WorldWideScience

Sample records for beetle tribolium castaneum

  1. PATCH EXPLOITATION BY FEMALE RED FLOUR BEETLES, TRIBOLIUM CASTANEUM

    Science.gov (United States)

    The red flour beetle, Tribolium castaneum (Herbst) (Coleoptera:Tenebrionidae) has had a long association with human stored food and can be a major pest in anthropogenic structures used for the processing and storage of grain-based products. Anthropogenic structures are fragmented landscapes characte...

  2. The genome of the model beetle and pest Tribolium castaneum

    DEFF Research Database (Denmark)

    Denell, Robin; Gibbs, Richard; Muzny, Donna;

    2008-01-01

    Tribolium castaneum is a member of the most species-rich eukaryotic order, a powerful model organism for the study of generalized insect development, and an important pest of stored agricultural products. We describe its genome sequence here. This omnivorous beetle has evolved the ability to inte...

  3. Larval RNA interference in the red flour beetle, Tribolium castaneum.

    Science.gov (United States)

    Linz, David M; Clark-Hachtel, Courtney M; Borràs-Castells, Ferran; Tomoyasu, Yoshinori

    2014-01-01

    The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle's body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

  4. The genome of the model beetle and pest Tribolium castaneum

    Czech Academy of Sciences Publication Activity Database

    Richards, S.; Jindra, Marek

    2008-01-01

    Roč. 452, č. 7190 (2008), s. 949-955. ISSN 0028-0836 Institutional research plan: CEZ:AV0Z50070508 Keywords : Tribolium castaneum * genome * sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 31.434, year: 2008

  5. Laboratory evaluation of some indigenous plant extracts as toxicants against red flour beetle, Tribolium castaneum Herbst

    OpenAIRE

    Mamum, M.S.A; Shahjahan, M.; Ahmad, M.

    2009-01-01

    Experiments were carried out to evaluate the toxicity of six botanicals, Bazna (Zanthoxylum rhetsa), Ghora-neem (Melia sempervirens), Hijal (Barringtonia acutangula), Karanja (Pongamia pinnata), Mahogoni (Swietenia mahagoni) and Neem (Azadirachta indica) against red flour beetle, Tribolium castaneum Herbst. Leaf and seed extracts were prepared by using acetone, methanol and water as solvents. The results showed that extracts of all the six plants had direct toxic effect on red flour beetle. A...

  6. BIOACTIVITY OF 1,8-CINEOLE AGAINST RED FLOUR BEETLE TRIBOLIUM CASTANEUM (HERBST

    Directory of Open Access Journals (Sweden)

    Anita Liška

    2011-06-01

    Full Text Available Red flour beetle Tribolium castaneum (Herbst is a major pest of stored products. The aim of this study was to assess the potential fumigant effects of 1,8-cineole, essential oil component, on the T. castaneum pupae. The compound was tested in 6 doses; in two treatments (fumigation without grain and with wheat grain, exposed for 48 h, in 4 repetitions, for each gender. The compound 1,8-cineole had lethal effect on the treated pupae at both genders and in the both treatments. Total proportion of the normally developed beetles was decreased. In addition, 1,8-cineole had also a growth regulator effect, producing adultoids and deformed units, with males more susceptible. In the treatment with the grain there were significant lower dead pupae, normally developed live male beetles and also deformed female units in the stage 2. In general, compound 1,8-cineole has multiple effect against T. castaneum in pupal stage.

  7. Genomics, transcriptomics, and peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium castaneum

    DEFF Research Database (Denmark)

    Li, Bin; Predel, Reinhard; Neupert, Susanne; Hauser, Frank; Tanaka, Yoshiaki; Cazzamali, Giuseppe; Williamson, Michael; Arakane, Yasuyuki; Verleyen, Peter; Schoofs, Liliane; Schachtner, Joachim; Grimmelikhuijzen, Cornelis J P; Park, Yoonseong

    2008-01-01

    Neuropeptides and protein hormones are ancient molecules that mediate cell-to-cell communication. The whole genome sequence from the red flour beetle Tribolium castaneum, along with those from other insect species, provides an opportunity to study the evolution of the genes encoding neuropeptide...... for corazonin, kinin, and allatostatin-A. The cognate receptor genes for these three peptides also appear to be absent in the Tribolium genome. Our analysis of Tribolium indicates that, during insect evolution, genes for neuropeptides and protein hormones are often duplicated or lost....

  8. Effects of γ-irradiation on larval and adult stages of Tribolium castaneum (red flour beetle)

    International Nuclear Information System (INIS)

    Food irradiation using γ-rays is one of powerful tools to reduce insect infestation in crops and spices. We examined the effects of γ-irradiation on larvae and adults of Tribolium castaneum. Eclosion for larvae was completely inhibited by irradiation at 500 Gy. A survival rate for adults was markedly reduced by irradiation at more than 500 Gy. The neutral comet assay presented that irradiation irreversibly increased DNA damage at 500 and 1000 Gy and transiently increased DNA damage at 100 Gy, suggesting possible DNA repair in larvae and adults stages. These results indicate that γ-irradiation at 500 Gy is available to eradicate the beetle at larval and adults stages. (author)

  9. Cap’n’collar differentiates the mandible from the maxilla in the beetle Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Coulcher Joshua F

    2012-11-01

    Full Text Available Abstract Background The biting mandible of the arthropods is thought to have evolved in the ancestor of the insects, crustaceans and myriapods: the Mandibulata. A unique origin suggests a common set of developmental genes will be required to pattern the mandible in different arthropods. To date we have functional studies on patterning of the mandibular segment of Drosophila melanogaster showing in particular the effects of the gene cap’n’collar (cnc, however, the dipteran head is far from representative of insects or of more distantly related mandibulates; Drosophila does not even possess a mandibular appendage. To study the development of a more representative insect mandible, we chose the red flour beetle Tribolium castaneum and investigated the function of the Tribolium orthologs of cap’n’collar (Tc-cnc and the Hox gene Deformed (Tc-Dfd. In order to determine the function of Tc-cnc and Tc-Dfd, transcripts were knocked down by maternal RNA interference (RNAi. The effects of gene knockdown were examined in the developing embryos and larvae. The effect of Tc-cnc and Tc-Dfd knockdown on the expression of other genes was determined by using in situ hybridization on Tribolium embryos. Results Our analyses show that Tc-cnc is required for specification of the identity of the mandibular segment of Tribolium and differentiates the mandible from maxillary identity. Loss of Tc-cnc function results in a transformation of the mandible to maxillary identity as well as deletion of the labrum. Tc-Dfd and the Tribolium homolog of proboscipedia (Tc-mxp = maxillopedia, Hox genes that are required to pattern the maxillary appendage, are expressed in a maxilla-like manner in the transformed mandible. Tribolium homologs of paired (Tc-prd and Distal-less (Tc-Dll that are expressed in the endites and telopodites of embryonic appendages are also expressed in a maxilla-like manner in the transformed mandible. We also show that Tc-Dfd is required to

  10. Insulin receptor regulates food intake through sulfakinin signaling in the red flour beetle, Tribolium castaneum.

    Science.gov (United States)

    Lin, Xianyu; Yu, Na; Smagghe, Guy

    2016-06-01

    Insects obtain energy and nutrients via feeding to support growth and development. The insulin signaling pathway is involved in the regulation of feeding; however, the underlying mechanisms are not fully understood. Here, we show that insulin signaling regulates food intake via crosstalk with neuropeptide sulfakinin in the red flour beetle, Tribolium castaneum. Silencing of the insulin receptor (InR) decreased the food intake in the penultimate and final instar stages, leading to a decrease of weight gain and mortality during larval-pupal metamorphosis. Interestingly, the knockdown of InR co-occurred with an increased expression of sulfakinin (sk), a gene encoding neuropeptide SK functioning as a satiety signal. In parallel, double silencing of sk and InR eliminated the inhibitory effect on food intake as induced by silencing of InR and the larvae died as prepupae. In conclusion, this study shows, for the first time, that the insulin/InR signaling regulates food intake through the sulfakinin signaling pathway in the larval stages of this important model and pest insect, indicating a novel target for pest control. PMID:26972481

  11. The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Sattelle David B

    2007-09-01

    Full Text Available Abstract Background Members of the cys-loop ligand-gated ion channel (cys-loop LGIC superfamily mediate chemical neurotransmission and are studied extensively as potential targets of drugs used to treat neurological disorders such as Alzheimer's disease. Insect cys-loop LGICs are also of interest as they are targets of highly successful insecticides. The red flour beetle, Tribolium castaneum, is a major pest of stored agricultural products and is also an important model organism for studying development. Results As part of the T. castaneum genome sequencing effort, we have characterized the beetle cys-loop LGIC superfamily which is the third insect superfamily to be described after those of Drosophila melanogaster and Apis mellifera, and also the largest consisting of 24 genes. As with Drosophila and Apis, Tribolium possesses ion channels gated by acetylcholine, γ-amino butyric acid (GABA, glutamate and histamine as well as orthologs of the Drosophila pH-sensitive chloride channel subunit (pHCl, CG8916 and CG12344. Similar to Drosophila and Apis, Tribolium cys-loop LGIC diversity is broadened by alternative splicing although the beetle orthologs of RDL and GluCl possess more variants of exon 3. Also, RNA A-to-I editing was observed in two Tribolium nicotinic acetylcholine receptor subunits, Tcasα6 and Tcasβ1. Editing in Tcasα6 is evolutionarily conserved with D. melanogaster, A. mellifera and Heliothis virescens, whereas Tcasβ1 is edited at a site so far only observed in the beetle. Conclusion Our findings reveal that in diverse insect species the cys-loop LGIC superfamily has remained compact with only minor changes in gene numbers. However, alternative splicing, RNA editing and the presence of divergent subunits broadens the cys-loop LGIC proteome and generates species-specific receptor isoforms. These findings on Tribolium castaneum enhance our understanding of cys-loop LGIC functional genomics and provide a useful basis for the

  12. Bioactivity of Indonesian mahogany, Toona sureni (Blume (Meliaceae, against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae

    Directory of Open Access Journals (Sweden)

    Sahana Parvin

    2012-09-01

    Full Text Available Bioactivity of Indonesian mahogany, Toona sureni (Blume (Meliaceae, against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae. The insecticidal activity of Toona sureni (Blume Merr. was evaluated considering repellency, mortality and progeny production of F1 adults of Tribolium castaneum (Herbst, 1797 (Coleoptera, Tenebrionidae. Dried extract of seeds of T. sureni was dissolved in acetone to prepare solution of various concentrations (0.5, 1.0, 2.5 and 5.0%. To test for repellency, the insects were exposed to treated filter paper. Mortality of larvae, pupae and adults was evaluated by the treatment of spraying the insects with different concentrations of T. sureni extract. Residual effect of the extract was also evaluated considering the production of progeny of F1 adults. The highest repellency (93.30% of T. castaneum occurred at the highest concentration (5.0% suspension of T. sureni; while the lowest (0.0% repellency occurred at 0.5% suspension after 1 day of treatment. The highest mortality against adults (86.71%, larvae (88.32% and pupae (85% occurred at 5% suspension at 8 days after application. There was a negative correlation between the concentrations of T. sureni and the production of F1 adult's progeny of T. castaneum. The highest number of progeny (147 of T. castaneum occurred in the control at 7 days after treatment; and the lowest number of progeny (43 occurred at 5.0% concentration in 1 day after treatment. The results show that T. sureni is toxic to T. castaneum and has the potential to control all stages of this insect in stored wheat.

  13. 3D standard brain of the red flour beetle Tribolium castaneum: a tool to study metamorphic development and adult plasticity

    Directory of Open Access Journals (Sweden)

    David Dreyer

    2010-03-01

    Full Text Available The red flour beetle Tribolium castaneum is emerging as a further standard insect model beside Drosophila. Its genome is fully sequenced and it is susceptible for genetic manipulations including RNA-interference. We use this beetle to study adult brain development and plasticity primarily with respect to the olfactory system. In the current study, we provide 3D standard brain atlases of freshly eclosed adult female and male beetles (A0. The atlases include eight paired and three unpaired neuropils including antennal lobes, optic lobe neuropils, mushroom body calyces and pedunculi, and central complex. For each of the two standard brains, we averaged brain areas of 20 individual brains. Additionally, we characterized eight selected olfactory glomeruli from 10 A0 female and male beetles respectively, which we could unequivocally recognize from individual to individual owing to their size and typical position in the antennal lobes. In summary, comparison of the averaged neuropil volumes revealed no sexual dimorphism in any of the reconstructed neuropils in A0 Tribolium brains. Both, the female and male 3D standard brain are also used for interspecies comparisons, and, very importantly, will serve as future volumetric references after genetical manipulation especially regarding metamorphic development and adult plasticity.

  14. The role of the serosa in innune defense of the beetle Tribolium castaneum

    OpenAIRE

    Bernardes, Joana Pimenta, 1988-

    2012-01-01

    Tese de mestrado. Biologia (Biologia Evolutiva e do Desenvolvimento). Universidade de Lisboa, Faculdade de Ciências, 2012 O modelo de investigação Tribolium castaneum tem sido amplamente utilizado em áreas como a biologia do desenvolvimento e evolução. Os trabalhos de investigação nesta espécie são importantes devido à sua relevância em termos económicos e de controlo de pragas. Esta espécie está inserida na ordem Coleopetera, a ordem com maior diversidade biológica conhecida. Este modelo ...

  15. A genome-wide inventory of neurohormone GPCRs in the red flour beetle Tribolium castaneum

    DEFF Research Database (Denmark)

    Hauser, Frank; Cazzamali, Giuseppe; Williamson, Michael;

    2008-01-01

    Insect neurohormones (biogenic amines, neuropeptides, and protein hormones) and their G protein-coupled receptors (GPCRs) play a central role in the control of behavior, reproduction, development, feeding and many other physiological processes. The recent completion of several insect genome...... consumption. In addition, T. castaneum is a model for insect development. Here, we have investigated the presence of neurohormone GPCRs in Tribolium and compared them with those from the fruit fly Drosophila melanogaster (Diptera) and the honey bee Apis mellifera (Hymenoptera). We found 20 biogenic amine...

  16. Concentration dependent toxicokinetics of copper in the red flour beetle Tribolium castaneum (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Bednarska, Agnieszka J; Stępień, Katarzyna

    2015-11-01

    To predict internal metal concentrations in animals under specific environmental exposures, the relationship between the exposure concentrations and values of toxicokinetic parameters must be known. At high exposure levels, the availability of carriers transporting metal ions through cellular membranes may become limited, thereby decreasing the assimilation rates (k A ). Furthermore, increased metal concentrations in food may result in greater damage to the gut and reduce the assimilation efficiency and/or increase the elimination rate (k E ). Therefore, k A should decrease and k E should increase with increasing metal concentrations. In fact, our study on Tribolium castaneum exposed to Cu at 500, 1000, 2000 and 4000 mg kg(-1) of dry flour showed that with increasing Cu concentrations, k A decreased from 0.0042 day(-1) at 500 mg kg(-1) to 0.0026 day(-1) at 4000 mg kg(-1) in females and from 0.0029 to 0.001 day(-1) in males and k E increased from 0.027 to 0.064 day(-1) and from 0.018 to 0.04 day(-1) in females and males, respectively. Significant differences in k A between the sexes were observed at 2000 and 4000 mg kg(-1), whereas significant differences between treatments were found for k A in males. Copper was efficiently regulated by T. castaneum: an eightfold increase in exposure concentrations resulted in only a ca. twofold increase in the internal concentration. No Cu effect on the respiratory metabolism of T. castaneum was found. PMID:26169625

  17. Bioactivity of Indonesian mahogany, Toona sureni (Blume (Meliaceae, against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae Bioatividade do mogno da Indonésia, Toona sureni (Blume (Meliaceae, contra o besouro-das-farinhas, Tribolium castaneum (Coleoptera, Tenebrionidae

    Directory of Open Access Journals (Sweden)

    Sahana Parvin

    2012-09-01

    Full Text Available Bioactivity of Indonesian mahogany, Toona sureni (Blume (Meliaceae, against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae. The insecticidal activity of Toona sureni (Blume Merr. was evaluated considering repellency, mortality and progeny production of F1 adults of Tribolium castaneum (Herbst, 1797 (Coleoptera, Tenebrionidae. Dried extract of seeds of T. sureni was dissolved in acetone to prepare solution of various concentrations (0.5, 1.0, 2.5 and 5.0%. To test for repellency, the insects were exposed to treated filter paper. Mortality of larvae, pupae and adults was evaluated by the treatment of spraying the insects with different concentrations of T. sureni extract. Residual effect of the extract was also evaluated considering the production of progeny of F1 adults. The highest repellency (93.30% of T. castaneum occurred at the highest concentration (5.0% suspension of T. sureni; while the lowest (0.0% repellency occurred at 0.5% suspension after 1 day of treatment. The highest mortality against adults (86.71%, larvae (88.32% and pupae (85% occurred at 5% suspension at 8 days after application. There was a negative correlation between the concentrations of T. sureni and the production of F1 adult's progeny of T. castaneum. The highest number of progeny (147 of T. castaneum occurred in the control at 7 days after treatment; and the lowest number of progeny (43 occurred at 5.0% concentration in 1 day after treatment. The results show that T. sureni is toxic to T. castaneum and has the potential to control all stages of this insect in stored wheat.Bioatividade do mogno da Indonésia, Toona sureni (Blume (Meliaceae, contra o besouro-das-farinhas, Tribolium castaneum (Coleoptera, Tenebrionidae. A atividade inseticida de Toona sureni (Blume Merr. foi avaliada considerando repelência, mortalidade e a produção de progênie de adultos F1 de Tribolium castaneum (Herbst, 1797 (Coleoptera, Tenebrionidae. Extrato seco de sementes

  18. Glycogen and glucose metabolism are essential for early embryonic development of the red flour beetle Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Amanda Fraga

    Full Text Available Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3 and hexokinase (HexA genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen.

