; and groups, gauges, and grand unified theories. Reports on this work have already been published, or will be, when it is completed. (RWR)

  18. Proceedings of second geopressured geothermal energy conference, Austin, Texas, February 23--25, 1976. Volume V. Legal, institutional, and environmental

    Energy Technology Data Exchange (ETDEWEB)

    Vanston, J.H.; Elmer, D.B.; Gustavson, T.C.; Kreitler, C.W.; Letlow, K.; Lopreato, S.C.; Meriwether, M.; Ramsey, P.; Rogers, K.E.; Williamson, J.K.

    1976-01-01

    Three separate abstracts were prepared for Volume V of the Proceedings of the Conference. Sections are entitled: Legal Issues in the Development of Geopressured--Geothermal Resources of Texas and Louisiana Gulf Coast; The Development of Geothermal Energy in the Gulf Coast; Socio-economic, Demographic, and Political Considerations; and Geothermal Resources of the Texas Gulf Coast--Environmental Concerns arising from the Production and Disposal of Geothermal waters. (MCW)

  19. Looking Forward: Texas and Its Elderly. Highlights of the Robert Lee Sutherland Seminar (4th, Austin, Texas, May 12, 1984).

    Science.gov (United States)

    Coleman, Marion Tolbert, Ed.; And Others

    This document presents the program agenda and highlights from the one-day Robert Lee Sutherland Seminar held to examine the current status and the future of the elderly population of Texas. Included is the speech, "The Longevity Revolution" by Robert N. Butler, in which is discussed the gain in life expectancy, the feminization of aging,…

  20. Final Report from The University of Texas at Austin for DEGAS: Dynamic Global Address Space programming environments

    Energy Technology Data Exchange (ETDEWEB)

    Erez, Mattan

    2018-02-21

    The Dynamic, Exascale Global Address Space programming environment (DEGAS) project will develop the next generation of programming models and runtime systems to meet the challenges of Exascale computing. Our approach is to provide an efficient and scalable programming model that can be adapted to application needs through the use of dynamic runtime features and domain-specific languages for computational kernels. We address the following technical challenges: Programmability: Rich set of programming constructs based on a Hierarchical Partitioned Global Address Space (HPGAS) model, demonstrated in UPC++. Scalability: Hierarchical locality control, lightweight communication (extended GASNet), and ef- ficient synchronization mechanisms (Phasers). Performance Portability: Just-in-time specialization (SEJITS) for generating hardware-specific code and scheduling libraries for domain-specific adaptive runtimes (Habanero). Energy Efficiency: Communication-optimal code generation to optimize energy efficiency by re- ducing data movement. Resilience: Containment Domains for flexible, domain-specific resilience, using state capture mechanisms and lightweight, asynchronous recovery mechanisms. Interoperability: Runtime and language interoperability with MPI and OpenMP to encourage broad adoption.

  1. The development of intensity modulated radiotherapy (IMRT) for prostate cancer at Austin and Repatriation Medical Centre (ARMC)

    International Nuclear Information System (INIS)

    Joon, D.L.; Mantle, C.; Viotto, A.; Rolfo, A.; Rykers, K.; Fernando, W.; Grace, M.; Liu, G.; Quong, G.; Feigen, M.; Wada, M.; Joon, M.L.; Fogarty, G.; Chao, M.W.; Khoo, V.

    2003-01-01

    To describe the protocol development of the IMRT program for prostate cancer at the ARMC. A series of protocols were defined and developed to facilitate the delivery of intensity modulated radiotherapy for prostate cancer. These included the following: 1. Physical Simulation including bowel and bladder preparation and immobilization 2. Image Acquisition including CT and MRI simulation scans with image co-registration 3. Contouring Definitions including target and organ at risk volumes as well as IMRT optimization and evaluation volumes 4. Radiotherapy Planning including constraint definition, inverse planning and CMS Focus specific parameters 5. DICOM RT interface including data transfer between CMS Focus and the Elekta Linac Desktop record and verify system 6. Verification including action limits and pre-treatment online EPID verification 7. Radiotherapy Delivery being that of step and shoot 8. Quality Assurance including physics testing and documentation The protocol development and testing has lead to the precise clinical delivery of IMRT for prostate cancer at ARMC that exceeds most of the parameters that were previously measured with our conventional and 3D conformal radiotherapy. Further development is now underway to allow it to be implemented as the routine treatment of prostate cancer at ARMC. The clinical implementation of IMRT for prostate cancer involves a collaborative team approach including radiation oncologists, radiation therapists, and radiation physics. This is necessary to develop the appropriate protocols and quality assurance for precision radiotherapy that is required for IMRT

  2. Analysis of, Continuation of, and Report on Data Gathered at Dover AFB Mortuary during Operation Desert Storm: ARO Short Term Analysis Service Program (STAS). Subtitle: Anticipated and Actual Stress of Deployment to the Dover AFB Mortuary during Operation Desert Storm

    Science.gov (United States)

    1992-10-30

    separation and separation from my business interests and clients." - "Hope air flights are on time." - "Bring home my kid brother" - "Not being able to spend...the care and sincereness they gave to their work. - " Fuck this-- I wanted to go." - "I thought being nude was impersonal." - "All the hype prior to

  3. Installation Restoration Program. Phase II. Confirmation/Quantification. Stage 1. Volume 2. Appendices A-M. Cannon AFB, New Mexico.

    Science.gov (United States)

    1986-09-01

    44 00 -4 rr - P.- <C Ix do 4a 0 - 4-P .0 0 di E .4 MIb-4 L. ., 0 z i -4 LLii4wI- cnJ LUJLLS C. W~EC... E- XI- <rLLJ < 0C... C:C~n z w cc w w c- td Ii...UL C 4. 04 N apwj ap qD tD G - c- GD 0C GD# GDQD ’Zn iffg.. o -0 L 0 a &0 03 03 4. a a --4l C~ >C C- a 0 =N r- (D 0 a 0 0 M:. -A 0Dd 0 .4- 0 0 0 0 I4...c𔃻 -l I0 4 - z.. z I 4c u Z (--c ~LL 1 LAJ CLl)L .’-. L& ii <C -4. ..= LO LW 21 ci cl L53 E:; L3 C.:11 Zi 4- z z Z Zz zz i-z C ~ jrnw C c r_ w. F- c

  4. Nellis AFB, Las Vegas, Nevada, Revised Uniform Summary of Surface Weather Observations (RUSSWO). Part A-F

    Science.gov (United States)

    1975-03-07

    Td Tnp WET BULB TEMPERATURE DEPRESSION (F) j TOTAL TOTAL ((F) 1 0 1 1.2 3.-4 5 * 6 7.-8 9 10 111- 12 13. 14 IS. 16 17.18119-20121-22 23-24 252 7 2...18 ___Li -ifnt I 0 -6__ -7t I I Element (X) Z 1l’ Z l No. Oh.. Moon No. of Oours will, romporotuoe O ReI.NHum. 226 3 )52 711 l53 . l 325 "OF s.32P

  5. Evaluation of Random Blinded Re-Checking of AFB Slides under Revised National Tuberculosis Control Programme in Solapur District

    Directory of Open Access Journals (Sweden)

    Swapnil Vishnu Lale

    2013-01-01

    Full Text Available Background: One of the important components of revised national tuberculosis control programme is ‘Good quality diagnosis, primarily by sputum smear microscopy’. All efforts are made to ensure that the designated microscopy centers function at optimal level. The process of ‘Random Blinded Re-Checking’ (RBRCof Acid Fast Bacillus slides is built in the programme. Objectives: To study the relationship of different types of errors detected in RBRC with respect to time, place and cost. To study the stability and capability of the process of RBRC. Methods: Analysis of secondary data of external quality assessment of Solapur district since January 2006 is supplemented by direct implementation of the programme since April 2011 till date. Data analysis is done using statistical software Minitab version 16.Results: Since January 2006 to May 2012;42191 slides were re-checked in 77 RBRC sessions at District Tuberculosis Center, Solapur.Different types of 69 errors were detected. Onsite evaluation and panel testing did not show any discordance. Barshi and Mangalwedha Tuberculosis Units (TU showed significantly higher number of errors as compared to Karmala TU. (P<0.002 Weighted Pareto Chart revealed that the costliest form of errors is high false negatives and low false negatives. Conclusion:Detection of errors in RBRC sessions follows Poisson distribution. The process of RBRC is found to be in control and capable of achieving the desired target of detection of errors.

  6. Scoping Summary Report, Los Angeles AFB, California. Air Force Base Closure and Realignment Environmental Impact Analysis Process Support

    Science.gov (United States)

    1990-07-01

    Mexico 87123 Dayton, Ohio 45402 * Richard A. Lampson Butch Maki Hydro Conduit Corp. Congressman Bill Richardson - 4801 Yucatan N.E. 548 Agua Fria...some chile con queso; however, that would be too much, and I think that might be considered a bribe. The Mayor asked me to convey his regrets. He’s tied...that God sends you here. Also, the small momento that Loretta is giving you, which is our state symbol, has a chile on it; and that’s to remind you

  7. Proceedings of the Defense Readiness and Requirements Symposium Held at Andrews AFB, Maryland on 24-25 September 1980.