  19. The complete mitochondrial genome of the red flour beetle, Tribolium castaneum (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Liu, Qiu-Ning; Bian, Dan-Dan; Jiang, Sen-Hao; Li, Zhen-Xing; Ge, Bao-Ming; Xuan, Fu-Jun; Yang, Li; Li, Chao-Feng; Zhang, Dai-Zhen; Zhou, Chun-Lin; Tang, Bo-Ping

    2016-01-01

    The complete mitochondrial genome (mitogenome) of Tribolium castaneum (Coleoptera: Tenebrionidae) was determined to be 15,883 bp (GenBank accession No. KM009121), which contains 22 tRNA genes, 13 protein-coding genes (PCGs), 2 rRNA genes and a major non-coding A + T-rich region. It has the typical gene organization and order of mitogenomes from ancestral insects. The nucleotide composition was also biased toward A + T nucleotides (71.72%) and the AT skew of this mitogenome was slightly positive. All of the 22 tRNA genes displayed a typical clover-leaf structure, with the exception of trnS1 (AGN). Thirteen PCGs were initiated by ATN codons, except for cytochrome c oxidase subunit 1 (cox1) gene which was initiated by AAT. Eight of the 13 PCGs harbor the incomplete termination codon by T or TA. The A + T-rich region of the mitogenome was 1237 bp in length and the A + T content was 82.30%. PMID:25162515

  20. A Defensin from the Model Beetle Tribolium castaneum Acts Synergistically with Telavancin and Daptomycin against Multidrug Resistant Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Rajmohan Rajamuthiah

    Full Text Available The red flour beetle Tribolium castaneum is a common insect pest and has been established as a model beetle to study insect development and immunity. This study demonstrates that defensin 1 from T. castaneum displays in vitro and in vivo antimicrobial activity against drug resistant Staphylococcus aureus strains. The minimum inhibitory concentration (MIC of defensin 1 against 11 reference and clinical staphylococcal isolates was between 16-64 μg/ml. The putative mode of action of the defensin peptide is disruption of the bacterial cell membrane. The antibacterial activity of defensin 1 was attenuated by salt concentrations of 1.56 mM and 25 mM for NaCl and CaCl2 respectively. Treatment of defensin 1 with the reducing agent dithiothreitol (DTT at concentrations 1.56 to 3.13 mM abolished the antimicrobial activity of the peptide. In the presence of subinhibitory concentrations of antibiotics that also target the bacterial cell envelope such as telavancin and daptomycin, the MIC of the peptide was as low as 1 μg/ml. Moreover, when tested against an S. aureus strain that was defective in D-alanylation of the cell wall, the MIC of the peptide was 0.5 μg/ml. Defensin 1 exhibited no toxicity against human erythrocytes even at 400 μg/ml. The in vivo activity of the peptide was validated in a Caenorhabditis elegans-MRSA liquid infection assay. These results suggest that defensin 1 behaves similarly to other cationic AMPs in its mode of action against S. aureus and that the activity of the peptide can be enhanced in combination with other antibiotics with similar modes of action or with compounds that have the ability to decrease D-alanylation of the bacterial cell wall.

  1. An appraisal of resistance of old and new wheat genotypes to red flour beetle (tribolium castaneum herbst)

    International Nuclear Information System (INIS)

    In the present investigation, 30 varieties of wheat were used to study their resistance against Red flour beetle, Tribolium castaneum (Herbst). The grains of all these varieties were obtained from Plant Breeding and Genetics Division, Nuclear and 65 +- 5% R.H. The standard of Institute of Agriculture, Tandojam. Experiment was conducted in the laboratory at 29 +- 2 deg. C. the samples of each variety used in the experiment was 1000 grains, kept in plastic jars (15 x 6 cm). Ten pairs of newly emerged adult flour beetles (both sexes in equivalent numbers) of uniform age from laboratory stocked culture were released in each jar. The results were evaluated on the bases of adult population development, percent grain damage and frass production, revealed that none of the genotype was completely resistant to the infestation of T. castaneum. All the varieties suffered losses, but their degree of resistance varied significantly. On the bases of pest population development, percent damage and frass production, the least damage was noted in variety Barani-70 and Bhittai and the highest damage was and T; hence these varieties were designated the most tolerant and the most susceptible varieties, recorded in T/sub 21/ and T/sub 16/ respectively. The comparative resistance displayed by the wheat varieties, could be placed in the following order: < Barani- 70< Bhatti < T/sub 19/ < T/sub 14/ < T/sub 24/ < T/sub 13/ < T/sub 20/ < T/sub 9/ < T/sub 11/ < T/sub 15/ < T/sub 25/ < T/sub 1/ < T/sub 25/ < T.J.-83 < T/sub 22/ < T/sub 3/ < T/sub 18/< T/sub 10/ < T/sub 23/ < T/sub 10/ < T/sub 23/. (author)

  2. Genomic and gene regulatory signatures of cryptozoic adaptation: Loss of blue sensitive photoreceptors through expansion of long wavelength-opsin expression in the red flour beetle Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Cook Tiffany A

    2007-12-01

    Full Text Available Abstract Background Recent genome sequence analysis in the red flour beetle Tribolium castaneum indicated that this highly crepuscular animal encodes only two single opsin paralogs: a UV-opsin and a long wavelength (LW-opsin; however, these animals do not encode a blue (B-opsin as most other insects. Here, we studied the spatial regulation of the Tribolium single LW- and UV-opsin gene paralogs in comparison to that of the five opsin paralogs in the retina of Drosophila melanogaster. Results In situ hybridization analysis reveals that the Tribolium retina, in contrast with other insect retinas, constitutes a homogenous field of ommatidia that have seven LW-opsin expressing photoreceptors and one UV-/LW-opsin co-expressing photoreceptor per eye unit. This pattern is consistent with the loss of photoreceptors sensitive to blue wavelengths. It also identifies Tribolium as the first example of a species in insects that co-expresses two different opsins across the entire retina in violation of the widely observed "one receptor rule" of sensory cells. Conclusion Broader studies of opsin evolution in darkling beetles and other coleopteran groups have the potential to pinpoint the permissive and adaptive forces that played a role in the evolution of vision in Tribolium castaneum.

  3. Odoriferous Defensive stink gland transcriptome to identify novel genes necessary for quinone synthesis in the red flour beetle, Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Jianwei Li

    Full Text Available Chemical defense is one of the most important traits, which endow insects the ability to conquer a most diverse set of ecological environments. Chemical secretions are used for defense against anything from vertebrate or invertebrate predators to prokaryotic or eukaryotic parasites or food competitors. Tenebrionid beetles are especially prolific in this category, producing several varieties of substituted benzoquinone compounds. In order to get a better understanding of the genetic and molecular basis of defensive secretions, we performed RNA sequencing in a newly emerging insect model, the red flour beetle Tribolium castaneum (Coleoptera: Tenebrionidae. To detect genes that are highly and specifically expressed in the odoriferous gland tissues that secret defensive chemical compounds, we compared them to a control tissue, the anterior abdomen. 511 genes were identified in different subtraction groups. Of these, 77 genes were functionally analyzed by RNA interference (RNAi to recognize induced gland alterations morphologically or changes in gland volatiles by gas chromatography-mass spectrometry. 29 genes (38% presented strong visible phenotypes, while 67 genes (87% showed alterations of at least one gland content. Three of these genes showing quinone-less (ql phenotypes - Tcas-ql VTGl; Tcas-ql ARSB; Tcas-ql MRP - were isolated, molecularly characterized, their expression identified in both types of the secretory glandular cells, and their function determined by quantification of all main components after RNAi. In addition, microbe inhibition assays revealed that a quinone-free status is unable to impede bacterial or fungal growth. Phylogenetic analyses of these three genes indicate that they have evolved independently and specifically for chemical defense in beetles.

  4. A Soluble Pyrophosphatase Is Essential to Oogenesis and Is Required for Polyphosphate Metabolism in the Red Flour Beetle (Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Klébea Carvalho

    2015-03-01

    Full Text Available Polyphosphates have been found in all cell types examined to date and play diverse roles depending on the cell type. In eukaryotic organisms, polyphosphates have been mainly investigated in mammalian cells with few studies on insects. Some studies have demonstrated that a pyrophosphatase regulates polyphosphate metabolism, and most of them were performed on trypanosomatids. Here, we investigated the effects of sPPase gene knocked down in oogenesis and polyphosphate metabolism in the red flour beetle (Tribolium castaneum. A single sPPase gene was identified in insect genome and is maternally provided at the mRNA level and not restricted to any embryonic or extraembryonic region during embryogenesis. After injection of Tc-sPPase dsRNA, female survival was reduced to 15% of the control (dsNeo RNA, and egg laying was completely impaired. The morphological analysis by nuclear DAPI staining of the ovarioles in Tc-sPPase dsRNA-injected females showed that the ovariole number is diminished, degenerated oocytes can be observed, and germarium is reduced. The polyphosphate level was increased in cytoplasmic and nuclear fractions in Tc-sPPase RNAi; Concomitantly, the exopolyphosphatase activity decreased in both fractions. Altogether, these data suggest a role for sPPase in the regulation on polyphosphate metabolism in insects and provide evidence that Tc-sPPase is essential to oogenesis.

  5. Use of Gamma Irradiation for the Control of the Red Flour Beetle (Tribolium castaneum Hrbst) in Bread Flour

    International Nuclear Information System (INIS)

    Three doses of gamma irradiation (viz. 2, 2.5 and 3 KGy) were tested against the red flour beetle (Tribolium castaneum Hrbst) in bread flour in Khartoum, Sudan. Corresponding control exhibited two groups of infested and uninfested flours. The results obtained showed that all the doses used reduced the infestation in a range 46-100 % during a six month storage period. The 2 KGy mortality range, of the test insect, was 46 - 100%, whereas the corresponding readings for 2.5 KGy and 3 KGy were 90 - 100% and total kill (100%), respectively. However, a natural infestation occurred in all the treated flours and in the infested and uninfested controls as well. This may refer to the resistant eggs of this insect whose a smaller size than the major bulk flour particles and therefore not affected by the milling process and the irradiation doses used too.The treatment mortality in this test was corrected by the Abbott's formula. Moreover, the flour analyses results implied that all the chemical parameters (moisture %, ash % and protein %) and the quality parameters (wet gluten and falling number) are within the recommended levels of the Codex Alimentarius.It was also found that these doses used had no harmful effect on dough rheological properties.

  6. Insecticide-Mediated Up-Regulation of Cytochrome P450 Genes in the Red Flour Beetle (Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Xiao Liang

    2015-01-01

    Full Text Available Some cytochrome P450 (CYP genes are known for their rapid up-regulation in response to insecticide exposures in insects. To date, however, limited information is available with respect to the relationships among the insecticide type, insecticide concentration, exposure duration and the up-regulated CYP genes. In this study, we examined the transcriptional response of eight selected CYP genes, including CYP4G7, CYP4Q4, CYP4BR3, CYP12H1, CYP6BK11, CYP9D4, CYP9Z5 and CYP345A1, to each of four insecticides in the red flour beetle, Tribolium castaneum. Reverse transcription quantitative PCR (RT-qPCR revealed that CYP4G7 and CYP345A1 can be significantly up-regulated by cypermethrin (1.97- and 2.06-fold, respectively, permethrin (2.00- and 2.03-fold and lambda-cyhalothrin (1.73- and 1.81-fold, whereas CYP4BR3 and CYP345A1 can be significantly up-regulated by imidacloprid (1.99- and 1.83-fold when 20-day larvae were exposed to each of these insecticides at the concentration of LC20 for 24 h. Our studies also showed that similar levels of up-regulation can be achieved for CYP4G7, CYP4BR3 and CYP345A1 by cypermethrin, permethrin, lambda-cyhalothrin or imidacloprid with approximately one fourth of LC20 in 6 h. Our study demonstrated that up-regulation of these CYP genes was rapid and only required low concentrations of insecticides, and the up-regulation not only depended on the CYP genes but also the type of insecticides. Our results along with those from previous studies also indicated that there were no specific patterns for predicting the up-regulation of specific CYP gene families based on the insecticide classification.

  7. The Presence of Flour Affects the Efficacy of Aerosolized Insecticides used to Treat the Red Flour Beetle, Tribolium castaneum

    OpenAIRE

    Toews, Michael D; Campbell, James F.; Arthur, Franklin H.

    2010-01-01

    Experiments were conducted in tightly sealed pilot scale warehouses to assess the efficacy of common aerosolized insecticides on all life stages of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) when exposed in dishes containing 0 to 2 g of wheat flour either under pallets or out in the open. Petri dishes containing 0, 0.1, 1, or 2 g of flour were prepared with 25 eggs, 3rd instars, pupae, or adults and then immediately treated with aerosolized solvent, Pyrethrins, or esfenvalerate....

  8. Anatomical localization and stereoisomeric composition of Tribolium castaneum aggregation pheromones

    Science.gov (United States)

    We report that the abdomen and associated tissues are the predominant sources of male-produced pheromones in the red flour beetle, Tribolium castaneum, and for the first time describe the stereoisomeric composition of the natural blend of isomers of the aggregation pheromone 4,8-dimethyldecanal (DMD...

  9. Insights into insect wing origin provided by functional analysis of vestigial in the red flour beetle, Tribolium castaneum

    OpenAIRE

    Clark-Hachtel, Courtney M.; Linz, David M.; Tomoyasu, Yoshinori

    2013-01-01

    Insect wings are a core example of morphological novelty, yet their acquisition remains a biological conundrum. More than a century of debates and observations has culminated in two prominent hypotheses on the origin of insect wings. Here, we show that there are two separate wing serial homologs in the wingless first thoracic segment of a beetle, Tribolium. These two tissues are merged to form an ectopic wing structure in homeotic transformation. Intriguingly, the two wing serial homologs may...

  10. The model beetle Tribolium castaneum can be used as an early warning system for transgenerational epigenetic side effects caused by pharmaceuticals.

    Science.gov (United States)

    Bingsohn, Linda; Knorr, Eileen; Vilcinskas, Andreas

    2016-01-01

    Pharmaceuticals are not currently tested for transgenerational and epigenetic side effects. The use of vertebrates as preclinical research models is limited by their long generation times, low numbers of progeny and ethical concerns. In contrast, invertebrates such as insects breed rapidly, produce many offspring and are more ethically acceptable, allowing them to be used for high-throughput screening. Here, we established Tribolium castaneum as a model to screen for the effect of drugs on complex fitness parameters and the expression of epigenetic regulatory genes. We tested diets supplemented with the psychoactive drug valproic acid (VPA), which is a histone deacetylase inhibitor, or the antioxidant curcumin, which is a histone acetyltransferase inhibitor. We found that VPA delayed development, reduced longevity, and increased female body weight compared to a control diet. Fertility and fecundity declined and the expression of epigenetic regulatory genes was induced in the untreated F1 generation. In contrast, curcumin did not affect development or body weight, but it increased longevity, caused a significant reduction in fertility, and induced the expression of epigenetic regulatory genes mostly in the treated F0 generation. VPA and curcumin administered to vertebrate models have similar effects to those we observed in T. castaneum, confirming that this beetle is potentially useful as an alternative model to screen for the epigenetic effect of drugs. T. castaneum also provides a valuable early warning system for transgenerational epigenetic risk factors that are difficult to detect in mammals. PMID:26972758

  11. A dual role for nanos and pumilio in anterior and posterior blastodermal patterning of the short-germ beetle Tribolium castaneum.

    Science.gov (United States)

    Schmitt-Engel, Christian; Cerny, Alexander C; Schoppmeier, Michael

    2012-04-15

    Abdominal patterning in Drosophila requires the function of Nanos (nos) and Pumilio (pum) to repress posterior translation of hunchback mRNA. Here we provide the first functional analysis of nanos and pumilio genes during blastodermal patterning of a short-germ insect. We found that nos and pum in the red flour beetle Tribolium castaneum crucially contribute to posterior segmentation by preventing hunchback translation. While this function seems to be conserved among insects, we provide evidence that Nos and Pum may also act on giant expression, another gap gene. After depletion of nos and pum by parental RNAi, Hunchback and giant remain ectopically at the posterior blastoderm and the posterior Krüppel (Kr) domain is not being activated. giant may be a direct target of Nanos and Pumilio in Tribolium and presumably prevents early Kr expression. In the absence of Kr, the majority of secondary gap gene domains fail to be activated, and abdominal segmentation is terminated prematurely. Surprisingly, we found Nos and Pum also to be involved in early head patterning, as the loss of Nos and Pum results in deletions and transformations of gnathal and pre-gnathal anlagen. Since the targets of Nos and Pum in head development remain to be identified, we propose that anterior patterning in Tribolium may involve additional maternal factors. PMID:22326441

  12. Identification of G protein-coupled receptors required for vitellogenin uptake into the oocytes of the red flour beetle, Tribolium castaneum.

    Science.gov (United States)

    Bai, Hua; Palli, Subba Reddy

    2016-01-01

    Previous studies suggested that a membrane receptor might be involved in mediating vitellogenin (Vg) uptake and juvenile hormone (JH)-regulated remodeling of follicular epithelium (also called 'patency'). G protein-coupled receptor (GPCR) family is one of the largest membrane receptor protein families and controls many key physiological processes. To investigate the role of GPCRs in insect reproduction and juvenile hormone-regulated Vg uptake, we performed a comprehensive RNA interference (RNAi) screen targeting GPCRs in the red flour beetle, Tribolium castaneum. Out of 112 GPCRs tested, knockdown of 41 GPCRs resulted in a reduction in fecundity. Interestingly, RNAi against two GPCRs (a Rhodopsin-like receptor and a Dopamine D2-like receptor) led to a significant reduction in Vg accumulation in developing oocytes. Functional assays of these two GPCRs showed that JH triggers a dose-dependent inhibition of intracellular cAMP levels in HEK293 cells expressing Tribolium Dopamine D2-like receptor. These data suggest that Dopamine D2-like receptor plays crucial roles in regulating Vg uptake and is a promising candidate membrane receptor mediating JH regulation of patency in the red flour beetle. PMID:27277501

  13. The presence of flour affects the efficacy of aerosolized insecticides used to treat the red flour beetle, Tribolium castaneum.