    Science.gov (United States)

    1980-09-25

    morning that Jim Schlesinger talked in an article about "rapid? deployment? force?" and I think there’s probably a little truth in that. It may not be...defense acquisition figure, Nietzsche , once was that the commonest form of madness was forgetting what we’re trying to do. His argument was that so often...points of view. Mr. Canan, our moderator, has written this article in Business Week and it’s a splendid article . That’s already been mentioned. I guess

  8. Environmental Impact Statement. Proposed Closure of Los Angeles AFB, California and Relocation of Space Systems Division. Appendix F. Public Comments

    Science.gov (United States)

    1990-11-01

    California) 40 33 Robert J. Wickmire (Hermosa Beach, California) 269 34 J. Lane Zercher ( Playa Del Rey, California) 68 I Ballistic Missile Organization San...71W3M IYT IA AY ACLL. RZA&Y 1CR IT. =MWSIN 3M.O1 SOF RT To IMPAIC us0 am"I REALLY WMRS. I LIMA am IRE REAR 2 VMS. or MAYOR. in 3 MRI isW. HO T DIOG...ITO USR 1, RUFSA . RE.EECT TEACULURTR RECURSDO 17 ARC FUTURE MaAGRS OFUERO WAEIL R DE t5 S INIR1 JANUARY o COFPLWI. N CR UAEAIDOCS SAUTE, AR SISCUNSRE

  9. Three Aspects of PLATO Use at Chanute AFB: CBE Production Techniques, Computer-Aided Management, Formative Development of CBE Lessons.

    Science.gov (United States)

    Klecka, Joseph A.

    This report describes various aspects of lesson production and use of the PLATO system at Chanute Air Force Base. The first chapter considers four major factors influencing lesson production: (1) implementation of the "lean approach," (2) the Instructional Systems Development (ISD) role in lesson production, (3) the transfer of…

  10. Mountain Home AFB, Mountain Home, Idaho. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1980-03-10

    DEPRESSIO ?~F OA TOTAL () 0 1 .2 3. 4 5-6 78 9- 10 11-12 13 -14 15 -1617.-18,19. 2br2I. 22123 -24 125. 26j27 -28j29.30, 53) OB’..,BlbWt1b~w~ * 100/ 9 91...1 1500-1700 "OURS IL. S. T.) Temp. WET BULB TEMPERATURE DEPRESSIO i (F) TOTAL I TOTAL (F) 0 I-2 3.4 5.6 7-8 9-10 1! 12 13-]4 15-16 17.18 19 .202. 22

  11. Revised Uniform Summary of Surface Weather Observations (RUSSWO) for Fairchild AFB, Spokane, Washington. Parts A-F

    Science.gov (United States)

    1979-12-21

    WET BULB TEMPERATURE DEPRESSIO (F) ITOTAL TOTAL 9 . 1 1 1 1 1 1 1 5 - 6 1 1 8. 1 4 2 8 2 9 3 01 2 3 1 2 4 2 _ u l b ] W e t B u l b j (F) 0 1-2 3. 4...StIeSTATIO W VUAS SNTo PAGE i 3600O-0800 lift (L. S. TO) WET BULB TEXPERATURE DEPRESSIO (F) TOTAL TOTAL () 0 1-2 3-4 5.6 7-8 -9l 1 2l-1151j71192112~324125

  12. McClellan AFB, California, RI/FS Quality Assurance Project Plan. Installation Restoration Program (IRP) Stage 3.

    Science.gov (United States)

    1992-08-07

    for homes near the base. A monitoring well network has been installed and includes on- and off-base wells that are located upgradient and downgradient...sites, expand the monitoring well network to allow more complete charac- terization of the extent of groundwater contamination, and to sample surface...To Neron Responibis tar Action: ___________________________ Psud MOM bq~ft Ad~m son I LAW: ljps: Mcurni 0 Dloaunmmalon 03 Spam 0 Otiur oats 1 Tm

  13. Environmental Impact Statement for BOMARC Missile Site, McGuire AFB, New Jersey. Volume 1, Sections 1 through 8

    Science.gov (United States)

    1992-05-22

    OF C Hunted, Trapped Loizg taile weasel Mustela freenata OF, OF C Trapped Mivk Mustela vison OF, OF C Trapped striped skunk Mephitis mephitis OF, OF C... respiratory protective equipment and safety garments (including disposable coveralls and booties) to be utilized by site personnel, identify requirements of a

  14. Visible and near-ultraviolet spectroscopy at Thule AFB (76.5 N) from January 28 - February 15, 1988

    Science.gov (United States)

    Mount, G. H.; Sanders, R. W.; Jakoubek, R. O.; Schmeltekopf, A. L.; Solomon, S.

    1988-01-01

    Near-ultraviolet and visible spectrographs identical to those employed at McMurdo Station, Antarctica (77.8 S) during the austral spring seasons of 1986 and 1987 were used to study the stratosphere above Thule, Greenland (76.5 N) during early spring, 1988. Observations were carried out both at night using the direct moon as a light source, and during the day by collecting the scattered light from the zenith sky when solar zenith angles were less than about 94.5 degrees. Excellent meteorological conditions prevailed in the troposphere and stratosphere at Thule. Surface weather was extremely clear over most of the period, facilitating measurements of the direct light from the moon. The lower stratospheric arctic polar vortex was located very near Thule throughout the observing period, and temperature at the 30 mbar level were typically below -80 C above Thule, according to the National Meteorological Center daily analyses. Thus conditions were favorable for polar stratospheric cloud formation above Thule. Total column ozone abundances were about 350 to 400 Dobson units, and did not suggest a clear temporal trend over the observing period. Stratospheric nitrogen dioxide measurements were complicated by the presence of a large component of tropospheric pollution on many occasions. Stratospheric nitrogen dioxide could be identified on most days using the absorption in the scattered light from the zenith sky, which greatly enhances the stratospheric airmass while suppressing the tropospheric contribution. These measurements suggest that the total vertical column abundance of nitrogen dioxide present over Thule in February was extremely low, sometimes as low as 3 x 10 to the 14th per sq cm. The abundance of nitrogen dioxide increased systemically from about 3 x 10 to the 14th in late January to 1.0 x 10 to the 15th per sq cm in mid-February, perhaps because of photolysis of N2O5 in the upper part of the stratosphere, near 25 to 35 km.

  15. Bangor International/Dow AFB, Maine. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1981-11-06

    temporary site at ground GM1-1l RO-2 Surfac level in ramp area. 6 Apr 60 Located approx 200 ft from corner Same RO-2A 13 ft of old rnwy 33 taxiway and...USAF STAC . 0-14-S( OL A) ............ . . .T... ..O . PORN ... 17- GLCPAL CLIMATOLOGY 9RANCH ArETAC CEILING VERSUS VISIBILITY Alq WEATHEk SERVICL/4AC S...13.1 i ?6 6.. 5918 USAFETAC PORN 0.9.5 (OL.-) PFVIOUS EDITIONS OF TnIS FORM AIRE ORSOLTE Jut 64 GLCRAL CLIMAT0L.i Y 1 ANCH AFE T AC SKYCO E A>4 4ATHER

  16. Analysis of wind bias change with respect to time at Cape Kennedy, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Adelfang, S. I.

    1978-01-01

    A statistical analysis is presented of the temporal variability of wind vectors at 1 km altitude intervals from 0 to 27 km altitude after applying a digital filter to the original wind profile data sample.

  17. An inverse modeling approach to estimate groundwater flow and transport model parameters at a research site at Vandenberg AFB, CA

    Science.gov (United States)

    Rasa, E.; Foglia, L.; Mackay, D. M.; Ginn, T. R.; Scow, K. M.

    2009-12-01

    A numerical groundwater fate and transport model was developed for analyses of data from field experiments evaluating the impacts of ethanol on the natural attenuation of benzene, toluene, ethylbenzene, and xylenes (BTEX) and methyl tert-butyl ether (MTBE) at Vandenberg Air Force Base, Site 60. We used the U.S. Geological Survey (USGS) groundwater flow (MODFLOW2000) and transport (MT3DMS) models in conjunction with the USGS universal inverse modeling code (UCODE) to jointly determine flow and transport parameters using bromide tracer data from multiple experiments in the same location. The key flow and transport parameters include hydraulic conductivity of aquifer and aquitard layers, porosity, and transverse and longitudinal dispersivity. Aquifer and aquitard layers were assumed homogenous in this study. Therefore, the calibration parameters were not spatially variable within each layer. A total of 162 monitoring wells in seven transects perpendicular to the mean flow direction were monitored over the course of ten months, resulting in 1,766 bromide concentration data points and 149 head values used as observations for the inverse modeling. The results showed the significance of the concentration observation data in predicting the flow model parameters and indicated the sensitivity of the hydraulic conductivity of different zones in the aquifer including the excavated former contaminant zone. The model has already been used to evaluate alternative designs for further experiments on in situ bioremediation of the tert-butyl alcohol (TBA) plume remaining at the site. We describe the recent applications of the model and future work, including adding reaction submodels to the calibrated flow model.