    Science.gov (United States)

    Toews, Michael D; Campbell, James F; Arthur, Franklin H

    2010-01-01

    Experiments were conducted in tightly sealed pilot scale warehouses to assess the efficacy of common aerosolized insecticides on all life stages of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) when exposed in dishes containing 0 to 2 g of wheat flour either under pallets or out in the open. Petri dishes containing 0, 0.1, 1, or 2 g of flour were prepared with 25 eggs, 3rd instars, pupae, or adults and then immediately treated with aerosolized solvent, Pyrethrins, or esfenvalerate. Twenty-four h after insecticide exposure, the dishes were brought to the laboratory and placed in a growth chamber and held for a 3 day moribund (knockdown) assessment and a 21 day mortality assessment. Mortality in untreated controls was generally less than 10%, with the exception of the 21 day counts of adults and eggs. Solvent-treated replications followed similar trends, except that additional mortality was observed in exposed larvae and pupae. In the insecticide-treated dishes, mortality of T. castaneum provisioned with flour generally showed a linear decrease with increasing flour deposits. Regardless of life stage, mortality did not exceed 60% when individuals were exposed in petri dishes containing 2 g of flour. Exposure location also made a significant difference in observed mortality. While mortality never exceeded 75% in dishes positioned under pallets, there was never less than 80% mortality in dishes exposed in the open. Although there was a perceptible increase in mortality with esfenvalerate compared to Pyrethrins, these differences were considerably less than the variation observed among flour deposits. The study suggests that sanitation and preparation prior to aerosol insecticide treatments were more important than choice of a particular insecticide. PMID:21268701

  14. Biochemical abnormalities induced by abamectin in sixth instar larvae of the red flour beetle, tribolium castaneum (herbst)

    International Nuclear Information System (INIS)

    The sub lethal effects of abamectin (Sure 1.8 EC) were studied on malathion-resistant (PAK) and organophosphate susceptible (FSS-II) strains of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) larvae in the laboratory. The objective was to examine changes in production or activities of carboxylesterase (CE), total esterases (TE), alpha-amylase, glucoamylase, alkaline phosphatase (AkP), acidic phosphatase (AcP), total protein, soluble protein and free amino acids (FAA). The sixth instar larvae of T. castaneum were released and exposed for 48h without food on abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Results showed differences in the activities of enzymes and quantities of total protein, soluble protein and FAA between strains and among concentrations. Abamectin, at LC and LC , changed the activities 10 20/levels of TE, CE, AcP, total protein and FAA in the larvae of both the strains. The activities of alpha-amylase, glucoamylase and AkP remained non-significant at both doses in the two strains. In PAK strain larvae, the TE activity was inhibited with depletion of total protein contents and elevation of FAA contents. In FSS-II larvae, the effect of abamectin on levels of alpha-amylase, glucoamylase, AkP, total protein and soluble protein remained non-significant. The activities of TE and AcP were reduced at both doses, while activities/levels of CE reduced at LC and FAA increased 10 at LC . It is concluded that abamectin affected the overall body 20 functioning of PAK strain more as compared to FSS-II strain considering disturbances caused in the levels/activities of biochemical components. (author)

  15. Efficacy of chlorfenapyr against Tribolium castaneum and Tribolium confusum (Coleoptera: Tenebrionidae) adults exposed on concrete, vinyl tile, and plywood surfaces

    Science.gov (United States)

    The insecticidal pyrrol chlorfenapyr was applied to concrete, tile, and wood surfaces, at an application rate of 0.11 mgAI/cm2. Adult Tribolium castaneum (Herbst), the red flour beetle, and adult T. confusum (DuVal), the confused flour beetle, were exposed for 2 and 4 hours, removed, and held witho...

  16. Essential Oil and its Insecticidal Activity of Medicinal Aromatic Plant Vetiveria zizanioides (L. Against the Red Flour Beetle Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    S. Sujatha

    2010-07-01

    Full Text Available Essential oil of Vetiver has versatile uses particularly as an inexpensive yet effective and eco-friendly tool to compact the essential role of biopesticides as well as insecticidal potentials. Insecticidal activity of the root extract of Vetiveria zizanioides (L. in Petroleum ether, Ethyl acetate, Acetone and methanol against XSM, SMC, SRS and JTC strains of the red flour beetle, Tribolium castaneum (Herbst was studied. The spongy root mass were dried, powdered and extracted by Steam distillation apparatus with the solvents below 60ºC. Experimental extracts were applied on larvae and adult beetles in film residue methods and mortality was recorded after 24 h. In larval bioassay the highest toxicity was recorded for petroleum ether extract (LD50 = 0.051 :g/cm2 in XSM strain and the low est toxicity has been observed in Methanol extract (LD50 =11.351:g/cm2 in SMC strain. In adults petroleum ether extract accessible highest toxicity (LD50 = 58.69 :g/cm2 in JTC 12 strain and the lowest toxicity (LD50 = 204.710 :g/cm2 also been observed for acetone extract in SRS strain. LD50, 95% confidence limits and regression equations are presented.

  17. Forward genetics in Tribolium castaneum: opening new avenues of research in arthropod biology

    OpenAIRE

    Peel, Andrew D

    2009-01-01

    A recent paper in BMC Biology reports the first large-scale insertional mutagenesis screen in a non-drosophilid insect, the red flour beetle Tribolium castaneum. This screen marks the beginning of a non-biased, 'forward genetics' approach to the study of genetic mechanisms operating in Tribolium. See research article http://biomedcentral.com/1741-7007/7/73

  18. Taxonomy Icon Data: red flour beetle [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available red flour beetle Tribolium castaneum Arthropoda Tribolium_castaneum_L.png Tribolium..._castaneum_NL.png Tribolium_castaneum_S.png Tribolium_castaneum_NS.png http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Triboliu...m+castaneum&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Tribolium+castaneum&t=N...L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Tribolium+castaneum&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Tribolium+castaneum&t=NS ...

  19. The negative effect of starvation and the positive effect of mild thermal stress on thermal tolerance of the red flour beetle, Tribolium castaneum

    Science.gov (United States)

    Scharf, Inon; Wexler, Yonatan; MacMillan, Heath Andrew; Presman, Shira; Simson, Eddie; Rosenstein, Shai

    2016-04-01

    The thermal tolerance of a terrestrial insect species can vary as a result of differences in population origin, developmental stage, age, and sex, as well as via phenotypic plasticity induced in response to changes in the abiotic environment. Here, we studied the effects of both starvation and mild cold and heat shocks on the thermal tolerance of the red flour beetle, Tribolium castaneum. Starvation led to impaired cold tolerance, measured as chill coma recovery time, and this effect, which was stronger in males than females, persisted for longer than 2 days but less than 7 days. Heat tolerance, measured as heat knockdown time, was not affected by starvation. Our results highlight the difficulty faced by insects when encountering multiple stressors simultaneously and indicate physiological trade-offs. Both mild cold and heat shocks led to improved heat tolerance in both sexes. It could be that both mild shocks lead to the expression of heat shock proteins, enhancing heat tolerance in the short run. Cold tolerance was not affected by previous mild cold shock, suggesting that such a cold shock, as a single event, causes little stress and hence elicits only weak physiological reaction. However, previous mild heat stress led to improved cold tolerance but only in males. Our results point to both hardening and cross-tolerance between cold and heat shocks.

  20. DIRS retroelements in arthropods: identification of the recently active TcDirs1 element in the red flour beetle Tribolium castaneum.

    Science.gov (United States)

    Goodwin, T J D; Poulter, R T M; Lorenzen, M D; Beeman, R W

    2004-08-01

    Members of the DIRS family of retrotransposons differ from most other known retrotransposons in that they encode a tyrosine recombinase (YR), a type of enzyme frequently involved in site-specific recombination. This enzyme is believed to insert the extrachromosomal DNA intermediate of DIRS element retrotransposition into the host genome. DIRS elements have been found in plants, a slime mold, fungi, and a variety of animals including vertebrates, echinoderms and nematodes. They have a somewhat patchy distribution, however, apparently being absent from a number of model organisms such as Saccharomyces cerevisiae, Arabidopsis thaliana and Drosophila melanogaster. In this report we describe the first DIRS retroelement to be identified in an arthropod. This element, TcDirs1, was found in the red flour beetle Tribolium castaneum (Coleoptera). It is generally similar in sequence and structure to several previously described members of the DIRS group: it is bordered by inverted terminal repeats and it has a similar set of protein-coding domains (Gag, reverse transcriptase/ribonuclease H, and the YR), although these are arranged in a novel fashion. TcDirs1 elements exhibit several features indicative of recent activity, such as intact coding regions, a high level of sequence similarity between distinct elements and polymorphic insertion sites. Given their presence in an experimentally tractable host, these potentially active elements might serve as useful models for the study of DIRS element retrotransposition. An element closely related to TcDirs1 was also detected in sequences from a second arthropod, the honey bee Apis mellifera (Hymenoptera), suggesting that these retrotransposons are long-term residents of arthropod genomes. PMID:15221458

  1. NSECTICIDAL TOXICITY OF 1,8-CINEOLE, CAMPHOR AND EUGENOL ON TRIBOLIUM CASTANEUM (HERBST)

    OpenAIRE

    Anita Liška

    2011-01-01

    Contact and fumigant activity of 1,8-cineole, camphor and eugenol compounds were tested In laboratory conditions on adult, larvae and pupae of the red flour beetle Tribolium castaneum (Herbst), as well as their effect on progeny emergence. Positive results were obtained with contact application for all three tested compounds and on all three stages of development of T. castaneum, with the highest activity of 1,8-cineole, followed by eugenol and camphor. In general, fumigant activity of all th...

  2. INSECTICIDAL TOXICITY OF 1,8-CINEOLE, CAMPHOR AND EUGENOL ON TRIBOLIUM CASTANEUM (HERBST)

    OpenAIRE

    Anita Liška

    2011-01-01

    Contact and fumigant activity of 1,8-cineole, camphor and eugenol compounds were tested In laboratory conditions on adult, larvae and pupae of the red flour beetle Tribolium castaneum (Herbst), as well as their effect on progeny emergence. Positive results were obtained with contact application for all three tested compounds and on all three stages of development of T. castaneum, with the highest activity of 1,8-cineole, followed by eugenol and camphor. Ingeneral, fumi...

  3. Microbiota Plays a Role in Oral Immune Priming in Tribolium castaneum

    OpenAIRE

    Futo, Momir; Armitage, Sophie A. O.; Kurtz, Joachim

    2016-01-01

    Animals are inhabited by a diverse community of microorganisms. The relevance of such microbiota is increasingly being recognized across a broad spectrum of species, ranging from sponges to primates, revealing various beneficial roles that microbes can play. The red flour beetle Tribolium castaneum represents a well-established experimental model organism for studying questions in ecology and evolution, however, the relevance of its microbial community is still largely unknown. T. castaneum l...

  4. Pesticidal Evaluation of Manilkara zapota (L. against Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    Muhammad Abu Osman

    2011-06-01

    Full Text Available This paper presents the residual eff ects of Manilkara zapota (L. P. Royen plant against the red flour beetle, Tribolium castaneum (Herbst. Four doses, i.e., 1238.5, 619.25, 309.6 and 154.8 μg/cm2 of ethyl acetate extract of stem bark of Manilkara zapota were applied on larvae and adult beetles. The effectiveness of the plant extract was increased with the increase of exposure time and after 72 hrs of exposure, the maximum residual toxicity was observed with LD50 of 228.8, 281.1, 413.4, 423.7, 455.2, 498.7 and 526.5 μg/cm2 for first, second, third, fourth, fifth, sixth instar larvae and adults, respectively. The results of this study also demonstrated that the earlier instars were more sensitive to the extracts than those of late instars as well as adults.

  5. Pesticidal Evaluation of Manilkara zapota (L. against Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    Muhammad Abu Osman

    2014-02-01

    Full Text Available This paper presents the residual eff ects of Manilkara zapota (L. P. Royen plant against the red flour beetle, Tribolium castaneum (Herbst. Four doses, i.e., 1238.5, 619.25, 309.6 and 154.8 μg/cm2 of ethyl acetate extract of stem bark of Manilkara zapota were applied on larvae and adult beetles. The effectiveness of the plant extract was increased with the increase of exposure time and after 72 hrs of exposure, the maximum residual toxicity was observed with LD50 of 228.8, 281.1, 413.4, 423.7, 455.2, 498.7 and 526.5 μg/cm2 for first, second, third, fourth, fifth, sixth instar larvae and adults, respectively. The results of this study also demonstrated that the earlier instars were more sensitive to the extracts than those of late instars as well as adults.

  6. Efficacy of aerosol applications of methoprene and synergized pyrethrin against Tribolium castaneum adults and eggs

    Science.gov (United States)

    Experiments were performed to determine the efficacy of a single aerosol application of the insecticides methoprene and piperonyl butoxide-synergized pyrethrin, alone or in combination, and the insecticide carrier, Isopar M, against Tribolium castaneum (Herbst), the red flour beetle. The initial tes...

  7. Expression patterns of cysteine peptidase genes across the Tribolium castaneum life cycle provide clues to biological function

    Science.gov (United States)

    The red flour beetle, Tribolium castaneum, is a major agricultural pest responsible for considerable loss of stored grain and cereal products worldwide. T. castaneum larvae have a highly compartmentalized gut, with cysteine peptidases mostly in the acidic anterior part of the midgut. We have descri...

  8. Biological effects of gamma radiation on stored product insects. 4 - radiation effects on sex pheromone production and perception by the rust-red flour beetle. Tribolium castaneum (herbst)

    OpenAIRE

    Abdu, R. M.; Abdel-Kader, Maissa M.; M. A. Hussein; Abdel-Rahman, H. A.

    1985-01-01

    Irradiation of the rust-red flour beetle, T. castaneum at different doses of gamma radiation considerably affected sex pheromone production by females and perception by males. The production of sex pheromone by virgin females decreased with the increase of radiation doses from 4 to 10 krad., and a dose of 12 krad could almost inhibit pheromone production. Males were more radiosensitive in their response to sex pheromone; and a radiation dose of 8 krad could brought inhibition of male respo...

  9. Gamma radiation effects on pupae of Tribolium castaneum (HERBST)

    International Nuclear Information System (INIS)

    The objective of the present paper was to determine the gamma radiation dose able to sterilize adults of the red flour beetle, Tribolium castaneum (Herbst, 1797) if irradiated in its pupal stage. After irradiation, with the doses of 25, 50, 75, 100, 125 and 150 Gy, at a dose rate of 1.24 kGy per hour, the insects were maintained under controlled environmental conditions, at temperatures between 23 deg and 27 deg C and relative humidity between 65 and 75 percent. It was observed that the sterilization of the adults was achieved with the irradiation of its pupae by the dose of 50 Gy, and the lethal dose to 85 percent of the population was 150 Gy with immediate kill. (author). 12 refs., 1 tab

  10. Differential preference of colored surface in Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    AMS Reza

    2006-07-01

    Full Text Available Insects show color preferences mostly to those which resembles the color of foliage, flower or even their hosts. In the present study observations were made to determine vision towards different colored surfaces in young (second instar, and advanced (fourth instar larvae, and adults of Tribolium castaneum (Herbst (Coleoptera: Tenebrionidae. The larva and adult beetles showed significant color preferences when given a choice between white (control and colored surfaces at 24- and 48-h exposures. The second instar larvae were more attracted by yellow and pink than green surfaces. The fourth instar larvae did not show any significant preference between white and colored surfaces at 24-h exposure, but avoided red and pink surfaces (P>0.05 and had a marginal choice for black (P<0.05. The adults avoided green significantly at both exposure times and pink at 48-h exposure, but was moderately attracted by black (P<0.05 at both exposure times.

  11. Gamma radiation effects of Cobalt-60 on eggs of Tribolium castaneum (Herbst., 1797) (Coleoptera: tenebrionidae)

    International Nuclear Information System (INIS)

    The objective of this research was to verify the effects of gamma radiation of a cobalt-60 source on eggs of the red flour beetle Tribolium castaneum (Herbst., 1797). The used dose rate was 1.28 kGy per hour, and the irradiated insects were kept under controlled environmental conditions: 25 ± 20 C and 70 ± 5% relative humidity. (author). 11 refs., 2 figs., 1 tab

  12. Antifeedant Diterpenoids against Tribolium castaneum from the Stems and Twigs of Ceriops tagal (Rhizophoraceae

    Directory of Open Access Journals (Sweden)

    Zhi Wei Deng

    2011-07-01

    Full Text Available The screening of several Chinese mangrove plants for insecticidal principles showed that ethanol extract of Ceriops tagal stems and twigs possessed significant feeding deterrent activity against the red flour beetle, Tribolium castaneum (Family: Rhizophoraceae. From the ethanol extract, three feeding deterrent diterpenoids were isolated by bioassay-guided fractionation. The compounds were identified as tagalsin A, B, and H on the basis of their phytochemical and spectral data. Tagalsin A, B, and H exhibited strong feeding deterrent activity against T. castaneum adults with EC50 values of 375.3 ppm, 277.3 ppm, and 285.45 ppm, respectively.

  13. Gene Families of Cuticular Proteins Analogous to Peritrophins (CPAPs) in Tribolium castaneum Have Diverse Functions

    OpenAIRE

    Jasrapuria, Sinu; Specht, Charles A.; Kramer, Karl J.; Beeman, Richard W.; Muthukrishnan, Subbaratnam

    2012-01-01

    The functional characterization of an entire class of 17 genes from the red flour beetle, Tribolium castaneum, which encode two families of Cuticular Proteins Analogous to Peritrophins (CPAPs) has been carried out. CPAP genes in T. castaneum are expressed exclusively in cuticle-forming tissues and have been classified into two families, CPAP1 and CPAP3, based on whether the proteins contain either one (CPAP1), or three copies (CPAP3) of the chitin-binding domain, ChtBD2, with its six characte...

  14. Insecticide Activity of Essential Oils of Mentha longifolia, Pulicaria gnaphalodes and Achillea wilhelmsii Against Two Stored Product Pests, the Flour Beetle, Tribolium castaneum, and the Cowpea Weevil, Callosobruchus maculatus

    Science.gov (United States)

    Khani, Abbas; Asghari, Javad

    2012-01-01

    Essential oils extracted from the foliage of Mentha longifolia (L.) (Lamiales: Lamiaceae) and Pulicaria gnaphalodes Ventenat (Asterales: Asteraceae), and flowers of Achillea wilhelmsii C. Koch (Asterales: Asteraceae) were tested in the laboratory for volatile toxicity against two storedproduct insects, the flour beetle, Tribolium castaneum Herbst (Coleoptera: Tenebrionidae) and the cowpea weevil, Callosobruchus maculatus F. (Coleoptera: Bruchidae). The chemical composition of the isolated oils was examined by gas chromatography-mass spectrometry. InM longifolia, the major compounds were piperitenon (43.9%), tripal (14.3%), oxathiane (9.3%), piperiton oxide (5.9%), and d-limonene (4.3%). In P. gnaphalodes, the major compounds were chrysanthenyl acetate (22.38%), 2L -4L-dihydroxy eicosane (18.5%), verbenol (16.59%), dehydroaromadendrene (12.54%), β-pinen (6.43%), and 1,8 cineol (5.6%). In A. wilhelmsii, the major compounds were 1,8 cineole (13.03%), caranol (8.26%), alpha pinene (6%), farnesyl acetate (6%), and p-cymene (6%). C maculatus was more susceptible to the tested plant products than T castaneum. The oils of the three plants displayed the same insecticidal activity against C. maculatus based on LC50 values (between 1.54µl/L air in P. gnaphalodes, and 2.65 µl/L air in A. wilhelmsii). While the oils of A. wilhelmsii and M. longifolia showed the same strong insecticidal activity against T. castaneum (LC50 = 10.02 and 13.05 µl/L air, respectively), the oil of P. gnaphalodes revealed poor activity against the insect (LC50 = 297.9 µl/L air). These results suggested that essential oils from the tested plants could be used as potential control agents for stored-product insects. PMID:23413994

  15. Properties and natural occurrence of maternal-effect selfish genes ('Medea' factors) in the red flour beetle, Tribolium castaneum

    International Nuclear Information System (INIS)

    Maternally acting selfish genes, termed 'Medea' factors, were found to be widespread in wild populations of Tribolium castaneum collected in Europe, North and South America, Africa and south-east Asia, but were rare or absent in populations from Australia and the Indian subcontinent. We detected at least four distinct genetic loci in at least two different linkage groups that exhibit the Medea pattern of differential mortality of genotypes within maternal families. Although each M factor tested had similar properties of maternal lethality to larvae and zygotic self-rescue, M factors representing distinct loci did not show cross-rescue. Alleles at two of these loci, M1 and M4, were by far the most prevalent, M4 being the predominant type. M2 and M3 were each found only once, in Pakistan and Japan, respectively. Although M1 could be genetically segregated from M4 and maintained as a purified stock, the M1 factor invariably co-occurred with M4 in field populations, whereas M4 usually occurred in the absence of other Medea factors. The dominant maternal lethal action of M1 could be selectively inactivated (reverted) by gene-knockout gamma irradiation with retention of zygotic rescue activity. (author)

  16. Food source provisioning and susceptibility of immature and adult Tribolium castaneum on concrete partially treated with chlorfenapyr (Phantom®)

    Science.gov (United States)

    A series of experiments were conducted in which adults, pupae, and 4-week-old larvae of Tribolium castaneum (Herbst), the red flour beetle, were exposed separately on concrete arenas partially treated (14.4 % of the total area) with the insecticide chlorfenapyr (Phantom®) at 1.1 g active ingredient/...

  17. Anatomical localization and stereoisomeric composition of Tribolium castaneum aggregation pheromones

    Science.gov (United States)

    Lu, Yujie; Beeman, Richard W.; Campbell, James F.; Park, Yoonseong; Aikins, Michael J.; Mori, Kenji; Akasaka, Kazuaki; Tamogami, Shigeyuki; Phillips, Thomas W.

    2011-09-01

    We report that the abdominal epidermis and associated tissues are the predominant sources of male-produced pheromones in the red flour beetle, Tribolium castaneum and, for the first time, describe the stereoisomeric composition of the natural blend of isomers of the aggregation pheromone 4,8-dimethyldecanal (DMD) in this important pest species. Quantitative analyses via gas chromatography-mass spectrometry showed that the average amount of DMD released daily by single feeding males of T. castaneum was 878 ± 72 ng (SE). Analysis of different body parts identified the abdominal epidermis as the major source of aggregation pheromone; the thorax was a minor source, while no DMD was detectable in the head. No internal organs or obvious male-specific glands were associated with pheromone deposition. Complete separation of all four stereoisomers of DMD was achieved following oxidation to the corresponding acid, derivatization with (1 R, 2 R)- and (1 S, 2 S)-2-(anthracene-2,3-dicarboximido)cyclohexanol to diastereomeric esters, and their separation on reversed-phase high-performance liquid chromatography at -54°C. Analysis of the hexane eluate from Porapak-Q-collected volatiles from feeding males revealed the presence of all four isomers (4 R,8 R)/(4 R,8 S)/(4 S,8 R)/(4 S,8 S) at a ratio of approximately 4:4:1:1. A walking orientation bioassay in a wind tunnel with various blends of the four synthetic isomers further indicated that the attractive potency of the reconstituted natural blend of 4:4:1:1 was equivalent to that of the natural pheromone and greater than that of the 1:1 blend of (4 R,8 R)/(4 R,8 S) used in commercial lures.

  18. Residual efficacy of aerosols to control Tribolium castaneum and Tribolium confusum

    OpenAIRE

    Arthur, F. H

    2010-01-01

    Aerosol insecticides can be important components of insect management plans for mills, food warehouses, and processing plants. In the United States, synergized pyrethrin is used alone or combined with an insect growth regulator (IGR), either methoprene or hydroprene. The presence of food material can result in increased survival of adult Tribolium castaneum (Herbst) or Tribolium confusum Jacquelin du Val exposed to synergized pyrethrins, but larvae appear to be more susceptible than adults. R...

  19. Effect of gamma irradiation on mortality of tribolium castaneum (HERBST)

    International Nuclear Information System (INIS)

    An investigation was made to assess the susceptibility of larvae and adults of Tribolium castaneum to gamma irradiation. The larvae were more susceptible to irradiation than the adults. A dose of 0.05 kGy killed all the larvae but higher dose of 0.15 kGy was required to kill all the adults. Therefore, a dose of 0.15 kGy was found to be the effective dose to kill both the larvae and the adults of T. castaneum. (author)

  20. Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum

    Institute of Scientific and Technical Information of China (English)

    Qibin Luo; Qing Zhou; Xiaomin Yu; Hongbin Lin; Songnian Hu; Jun Yu

    2008-01-01

    MicroRNAs (miRNAs) are endogenous 22-nt RNAs, which play important regulatory roles by post-transcriptional gene silencing. A computational strategy has been developed for the identification of conserved miRNAs based on features of known metazoan miRNAs in red flour beetle (Tribolium castaneum), which is regarded as one of the major laboratory models of arthropods. Among 118 putative miRNAs, 47% and 53% of the predicted miRNAs from the red flour beetle are harbored by known protein-coding genes (intronic) and genes located outside (intergenic miRNA), respectively. There are 31 intronic miRNAs in the same transcriptional orientation as the host genes, which may share RNA polymerase Ⅱ and spliceosomal machinery with their host genes for their biogenesis. A hypothetical feedback model has been proposed based on the analysis of the relationship between intronic miRNAs and their host genes in the development of red flour beetle.

  1. Toxicity of Boldo Peumus boldus Molina for Sitophilus zeamais Motschulsky and Tribolium castaneum Herbst Toxicidad del Boldo, Peumus boldus Molina, sobre Sitophilus zeamais Motschulsky y Tribolium castaneum Herbst

    Directory of Open Access Journals (Sweden)

    Margarita Ortiz U

    2012-09-01

    Full Text Available The maize weevil (Sitophilus zeamais Motschulsky and the red flour beetle (Tribolium castaneum Herbst are two key pests of stored-grain products worldwide. The insecticidal activity of boldo (Peumus boldus Molina powder, liquid ethanolic and hexanic extracts against S. zeamais and T. castaneum were evaluated under laboratory conditions. The evaluated variables were mortality, emergence of adult insects (F1, and grain weight loss. The experimental design was completely randomized. The mortality in S. zeamais was 100% even at the lowest powder concentration (0.5% w/w, whereas emergence of F1 adult insects was 0% and grain weight loss was El gorgojo del maíz (Sitophilus zeamais Motschulsky y el gorgojo castaño de la harina (Tribolium castaneum Herbst son plagas primarias de productos almacenados a nivel mundial. Se evaluó en laboratorio la actividad insecticida de polvo y extractos líquidos etanólicos y hexánicos del boldo (Peumus boldus Molina sobre S. zeamais y T. castaneum. Las variables evaluadas fueron mortalidad y emergencia de insectos adultos (F1 y pérdida de peso de los granos con un diseño experimental completamente al azar. La mortalidad en S. zeamais fue 100%, incluso con la concentración menor (0,5% p/p mientras que la emergencia de insectos adultos y la pérdida de peso de granos de maíz fue < 0,08%. Para T. castaneum sólo las concentraciones de 8 y 16% p/p de polvo causaron una mortalidad de 100%. Los extractos en agua, etanol, y hexano tuvieron un efecto insecticida de 100% en S. zeamais, mientras que en T. castaneum sólo el extracto en etanol alcanzó este valor. Por lo tanto, el polvo y los extractos evaluados de P. boldus presentan actividad insecticida contra S. zeamais y T. castaneum y son promisorios para utilizarse contra éstas y otras plagas de granos almacenados.

  2. Acute, Lethal and Synergistic Effects of Some Terpenes Against Tribolium castaneum Herbst (Coleoptera: Tenebrionidae

    Directory of Open Access Journals (Sweden)

    M. K. Chaubey

    2012-07-01

    Full Text Available Terpenes are found in abundance in all plant essential oils. In the present study two pure volatile compounds of terpene group, α-pinene and β-caryophyllene have been evaluated for their repellent, acute toxicity and developmental inhibitory activities alone and in binary combination against red flour beetle Tribolium castaneum. In repellency assay, α-pinene and β-caryophyllene repelled T. castaneum adults significantly even at 0.025% concentrations. Fumigation of larvae and adults of T. castaneum with these two compounds caused lethality in them. Median lethal concentrations (LC50 of α-pinene and β-caryophyllene against adults were 0.998 and 1.624 μl/cm3 and against larvae were 1.379 and 1.949 μl/cm3 respectively. In binary combination, the LC50 values against adults and larvae were found 1.277 and 1.438 μl/cm3 respectively. Fumigation with two sublethal concentrations viz. 40 and 80% of 24-h LC50 of these two compunds alone and in binary combination significantly reduced oviposition potential of adults and inhibited pupation and adult emergence in larvae. All the responses were found concentration-dependent. From the present study, it can be concluded that α-pinene is more active than β-caryophyllene and these two volatile compounds in binary combination shows synergism and thus, can used as efficient insecticidal tool against T. castaneum as fumigant either alone or in combination.

  3. Toxicities of azadirachtin and polychlorinated petroleum Hydrocarbon against resist and susceptible strains of tribolium castaneum (coleoptera: tenebrionidae) adults

    International Nuclear Information System (INIS)

    The LC/sub 50/ values for malathion-resistant (PAK) and organo-50 phosphate-susceptible (FSS-II) strains of red flour beetle, Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) adult beetles were determined through filter paper impregnated method against azadirachtin (Nimbokil 60 EC) and polychlorinated petroleum hydrocarbon (Tenekil 100 EC). The LC values of these insecticides were worked out as 12830 and 50 9331 ppm for azadirachtin and 5148 and 4047 ppm for Tenekil 100 EC against PAK and FSS-II strains, respectively. The results revealed that polychlorinated petroleum hydrocarbon was more toxic than the azadirachtin. Furthermore, both the insecticides were equally toxic to the adult beetles of T. castaneum as the difference was non-significant because of overlapping 95% FLs to LC./sub 50/. (author)

  4. UVB Radiation Delays Tribolium castaneum Metamorphosis by Influencing Ecdysteroid Metabolism

    Science.gov (United States)

    Sang, Wen; Yu, Lin; He, Li; Ma, Wei-Hua; Zhu, Zhi-Hui; Zhu, Fen; Wang, Xiao-Ping; Lei, Chao-Liang

    2016-01-01

    Ultraviolet B (UVB) radiation is an important environmental factor. It is generally known that UVB exhibits high genotoxicity due to causing DNA damage, potentially leading to skin carcinogenesis and aging in mammals. However, little is known about the effects of UVB on the development and metamorphosis of insects, which are the most abundant terrestrial animals. In the present study, we performed dose-response analyses of the effects UVB irradiation on Tribolium castaneum metamorphosis, assessed the function of the T. castaneum prothoracicotropic hormone gene (Trcptth), and analyzed ecdysteroid pathway gene expression profile and ecdysterone titers post-UVB irradiation. The results showed that UVB not only caused death of T. castaneum larvae, but also delayed larval-pupal metamorphosis and reduced the size and emergence rate of pupae. In addition, we verified the function of Trcptth, which is responsible for regulating metamorphosis. It was also found that the expression profiles of Trcptth as well as ecdysteroidogenesis and response genes were influenced by UVB radiation. Therefore, a disturbance pulse of ecdysteroid may be involved in delaying development under exposure to irradiation. To our knowledge, this is the first report indicating that UVB can influence the metamorphosis of insects. This study will contribute to a better understanding of the impact of UVB on signaling mechanisms in insect metamorphosis. PMID:26986217

  5. Microbiota plays a role in oral immune priming in Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Momir eFuto

    2016-01-01

    Full Text Available Animals are inhabited by a diverse community of microorganisms. The relevance of such microbiota is increasingly being recognised in a broad spectrum of species, ranging from sponges to primates, revealing various beneficial roles that microbes can play. The red flour beetle Tribolium castaneum represents a well-established experimental model organism for studying questions in ecology and evolution, however, the relevance of its microbial community is still largely unknown. T. castaneum larvae orally exposed to inactivated bacterial components of the entomopathogen Bacillus thuringiensis bv. tenebrionis showed increased survival upon a subsequent challenge with spores of this bacterium. To investigate whether T. castaneum microbiota plays a role in this phenomenon, we established a protocol for raising microbe-free larvae and subsequently tested whether they differ in their ability to mount such a priming response. Here we demonstrate that larvae with significantly lowered microbial loads, show decreased survival upon secondary challenge with B. thuringiensis bv. tenebrionis spores, compared to animals which were allowed to regain their microbiota before priming. Although the exact mechanism of oral immune priming is unclear, we here suggest that microbiota plays a crucial role in oral immune priming in this species.

  6. Evaluación de la acción insecticida de la rapanona sobre Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    Chavez Germán

    1992-11-01

    Full Text Available Experiments were carried out to detect and estimate the insect-killing effect of rapanone on the flour beetle  T.castaneum. Two kinds ofessays were made: by ingestion and by contacto It was proved that rapanone has insecticide activity on T. castaneum. Relatively high LD50 were determined, in comprarison
    with those of conventional commercial insecticides. An inverse proportionality, between doses of rapanone and the mean productivity, was also found; adose of 7000 mg rapanone per kg standard culture medium is enough to exterminate, almost completely, a population of T. castaneum in one generation.
    Se realizaron experimentos para detectar y cuantificar efectos insecticidas de la rapa nona sobre el escarabajo de la harina, Tribolium castaneum. Las pruebas fueron de dos clases: por ingestión y por contacto. Se comprobó que la rapanona tiene propiedades insecticidas sobre T. castaneum. Las toxicidades agudas, medidas en términos de DL50 fueron relativamente altas comparadas con insecticidas sintéticos comerciales. También se encontró una proporcionalidad inversa entre dosis de rapanona y productividad promedio; una dosis de 7000 mg de rapanona por kilo de alimento, es suficiente para exterminar casi del todo una poblaci6n de T.castaneum en una sola generación.

  7. A Tribolium castaneum whole-embryo culture protocol for studying the molecular mechanisms and morphogenetic movements involved in insect development.

    Science.gov (United States)

    Macaya, Constanza C; Saavedra, Patricio E; Cepeda, Rodrigo E; Nuñez, Viviana A; Sarrazin, Andres F

    2016-01-01

    The development of the red flour beetle Tribolium castaneum is more representative of arthropods than the evolutionarily derived fly, Drosophila melanogaster. Thus, Tribolium is becoming an emerging organism model for studying the evolution of the mechanisms that control embryonic development in arthropods. In this regard, diverse genetic and molecular tools are currently available for Tribolium, as well as imaging and embryonic techniques. Recently, we developed a method for culturing embryos in order to study specific stages during Tribolium development. In this report, we present a detailed and "easy-to-follow" protocol for embryo handling and dissection, extending the use of whole-embryo culture to functional analysis by performing in vivo pharmacological manipulations. This experimental accessibility allowed us to study the relevance of microtubules in axis elongation, using nocodazole and taxol drugs to interfere with microtubule networks, followed by length measurement analysis. Additionally, we demonstrated that embryo handling had no effect on the development of Tribolium embryos, and we checked viability after dissection and bisection and during incubation using propidium iodide. The embryo culture protocol we describe here can be applied to study diverse developmental processes in Tribolium. We expect that this protocol can be adapted and applied to other arthropods. PMID:26739999

  8. Efficacy of aerosol applications of methoprene and synergized pyrethrin against Tribolium castaneum adults and eggs.

    Science.gov (United States)

    Tucker, Angela M; Campbell, James F; Arthur, Frank H; Zhu, Kun Yan

    2014-06-01

    Experiments were performed to determine the efficacy of a single aerosol application of the insecticides methoprene and piperonyl butoxide-synergized pyrethrin, alone or in combination, and the insecticide carrier, Isopar M, against Tribolium castaneum (Herbst), the red flour beetle. The initial test exposed adults to insecticide treatments and placed male/female pairs in flour. All adults exposed to synergized pyrethrin were knocked down for at least 24 h after exposure but they recovered. High adult survival and similar average numbers of living F1 progeny were produced regardless of treatment exposure. In a separate test, insecticide treatments were directly applied to newly laid eggs, which resulted in the suppression of egg hatch. Synergized pyrethrin was the most effective insecticide (P < or = 0.001) for suppressing egg hatch. The effect of flour on insecticide activity to eggs and consequent insect development was also evaluated. An amount of 0.01 g of flour in the exposure arena, 62-cm2 area, was not sufficient for individuals to develop beyond the early larval stages, regardless of the treatment. As the flour amount in the arena increased from 1 to 5 g, the number of eggs that could develop to the adult stage increased, but this number was significantly lower in the insecticide treatments than in the control or carrier treatments. The results of the later tests indicate a high efficacy of the insecticides alone or in combination on T. castaneum egg hatch and development to the adult stage. PMID:25026694

  9. Structure of the Tribolium castaneum Telomerase Catalytic Subunit TERT

    Energy Technology Data Exchange (ETDEWEB)

    Gillis,A.; Schuller, A.; Skordalakes, E.

    2008-01-01

    A common hallmark of human cancers is the overexpression of telomerase, a ribonucleoprotein complex that is responsible for maintaining the length and integrity of chromosome ends. Telomere length deregulation and telomerase activation is an early, and perhaps necessary, step in cancer cell evolution. Here we present the high-resolution structure of the Tribolium castaneum catalytic subunit of telomerase, TERT. The protein consists of three highly conserved domains, organized into a ring-like structure that shares common features with retroviral reverse transcriptases, viral RNA polymerases and B-family DNA polymerases. Domain organization places motifs implicated in substrate binding and catalysis in the interior of the ring, which can accommodate seven to eight bases of double-stranded nucleic acid. Modelling of an RNA-DNA heteroduplex in the interior of this ring demonstrates a perfect fit between the protein and the nucleic acid substrate, and positions the 3'-end of the DNA primer at the active site of the enzyme, providing evidence for the formation of an active telomerase elongation complex.