  18. The second stage of a Titan II rocket is lifted for mating at the launch tower, Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    At the launch tower, Vandenberg Air Force Base, Calif., the second stage of a Titan II rocket is lifted to vertical. The Titan will power the launch of a National Oceanic and Atmospheric Administration (NOAA-L) satellite scheduled no earlier than Sept. 12. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. Tuberculous brain abscess and subdural empyema in an immunocompetent child: Significance of AFB staining in aspirated pus

    Directory of Open Access Journals (Sweden)

    B Vijayakumar

    2012-01-01

    Full Text Available Tuberculous brain abscess and subdural empyema are extremely rare manifestations of central nervous system tuberculosis. Here, we report a case of an 11-year-old immunocompetent child who developed temporal lobe abscess and subdural empyema following chronic otitis media. A right temporal craniotomy was performed and the abscess was excised. The Ziehl Nielsen staining of the aspirated pus from the temporal lobe abscess yielded acid fast bacilli. Prompt administration of antituberculous treatment resulted in complete recovery of the child. Even though the subdural abscess was not drained, we presume that to be of tubercular aetiology. Ours is probably the first case of brain abscess and subdural empyema due to Mycobacterium tuberculosis reported in the same child. This case is being reported because of its rarity and to stress the importance of routine staining for tubercle bacilli in all cases of brain abscess, especially in endemic areas, as it is difficult to differentiate tuberculous from pyogenic abscess clinically as well as histopathologically.

  19. Robins AFB, Warner Robins, Georgia. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1979-08-31

    CONDITIONSEOFWEAHE CONDI!T IONS FRWJ4 HOUR~LY ORSIURVAT IONS MNH HOURS THNE*AAIN FREEZING SNOW % OF SMOKE BOIG DUST % OF OBS ’TOTALMONT THUNDEORS AD...MAY JUN. JUL AUG, SEP OCT NOV, DEC. MONTHYEAR MNH 79 6.26 8.66 I -4 MEN if 3* 5 __________ 4.79Z_____ 3.16--____ 3___482___ __________ _________ 18K

  1. Environmental Impact Analysis Process. Environmental Impact Statement. Supersonic Flight Operations in the Reserve Military Operations Area, Holloman AFB, New Mexico

    Science.gov (United States)

    1983-09-01

    tailed Rattlesnake Crotalus molossus Western Rattlesnake Crotalus viridis CAUTION Most snake bites occur to people who are trying to kill or catch snakes...Strawberry Fragaria bracteata Yarrow Achillea lanulosa Yellow Sweetclover Melilotus indicus IX L-2 List of Preparers Jim Battis; AFGL/LWH, Ha’-com

  2. Pease AFB, Portsmouth, New Hampshire. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A through F.

    Science.gov (United States)

    1972-05-25

    SNOW DEPTH IN INCHES lIAS*O ON Liss THAN PULL NONTHS1 MON I tJAN, FEB. MAN. APR. MAY JUN JUL. AUG. SEP. OCT. NOV. DC. ALL 5* ’SNO OPTH _ _ _~DAYS...J- 3 iL-i- A1 L L_ 4L -10 ’- .0 _m GoAlI ’SW .. L JL 44.. ak af AL aw 1* 4. l.0 4.2 6...4. s fl .40 1& .0 -0 -7. __ on ltil - -. C TWAL NUMM

  3. Review of Hangar Door Design of Mountain Home AFB (MHAFB) Refurbished Non-Destructive Inspection (NDI) Facility

    Science.gov (United States)

    2012-06-18

    Blonetics Corporation, Newark Metrology Operations, complies with the requirements of the current version of ISO / IEC 17025 on the date of...requirements of the current version of ISOIIEC 17025 on the date of calibration. 2. This report may not be reproduced, except rn full, without

  4. Environmental Assessment Addressing Activities Associated with Development of a Regional Wastewater Treatment Plant Ellsworth AFB, South Dakota

    Science.gov (United States)

    2012-05-01

    addition, a central Recycling Center (Building 9050) on Centennial Drive is available for the disposal of tires, wood waste, yard waste...fans. Permeability is very slow. Gilgai microrelief, which consists of small mounds and depressions formed from shrinking and swelling of the soil

  5. Remedial Investigation/Feasibility Study, Operable Unit 5, Elmendorf AFB, Anchorage, Alaska. Volume 2. Text and Appendices A - J

    Science.gov (United States)

    1994-03-04

    hitting abandoned paper sheathed copper wire telephone cable at 4.2’. Boring moved. No discernible floating product. 35.0 . 40.0 45.0 50.0 55.0 - jPROJECT...0.60 U N/C Magnesium, Mg 14.3 U 14.3 U N/C Manganese, Mn 0.80 U 0.80 U N/C Mercury, Hg 0.10 U 0.10 U N/C Nikel , Ni 7.7 U 7.7 U N/C Potassium, K 191 U

  6. Installation Restoration Program. Phase 2. Confirmation/Quantification. Stage 1 Report for Beale AFB, Marysville, California. Volume 2.

    Science.gov (United States)

    1987-05-01

    Maintarer.e ground water 2 scil borinF 8 hand auger 12 Disna:-e Area No. 10 (DA-10) - Entomology Bldg UO soil boring 6 13 Landfil: Nc. 1 (LF-1) ground...l’JSZIL I ’ SCIL SO V ; 7 ILill ( oi[ ;Q0 SO IL. $;I 60 . *O (3 .1 *, W i ; Q,. t.t WLi it hI OX aoPit IV 3 ’ Table F-1 (Cont.) 6OIOOtO LAB WPLIAT

  7. Installation Restoration Program. Phase II. Confirmation/Quantification. Stage 1 for Hancock Field, New York and HQTAC, Langley AFB, Virginia.

    Science.gov (United States)

    1984-10-01

    mineral particles, derived from the chemical decomposition of rocks, which is plastic when wet and hard when dry. The distinctive physical proprties are...perpendicular to the direction of the dip. Swell-and-Swale The type of topography caracteristic of the ground moraine of a continental glacier. Till That...clay (10 YR 5/1), some very fine sand, moist; plastic . .20’ very soft gray clay (10YR 5.1); wet; plastic . SS#2 S.I. 9.5-11.5’ BLS Rec. 1.6’ 1 o L 1.6

  8. Wright-Patterson AFB, Ohio Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1985-09-01

    LSTI: ISO -1700 ............. [..........................................NO" ........". OT5...................................................... I WIND...90.3 91.1 91.3 91.4 91.6 92.6 91.b 9i.T 91.7 91.7 91.7 E iso 51.i8 - 76.9 82.1 8b. 90.7 90.7 92.s 92.7 92.8 93.0 93.0 93.0 93.1 93.1 93.1 93.1 FE 2000...97.4 91.4 97.% 91.4 97.4 GE 27003 55.1 79.4 84.4 90.1 95.7 96.8 97.1 98.0 88.1 98.1 98.1 98.1 91.3 98.1 98.1 98.1 UE 18001 55.1 79.5 84.5 90.? 95.8 96.9

  9. KI Sawyer AFB, Gwinn, Michigan. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1979-04-26

    I SAVYFR AO MA4 -97; AG 1 { ’..WET BULB TEMPERATURE DEPRESION (F) TOTAL TOTA -20,-2l1 14 o241-25 ................ -32/-33...PAGE 2 0o00--900! MOLOS (L. $. ,. - T..p. WET BULB TEMPERATURE DEPRESION (F) I TOTAL 1 TOTAL (F) 0 1-2 3-4 5-6 7-8 19-10 11- 12:13. 1415- 16117

  10. Norton AFB, San Bernardino, California. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1974-01-08

    17. 18 19 2-22 23- 24 25-26 27- 2829 30- 3 WeB Bu . 1 00/7..107 75 757 106/105 1. 82 19 102/01 4 .1 .84 42 1001 99 .0 .0 .1 " 3 92 9? 68/697 . . 1...DATA Pkw’mSSING, BRANCH{~ USAF ETA. PSYCHROMETRIC SUMMARY AIR VIL’ATIER S.iPVICt=/mAC 0’, 231.? NIRTPN ArtB CALIF/SAN F rRNt.fti) NCV 43-71 1 F VP

  11. Environmental Assessment for Travis AFB C-17 Use of Instrument Routes 264, 275, 280, 281 , and 282 in Central Nevada

    Science.gov (United States)

    2013-09-01

    www.travis.af.mil/ enviro , under the heading entitled Draft Environmental Assessment. Copies of the draft EA and FONSI were also provided to Nevada...likely to come in contact with or ingest (such as air, food, drinking water, recreational water, and soil ). Each of the ten counties in Nevada overflown...Northern Basin and Range. Soils grade upslope from Aridisols or Entisols to Mollisols. The land is primarily used for grazing, and a greater

  12. Kinetic Super-Resolution Long-Wave Infrared (KSR LWIR) Thermography Diagnostic for Building Envelopes: Scott AFB, IL

    Science.gov (United States)

    2015-08-18

    structures. The system software au- tomatically analyzes the thermal imagery and provides a custom report for each building that recommends cost-effective...possible using traditional thermogra- phy. This includes building facade data and building orientation. The au- tomated data processing system also

  13. The Soluble Plasminogen Activator Receptor as a Biomarker on Monitoring the Therapy Progress of Pulmonary TB-AFB(+ Patients

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2010-01-01

    P=.0001<.05, R2=.890 after 2 months (median 8.019?ng/mL and 4 months (median 5.771?ng/mL of treatment, respectively. However, only slightly declined after 6 months therapy (median 5.009?ng/mL, near control group level (median 4.772?ng/mL. Interestingly, the significant reduced of suPAR level was parallel to treatment efficacy and correlated with other clinical and laboratory parameters, that is, decreasing of patients' complaints, increasing of BMI (r=-0.281, thoracic imaging improvement, sputum conversion, decreasing of ESR (r=0.577 and monocytes count (r=0.536 with exception the width of lesion in thoracic imaging. In conclusion, the suPAR level in could reflect the progress of TB therapy.