  10. Effect of salt stressed wheat varieties on life history of tribolium castaneum (hebrst) (tenebrionidae: coleoptera)

    International Nuclear Information System (INIS)

    In the present investigation an attempt was made to determine the antibiosis of three salt stressed wheat varieties (Shafaq, Inqlab-91 and Sehar-2006) at three salinity levels (8, 12 and 16 dS m/sup -1/) to red flour beetle, Tribolium castaneum (Herbst). The grains of three varieties were ground and sieved through 80 mesh. Life history parameters, i.e., larval and pupal durations and survivals, adult emergence, fecundity and egg hatching was observed by introducing 10 pairs of pupae, from previously reared beetles, on three varieties at their respective salt levels. One control was included with grains of the plants, which were irrigated with distilled water only. Results have shown that varieties had significant difference among the treatments for larval duration, which was significantly extended in different varieties at various salt levels. Mean longest larval duration (31.67 days) was recorded in Shafaq as respectively 8 (33.00 days), 12 (33.33 days) and 16 (30.33 days) dS m/sup -1/ salt level as compared to its control (31.00 days). Fecundity and egg hatching of T. castaneum differed among the wheat varieties irrespective of salt levels. In another experiment, response of SARC-1, SARC-2, SARC-3, SARC-4, SARC-5, SARC-6, SARC-7, SARC-8, LU-26S, to life history parameters of T. castaneum showed that significant difference in the number of eggs, hatching percentage, larval and pupal survival was found. The number of eggs was significantly lower in variety SARC 1 (126.00) followed by SARC 2 (128.75), SARC 3 (132.25) while was significantly higher in SARC 5 (151.75). Egg hatching percentage was lower in SARC 6 (39.38%) and significantly higher in SARC 5 (58.42%). Larval survival was significantly less in SARC 7 (36.99%) and more in SAR (52.25%). Pupal survival was significantly lower in SARC 1 (20.54%) while higher in SARC 8 (42.11%). Based on results it may be stated that salt stressed wheat varieties have significant impact of the biology of T. castaneum. (author)

  11. Penetration of 14C-labelled methyl parathion in Tribolium castaneum (Herbst)

    International Nuclear Information System (INIS)

    Studies on the rate of penetration of radioactive methyl parathion (14C-ri ng labelled) were conducted under laboratory conditions, by applying 5 ng toxicant in 1μl acetone/insect on the thoracic sternum of rust red flour beetle, Tribolium castaneum (Herbst). Results revealed that the penetration of this toxicant was non-linear with two distinct phases. The earlier phase was faster and lasted upto 60 min from the time of application (half-life:14±3 min) followed by a slower phase from 60 min to 24 hr with longer half-life (909± 313 min). It was further observed that at the end of the faster phase i.e., 1 hr after treatment, nearly 68 per cent of the applied insecticide was absorbed by the beetle whereas the maximum quantity of the toxicant absorbed by the insect at the end of the experiment (24 hr after treatment) was 89 per cent. (author). 27 refs

  12. Age and sex related responsiveness of Tribolium castaneum (Coleoptera: Tenebrionidae) in novel behavioral bioassays

    Science.gov (United States)

    The hardiness and mobile nature of Tribolium castaneum (Herbst) make them easy to work with but are the same factors that make their responses to behavior modifying chemical stimuli difficult to evaluate. To overcome these difficulties we developed two bioassays: a two choice test with airflow and a...

  13. Tribolium castaneum defensins are primarily active against Gram-positive bacteria

    Czech Academy of Sciences Publication Activity Database

    Tonk, M.; Knorr, E.; Cabezas-Cruz, A.; Valdés, James J.; Kollewe, C.; Vilcinskas, A.

    2015-01-01

    Roč. 132, NOV 2015 (2015), s. 208-215. ISSN 0022-2011 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Antimicrobial peptides * Defensin * Innate immunity * Insects * Tribolium castaneum * Gram-positive bacteria Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.110, year: 2014

  14. LONG-TERM EFFICACY OF PROTEIN-ENRICHED PEA FLOUR AGAINST TRIBOLIUM CASTANEUM (COLEOPTERA: TENEBRIONIDAE IN WHEAT FLOUR

    Directory of Open Access Journals (Sweden)

    P Pretheep-Kumar

    2007-07-01

    Full Text Available Long-term efficacy of the protein-enriched flour of pea (Pisum sativum L. var. Bonneville in its toxicity, progeny reduction and organoleptic properties was evaluated by combining it with wheat flour and testing the admixture against the red flour beetle, Tribolium castaneum (Herbst. The toxicity and progeny-reducing effects of the wheat flour treated with protein-enriched pea flour were stable for a period of 5 months when stored at 28°C with 75% r.h. Heat treatment destroyed the biological activity of the protein-enriched pea flour containing the active ingredient due to the denaturation of proteins. The organoleptic properties of stored wheat flour were not affected by the treatment with protein-enriched pea flour.

  15. Translocation of bacteria from the gut to the eggs triggers maternal transgenerational immune priming in Tribolium castaneum.

    Science.gov (United States)

    Knorr, Eileen; Schmidtberg, Henrike; Arslan, Derya; Bingsohn, Linda; Vilcinskas, Andreas

    2015-12-01

    Invertebrates can be primed to enhance their protection against pathogens they have encountered before. This enhanced immunity can be passed maternally or paternally to the offspring and is known as transgenerational immune priming. We challenged larvae of the red flour beetle Tribolium castaneum by feeding them on diets supplemented with Escherichia coli, Micrococcus luteus or Pseudomonas entomophila, thus mimicking natural exposure to pathogens. The oral uptake of bacteria induced immunity-related genes in the offspring, but did not affect the methylation status of the egg DNA. However, we observed the translocation of bacteria or bacterial fragments from the gut to the developing eggs via the female reproductive system. Such translocating microbial elicitors are postulated to trigger bacterial strain-specific immune responses in the offspring and provide an alternative mechanistic explanation for maternal transgenerational immune priming in coleopteran insects. PMID:26701756

  16. Efeitos da radiação gama do Cobalto-60 em ovos de Tribolium castaneum (Herbst., 1797 (Coleoptera: Tenebrionidae Gamma radiation effects on eggs of Tribolium castaneum (Herbst., 1797 (Coleoptera: Tenebrionidae

    Directory of Open Access Journals (Sweden)

    L. S. Fontes

    1994-12-01

    Full Text Available Este trabalho teve por objetivo determinar as doses esterilizantes e letal para ovos de T. castaneum (Herbst., 1797 (Coleoptera: Tenebrionidae, através de doses crescentes de radiação gama. Utilizou-se uma fonte de Cobalto-60, tipo Gammabeam-650, com taxa de dose de 1,28 kGy/hora. O experimento foi conduzido sob condições controladas com temperatura de 25 ± 2°C e umidade relativa de 70 ± 5%. As doses letal e esterilizante para os ovos foram respectivamente 30 e 20 Gy.The objective of this research was to verify the effects of gamma radiation of a Cobalt-60 source on eggs of the red flour beetle Tribolium castaneum (Herbst., 1797. The used dose rate was 1.28 kGy per hour, and the irradiated insects were kept under controlled environment condition: 25 ± 2°C and 70 ± 5% relative humidity. For eggs the sterilizing and lethal dose were respectively, 20 and 30 Gy.

  17. EFFECTS OF ESSENTIAL OIL FORMULATIONS ON THE ADULT INSECT TRIBOLIUM CASTANEUM (HERBST) (COL., TENEBRIONIDAE)

    OpenAIRE

    Aleksandra Popovic; Jovana Sucur; Dejan Orcic; Pero Strbac

    2013-01-01

    Stored product pests such as Tribolium castaneum ( Herbst, 1979) are a major problem. Adult insects were obtained from laboratory cultures maintained in the dark in incubators at 25 1C and 70 80percent r.h., reared on wheat flour and fed with flour disks containing a known concentration of essential oil of 9 plants. The chemical components of essential oil of 3 plants, collected on the area of Montenegro, were also identified using GC-MS analysis. The results of insecticidal effect of essenti...

  18. Effect of five diatomaceous earth formulations against Tribolium castaneum (Coleoptera: Tenebrionidae),Oryzaephilus surinamensis (Coleoptera: Silvanidae) and Rhyzopertha dominica (Coleoptera: Bostrychidae)

    Institute of Scientific and Technical Information of China (English)

    MASUMEH ZIAEE; ADEL KHASHAVEH

    2007-01-01

    Laboratory bioassays were conducted to determine the effect of food source on the survival of Tribolium castaneum Herbst, Oryzaephilus surinamensis L. and Rhyzopertha dominica F., after exposure to five diatomaceous earth (DE) formulations: Protect-It(R),Insecto(R), Perma-GuardTM, Dryacide(R) and SilicoSec(R). Adults of these species were exposed to DEs at the rate of 0.5 mg/cm2 for 1 day on filter paper inside plastic Petri dishes. After exposure,the initial mortality was counted and live individuals of the three species were held for a week in glass vials containing 50 mg wheat flour, rice and whole wheat, respectively. In the second experiment, after 1 day exposure to DEs, beetles were transferred to Petri dishes without food and held for a week to determine if the presence of food source would decrease the mortality of beetles. Experiments were carried out at 27℃ and 55% RH in the dark. The initial morality in both of the experiments reached 100% for the three species exposed to Protect-It(R) and in the case orR. dominica and O. surinamensis exposed to Dryacide(R). In contrast, low level of mortality (< 10%) was observed for T. castaneum exposed to Perma-GuardTM and Insecto(R). The mortality after the post-treatment period on food was decreased for the three species exposed to Perma-GuardTM and in the case of T. castaneum and R. dominica exposed to Insecto(R) and SilicoSec(R). Adults of O. surinamensis were the most susceptible followed by R. dominica and 100% adult mortality was obtained, whereas T. castaneum were the least susceptible beetles to DEs. Protect-It(R) and Dryacide(R) were the most efficient DE formulations and can be used effectively in a stored grain integrated pest management program.

  19. Irradiation as an alternative treatment to methyl bromide for the disinfestation of tribolium castaneum in stored cacao

    International Nuclear Information System (INIS)

    Effects of irradiation on red flour beetle, Tribolium castaneum, eggs, larvae, pupae, and adults were examined. Data was taken on mortality, adult emergence, and sterility after irradiation at doses between 0.02 and 0.16 kGy. Mature eggs were more resistant to irradiation than young eggs; development to adults was prevented at a dose of 0.08 kGy for one to two day old eggs but was not stopped for the three to four day old eggs at doses as high as 0.16 kGy. Larvae were the most sensitive to irradiation. Young larvae appeared to be more resistant to irradiation than older larvae. Pupae were the most resistant to irradiation, and older pupae were more resistant than younger pupae. Development to adults was not prevented in both types of pupae up to 0.16 kGy. Survivors were not observed after four weeks for adults receiving a dose of 0.10 kGy or higher. Adults emerging from irradiated eggs, larvae, and pupae were sterile, in some cases, at slightly higher doses than those required to prevent adult emergence. Adults from irradiated eggs and larvae were sterile at 0.06 kGy. For pupae, sterility was achieved at 0.06 and 0.12 kGy for the one to two days and four to five days old pupae, respectively. Adult sterility was achieved at 0.12 kGy. As expected, when one member of a mating pair was left unirradiated, the dose requirements were higher. The effect of mating combination is still being analyzed. Data are still being collected and analyzed for Ephestia cautella, another major pest of stored cacao bean. Tests with T. castaneum and E. cautella must be completed before a dose can be recommended for commercial treatment. (author)

  20. MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum.

    Science.gov (United States)

    Ninova, Maria; Ronshaugen, Matthew; Griffiths-Jones, Sam

    2016-01-01

    MicroRNAs are well-established players in the development of multicellular animals. Most of our understanding of microRNA function in arthropod development comes from studies in Drosophila. Despite their advantages as model systems, the long germband embryogenesis of fruit flies is an evolutionary derived state restricted to several holometabolous insect lineages. MicroRNA evolution and expression across development in animals exhibiting the ancestral and more widespread short germband mode of embryogenesis has not been characterized. We sequenced small RNA libraries of oocytes and successive intervals covering the embryonic development of the short germband model organism, Tribolium castaneum. We analyzed the evolution and temporal expression of the microRNA complement and sequenced libraries of total RNA to investigate the relationships with microRNA target expression. We show microRNA maternal loading and sequence-specific 3' end nontemplate oligoadenylation of maternally deposited microRNAs that is conserved between Tribolium and Drosophila. We further uncover large clusters encoding multiple paralogs from several Tribolium-specific microRNA families expressed during a narrow interval of time immediately after the activation of zygotic transcription. These novel microRNAs, together with several early expressed conserved microRNAs, target a significant number of maternally deposited transcripts. Comparison with Drosophila shows that microRNA-mediated maternal transcript targeting is a conserved process in insects, but the number and sequences of microRNAs involved have diverged. The expression of fast-evolving and species-specific microRNAs in the early blastoderm of T. castaneum is consistent with previous findings in Drosophila and shows that the unique permissiveness for microRNA innovation at this stage is a conserved phenomenon. PMID:26518483

  1. Repellent Constituents of essential oil from Citrus wilsonii stem barks against Tribolium castaneum.

    Science.gov (United States)

    Wua, Yan; Chenb, Hai-Ping; Wei, Jian-Yu; Yang, Kai; Tian, Zhao-Fu; Li, Xiao-Lan; Wang, Ping-Juan; Wang, Cheng-Fang; Du, Shu-Shan; Cai, Qian

    2014-10-01

    The essential oil obtained from Citrus wilsonii Tanaka stem barks with hydrodistillation was investigated by GC-FID and GC-MS. The main components of the essential oil were identified to be nerol acetate (44.5%), nerol (13.6%), citronellyl propionate (13.5%) and α-terpineol (3.6%). Among them, the four active constituents, predicted with a bioactivity-test, were isolated and identified as nerolacetate, nerol, citronellyl propionate and α-terpineol. It was found that the essential oil of C. wilsonii stem barks possessed strong repellency (86% and 92%, respectively, at 78.6 nL/cm2, after 2 and 4 h treatment) against Tribolium castaneum adults. Repellency of the four active compounds was also determined. Nerolacetate, nerol, citronellyl propionate and α-terpineol were strongly repellent (100%, 100%, 90% and 96%, respectively, at 15.7 nL/cm2, after 2h treatment) against T. castaneum. Nerol exhibited the same level of repellency as the positive control, DEET. The results indicate that the essential oil of C. wilsonii stem barks and its active compounds have the potential to be developed as natural repellents for control of T. castaneum. PMID:25522550

  2. EFFECTS OF ESSENTIAL OIL FORMULATIONS ON THE ADULT INSECT TRIBOLIUM CASTANEUM (HERBST (COL., TENEBRIONIDAE

    Directory of Open Access Journals (Sweden)

    Aleksandra Popovic

    2013-06-01

    Full Text Available Stored product pests such as Tribolium castaneum ( Herbst, 1979 are a major problem. Adult insects were obtained from laboratory cultures maintained in the dark in incubators at 25 1C and 70 80percent r.h., reared on wheat flour and fed with flour disks containing a known concentration of essential oil of 9 plants. The chemical components of essential oil of 3 plants, collected on the area of Montenegro, were also identified using GC-MS analysis. The results of insecticidal effect of essential oils were discussed. Also, mortality rate of adult insects was tested. In this research, the essential oils of C. glandulosa which were rich in monoterpene alcohols carvacrol and contained ketonic component showed strong insecticidal and fumigant activity against adults of T. castaneum. Less toxic effect showed essential oils of Satureja montana which had a lower carvacrol and ketonic content. On the other hand, essential oils of Teucrium polium which did not contain ketonic component did not show any activity. Therefore, it was observed that essential oils of C. glandulosa with concentration of 1.14% showed powerful toxic and repellent effect, with very high mortality rate after 24h (56,67%.

  3. Repellent activity of essential oils and some of their individual constituents against Tribolium castaneum herbst.

    Science.gov (United States)

    Caballero-Gallardo, Karina; Olivero-Verbel, Jesús; Stashenko, Elena E

    2011-03-01

    A tool for integrated pest management is the use of essential oils (EOs) and plant extracts. In this study, EOs from Tagetes lucida , Lepechinia betonicifolia , Lippia alba , Cananga odorata , and Rosmarinus officinalis , species grown in Colombia, were analyzed by gas chromatography-mass spectrometry. These oils as well as several of their constituents were tested for repellent activity against Tribolium castaneum , using the area preference method. The main components (>10%) found in EOs were methylchavicol, limonene/α-pinene, carvone/limonene, benzyl acetate/linalool/benzyl benzoate, and α-pinene, for T. lucida, L. betonicifolia, L. alba, C. odorata, and R. officinalis, respectively. All EOs were repellent, followed a dose-response relationship, and had bioactivity similar to or better than that of commercial compound IR3535. EOs from C. odorata and L. alba were the most active. Compounds from EOs, such benzyl benzoate, β-myrcene, and carvone, showed good repellent properties. In short, EOs from plants cultivated in Colombia are sources of repellents against T. castaneum. PMID:21291237

  4. Ionizing radiation control of Tribolium castaneum in wheat flour type 000

    International Nuclear Information System (INIS)

    The insects, mainly those of the coleoptera order, produce serious changes on the grains and flours, producing in some regions up to 50 % loss. Taking in account the information available up to date, this experiment consists of putting under the effect of the ionizing radiation specimens of Tribolium castaneum feeded with bread flour type 000, with the purpose of controling their biological cycle. They received gamma radiation doses between 250 and 2000 Gy, using 60Co source. The daily observation made over a population of 590 insects, indicates the efficiency of the procedure, non toxic, which provokes the sterility at 250 Gy and inmediate dead starting at 1750 Gy. On the other hand, it was verified that the DL50 on the insects irradiated at the lower of eight different doses applied, reaches 15,3 days, against the 162,6 days of the reference Tribolium. Then it is concluded that it is technologically feasible the application of ionizing radiation to the bread wheat flour type 000 for controling this main plage. (Author)

  5. Chemical composition of four essential oils from Eupatorium spp: Biological activities toward Tribolium castaneum (Coleoptera: Tenebrionidae) Composición química de cuatro aceites esenciales provenientes de Eupatorium spp. y su toxicidad para Tribolium castaneum (Coleoptera: Tenebrionidae)

    OpenAIRE

    Hugo G. Lancelle; Oscar S. Giordano; Marta E. Sosa; CARLOS E TONN

    2009-01-01

    Toxic and repellent properties of whole essential oils from four Eupatorium (Asteraceae) species (E. buniifolium Hook. et Arn, E. inulaefolium Kunth, E. arnottii Baker, and E. viscidum Hook. & Arn) were investigated in different concentrations toward Tribolium castaneum Herbst adults. The essential oils were isolated by hydrodistillation techniques from the aerial parts. The analysis was performed by GC-FID and GC-MS methods. Contact toxicity assays showed that all the evaluated essential oil...

  6. Implications of the Tribolium genome project for pest biology

    Science.gov (United States)

    The universal availability of the complete Tribolium castaneum genome sequence assembly and annotation and concomitant development of the versatile Tribolium genome browser, BeetleBase (http://beetlebase.org/) open new realms of possibility for stored-product pest control by greatly simplifying the...

  7. Toxicity of several contact insecticides to Tribolium castaneum (Herbst) populations after selection with pirimiphos-methyl and deltamethrin

    OpenAIRE

    Andrić Goran; Pražić-Golić Marijana; Kljajić Petar

    2015-01-01

    Laboratory bioassays were conducted to detect possible alteration in susceptibility of two field Tribolium castaneum (Herbst) populations (sampled in a warehouse in Nikinci and a silo in Jakovo) to dichlorvos, malathion, chlorpyrifos-methyl, pirimiphos-methyl, deltamethrin and bifenthrin after previous selection with the LD80 of pirimiphos-methyl and deltamethrin. Data from the topical application bioassays show that chlorpyrifos-methyl was the most toxic i...

  8. Insecticidal activity of Ageratum conyzoides L., Coleus aromaticus Benth. and Hyptis suaveolens (L.) Poit essential oils as fumigant against storage grain insect Tribolium castaneum Herbst

    OpenAIRE

    Jaya; Singh, Priyanka; Prakash, Bhanu; Dubey, N.K.

    2012-01-01

    Essential oils (EOs) from Ageratum conyzoides L., Coleus aromaticus Benth. and Hyptis suaveolens (L.) Poit were extracted and tested against Tribolium castaneum Herbst, the storage grain insect. The EOs were found effective against Tribolium castaneum during in vitro as well as in vivo fumigant testing. The EOs of H. suaveolens and A. conyzoides showed 100 % mortality of test insect at 250 ppm while C. aromaticus at 350 ppm. During in vivo fumigant testing of wheat samples against Tribolium c...

  9. Identification and characterization of the Sudanese Bacillus thuringiensis and related bacterial strains for their efficacy against Helicoverpa armigera and Tribolium castaneum.

    Science.gov (United States)

    Gorashi, N E; Tripathi, M; Kalia, V; Gujar, G T

    2014-06-01

    Forty-four isolates of Bacillus thuringiensis like bacteria from various sources in different locations from Sudan were tested for their insecticidal activity. The toxicity of these isolates ranged from 6.6 to 70% to the neonates of cotton bollworm, Helicoverpa armigera at 10 ppm concentration. The most effective ones are Kb-29, St-6 and Wh-1 comparable with HD-1. Toxicity of isolates to larvae of the red flour beetle, Tribolium castaneum ranged from 20 to 100%. Isolates St-2 and St-23 gave 100% larval mortality within 15 days of exposure and were at par with Ab-8, Ab-12, Kb-26, Kb-30, Om-4, Po-2, Po-5, Po-7, Sa-8 and Wh-5 and were also comparable with E. coli clone expressing Cry3 toxin. The most effective five isolates viz., Kb-29, St-2, St-6, St-23 and Wh-1 belonged to B. thuringiensis. The St-6 isolate, which also showed high toxicity to T. castaneum larvae, had cry1 genes along with coleopteran active cry28 genes, but not cry3 genes. Of the 25 isolates characterized with 16s DNA sequencing, seven belonged to Paenibacillus spp., one Lysinibacillus sphaericus, one Bacillus pumilus, four Bacillus spp., and rest 12 belonged to B. thuringiensis. Biochemical characterization in each species showed variation. The present study shows potential of some isolates like Kb-29, St-2, St-6, St-23 and Wh-1 as promising bioinsecticides. PMID:24956895

  10. 七种糕点对赤拟谷盗(鞘翅目:拟步甲科)感染的抗性%Resistance of Seven Biscuit Types to Infestation by Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae)

    Institute of Scientific and Technical Information of China (English)

    Olusola O. ODEYEMI; Bernice M. OYEDARE; Michael O. ASHAMO

    2005-01-01

    Seven biscuit types namely, Okin, Digestive, Cabin, Peanut, Cream crackers, Hobnobs and Glucose and wheat flour were screened for their resistance to Tribolium castaneum (Herbst) at ambient temperature of 28±2 ℃ and 78±2% relative humidity in the laboratory. 50 g of each biscuit sample were infested with four female and two male adult beetles and left for 15 days then remove for a resistant experiment and 70 days for a mortality experiment. Each treatment and the control without beetles were replicated three times. Results showed that there was significant difference (P0.05) in the weight loss of biscuit types. The highest adult mortality of beetles (100%) was obtained from Peanut biscuits at 28 days after infestation while there was only 5.5% adult mortality in wheat flour at 70 days after infestation. The susceptibility index was 0 for all the biscuit types since there was no adult emergence indicating that they were resistant to T. castaneum infestation. Resistance in the biscuit types could be due to chemical additives (e.g. sodium chloride and sodium bicarbonate) used in the production of biscuits, which may have inhibitory effect on the development of T. castaneum and also the low moisture content of the biscuits. Packages that can easily be perforated or damaged to allow absorption of moisture from the environment should not be used in packing biscuits.

  11. Identification and evolution of two insulin receptor genes involved in Tribolium castaneum development and reproduction.

    Science.gov (United States)

    Sang, Ming; Li, Chengjun; Wu, Wei; Li, Bin

    2016-07-10

    The insulin and insulin-like signaling (IIS) pathway exists in a wide range of organisms from mammals to invertebrates and regulates several vital physiological functions. A phylogenetic analysis have indicated that insulin receptors have been duplicated at least twice among vertebrates, whereas only one duplication occurred in insects before the differentiation of Coleoptera, Hymenoptera, and Hemiptera. Thus, we cloned two putative insulin receptor genes, T.cas-ir1 and T.cas-ir2, from T. castaneum and determined that T.cas-ir1 is most strongly expressed during the late adult and early pupal stages, whereas T.cas-ir2 is most strongly expressed during the late larval stage. We found that larval RNAi against T.cas-ir1 and T.cas-ir2 causes 100% and 42.0% insect death, respectively, and that parental RNAi against T.cas-ir1 and T.cas-ir2 leads to 100% and 33.3% reductions in beetle fecundity, respectively. The hatching rate of ds-ir2 insects was 66.2%. Moreover, RNAi against these two genes increased the expression of the pkc, foxo, jnk, cdc42, ikk, and mekk genes but decreased erk gene expression. Despite these similarities, these two genes act via distinct regulatory pathways. These results indicate that these two receptors have functionally diverged with respect to the development and reproduction of T. castaneum, even though they retain some common regulatory signaling pathways. PMID:26923187

  12. Infection of Tribolium castaneum with Bacillus thuringiensis: quantification of bacterial replication within cadavers, transmission via cannibalism, and inhibition of spore germination.

    Science.gov (United States)

    Milutinović, Barbara; Höfling, Christina; Futo, Momir; Scharsack, Jörn P; Kurtz, Joachim

    2015-12-01

    Reproduction within a host and transmission to the next host are crucial for the virulence and fitness of pathogens. Nevertheless, basic knowledge about such parameters is often missing from the literature, even for well-studied bacteria, such as Bacillus thuringiensis, an endospore-forming insect pathogen, which infects its hosts via the oral route. To characterize bacterial replication success, we made use of an experimental oral infection system for the red flour beetle Tribolium castaneum and developed a flow cytometric assay for the quantification of both spore ingestion by the individual beetle larvae and the resulting spore load after bacterial replication and resporulation within cadavers. On average, spore numbers increased 460-fold, showing that Bacillus thuringiensis grows and replicates successfully in insect cadavers. By inoculating cadaver-derived spores and spores from bacterial stock cultures into nutrient medium, we next investigated outgrowth characteristics of vegetative cells and found that cadaver-derived bacteria showed reduced growth compared to bacteria from the stock cultures. Interestingly, this reduced growth was a consequence of inhibited spore germination, probably originating from the host and resulting in reduced host mortality in subsequent infections by cadaver-derived spores. Nevertheless, we further showed that Bacillus thuringiensis transmission was possible via larval cannibalism when no other food was offered. These results contribute to our understanding of the ecology of Bacillus thuringiensis as an insect pathogen. PMID:26386058

  13. Insecticidal properties of essential oils against Tribolium castaneum (Herbst) and their inhibitory effects on acetylcholinesterase and adenosine triphosphatases.

    Science.gov (United States)

    Abou-Taleb, Hamdy K; Mohamed, Magdy I E; Shawir, Mohamed S; Abdelgaleil, Samir A M

    2016-01-01

    Essential oils from 20 Egyptian plants were obtained by using hydrodistillation. The chemical composition of the isolated oils was identified by gas chromatograph/mass spectrometer. Fumigant and contact toxicities of the essential oils were evaluated against the adults of Tribolium castaneum. In fumigation assays, the oil of Origanum vulgare (LC50 = 9.97 mg/L air) displayed the highest toxicity towards the adults of T. castaneum. In contact assays, the oils of Artemisia monosperma (LC50 = 0.07 mg/cm(2)) and O. vulgare (LC50 = 0.07 mg/cm(2)) were the most potent toxicants against the adults of T. castaneum. Biochemical studies showed that the tested oils caused pronounced inhibition of acetylcholinesterase (AChE) and adenosine triphosphatases (ATPases) isolated from the larvae of T. castaneum. The oil Cupressus macrocarpa (IC50 = 12.3 mg/L) was the most potent inhibitor of AChE, while the oil of Calistemon viminals (IC50 = 4.4 mg/L) was the most potent inhibitor of ATPases. PMID:25978134

  14. Effect of combination of gamma radiation and essential oil from perovskia atriplicifolia on mortality of tribolium castaneum

    International Nuclear Information System (INIS)

    In an attempt to find a natural and inexpensive method to control the stored-product pests, the effect of combination of gamma radiation and essential oil from Perovskia atriplicifolia (Benth) on the adults of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) was investigated. Experiments were carried out at 27±ldegC and 65±5% R. H. under dark condition. Two experimental regimes were designed: 1) irradiation of fumigated adults 2)fumigation of irradiated adults. In combination experiments, mortality was assessed 14 days after the first treatment. The results showed significant synergistic effect of gamma radiation with essential oil on adults of T. castaneum (1-7 days old). Gamma irradiation at dosage 100 Gy, alone caused 12.5% mortality on T. castaneum but when these irradiated insects were treated by 7.66 μ1/1 air of P. atriplicifolia oil 7 days after irradiation, (caused 6.25% mortality alone) mortality percent reached 32.5%. These results provide the basis for successful use of gamma radiation in the presence of the essential oil for management of T. castaneum.

  15. Chemical constituents and biological activities against Tribolium castaneum (Herbst of the essential oil from Citrus wilsonii leaves

    Directory of Open Access Journals (Sweden)

    Chen Hai Ping

    2014-01-01

    Full Text Available The essential oil obtained from Citrus wilsonii Tanaka leaves with hydrodistillation was investigated by GC and GC-MS. The main components of the essential oil were identified to be citronellol (16.94%, nerol acetate (10.35%, γ-terpinen (9.85%, citronellal (9.36% and β-pinene (6.72%. Among them, the four active constituents, predicted with a bioactivity-test, were isolated and identified as citronellol, γ-terpinene, nerol (neryl acetate and β-pinene. It was found that the essential oil of C. wilsonii leaves and isolated compounds possessed fumigant and contact toxicity against Tribolium castaneum adults. The essential oil and γ-terpinen showed strong fumigant toxicity against T. castaneum (LC50 = 8.18 and 4.09 mg L-1. Repellency of the crude oil and active compounds was also determined. Citronellol, neryl acetate and β-pinene were strongly repellent (100%, 86% and 92%, respectively, at 78.63 nL cm-2, after 2 h treatment against T. castaneum. The essential oil and citronellol exhibited the same level of repellency compared with the positive control, DEET. The results indicate that the essential oil of C. wilsonii leaves and its active compounds had the potential to be developed as natural fumigants, insecticides and repellents for control of T. castaneum.

  16. Chemical composition of four essential oils from Eupatorium spp: Biological activities toward Tribolium castaneum (Coleoptera: Tenebrionidae Composición química de cuatro aceites esenciales provenientes de Eupatorium spp. y su toxicidad para Tribolium castaneum (Coleoptera: Tenebrionidae

    Directory of Open Access Journals (Sweden)

    Hugo G. Lancelle

    2009-12-01

    Full Text Available Toxic and repellent properties of whole essential oils from four Eupatorium (Asteraceae species (E. buniifolium Hook. et Arn, E. inulaefolium Kunth, E. arnottii Baker, and E. viscidum Hook. & Arn were investigated in different concentrations toward Tribolium castaneum Herbst adults. The essential oils were isolated by hydrodistillation techniques from the aerial parts. The analysis was performed by GC-FID and GC-MS methods. Contact toxicity assays showed that all the evaluated essential oils were toxic. Furthermore, in all the cases mortality was dose dependent. The main repellency was observed for the essential oil recovered from E. buniifolium.Se evaluaron las propiedades tóxicas y repelentes de los aceites esenciales de cuatro especies del género Eupatorium (Asteraceae: E. buniifolium Hook. et Arn, E. inulaefolium Kunth, E. arnottii Baker y E. viscidum Hook. & Arn, en diferentes concentraciones frente a adultos de Tribolium castaneum Herbst. Los aceites esenciales se aislaron de las partes aéreas de las plantas, mediante técnicas de hidrodestilación y se analizaron por los métodos GC-FID y GC-MS. Los ensayos de toxicidad por contacto demostraron que todos los aceites fueron tóxicos y la mortalidad fue, en todos los casos, dependiente de la dosis. El aceite esencial de E. buniifolium presentó la mayor actividad repelente.

  17. Lethal dose determination of Cobalt-60 for adult Tribolium castaneum (Coleoptera: Tenebrionidae) and Cryptolestes ferrugineus (Coleoptera: Laemophloeidae)

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Anderson Aparecido, E-mail: potenza@biologico.sp.gov.br [Instituto Biologico, Centro de Pesquisa e Desenvolvimento de Protecao Ambiental, Sao Paulo, SP (Brazil); Potenza, Marcos Roberto, E-mail: fcreis@usp.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Reis, Fabricio Caldeira; Sato, Mario Eidi, E-mail: mesato@biologico.sp.gov.br [Instituto Biologico, Centro Experimental Central, Laboratorio de Acarologia, Campinas, SP (Brazil)

    2015-07-01

    The insect infestation is a major problem in the grain storage. The pesticides are most widely used method for disinfestation and prevention. Treatment with gamma irradiation may increase the product shelf life without encountering formation of waste can be used in packaged foods and ready for commercialization, representing an important alternative to the use of pesticides. This study aimed to determine the immediate lethal dose of gamma radiation for adults of Tribolium castaneum and Cryptolestes ferrugineus. The study was conducted in the Instituto Biologico and the radiations held at the Instituto de Pesquisas Energeticas e Nucleares - IPEN/CNEN, Sao Paulo city, using a multipurpose irradiator Cobalt-60 with 3.31 dose rate and 3.23 kGy in months of November/2014 and January/2015. Each experimental unit consisted of 20 adult insects, confined in a 10 mL polyethylene container. The experimental plots in number 10 per dose were subjected to increasing doses of gamma radiation: 0; 0.5; 0.75; 1.0; 1.25; 1.50; 1.75; 2.00; 2:50 and 3.00 kGy. Mortality was assessed within two to four hours after irradiation. The data were submitted to Probit analysis, using the POLO PLUS program. The LD90 to control 90% (LD90) to control adult Cryptolestes ferrugineus and Tribolium castaneum were 2.73 and 2.91 kGy, respectively. (author)

  18. Lethal dose determination of Cobalt-60 for adult Tribolium castaneum (Coleoptera: Tenebrionidae) and Cryptolestes ferrugineus (Coleoptera: Laemophloeidae)

    International Nuclear Information System (INIS)

    The insect infestation is a major problem in the grain storage. The pesticides are most widely used method for disinfestation and prevention. Treatment with gamma irradiation may increase the product shelf life without encountering formation of waste can be used in packaged foods and ready for commercialization, representing an important alternative to the use of pesticides. This study aimed to determine the immediate lethal dose of gamma radiation for adults of Tribolium castaneum and Cryptolestes ferrugineus. The study was conducted in the Instituto Biologico and the radiations held at the Instituto de Pesquisas Energeticas e Nucleares - IPEN/CNEN, Sao Paulo city, using a multipurpose irradiator Cobalt-60 with 3.31 dose rate and 3.23 kGy in months of November/2014 and January/2015. Each experimental unit consisted of 20 adult insects, confined in a 10 mL polyethylene container. The experimental plots in number 10 per dose were subjected to increasing doses of gamma radiation: 0; 0.5; 0.75; 1.0; 1.25; 1.50; 1.75; 2.00; 2:50 and 3.00 kGy. Mortality was assessed within two to four hours after irradiation. The data were submitted to Probit analysis, using the POLO PLUS program. The LD90 to control 90% (LD90) to control adult Cryptolestes ferrugineus and Tribolium castaneum were 2.73 and 2.91 kGy, respectively. (author)

  19. The lethal giant larvae Gene in Tribolium castaneum: Molecular Properties and Roles in Larval and Pupal Development as Revealed by RNA Interference

    Directory of Open Access Journals (Sweden)

    Da Xiao

    2014-04-01

    Full Text Available We identified and characterized the TcLgl gene putatively encoding lethal giant larvae (Lgl protein from the red flour beetle (Tribolium castaneum. Analyses of developmental stage and tissue-specific expression patterns revealed that TcLgl was constitutively expressed. To examine the role of TcLgl in insect development, RNA interference was performed in early (1-day larvae, late (20-day larvae, and early (1-day pupae. The early larvae injected with double-stranded RNA of TcLgl (dsTcLgl at 100, 200, and 400 ng/larva failed to pupate, and 100% mortality was achieved within 20 days after the injection or before the pupation. The late larvae injected with dsTcLgl at these doses reduced the pupation rates to only 50.3%, 36.0%, and 18.2%, respectively. The un-pupated larvae gradually died after one week, and visually unaffected pupae failed to emerge into adults and died during the pupal stage. Similarly, when early pupae were injected with dsTcLgl at these doses, the normal eclosion rates were reduced to only 22.5%, 18.0%, and 11.2%, respectively, on day 7 after the injection, and all the adults with abnormal eclosion died in two days after the eclosion. These results indicate that TcLgl plays an essential role in insect development, especially during their metamorphosis.