  14. MacDill AFB, Tampa Bay, Florida. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1980-03-05

    90.31 90.3 90.8 91.1 91.4 1. S700 52. S4O&6. 85 89. 89.6 90.1 90.3 90.6 91:0 91: 41 91&4 91.8 9229.59. 600~ 52. 8s5. 87. 88.6 89. 91.1. 91. 91&1 91.4...99.4 99.5 99.5 99.5 99.5 99.5 99.5 99.5 99.5 99.5 99.5 S700 60.- 97.5 98.6 99. 99. 99. 99.7 99o? 99.7 99.7 99.7 99.7 99.7 99.7 99.7 99.7 _ 600 60. 97. 98

  15. Cannon AFB, Clovis, New Mexico. Revised Uniform Summary of Surface Weather Observations (RUSSWO), Parts A-F

    Science.gov (United States)

    1975-06-16

    I 91, 91o4 9i.4 91. 91.6 9j.6 91. S700 tb~o 097K97 89o 90.106 9o’ - 9 -1LT ItC lp -,1 󈨟.7 s6 91p 9 91* WO- 96 6000 6.4 9c1 90.4, 90,9 91,2 91.3 9i...88.7 88.7 88.8 68.9 9i86 S700 ~78.5 04I70 53~ v "om 39-; Th 18b17 l 9 9313 6W_- 78.6 64.2 85.3 86.9 88.2 88.4 89?o 89.1 89.1 89.6 89.8 89.8 89.9 9o...800 086 93,6 94.11 947 95.3 95.4 95.6 95,7 95.7 96.2 96.3 96.3 9 6 ,L 96.4 96.4 96.4 S700 - _ 94.2 94o8 9ř. 95 e 99--9 9 - -- 99 6 65 965 >__6W 88.6

  16. McConnell AFB, Witchita, Kansas. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1981-12-14

    96. 96. 97. 97.3 979; 97.8 97.9 97.9 97.9 97.9 97.9 97.9 97.9~~v 78q9o 5q90 7 90 8u 98.380 6� 98*7 98, �,7 98,7 S700 95:1 9b:’ 08’ 0 * 98o77 6...69o9 7301 70.2 70.2 70.3 7003 70.3 70.3 70o3 70.4 70o4 73.4 7o.4 : 8000 50 71, 71T6 71o 72 701 T71 -72 F2 7 o3 72.3 -.1 72,3 72 o 3 72.3 M7 2 ,3. S700 ...97.5 97.5 97o5 97o5 97,5 Roo 80. 95. 96. 97. 97s 97. 97. 98.1 98.1 98.1 98.1 98.1 98.1 98.1 98.1 Q81 S700 8 8 98 8 98. 98. 98. . 98. 9811117 17 17 .8

  17. Final Environmental Impact Statement, Peacekeeper in Minuteman Silos, F. E. Warren AFB, Wyoming. Volume 2. Public Comments.

    Science.gov (United States)

    1984-01-01

    n t g w qs I c:am ar n’l ot lisyt odown *As to. woume of unemployed wpAwaao nooos toot -mtosro hw isiu.j 4261 paermas ris ed- thns 0 .1 mon popiswt...PEREN OP TM! U.S. NUCLEAR ARESENAL WHER IT IS DUE TO ALCOHOL OR DRUG ABUSE OR TO S1IWIICAAM PSYCHICAL 0R CONFIRTM IN 1989. TEA? $27.6 BILLION WOULD HE3...nearly half of the mental 10 some services and shortchanging other.. 1 health center’s clients are unemployed persons. The 11 Th* 218 should recommend that

  18. Final Environmental Assessment for Republic of Singapore Air Force F-15SG Beddown at Mountain Home AFB

    Science.gov (United States)

    2007-03-01

    Bighorn Sheep, a BLM sensitive species. Two herds of California bighorn sheep occur in the area: the Owyhee River herd and the Bruneau/Jarbidge...Rivers herd . The Owyhee herd range includes portions of the East and South Forks of the Owyhee River, as well as Battle, Deep, and Dickshooter Creeks...Rabbit (Oryctolagus cuniculus) 12 12 North American Porcupine (Erethizon dorsatum) 1 1 Yellow-bellied Marmot (Marmota flaviventris) 1 1

  19. Systematics of Old World Odontacolus Kieffer s.l. (Hymenoptera, Platygastridae s.l.: parasitoids of spider eggs

    Directory of Open Access Journals (Sweden)

    Alejandro Valerio

    2013-07-01

    Full Text Available The genera Odontacolus Kieffer and Cyphacolus Priesner are among the most distinctive platygastroid wasps because of their laterally compressed metasomal horn; however, their generic status has remained unclear. We present a morphological phylogenetic analysis comprising all 38 Old World and four Neotropical Odontacolus species and 13 Cyphacolus species, which demonstrates that the latter is monophyletic but nested within a somewhat poorly resolved Odontacolus. Based on these results Cyphacolus syn. n. is placed as a junior synonym of Odontacolus which is here redefined. The taxonomy of Old World Odontacolus s.str. is revised; the previously known species O. longiceps Kieffer (Seychelles, O. markadicus Veenakumari (India, O. spinosus (Dodd (Australia and O. hackeri (Dodd (Australia are re-described, and 32 new species are described: O. africanus Valerio & Austin sp. n. (Congo, Guinea, Kenya, Madagascar, Mozambique, South Africa, Uganda, Zimbabwe, O. aldrovandii Valerio & Austin sp. n. (Nepal, O. anningae Valerio & Austin sp. n. (Cameroon, O. australiensis Valerio & Austin sp. n. (Australia, O. baeri Valerio & Austin sp. n. (Australia, O. berryae Valerio & Austin sp. n. (Australia, New Zealand, Norfolk Island, O. bosei Valerio & Austin sp. n. (India, Malaysia, Sri Lanka, O. cardaleae Valerio & Austin sp. n. (Australia, O. darwini Valerio & Austin sp. n. (Thailand, O. dayi Valerio & Austin sp. n. (Indonesia, O. gallowayi Valerio & Austin sp. n. (Australia, O. gentingensis Valerio & Austin sp. n. (Malaysia, O. guineensis Valerio & Austin sp. n. (Guinea, O. harveyi Valerio & Austin sp. n. (Australia, O. heratyi Valerio & Austin sp. n. (Fiji, O. heydoni Valerio & Austin sp. n. (Malaysia, Thailand, O. irwini Valerio & Austin sp. n. (Fiji, O. jacksonae Valerio & Austin sp. n. (Cameroon, Guinea, Madagascar, O. kiau Valerio & Austin sp. n. (Papua New Guinea, O. lamarcki Valerio & Austin sp. n. (Thailand, O. madagascarensis Valerio & Austin sp. n

  20. Ukritisk monografi

    DEFF Research Database (Denmark)

    Ejlers, Steen

    2003-01-01

    Anmeldelse af  monografi om den meget produktive grafiker Austin Grandjean. Udgivelsesdato: 2003......Anmeldelse af  monografi om den meget produktive grafiker Austin Grandjean. Udgivelsesdato: 2003...

  1. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  2. Evolution of the household vehicle fleet : anticipating fleet composition, plug-in hybrid electric vehicle (PHEV) adoption and greenhouse gas (GHG) emissions in Austin, Texas.

    Science.gov (United States)

    2009-12-01

    Automobile ownership plays an important role in determining vehicle use, emissions, fuel : consumption, congestion and traffic safety. This work provides new data on ownership decisions : and owner preferences under various scenarios, coupled with ca...

  3. Developing a model for effects of climate change on human health and health-environment interactions: Heat stress in Austin, Texas - Urban Climate

    Science.gov (United States)

    Human health and well-being are and will be affected by climate change, both directly through changes in extreme weather events and indirectly through weather-induced changes in human and natural systems. Populations are vulnerable to these changes in varying degrees, depending ...