  20. Toxicidade da combinação de dióxido de carbono e fosfina sob diferentes temperaturas para Tribolium castaneum Toxicity of the carbon dioxide and phosphine combination to Tribolium castaneum under different temperatures

    Directory of Open Access Journals (Sweden)

    Raimundo W. S. Aguiar

    2010-01-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito da temperatura sobre a toxicidade da combinação de dióxido de carbono e fosfina, para os estágios de desenvolvimento de Tribolium castaneum (Herbst (Coleoptera: Tenebrionidae. A toxicidade da combinação de 5% de dióxido de carbono e 1 g m-3 de fosfina para os estágios de ovo, larvas de 5, 10 e 15 dias, pupa e adulto de T. castaneum, foi estudada nas temperaturas de 25, 30, 35, 40 e 45 °C, por meio de estimativas dos tempos de exposição letais para 50 e 95% dos insetos (TL50 e TL95. Curvas tempo-resposta foram estabelecidas mediante bioensaios com períodos crescentes de exposição à combinação do dióxido de carbono com a fosfina. Observou-se que os TL50 e TL95 reduziram com a elevação da temperatura em todos os estágios de T. castaneum avaliados. O estágio de larva de cinco dias foi a mais susceptível à combinação de dióxido de carbono e fosfina. De acordo com os resultados, a combinação do dióxido de carbono com a fosfina é alternativa potencial para diminuir a quantidade de fosfina aplicada em produtos armazenados, por apresentar alta toxicidade para todos os estágios de T. castaneum sob diferentes temperaturas.The objective of this work was to assess the effect of temperature on the toxicity of the carbon dioxide-phosphine combination for the developmental stages of Tribolium castaneum (Herbst (Coleoptera: Tenebrionidae. The toxicity of combination of 5% carbon dioxide and 1 g m-3 phosphine in the developmental stages of egg, larvae of 5, 10 and 15 days, pupae and adult of T. castaneum was studied under the temperatures of 25, 30, 35, 40 and 45 °C, through the estimation of lethal insect exposure times of 50 and 95% (LT50 and LT95. For that, time-response curves were established through bioassays with increasing periods of exposure to the combination of carbon dioxide and phosphine. A reduction of LT50 and LT95 was observed with temperature increase in all

  1. Residual efficacy of methoprene for control of Tribolium castaneum (Coleoptera: Tenebrionidae) larvae at different temperatures on varnished wood, concrete, and wheat

    Science.gov (United States)

    The residual efficacy of the juvenile hormone analogue, methoprene (Diacon II), was evaluated in bioassays using larvae of Tribolium castaneum (Herbst) exposed on varnished wood or unsealed concrete treated with a liquid formulation and held at different temperatures. When these surfaces were stored...

  2. Combination of gamma radiation and essential oils from medicinal plants in managing Tribolium castaneum contamination of stored products

    International Nuclear Information System (INIS)

    Effectiveness of management of insect infestation of stored products with essential oils as viable alternatives to synthetic insecticides can be enhanced with gamma radiation. We studied effects of sublethal doses of essential oils from Rosmarinus officinalis (L.) and Perovskia atriplicifolia (Benth) (safe natural insecticides) in combination with gamma radiation on mortality of adults of Tribolium castaneum (Herbst). The insects were subjected to two radiation doses and two concentrations of the essential oils in the air. This combined treatment increased the mortality, which was also 3–6 times higher than could be expected from the sum of the effects of each of the treatments. The synergistic effect was more pronounced in the case of R. officinalis (L.) than in the case of P. atriplicifolia (Benth). The experiments have shown that the known insecticidal effectiveness of the essential oils can be enhanced by preliminary irradiation. Possible approaches to implementation of the combined treatment are discussed. - Highlights: • The mortality of T. castaneum increased with an increase of the radiation dose. • R. officinalis was more toxic to T. castaneum than P. atriplicifolia. • Gamma radiation and essential oils could be used as combined methods in IPM. • Combination of radiation with essential oils made a synergistic effect. • The synergistic effect of the R–G was much more appropriate from P–G

  3. Influência da temperatura da massa de grãos sobre a toxicidade do ozônio a Tribolium castaneum Influence of the grain temperature on the ozone toxicity to Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Alexandre de M. Pereira

    2008-10-01

    Full Text Available Considerando que a temperatura da massa de grãos pode influenciar o período de exposição dos fumigantes, desenvolveu-se este trabalho com o propósito de investigar a influência de temperaturas crescentes da massa de grãos (20, 30, 35 e 40 ºC no período de exposição do ozônio necessário para matar 50 e 95% de insetos adultos de Tribolium castaneum Herbst (Coleoptera: Tenebrionidae. Grãos de milho foram distribuídos em recipientes cilíndricos de PVC com conexões para injeção e exaustão de gás. Os insetos contidos em gaiolas foram colocados na camada mediana da massa de grãos em cada recipiente e estes, por sua vez foram fumigados com ozônio na concentração de 50 ppm. Os tempos letais (TL50 e TL95 para os insetos adultos de T. castaneum foram reduzidos com o aumento da temperatura da massa de grãos, de 20 para 30 ºC, porém a 35 ºC os tempos letais não foram reduzidos em relação às temperaturas menores, mas a 40 ºC os tempos letais foram reduzidos novamente, resultando no menor TL95.Considering that the grain temperature may influence the exposure time of the fumigants, the present study was carried out to investigate the influence of increasing temperatures of the grain mass (20, 30, 35 and 40 ºC on the exposure time to ozone required to kill 50 and 95% of adult insects of Tribolium castaneum (Herbst (Coleoptera: Tenebrionidae. Maize grains were distributed in cylindrical polyvinyl chloride recipients having connections for gas injection and exhaustion. The insects held in cages were placed at the median height of the grain mass in each recipient, which was then fumigated with ozone at the concentration of 50 ppm. The lethal times (LT50 and LT95 for adult insects of T. castaneum were reduced by increasing grain temperature, from 20 to 30 ºC; however, at 35 ºC the lethal times were not reduced compared with lower temperatures; but at 40 ºC the exposure time decreased again, resulting in lower LT95.

  4. Comparative toxicity and micronuclei formation in Tribolium castaneum, Callosobruchus maculatus and Sitophilus oryzae exposed to high doses of gamma radiation

    International Nuclear Information System (INIS)

    The effects of gamma radiation on mortality and micronucleus formation in Tribolium castaneum Herbst, Callosobruchus maculatus (F.) and Sitophilus oryzae (L.) genital cells were evaluated. Two groups of healthy and active adult insects 1–3 and 8–10 days old were irradiated with various doses (50–200 Gy) gamma ray. Seven days post-irradiation; mortality rates and micronucleus formation were assessed in genital cells of the irradiated insects. The results show that with increasing gamma doses, the mortality rate of each species increased and T. castaneum and S. oryzae showed the low and high sensitivity respectively. It was shown that the micronucleus appearance in the tested insects had correlation with amount and intensity of radiation doses. Moreover our results indicate different levels in the genotoxicity of gamma radiation among the insects' genital cells under study. The frequency of micronuclei in genital cells of 1–3 days old insects exposed to 50 and 200 Gy were 12.6 and 38.8 Mn/1000 cells in T. castaneum, 20.8 and 46.8 Mn/1000 cells in C. maculatus and 16.8 and 57.2 Mn/1000 cells in S. oryzae respectively. A high sensitivity of the genital cells to irradiation exposure was seen in S. oryzae correlated with its high mortality rate compared with the other two species. These results might be indicative of inflicting chromosomal damage expressed as micronucleus in high mortality rates observed in the pest population; an indication of genotoxic effects of radiation on the studied species. - Highlights: • C. maculatus was more susceptible than that of the T. castaneum to irradiation. • S. oryzae was more susceptible to irradiation than of those other two species. • The incidence of Mn is correlated to the loss of chromosome segments. • Gamma radiation has the ability to create micronuclei in insects. • Mn induced in the genital cells of adult increased with increasing radiation doses

  5. Combination of gamma radiation and essential oils from medicinal plants in managing Tribolium castaneum contamination of stored products.

    Science.gov (United States)

    Ahmadi, Mehrdad; Abd-alla, Adly Mohamed M; Moharramipour, Saeid

    2013-08-01

    Effectiveness of management of insect infestation of stored products with essential oils as viable alternatives to synthetic insecticides can be enhanced with gamma radiation. We studied effects of sublethal doses of essential oils from Rosmarinus officinalis (L.) and Perovskia atriplicifolia (Benth) (safe natural insecticides) in combination with gamma radiation on mortality of adults of Tribolium castaneum (Herbst). The insects were subjected to two radiation doses and two concentrations of the essential oils in the air. This combined treatment increased the mortality, which was also 3-6 times higher than could be expected from the sum of the effects of each of the treatments. The synergistic effect was more pronounced in the case of R. officinalis (L.) than in the case of P. atriplicifolia (Benth). The experiments have shown that the known insecticidal effectiveness of the essential oils can be enhanced by preliminary irradiation. Possible approaches to implementation of the combined treatment are discussed. PMID:23632647

  6. RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum

    Science.gov (United States)

    Abd El Halim, Hesham M.; Alshukri, Baida M. H.; Ahmad, Munawar S.; Nakasu, Erich Y. T.; Awwad, Mohammed H.; Salama, Elham M.; Gatehouse, Angharad M. R.; Edwards, Martin G.

    2016-01-01

    The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p insect control. PMID:27411529

  7. Toxicity of several contact insecticides to Tribolium castaneum (Herbst populations after selection with pirimiphos-methyl and deltamethrin

    Directory of Open Access Journals (Sweden)

    Goran Andrić

    2015-12-01

    Full Text Available Laboratory bioassays were conducted to detect possible alteration in susceptibility of two field Tribolium castaneum (Herbst populations (sampled in a warehouse in Nikinci and a silo in Jakovo to dichlorvos, malathion, chlorpyrifos-methyl, pirimiphos-methyl, deltamethrin and bifenthrin after previous selection with the LD80 of pirimiphos-methyl and deltamethrin. Data from the topical application bioassays show that chlorpyrifos-methyl was the most toxic insecticide to T. castaneum adults of the Nikinci population selected with pirimiphosmethyl and deltamethrin, while malathion was the weakest, and both selection procedures changed/reduced significantly only the toxicity of deltamethrin and bifenthrin, increasing their resistance ratios (RR at the LD50 from 1.1 to 1.8 (bifenthrin and from 0.9 to 2.2 (deltamethrin. Deltamethrin was the most toxic insecticide for Jakovo adults selected with the LD80 of pirimiphosmethyl, while malathion was again the least toxic. Selection of that population had no effect on insecticide toxicity, except of malathion, which had a rise in RR at the LD50 from 26.0 to 29.8.

  8. Comparative toxicity and micronuclei formation in Tribolium castaneum, Callosobruchus maculatus and Sitophilus oryzae exposed to high doses of gamma radiation.

    Science.gov (United States)

    Ahmadi, Mehrdad; Mozdarani, Hossein; Abd-Alla, Adly M M

    2015-07-01

    The effects of gamma radiation on mortality and micronucleus formation in Tribolium castaneum Herbst, Callosobruchus maculatus (F.) and Sitophilus oryzae (L.) genital cells were evaluated. Two groups of healthy and active adult insects 1-3 and 8-10 days old were irradiated with various doses (50-200 Gy) gamma ray. Seven days post-irradiation; mortality rates and micronucleus formation were assessed in genital cells of the irradiated insects. The results show that with increasing gamma doses, the mortality rate of each species increased and T. castaneum and S. oryzae showed the low and high sensitivity respectively. It was shown that the micronucleus appearance in the tested insects had correlation with amount and intensity of radiation doses. Moreover our results indicate different levels in the genotoxicity of gamma radiation among the insects' genital cells under study. The frequency of micronuclei in genital cells of 1-3 days old insects exposed to 50 and 200 Gy were 12.6 and 38.8 Mn/1000 cells in T. castaneum, 20.8 and 46.8 Mn/1000 cells in C. maculatus and 16.8 and 57.2 Mn/1000 cells in S. oryzae respectively. A high sensitivity of the genital cells to irradiation exposure was seen in S. oryzae correlated with its high mortality rate compared with the other two species. These results might be indicative of inflicting chromosomal damage expressed as micronucleus in high mortality rates observed in the pest population; an indication of genotoxic effects of radiation on the studied species. PMID:25898238

  9. Comparative genomic analysis of the Tribolium immune system

    Science.gov (United States)

    The red flour beetle Tribolium castaneum has contributed a wealth of knowledge on insect development but limited information about innate immunity. With its complete nucleotide sequence determined, we have taken the opportunity to annotate immunity-related genes and compare them with homologous mole...

  10. Effect of Gamma Radiation on Nutritional Indices of Larval and Adults Stages of Tribolium castaneum (Coleoptera: Tenebrionidae)

    International Nuclear Information System (INIS)

    In this study antifeedant effect of different doses of gamma radiation as a controlling safe method on flour weevil, Tribolium castaneum (Herbst) larvae and adult was studied. Doses of 100, 400, 600, 800 and 1000 Gy of gamma radiation were used and after 72 hours, nutritional indices were evaluated. The relative growth rate, relative consumption rate, efficiency of conversion of ingested food and feeding deterrence index as nutritional indices were evaluated. Treatments were assessed by flour wheat disc at 27±1degreeC and 65percenthumidity in a dark condition. The results showed that the relative growth rate of flour weevil larvae and adults decreased significantly (P<0.05) by gamma radiation and the severity of this reduction in larvae was higher than the adults. Although the relative growth rates decreased in adults, this rate in doses of 400, 600, 800 and 1000 Gy showed no significant difference. The relative food consumption rate also decreased with the gamma radiation and its value found to be inversely proportional to the dose radiation. Our experiments showed that the use of gamma radiation exposure to 800 Gy had no significant effect on the efficiency of conversion of ingested food of larvae and reduction was observed only when the gamma radiation was used in 1000 Gy. The feeding deterrence effect of gamma radiation, especially on the larvae was high but no significant difference between doses of 100 to 800 Gy was observed. The results showed that gamma radiation that induces antifeedant effect can be applied as an effective method in control of T. castaneum.

  11. Effectiveness of gamma radiation for the control of tribolium castaneum, the pest of stored cashew kernels

    International Nuclear Information System (INIS)

    Effect of gamma radiation on T. castaneum irradiated during adult stage revealed that survival of adults was found to decrease with increase in radiation dose. Gamma radiations are used to produce mortality or sterility in the insects. The technique can be used by irradiating the insects at doses sufficiently high to produce the desired effects. The present study observed the gamma-ray effect on this insect, and the results may be useful for commercial applications. Overall the results showed highly significant effect of irradiation on insects administered with different doses

  12. Experimental removal of sexual selection leads to decreased investment in an immune component in female Tribolium castaneum.

    Science.gov (United States)

    Hangartner, Sandra; Michalczyk, Łukasz; Gage, Matthew J G; Martin, Oliver Y

    2015-07-01

    Because of divergent selection acting on males and females arising from different life-history strategies, polyandry can be expected to promote sexual dimorphism of investment into immune function. In previous work we have established the existence of such divergence within populations where males and females are exposed to varying degrees of polyandry. We here test whether the removal of sexual selection via enforced monogamy generates males and females that have similar levels of investment in immune function. To test this prediction experimentally, we measured differences between the sexes in a key immune measurement (phenoloxidase (PO) activity) and resistance to the microsporidian Paranosema whitei in Tribolium castaneum lines that evolved under monogamous (sexual selection absent) vs polyandrous (sexual selection present) mating systems. At generation 49, all selected lines were simultaneously assessed for PO activity and resistance to their natural parasite P. whitei after two generations of relaxed selection. We found that the polyandrous regime was associated with a clear dimorphism in immune function: females had significantly higher PO activities than males in these lines. In contrast, there was no such difference between the sexes in the lines evolving under the monogamous regime. Survival in the infection experiment did not differ between mating systems or sexes. Removing sexual selection via enforced monogamy thus seems to erase intersexual differences in immunity investment. We suggest that higher PO activities in females that have evolved under sexual selection might be driven by the increased risk of infections and/or injuries associated with exposure to multiple males. PMID:25958137

  13. Effects of weightlessness, gravity compensation and radiation on the flour beetle, Tribolium confusum

    International Nuclear Information System (INIS)

    Tribolium confusum, the flour beetle; was chosen as a test organism for determination of possible synergistic effects of radiation and space environment in the inertial flight of Biosatellite-II. The organism subjected to weightlessness and radiation during the flight exhibited greater than expected wing abnormalities. However, a postflight vibration control experiment produced anomalous results, and some doubt remained with respect to assigning weightlessness as the sole cause of the increased wing abnormalities. Results are reported from experiments performed on the interaction of gravity compensation, radiation, and Tribolium development. It was found that gravity compensation together with heavy ion irradiation did not cause more wing abnormalities than those caused by radiation alone. However, radiation and gravity compensation plus high temperature did cause an increased percentage of wing abnormalities. Two possible reasons are discussed

  14. Functional analysis of the ATP-binding cassette (ABC transporter gene family of Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Broehan Gunnar

    2013-01-01

    Full Text Available Abstract Background The ATP-binding cassette (ABC transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H. This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  15. The complete mitochondrial genome of the confused flour beetle Tribolium confusum (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Ou, Jing; Yao, Fu-Jiao; Li, Ya-Xiao; Yang, Yan; Jin, Cheng; Wei, Zhao-Ming

    2016-09-01

    Flour beetles of the genus Tribolium are economically important as destructive cosmopolitan pests of stored flour, corn, peanuts, and other dried agricultural products. The confused flour beetle Tribolium confusum Jacquelin du Val (1868) is one of the most important pest species of flour beetle. Here we sequenced and characterized the complete mitochondrial genome of T. confusum, the entire sequence is 15,813 bp in size with 72.8% AT content. It consists of 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA), 2 ribosomal RNA (rRNA) genes and one major non-coding AT-rich region. The mitogenome of T. confusum exhibits a gene arrangement and content identical to the most common type in insects. All PCGs are start with a typical ATN initiation codon, except for the cox1, which use AAC as its start codon instead of ATN. Ten genes use standard complete termination codon (six TAA, three TAG), whereas the cox2, cox3, nad4 and nad5 genes end with single T. Except for trnS1 ((AGN)), all tRNA genes display typical secondary cloverleaf structures as those of other insects. The sizes of the large and small ribosomal RNA genes are 1277 and 773 bp, respectively. The AT content of the AT-rich region is 79.5%. The 5 bp conserved motif TACTA was found in the intergenic region between trnS2 ((UCN)) and nad1. PMID:25693711

  16. Progeny production by Tribolium castaneum (Coleoptera: Tenebrionidae) and Oryzaephilus surinamensis (Coleoptera: Silvanidae) on maize previously infested by Sitotroga cerealella (Lepidoptera: Gelechiidae).