  4. Proceedings of second geopressured geothermal energy conference, Austin, Texas, February 23--25, 1976. Volume IV. Surface technology and resource utilization

    Energy Technology Data Exchange (ETDEWEB)

    Underhill, G.K.; Carlson, R.A.; Clendinning, W.A.

    1976-01-01

    Separate abstracts were prepared for the eight chapters for ERA and one chapter for EAPA. Included in appendices are the reports of two subcontractors on the flashed steam and binary-fluid systems which are discussed at length in the chapters. (MHR)

  5. Quick Reaction Report on the Audit of the Army Contract with the University of Texas at Austin Institute for Advanced Technology

    National Research Council Canada - National Science Library

    1992-01-01

    .... This audit was performed as part of the Special Audit of Federally Funded Research and Development Centers requested by the Office of Federal Procurement Policy and the House Appropriations Committee...

  6. Quick Reaction Report on the Audit of the Army Contract with the University of Texas at Austin Institute for Advanced Technology

    Science.gov (United States)

    1992-10-27

    Oct 27, 1992 Title: Audit Report Office Of The Inspector General: Quick Reaction Report On The Audit Of The Army Contract With The University Of Texas...ENGINEERING "INSPECTOR GENERAL, DEPARTMENT OF THE ARMY SUBJECT: Quick-Reaction Report on the Audit of the Army Contract with the University of Texas...additional comments on Recommendation 3. by November 27, 1992. The courtesies extended to the audit staff are appreciated. If you have any questions on

  7. Installation of dynamic travel time signs and efforts to obtain and test a graphical route information panel (GRIP) sign in Austin.

    Science.gov (United States)

    2016-08-01

    Graphic Route Information Panel (GRIP) signs use a combination of text, colors, and representative maps of : the roadway system to convey real-time roadway congestion location and severity information. The intent of : this project was to facilitate t...

  8. American Foundation for the Blind

    Science.gov (United States)

    ... loss Text Size Smaller Type Larger Type Change Colors My AFB Search Donate to AFB Shop AFB ... and More Public Policy and Research Statistics on Blindness DirectConnect: Public Policy and Advocacy News Research Navigator: ...

  9. DoD Global, Laboratory-Based, Influenza Surveillance Program, End-of-Year Report, 2014-2015

    Science.gov (United States)

    2016-01-01

    5 Laughlin AFB, TX - 9 - - - - - - - - - 3 - 1 - 2 2 3 7 3 17 47 Little Rock AFB, AR - 18 - - - - - - - - - - - - - - - 1 - - 34 53 SAM M C, TX - 3... Rock AFB 4 California, Beale AFB 1 California, Edwards AFB 5 1 1 California, NHRC 9 1 California, Travis AFB 19 1 California, USCG Island Alameda 1...DJ. Long intervals of stasis punctuated by bursts of positive selection in the seasonal evolution of influenza A virus. Biol Direct. 2006; 1: 34

  10. 76 FR 75536 - Procurement List; Proposed Addition

    Science.gov (United States)

    2011-12-02

    ... listed: Service Service Type/Location: Grounds Maintenance, Beale AFB, CA. NPA: Crossroads Diversified Service, Inc., Sacramento, CA. Contracting Activity: 9th Contracting Squadron, Beale AFB, CA. Patricia...

  11. Estimation of nonmarket benefits of agricultural land retention in Eastern Canada

    Science.gov (United States)

    J. Michael Bowker; D.D. Didychuk

    1994-01-01

    We assess the nonmarket value for retention of farmland in the Moneton area of New Brunswick. We examine a number of factors explaining household external values for farmland preservation and expand on previous work by Beasley et al., Bergstrom et al., and Halstead. Our findings indicate that the marginal external benefit of preserving farmland in general in this...

  12. 75 FR 29976 - Initiation of Antidumping and Countervailing Duty Administrative Reviews

    Science.gov (United States)

    2010-05-28

    ...., Ltd. Yancheng H&M Pressure Valve York International (Northern Asia) Ltd. Yuyao Dianbo Machinery Co... Co. Ltd. Pennengineering Automotive Fastener Pinghu City Zhapu Screw Cap Qingdao H.R. International...., Ltd. Bergstrom China Group Bowen Casting Co Ltd Broad-Ocean Motor (Hong Kong) Co., Ltd. C.H. Robinson...

  13. Extracting Valuable Data from Classroom Trading Pits

    Science.gov (United States)

    Bergstrom, Theodore C.; Kwok, Eugene

    2005-01-01

    How well does competitive theory explain the outcome in experimental markets? The authors examined the results of a large number of classroom trading experiments that used a pit-trading design found in Experiments with Economic Principles, an introductory economics textbook by Bergstrom and Miller. They compared experimental outcomes with…

  14. Testing Testing Testing.

    Science.gov (United States)

    Deville, Craig; O'Neill, Thomas; Wright, Benjamin D.; Woodcock, Richard W.; Munoz-Sandoval, Ana; Gershon, Richard C.; Bergstrom, Betty

    1998-01-01

    Articles in this special section consider (1) flow in test taking (Craig Deville); (2) testwiseness (Thomas O'Neill); (3) test length (Benjamin Wright); (4) cross-language test equating (Richard W. Woodcock and Ana Munoz-Sandoval); (5) computer-assisted testing and testwiseness (Richard Gershon and Betty Bergstrom); and (6) Web-enhanced testing…

  15. 75 FR 63197 - Fall 2010 Meeting of the National Preservation Technology and Training Board

    Science.gov (United States)

    2010-10-14

    ... Embassy Suites Hotel Austin Downtown/Town Lake at 300 South Congress Avenue, Austin, TX 78704-- telephone... accomplishments and operational priorities for FY2011; FY2011 National Center budget and initiatives; the National... location is: Suites Hotel Austin Downtown/Town Lake at 300 South Congress Avenue, Austin, TX 78704...

  16. 75 FR 48967 - Proposed Administrative Settlement Agreement Under Section 122(h) of the Comprehensive...

    Science.gov (United States)

    2010-08-12

    ... settlement agreement (``Settlement Agreement'') with Peter S. Austin, the William E. Austin Trust, and Austin & Austin Company, a partnership (``Respondents'') pursuant to Section 122(h) of the Comprehensive... CERCLA, 42 U.S.C. 9622(i), this notice is being published to inform the public of the proposed Settlement...

  17. 76 FR 55883 - Procurement List; Proposed Addition

    Science.gov (United States)

    2011-09-09

    ... INFORMATION: This notice is published pursuant to 41 U.S.C 47(a)(2) and 41 CFR 51-2.3. Its purpose is to... Break Caf[eacute], 3651 S. IH-35, Austin, TX. Connection Warehouse, 2021 East Woodward, Austin, TX. Southpark G (CSB), 1821 Directors Blvd., Austin, TX. Southpark J, 2191 Woodward, Austin, TX. Southpark K...

  18. IRP Stage 2 Remedial Investigation/Feasibility Study, Appendices A through K and M through R, for BOMARC Missile Site, McGuire AFB, New Jersey.

    Science.gov (United States)

    1992-05-26

    Mellinger, P. J., R. D. Stenner , D. K. Landstrom, D. G. Watson, C. E. Cushing and R. A. Ewing. 1987. Evaluation of the Potential Environmental...Northwest Weatherized Residences. PNL-6058, Pacific Northwest Laboratory, Richland, Washington. Mellinger, P. J., and R. D. Stenner . 1986. Environmental

  19. The Proceedings of the Hypobaric Decompression Sickness Workshop Held in Armstrong Laboratory, Brooks AFB, Texas on 16-18 October 1990.

    Science.gov (United States)

    1992-06-01

    absence of Air in the Bloud iuyces. and soft parts of the Body. may by their Vast number. and their conspiring distension , variously streighten in...and vitiating the figure of others. disturb or hinder the due circulation of the Bloud? Not to mention the pains that such distensions may cause in...Effects of Altitude on Aviators. Aviation, 2, 145-147 (1917). 10. Barcroft, J.; C.G. Douglas; L.P. Kendall and R. Margaria. Muscular Exercise at Low

  20. The electromagnetic α3 contributions to e+e--annihilation into fermions in the electroweak theory. Total cross section σT and integrated asymmetry AFB

    International Nuclear Information System (INIS)

    Bardin, D.Yu.; Bilenky, S.M.; Riemann, T.

    1988-01-01

    Analytic expressions are obtained for the integrated α 3 QED contributions to the total cross section σ T and the forward-backward asymmtery A FB in the process e + e - → f + f - γ. Photons from soft and hard bremsstrahlung are assumed not to be observed. The calculations are performed in the ultrarelativistic approximation in fermion masses, m f 2 Z 2 , M Z I Z , but the mass M Z and width Γ Z of the neutral weak gauge boson Z are treated without any further approximations

  1. An Annotated Bibliography of Hypobaric Decompression Sickness Research Conducted at the Crew Technology Division, USAF School of Aerospace Medicine, Brooks AFB, Texas from 1983 to 1988

    Science.gov (United States)

    1990-06-01

    AN ANNOTATED BIBLIOGRAPHY OF HYPOBARIC DECOMPRESSION SICKNESS RESEARCH CONDUCTED AT THE CREW TECHNOLOGY DIVISION, USAF SCHOOL OF AEROSPACE MEDICINE...190 man-flights to four selected altitudes (30000, 27500, 25000, and 22500 ft pressure equivalent) in a hypobaric chamber. The subjects’ ages ranged...conditions and two of these developed delayed sy~rtcms. Three of these five subjects underwent hyperbaric oxygen treatment. Conclusion. Female subjects

  2. Prime Contract Awards Alphabetically by Contractor, State or Country, and Place. Part 11 (Lemmon Company, Sellersville Pennsylvania - McEwen Construction, Beale AFB, California), FY1991

    Science.gov (United States)

    1991-01-01

    00-I v aEaIOMN n 0 U 0 0 1-4 0 00 x 0 web -CN0a 1 N N b I- z x x- I- 0-4 -4 1.- 0 1.- 1.-A W z I MN *4 0 0-4 U. 40 -4 0 .U 0 0. 40 3 I.-N M0N xnᝰ...CMC4� (" 0 0 00 0 0 0 10 N W I wix >u a 0 4 Ccljcd 0-4-4.4-4-4.4 ammmmmmmcv) 40 -4 -4 -4 -4 -4 CY 04 C4 04 CM CQ (4 04 N F- IZZU M0-4...C Of 04C)’ m EE KKl1Z K Kl x 06 06’. I to0 to w a wX)wxle= web x cU6ALOUn) 0D a 00909(0 0a0 00 0 0 004 06 06- I. ( 06l 00 00 0 00 0 40(4(0 0 0 0 0

  3. Proceedings of the Annual Conference on Manual Control (10th) held at Wright-Patterson AFB, Ohio on 9-11 April 1974

    Science.gov (United States)

    1974-04-01

    427 R. E. Fenton , R. D. Gilson, and R. W. Ventola Simulator Evaluation of Three Situation and Guidance Displays for V/STOL Zero-Zero Landings...prostheses is a factor that may lead some amputees to abandon their prostheses shortly after fitting, or to use them primarily for cosmetic purposes...PRESENTATION VIA DUAL KINESTHETIC-TACTUAL DISPLAYS lüTn w *rr ,-.-r Robert E. Fenton Richard D. 611 son Dept. of Electrical Engineering Dept. of

  4. Environmental Impact Statement for BOMARC Missile Site, McGuire AFB, New Jersey. Volume 3. Methodology Development. Appendices 3-1 through 3-8

    Science.gov (United States)

    1992-05-01

    wild, but are extant in cultivation . It is likely that some of these will not warrant listing, while others will be found to be in greater danger of...region (North-West Italy). Journal of Environmental Radioactivity 5:71-81. Connell, D.W., and Miller, G.J., 1984. Chemistry and Ecotoxicology of...Rare in most of the Pine Region, but occasional in cultivated areas near towns. Gray Squirrel (Sciarus carolinensis) Occasional throughout the Pine

  5. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico, Environmental Impact Statement. Volume 2: Public Hearing Transcripts and Responses to Comments

    Science.gov (United States)

    1998-04-01

    Ca6 44 m4 I 4s 6i 0 A0 C 4 0 0 6 6 6 a 4 6 0 I. wIw 6 3 .406 4 0 0 0 0 . a a4 .0 .4 In 4 5 6 1 A 6 0 0 I 4 5 0 4 1 V 4 4 0 0A 41 6 4 0 4 .2. A 54 4 0...some rural and recre- irget complex at McGregor Range Utilities - Increased demand for water, wastewater treatment , )treas of the range. solid waste

  6. Proceedings of the Conference on Toxicology: Applications of Advances in Toxicology to Risk Assessment. Held at Wright-Patterson AFB, Ohio on 19-21 May 1992

    Science.gov (United States)

    1993-01-01

    assay is cellular inhibition. Cellular proliferation is essential to normal development and its interruption could lead to depressed growth and possibly...such as the FOB. One major conclusion from motor activity is that the acute effect of many chemicals is a depression of motor activity. Some... Acetylcysteine of cigarrette smoke- induced "bronchitis" in the rat. Exp. Lung Res. 10:267-283. 262 15. Snider, G.L., E.C. Lucey, T.G. Christensen, P.J. Stone

  7. Proceedings of Joint RL/AFOSR Workshop on Intelligent Information Systems Held at Griffiss AFB, New York on October 22-23, 1991

    Science.gov (United States)

    1992-04-01

    OF PENNSYLVANIA F. "HErEROGENOUS KNOWLEDGE BASES" GIO WIEDERHOLD, DARPA G. "SIMS: SERVICES AND INFORMATION MANAGEMENT FOR DECISION SUPPORT", YIGAL...Pennsylvania 9:00 - 9:30 "Heterogenous Knowledge Bases", Gio Wiederhold - Darpa iv 9:30 - 9:45 Break 9:45 - 10:15 "Services and Information Management ...Ohio Sam University Met;tphors fir Problem Solving in Al Reasoning Deliberation - Knowlede Rules of Inference Problem Solving - Initial state - Goal

  8. Geophysical Imaging for Investigating the Delivery and Distribution of Amendments in the Heterogeneous Subsurface of the F.E. Warren AFB

    Science.gov (United States)

    2012-12-01

    grain-fluid interface (Revil and Glover 1997, 1998). The electrical current distribution can be visualized by equipotential surfaces , with current flow...dimensional µg/L micrograms per liter µS/cm micro-Siemens per centimeter bgs below ground surface CERCLA Comprehensive Environmental Response...during, and after fracture emplacement using both surface and crosshole-based configurations. Several seismic methods were tested, including

  9. Environmental Impact Statement, Establishment of the Gandy Range Extension and Adjacent Restricted Airspace as an Area for Supersonic Flight Training, Hill AFB, Utah

    Science.gov (United States)

    1985-10-03

    Miller, Maya Attn: Jeff Nelson 6185 FrankioWn Road Carson City, Nevada 89701 Lahantan Auduhon Society, ino Janet C. Meierdiprck, President Dan Murphy...Elaine D-181 1 32. Majewski, Arthur D-182 9, 142 V.. Miller, Maya D-183 5 84. Montague, Earlene D-184 1 85. Montague, Floyd D-185 1 86. Nelson, Richard... archaeological sites. .s 121. Thank you. 122. The Air Force [eel-i that these impacts have befn adequately addressed. Also see responses 6, 32, 36, and 37

  10. Proceedings of the Government Neural Network Applications Workshop Held at Wright-Patterson AFB, Ohio on August 24-26, 1992. Volume 1

    Science.gov (United States)

    1992-08-01

    W. Hubbard and LD. lackel. Backpropagation applied to handwritm zip code recognitio Neral Comptaion. vol. I pages 541-551.1989 I LFh*udaima. Neual...vision system onto one face of the wheel as a 3 cm x 3 cm image. This face of the wheel is finished as a fine-grain ground-glass diffusing surface...sensor system described above actually computes 3 sets of features per wheel rotation as shown in Figure 5. A third of the wheel’s image input face is

  11. Final Environmental Assessment for 2012-14 Capital Improvements Program (CIP) for Davis-Monthan Air Force Base (AFB), Tucson, Arizona

    Science.gov (United States)

    2012-03-01

    but most of the andesite and basaltic flows were fo1med in the last 50 million years. The oldest rocks in the Tucson Basin ru·e the metavolcanic...Pinal Schist, fo1med approximately 1.7 billion years ago (U.S. Geological Smvey 2003). Some basaltic flows occmTed as early as 4 million years ago and...pe1mits. ACMs are a pruticulru· concem for demolition projects because of potential exposme of workers to hazardous fibers released into the air

  12. Competitive horseradish peroxidase-linked aptamer assay for sensitive detection of Aflatoxin B1.

    Science.gov (United States)

    Sun, Linlin; Zhao, Qiang

    2018-03-01

    Aflatoxin B1 (AFB1) is one of highly toxic mycotoxins and a known human carcinogen. The frequent contamination of AFB1 in food products and large health risk of AFB1 have raised global concerns. Sensitive detection of AFB1 is of vital importance and highly demanded. Herein, we reported a competitive horseradish peroxidase (HRP)-linked aptamer assay for AFB1, combining the advantages of aptamer for affinity binding and enzyme label for signal amplification. In this assay, free AFB1 in solution competed with a covalent conjugate of bovine serum albumin-AFB1 (BSA-AFB1) coated on the wells of microplate in binding to the HRP-labeled aptamer probe. HRP attached on BSA-AFB1 in the wells catalyzed the conversion of substrates into products, allowing the final detection of AFB1 through measurement of the generated products. When TMB (3,3',5,5'-tetramethylbenzidine dihydrochloride) was used as substrate, absorbance analysis of the product of enzyme reaction enabled the detection of AFB1 at 0.2nM. We further lowered the detection limit of AFB1 to 0.01nM through chemiluminescence analysis by using chemiluminescence substrate of HRP. This assay enabled the detection of AFB1 in complex sample matrix, such as diluted white wine and maize flour. This assay provides a simple, sensitive and rapid method for AFB1 determination. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The relationship between patient-related factors and medication ...

    African Journals Online (AJOL)

    2017-09-03

    Sep 3, 2017 ... Health Outcomes and Pharmacy Practice Division, The University of Texas at Austin College of Pharmacy,. Austin ... medication for life with at as high as 95% adherence for ..... for improving patients' organizational skills.

  14. 75 FR 63147 - Solicitation of Applications for the Public Works, Economic Adjustment Assistance, and Global...

    Science.gov (United States)

    2010-10-14

    ... development of regional innovation clusters (RICs), which are broadly defined as geographic concentrations of... submit paper submissions to: Economic Development Administration, Atlanta Regional Office, 401 West... Development Administration, Austin Regional Office, 504 Lavaca, Suite 1100, Austin, Texas 78701- 2858...

  15. Design: More than a cool chair

    DEFF Research Database (Denmark)

    Friis, Silje Alberthe Kamille; Austin, Robert; Sullivan, Erin

    2006-01-01

    Austin, R., Friis, K., Sullivan, E. 2006. Design: More than a cool chair. Boston: Harvard Business School Publishing.......Austin, R., Friis, K., Sullivan, E. 2006. Design: More than a cool chair. Boston: Harvard Business School Publishing....

  16. 77 FR 49784 - Procurement List; Proposed Additions

    Science.gov (United States)

    2012-08-17

    ... INFORMATION: This notice is published pursuant to 41 U.S.C. 8503(a)(2) and 41 CFR 51-2.3. Its purpose is to... Grounds Maintenance Services, Austin Courthouse, 501 West 5th Street, Austin, TX NPA: Crossroads...

  17. 78 FR 25971 - Procurement List, Additions

    Science.gov (United States)

    2013-05-03

    ... Committee for Purchase From People Who Are Blind or Severely Disabled published notices of proposed..., MI, (Off- site: 2307 Business Center Dr, Austin TX) NPA: Travis Association for the Blind, Austin, TX...

  18. ULF/VLF (0.001 to 50 Hz) Seismo-Acoustic Noise in the Ocean. Proceedings of a Workshop Held at Austin, Texas on November 29-December 1, 1988

    Science.gov (United States)

    1989-08-03

    holes drilled in the seafloor from the D/V JOIDES Resolution through petrological , geochemical and paleomagnetic studies of the samples and logging...seismome- ters and/or hydrophones (or differential pressure gauges , DPG). Testing of the new instruments at very early stages is important to ensure...resolved using ocean bottom seismometers, suspended hydrophones and differential pressure gauges assisted by an orbiting radar altimeter (GEOSAT

  19. Continuation application for the Amarillo National Resource Center for Plutonium, a higher education consortium consisting of Texas A and M University, Texas Tech University, and the University of Texas at Austin

    International Nuclear Information System (INIS)

    1995-01-01

    This report describes the 5 tasks to be covered under this project and compiles budget information. Task 1 is to establish a Plutonium Information Resource, which has been established in Amarillo, Texas. Task 2, Advisory Functions, coordinates studies and activities relating to the disposition of excess weapons-grade plutonium. Task 3, Environmental, Public Health, and Safety, supports soil remediation activities. Task 4, Education and Outreach, is supporting four programs: K--12 education improvement in science and math courses; Academic intervention to identify and encourage high ability high school and middle school students with potential to become scientists and engineers; Graduate education evaluation; and Public outreach programs. Task 5, Plutonium and other Materials Studies, is currently funding two projects for the disposition of high explosives: a feasibility study of burning a mixture of high explosives and other materials in a commercial coal-fired power plant and synthesis of diamond by shock compression of bucky ball with explosives

  20. Continuation application for the Amarillo National Resource Center for Plutonium, a higher education consortium consisting of Texas A and M University, Texas Tech University, and the University of Texas at Austin

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-29

    This report describes the 5 tasks to be covered under this project and compiles budget information. Task 1 is to establish a Plutonium Information Resource, which has been established in Amarillo, Texas. Task 2, Advisory Functions, coordinates studies and activities relating to the disposition of excess weapons-grade plutonium. Task 3, Environmental, Public Health, and Safety, supports soil remediation activities. Task 4, Education and Outreach, is supporting four programs: K--12 education improvement in science and math courses; Academic intervention to identify and encourage high ability high school and middle school students with potential to become scientists and engineers; Graduate education evaluation; and Public outreach programs. Task 5, Plutonium and other Materials Studies, is currently funding two projects for the disposition of high explosives: a feasibility study of burning a mixture of high explosives and other materials in a commercial coal-fired power plant and synthesis of diamond by shock compression of bucky ball with explosives.

  1. Southwest Regional Clean Energy Incubation Initiative (SRCEII)

    Energy Technology Data Exchange (ETDEWEB)

    Webber, Michael [Univ. of Texas, Austin, TX (United States)

    2017-10-31

    The Austin Technology Incubator’s (ATI’s) Clean Energy Incubator at the University of Texas at Austin (ATI-CEI) utilized the National Incubator Initiative for Clean Energy (NIICE) funding to establish the Southwest Regional Clean Energy Incubation Initiative, composed of clean energy incubators from The University of Texas at Austin (UT-Austin), The University of Texas at El Paso (UTEP), The University of Texas at San Antonio (UTSA), and Texas A&M University (TAMU).

  2. Effect of γ-radiation on the production of aflatoxin B1 by Aspergillus parasiticus in raisins (Vitis vinifera L.)

    International Nuclear Information System (INIS)

    Kanapitsas, Alexandros; Batrinou, Anthimia; Aravantinos, Athanasios; Markaki, Panagiota

    2015-01-01

    Aflatoxin B 1 (AFB 1 ) mostly produced by Aspergillus flavus and Aspergillus parasiticus, is an extremely toxic and carcinogenic metabolite. The effect of gamma irradiation at dose of 10 kGy on the production of aflatoxin B 1 (AFB 1 ) inoculated by Aspergillus parasiticus in raisins (Vitis vinifera L.) and on AFB 1 in contaminated samples, was investigated. Values of the amount of aflatoxin B 1 produced on the 12th day of incubation, after irradiation, showed that gamma radiation exposure at 10 kGy decreased AFB 1 production at 65% compared with the non-irradiated sample, on the same day. The application of 10 kGy gamma radiation directly on 100 ng of AFB 1 which were spiked in raisins resulted in ∼29% reduction of AFB 1 . According to the risk assessment analysis the Provisional Maximum Tolerable Daily Intake (PMTDI) of 1.0 ng AFB 1 kg −1 bw, indicates that consumers are less exposed to AFB 1 from the irradiated raisins. - Highlights: • Aflatoxin B 1 (AFB 1 ) is an extremely toxic and carcinogenic metabolite. • AFB 1 is produced in raisins. • Irradiation at the dose of 10 kGy affects AFB 1 production. • 10 kGy reduced (∼65%) AFB 1 production by A.parasiticus in raisins. • 10 kGy reduced (∼29%) AFB 1 spiked directly in raisins

  3. 76 FR 17968 - Manufacturer of Controlled Substances; Notice of Registration

    Science.gov (United States)

    2011-03-31

    ... 1, 2010, (75 FR 53720), Austin Pharma LLC., 811 Paloma Drive, Suite A, Round Rock, Texas 78665-2402...) and determined that the registration of Austin Pharma LLC. to manufacture the listed basic classes of controlled substances is consistent with the public interest at this time. DEA has investigated Austin Pharma...

  4. 77 FR 2324 - Manufacturer of Controlled Substances; Notice of Registration

    Science.gov (United States)

    2012-01-17

    ..., 2011, 76 FR 51401, Austin Pharma LLC., 811 Paloma Drive, Suite C, Round Rock, Texas 78665-2402, made...) and determined that the registration of Austin Pharma LLC. to manufacture the listed basic classes of controlled substances is consistent with the public interest at this time. DEA has investigated Austin Pharma...

  5. 75 FR 7955 - Changes in Flood Elevation Determinations

    Science.gov (United States)

    2010-02-23

    ... Honorable James A. December 31, 2008 390348 2056P) January 19, 2009; Smith, Mayor, City of Morning Journal...; August The Honorable Jeff December 4, 2009 481028 (09-06-0609P) 6, 2009; Austin Coleman, Mayor, City...; Austin T. Biscoe, Travis 0609P) American Statesman. County Judge, 314 West 11th Street, Suite 520, Austin...

  6. 76 FR 43194 - Changes in Flood Elevation Determinations

    Science.gov (United States)

    2011-07-20

    ..., Supervisor, Town The Journal News. of Orangetown, 26 Orangeburg Road, Orangeburg, NY 10962. Oklahoma..., Saginaw, TX 76179. Travis City of Austin (10-06- January 19, 2011; The Honorable Lee May 20, 2011 480624 1794P). January 26, 2011; Leffingwell, Mayor, City The Austin American- of Austin, P.O. Box Statesman...

  7. 78 FR 64001 - Finding of No Significant Impact for the Renewal and Amendment to the Barton Springs Pool Habitat...

    Science.gov (United States)

    2013-10-25

    ....fws.gov/southwest/es/AustinTexas . The BSP HCP is also available on the City of Austin's ftp site at ftp://ftp.ci.austin.tx.us/wre/BSHCP . Alternatively, you may obtain a CD-ROM with electronic copies of...

  8. 75 FR 3251 - Applied Materials, Inc., Including On-Site Leased Workers From Adecco Employment Services...

    Science.gov (United States)

    2010-01-20

    ... NSTAR, Austin, Texas. The notice was published in the Federal Register on November 17, 2009 (74 FR 59253... Resources, SQA Services and NSTAR, Austin, TX; Amended Certification Regarding Eligibility To Apply for..., Proactive Business Solution, Inc., Technical Resources, SQA Services, and NSTAR, Austin, Texas, who became...

  9. 76 FR 59161 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-National Warheads...

    Science.gov (United States)

    2011-09-23

    ...., Albuquerque, NM; Tetra Tech, Inc., Honolulu, HI; Trident Research, LLC, Austin, TX; Unified Design Corporation, Rockaway, NJ; and University of Texas at Austin, Austin, TX, have withdrawn as parties to this venture. No... pursuant to Section 6(a) of the Act. The Department of Justice published a notice in the Federal Register...

  10. 75 FR 452 - Applied Materials, Inc. Including On-Site Leased Workers From Adecco Employment Services, Aerotek...

    Science.gov (United States)

    2010-01-05

    ... NSTAR, Austin, Texas. The notice was published in the Federal Register on November 17, 2009 (74 FR 59253... Resources, SQA Services and NSTAR; Austin, TX; Amended Certification Regarding Eligibility To Apply for... NSTAR, Austin, Texas, who became totally or partially separated from employment on or after June 25...

  11. 75 FR 38129 - Freescale Semiconductor, Inc., Hardware/Software Design and Manufacturing A Including On-Site...

    Science.gov (United States)

    2010-07-01

    ... Manufacturing A, Austin, Texas. The notice was published in the Federal Register on May 28, 2010 (75 FR 30070...Logic, Inc., Austin, TX; Amended Certification Regarding Eligibility To Apply for Worker Adjustment..., Design Solutions, Inc., Veriseo, SilconElite and MicroLogic, Inc. were employed on-site at the Austin...

  12. Prospective use of soluble urokinase plasminogen activator receptor to screen TB co-infected with HIV patient among TB patient

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2017-10-01

    Conclusion: Plasma suPAR level of TB patients co-infected with HIV showed significantly difference from that of TB-AFB(+ patients suggested its potential to screen the TB/HIV among pulmonary TB-AFB(+ patients.

  13. 76 FR 10610 - Federal Property Suitable as Facilities To Assist the Homeless

    Science.gov (United States)

    2011-02-25

    ... Force Property Number: 18200820001 Status: Unutilized Reasons: Secured Area Bldg. 3224 Eielson AFB Eielson AK 99702 Landholding Agency: Air Force Property Number: 18200820002 Status: Unutilized Reasons: Secured Area, Extensive deterioration Bldgs. 1437, 1190, 2375 Eielson AFB Eielson AK [[Page 10613...

  14. Assessment of workers’ exposure to Aflatoxin B1 in a Portuguese waste industry

    OpenAIRE

    Viegas, Susana; Veiga, Luísa; Figueredo, Paula; Almeida, Ana; Carolino, Elisabete; Viegas, Carla

    2015-01-01

    Aflatoxin B1 (AFB1) is considered by different International Agencies as a genotoxic and potent hepatocarcinogen. However, despite the fact that the fungi producing this compound are detected in some work environments, AFB1 is rarely monitored in occupational settings. The aim of the present investigation was to assess exposure to AFB1 of workers from one Portuguese waste company located in the outskirt of Lisbon. Occupational exposure assessment to AFB1 was done with a biomarker of internal ...

  15. NetView technical research

    Science.gov (United States)

    1993-01-01

    This is the Final Technical Report for the NetView Technical Research task. This report is prepared in accordance with Contract Data Requirements List (CDRL) item A002. NetView assistance was provided and details are presented under the following headings: NetView Management Systems (NMS) project tasks; WBAFB IBM 3090; WPAFB AMDAHL; WPAFB IBM 3084; Hill AFB; McClellan AFB AMDAHL; McClellan AFB IBM 3090; and Warner-Robins AFB.

  16. On-Site Detection of Aflatoxin B1 in Grains by a Palm-Sized Surface Plasmon Resonance Sensor

    Directory of Open Access Journals (Sweden)

    Jeong Moon

    2018-02-01

    Full Text Available Aflatoxins (AFs are highly toxic compounds that can cause both acute and chronic toxicity in humans. Aflatoxin B1 (AFB1 is considered the most toxic of AFs. Therefore, the rapid and on-site detection of AFB1 is critical for food safety management. Here, we report the on-site detection of AFB1 in grains by a portable surface plasmon resonance (SPR sensor. For the detection of AFB1, the surface of an SPR Au chip was sequentially modified by cysteine-protein G, AFB1 antibody, and bovine serum albumin (BSA. Then, the sample solution and AFB1-BSA conjugate were flowed onto the Au chip in serial order. In the absence of AFB1, the SPR response greatly increased due to the binding of AFB1-BSA on the Au chip. In the presence of AFB1, the SPR response showed little change because the small AFB1 molecule binds on the Au chip instead of the large AFB1-BSA molecule. By using this portable SPR-based competitive immunoassay, the sensor showed low limits of detection (2.51 ppb and quantification (16.32 ppb. Furthermore, we successfully detected AFB1 in rice, peanut, and almond samples, which suggests that the proposed sensing method can potentially be applied to the on-site monitoring of mycotoxins in food.

  17. 76 FR 75453 - Restricted Areas and Danger Zones at Eglin Air Force Base, FL

    Science.gov (United States)

    2011-12-02

    ... and Danger Zones at Eglin Air Force Base, FL AGENCY: U.S. Army Corps of Engineers, Department of... within the Eglin Air Force Base (AFB) facilities and along the Eglin AFB facility shoreline in Florida... have the permission of the Commander, 96 Air Base Wing, Eglin AFB or his/her authorized representative...

  18. Aerospace Physiologist, AFSCs 43AX, M11XXY, and M122XY (Formerly AFSCs 916X, 149XA, and 229XY)

    Science.gov (United States)

    1993-12-01

    need arises, such as during hyperbaric and hypobaric chamber operations and specialized aerospace physiology classroom training requirements. xi 7... Hyperbaric And Hypobaric Chambers Little Rock AFB AK High Altitude Airdrop Mission Support (HAAMS) Holloman AFB NM Centrifuge Training Travis AFB CA... hypobaric , or hyperbaric chambers, etc.). Representative tasks which show the differentiation in time spent on duties among the DAFSC officers are

  19. Solvent-dependent transformation of aflatoxin B1 in soil.

    Science.gov (United States)

    Starr, James M; Rushing, Blake R; Selim, Mustafa I

    2017-08-01

    To date, all studies of aflatoxin B 1 (AFB 1 ) transformation in soil or in purified mineral systems have identified aflatoxins B 2 (AFB 2 ) and G 2 (AFG 2 ) as the primary transformation products. However, identification in these studies was made using thin layer chromatography which has relatively low resolution, and these studies did not identify a viable mechanism by which such transformations would occur. Further, the use of methanol as the solvent delivery vehicle in these studies may have contributed to formation of artifactual transformation products. In this study, we investigated the role of the solvent vehicle in the transformation of AFB 1 in soil. To do this, we spiked soils with AFB 1 dissolved in water (93:7, water/methanol) or methanol and used HPLC-UV and HPLC-MS to identify the transformation products. Contrasting previous published reports, we did not detect AFB 2 or AFG 2 . In an aqueous-soil environment, we identified aflatoxin B 2a (AFB 2a ) as the single major transformation product. We propose that AFB 2a is formed from hydrolysis of AFB 1 with the soil acting as an acid catalyst. Alternatively, when methanol was used, we identified methoxy aflatoxin species likely formed via acid-catalyzed addition of methanol to AFB 1 . These results suggest that where soil moisture is adequate, AFB 1 is hydrolyzed to AFB 2a and that reactive organic solvents should be avoided when replicating natural conditions to study the fate of AFB 1 in soil.

  20. Human health implications from co-exposure to aflatoxins and fumonisins in maize-based foods in Latin America: Guatemala as a case study

    Science.gov (United States)

    Co-occurence of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) in maize has been demonstrated in many surveys. Combined-exposure to FB1 and AFB1 was of concern to the Joint FAO/WHO Expert Committee on Food Additives because of the known genotoxicity of AFB1 and the ability of FB1 to induce regenerative...