    Science.gov (United States)

    Weston, P A; Rattlingourd, P L

    2000-04-01

    A laboratory experiment was conducted to quantify the effects of infestation of maize by Sitotroga cerealella (Olivier) on progeny production by two common secondary colonizers of grain, Tribolium castaneum (Herbst) and Oryzaephilus surinamensis (L.). Adults of both secondary pest species were allowed to oviposit for 3 wk on intact kernels of 'DeKalb 689', mechanically split kernels, kernels that had been infested for 3 mo by S. cerealella, and kernels that had been infested for 6 mo. Progeny of both species reached highest numbers on 6-mo infested maize. Prior infestation for 6 mo by S. cerealella makes maize a more suitable medium for reproduction by T. castaneum and O. surinamensis, much more than can be accounted for by mere disruption of kernel integrity resulting from larval feeding. The results highlight the importance of limiting establishment by S. cerealella on maize in storage. PMID:10826210

  17. Actividad insecticida del aceite esencial de Lippia alba (Mill.) N. E. Brown sobre Tribolium castaneum Herbst. en granos de trigo (Triticum aestivum L.)

    OpenAIRE

    Ringuelet, Jorge Abel; Ocampo, Rafael; Henning, Cynthia; Padín, Susana; Urrutia, María Inés; Dal Bello, Gustavo

    2014-01-01

    Tribolium castaneum (Coleoptera: Tenebrionidae) es un insecto plaga de granos, muy destructivo en la etapa de almacenamiento y altamente resistente a los fitosanitarios sintéticos. Por esta razón su control químico se realiza con altas concentraciones de insecticidas que aumentan la contaminación ambiental y los peligros para la salud humana. Las tendências actuales en el manejo integrado de plagas se orientan hacia el uso de plaguicidas biológicos o biopesticidas como los extractos vegetales...

  18. Effect of gamma irradiation on the insect development and esterase activity in the confused flour beetle, tribolium confusum (Duval.)

    International Nuclear Information System (INIS)

    Three day-old adults of the confused flour beetle, tribolium confusum were irradiated with gamma doses (10-40 Gray) to investigate the effects of irradiation on the F1 development and on the activity of esterase enzyme in F1 adult males and females. The total numbers of the F1 larvae, pupae and adults were decreased with increasing the irradiation dose. Esterase pattern of the adults was affected by the higher doses of irradiation. The mutagenic effect of these doses is represented by the disappearance of the electrophoretic patterns of some beetles.4 Figs., 1 Tab

  19. Juvenile hormone resistance gene Methoprene-tolerant controls entry into metamorphosis in the beetle Tribolium castaneum

    Czech Academy of Sciences Publication Activity Database

    Konopová, Barbora; Jindra, Marek

    2007-01-01

    Roč. 104, - (2007), s. 10488-10493. ISSN 0027-8424 R&D Projects: GA AV ČR IAA5007305; GA MŠk LC07032 Institutional research plan: CEZ:AV0Z50070508 Keywords : insect metamorphosis * postembryonic development * endocryne regulation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.598, year: 2007

  20. The Red Flour Beetle, Tribolium castaneum (Coleoptera): A Model for Studies of Development and Pest Biology

    Czech Academy of Sciences Publication Activity Database

    Brown, S. J.; Shippy, T. D.; Miller, S.; Bolognesi, R.; Beemam, R. W.; Lorenzen, M. D.; Bucher, G.; Wimmer, E. A.; Klingler, M.; Posnien, N.; Schinko, J.; Grossmann, D.; Konopová, Barbora; Coleman, C. M.; Tomoyasu, Y.; Kittelmann, S.; Koniszewski, N.; Berghammer, A. J.; Weber, M.; Trauner, J.

    Vol. 2. Plainview: Cold Spring Harbor Laboratory Press, 2010, s. 299-333. ISBN 978-0-87969-872-0 Institutional research plan: CEZ:AV0Z50070508 Keywords : genetics-linkage maps * transgene expression * larval RNAi Subject RIV: EB - Genetics ; Molecular Biology

  1. The Growth of Tribolium castaneum (Herbst) and Lasioderma serricorne (Fabricius) on Feed Media Dosed with Flavour Volatiles Found in Dry Cocoa Beans

    OpenAIRE

    Jonfia-Essien, W. A.; Alderson, P. G.; G. Tucker; R. Linforth; West, G.

    2007-01-01

    Acetophenone, ethyl butyrate and 2-phenyl ethanol were used as additives to media on which Tribolium castaneum (Herbst) and Lasioderma serricorne (Fabricius) were cultured for 65 days. Acetophenone and ethyl butyrate had a positive impact on the weight and multiplication of the insects. The weight and rate of multiplication was higher in feed media containing acetophenone alone. The amount of the flavour volatiles added was high enough to deter the Lasioderma from feeding well, which affected...

  2. Efeitos da radiação gama do Cobalto-60 em ovos de Tribolium castaneum (Herbst., 1797) (Coleoptera: Tenebrionidae) Gamma radiation effects on eggs of Tribolium castaneum (Herbst., 1797) (Coleoptera: Tenebrionidae)

    OpenAIRE

    L. S. Fontes; V. Arthur

    1994-01-01

    Este trabalho teve por objetivo determinar as doses esterilizantes e letal para ovos de T. castaneum (Herbst., 1797) (Coleoptera: Tenebrionidae), através de doses crescentes de radiação gama. Utilizou-se uma fonte de Cobalto-60, tipo Gammabeam-650, com taxa de dose de 1,28 kGy/hora. O experimento foi conduzido sob condições controladas com temperatura de 25 ± 2°C e umidade relativa de 70 ± 5%. As doses letal e esterilizante para os ovos foram respectivamente 30 e 20 Gy.The o...

  3. Residual efficacy of methoprene for control of Tribolium castaneum (Coleoptera: Tenebrionidae) larvae at different temperatures on varnished wood, concrete, and wheat.

    Science.gov (United States)

    Wijayaratne, L K Wolly; Fields, Paul G; Arthur, Frank H

    2012-04-01

    The residual efficacy of the juvenile hormone analog methoprene (Diacon II) was evaluated in bioassays using larvae of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) exposed on unsealed concrete or varnished wood treated with a liquid formulation and held at different temperatures. When these two types of surfaces were stored at 20, 30 or 35 degrees C for 0-24 wk, the percentage of adult emergence on concrete increased with time. In contrast, there was no adult emergence from larvae exposed to varnished wood at 24 wk after treatment at any of these temperatures. The presence of flour reduced residual efficacy of methoprene on concrete, but not on varnished wood, with no differences between cleaning frequencies. Methoprene was also stable for 48 h on concrete held at 65 degrees C and wheat, Triticum aestivum L., held at 46 degrees C. Results show that methoprene is stable at a range of temperatures commonly encountered in indoor food storage facilities and at high temperatures attained during insecticidal heat treatments of structures. The residual persistence of methoprene applied to different surface substrates may be affected more by the substrate than by temperature. PMID:22606845

  4. The SNMP/CD36 gene family in Diptera, Hymenoptera and Coleoptera: Drosophila melanogaster, D. pseudoobscura, Anopheles gambiae, Aedes aegypti, Apis mellifera, and Tribolium castaneum.

    Science.gov (United States)

    Nichols, Zachary; Vogt, Richard G

    2008-04-01

    Sensory neuron membrane proteins (SNMPs) are membrane bound proteins initially identified in olfactory receptor neurons of Lepidoptera and are thought to play a role in odor detection; SNMPs belong to a larger gene family characterized by the human protein CD36. We have identified 12-14 candidate SNMP/CD36 homologs from each of the genomes of Drosophila melanogaster, D. pseudoobscura, Anopheles gambiae and Aedes aegypti (Diptera), eight candidate homologs from Apis mellifera (Hymenoptera), and 15 from Tribolium castaneum (Coleoptera). Analysis (sequence similarity and intron locations) suggests that the insect SNMP/CD36 genes fall into three major groups. Group 1 includes the previously characterized D. melanogaster emp (epithelial membrane protein). Group 2 includes the previously characterized D. melanogaster croquemort, ninaD, santa maria, and peste. Group 3 genes include the SNMPs, which fall into two subgroups referred to as SNMP1 and SNMP2. D. melanogaster SNMP1 (CG7000) shares both significant sequence similarity and five of its six intron insertion sites with the lepidopteran Bombyx mori SNMP1. The topological conservation of this gene family within the three major holometabolous lineages indicates that it predates the coleopteran and hymenoptera/dipera/lepidoptera split 300+ million years ago. The current state of knowledge of the characterized insect members of this gene family is discussed. PMID:18342246

  5. Reproduction of confused flour beetle Tribolium confusum Du Val (Coleoptera: Tenebrionidae on common and spelt wheat and their products

    Directory of Open Access Journals (Sweden)

    Radmila Almaši

    2014-09-01

    Full Text Available The interest in spelt wheat production has grown in recent years but there is hardly any information on pest development on that wheat species in storehouses. The influence of common and spelt wheat and their products on the reproduction and offspring of confused flour beetles Tribolium confusum Du Val was studied under laboratory conditions (22-25 °C and 40-60% RH. The experiment was carried out in four replications with four, 10 and 20 insects over a period of six months. The reproduction of confused flour beetles significantly varied depending on the wheat species and product. The highest reproduction rate was recorded on spelt wheat (Triticum spelta L.. The greatest number of offspring beetles appeared on spelt wheat flour (23469. The number of offspring beetles was higher on common (7044 than on spelt wheat kernels (5469. No offspring developed on common wheat pasta while only 4 young beetles were found on spelt wheat pasta. Offspring numbers increased with storage period up to a point but further on they depended on insect number. The number of insects increased over the first four months but decreased later on and the mortality rate was higher. Initial population density affected the offspring numbers but offspring numbers did not rise proportionally with the rising initial population density. Considering the species of wheat, higher mortality was recorded in common wheat. Regarding the type of product, the highest mortality was recorded in pasta, then in kernels and the lowest in flour. The paper shows that confused flour beetles develop extremely well on spelt wheat, even better than on common wheat which is widely grown in Serbia.

  6. Evaluación de la actividad repelente e insecticida de aceites esenciales extraídos de plantas aromáticas utilizados contra tribolium castaneum herbst (coleoptera: tenebrionidae)

    OpenAIRE

    Espitia Yanes, Carmen Regina

    2011-01-01

    Los aceites esenciales son mezclas volátiles de terpenos obtenidas de plantas. Estos productos poseen propiedades repelentes e insecticida de insectos. Uno de los insectos de mayor importancia económica es el Tribolium castaneum Herbst. Con el objetivo de evaluar la actividad de aceites esenciales de plantas de Colombia Cymbopogon citratus y (GRbgV02E), Lippia origanoides (VEbgV07E) y Eucalyptus citriodora (MYbgV01E) fueron realizados ensayos de repelencia y mortalidad. Para tal efecto, fué u...

  7. Ojo blanco (obl : un gene marcador del grupo de ligamiento IV en Tribolium castaneum Herbst Ojo blanco (obl: un gene marcador del grupo de ligamiento IV en Tribolium castaneum Herbst

    Directory of Open Access Journals (Sweden)

    Nuñez Fernando

    1988-06-01

    Full Text Available

    Some genetic aspects of a spontaneous mutation in T. castaneum, discovered in the Department of Biology of National University of Colombia (Bogota, were studied. The mutant gene christened "ojo blanco" (obl, is recessive autosomic, of excellent viability, complete penetrance and variable expression. The gene is phenotipically characterized by a depigmentation of the compound eyes and can be observed from the larval stage. Linkage tests with marker mutants for different groups were carried out. The marker "sooty", of the linkage group IV, gave positive results. The distance was estimated from 2843 descendants obtained from backcrosses in repulsion plase and 1630 in coupling phase. This distance was worked out as 15.64 ± 0.92 units between obl ands. It was not possible to determine if obl is on the left or the right hand side of s. Nor discrepancies between sexes, neither between phases were found in the recombination frequencies for the region between the two loci of chromosome IV.

    Se estudiaron algunos aspectos genéticos de una mutación espontanea en T. casteneum, descubierta en el Departamento de Biología de la Universidad Nacional de Colombia (Bogotá. EI gene mutante llamado "ojo blanco" (obl es autosómico recesivo, de excelente viabilidad, penetrancia completa y expresividad variable. Fenotípicamente se caracteriza por una despigmentación de los ojos compuestos; puede observarse desde el estado de larva. Se le hicieron pruebas de ligamiento con marcadores para diferentes grupos. Se obtuvieron resultados positivos con el marcador "sooty" del grupo de ligamiento IV. La  distancia se calcu1ó a partir de 2.843 descendientes de retrocruzas en posición de repulsión y 1.630 descendientes de retrocruzas en posición de acoplamiento. Esta distancia fue de 15.ó4 ± 0.92 unidades entre obl ys. No se pudo determinar si obl esta a la izquierda 0 a la

  8. Influence of age, mating status, sex, quantity of food, and long-term food deprivation on red flour beetle (Coleoptera: Tenebrionidae) flight initiation

    Science.gov (United States)

    Effects of age, sex, presence or absence of food, mating status, quantity of food, and food deprivation on rate of and time of flight initiation of the red flour beetle, Tribolium castaneum (Herbst), were determined. Flight initiation declined with increasing age in both presence and absence of food...

  9. Toxic and Repellent effecto of Harmal (Peganum harmala L. Acetonic Extract on Several Aphids and Tribolium castaneum (Herbst Efecto Tóxico y Repelente del Extracto Acetónico de Harmal (Peganum harmala L. sobre varias especies de Áfidos y Tribolium castaneum (Herbst

    Directory of Open Access Journals (Sweden)

    Elham Salari

    2012-03-01

    Full Text Available To reduce the dependence on the sometimes unwise use of synthetic pesticides in fruit and vegetable plantations, the toxicity and repellence of Peganum harmala L. (Zygophyllaceae acetonic seed extract was assayed against several insect pests. For contact toxicity, 3- to 4-d-old individuals of Aphis fabae Scopoli, A. gossypii Glover, A. nerii Boyer de Fonscolombe, and Myzus persicae (Sulzer were included, as well as 1- to 7-d-old adult Tribolium castaneum (Herbst. Repellent effect experiments were conducted on adult, 1- to 2- and 3- to 4-d old M.persicae individuals. At 60 mg mL4, the topical bioassay mortality percentage was significantly higher in A. gossypii than in A. fabae and A. nerii after 12-72 h. Mortality of the treatments on M.persicae was 87.1% and 90.0% after 24 and 48 h, respectively, and significantly higher than A. fabae and A. nerii during this period. At 60 mg mL-1, the mortality of T. castaneum was much lower than that of the aphid species. The highest repellent index (over 72% was observed on 1- to 2-d-old M. persicae individuals.Para reducir la dependencia de los pesticidas sintéticos en plantaciones frutales y hortalizas, se realizó un ensayo para medir la toxicidad y repelencia de un extracto acetónico obtenido a partir de semillas de Peganum harmala L. (Zygophyllaceae contra diferentes especies de plagas. Para evaluar la toxicidad del extracto al contacto con los insectos, se incluyeron individuos de 3-4 d de edad de Aphis fabae Scopoli, Aphis gossypii Glover, Aphis nerii Boyer de Fonscolombe, y Myzus persicae (Sulzer, así como adultos 1-7 d de edad de Tribolium castaneum (Herbst. Experimentos para medir el efecto repelente se llevaron a cabo con individuos de 1-2 y 3-4 d de edad de M. persicae. En los resultados de los bioensayos tópicos el porcentaje de mortalidad fue significativamente mayor en la especie A. gossypii que en A. fabae y A. nerii, después de 12-72 h con una concentración de 60 mg mL-1. La mortalidad

  10. Effects of vanillin and gamma irradiation on the development of confused flour beetle, tribolium confusum (DUV.)

    International Nuclear Information System (INIS)

    The effect of the natural chemical compound food flavoring agent, vanillin on the tribolium confusum was examined. The effect of vanillin on tribolium confusum reared as 18-day old larvae decreased the percent adult emergence, it was 32 % and 51.4 % adults at the treatments 2 % and 4 % respectively. The sex ratio was in favour of female at control group (1:1.2 male:female). This ratio reversed at the treatments 2 %, 4 % vanillin was favour of males. When one day old larvae treated with 2 %, 8 % vanillin, the percent pupation was decrease from control group. It was 31.83, 45.0 %, as compared with 53.33 in control group, respectively. At highest treatment 8 %, sex ratio was in favour of males. The mean number of total progenies decrease significantly from control when larvae 18-day old treated with vanillin and stored for two or four months. While when larvae 1-day old treated with vanillin , the decrease in the number of total progenies was insignificant. When one day old adults irradiated at 20, 50 and 70 Gy and reared for two and four months. The mean number of progenies decrease significantly by increasing the radiation dose, when compared with control group

  11. DNA barcoding, species-specific PCR and real-time PCR techniques for the identification of six Tribolium pests of stored products.

    Science.gov (United States)

    Zhang, Tao; Wang, Yi-Jiao; Guo, Wei; Luo, Dan; Wu, Yi; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun; Li, Zhi-Hong

    2016-01-01

    Flour beetles of the genus Tribolium Macleay (Coleoptera: Tenebrionidae) are important stored product pests in China and worldwide. They are often found or are intercepted in grain depots, flour mills, and entry-exit ports, etc. Traditionally, Tribolium species are identified according to the morphological characteristics of the adult. However, it is almost impossible to rapidly identify adult fragments and non-adult stages based on external morphological characteristics. Molecular techniques for the rapid and accurate identification of Tribolium species are required, particularly for pest monitoring and the quarantine of stored products pests. Here, we establish DNA barcoding, species-specific PCR, and real-time PCR techniques for the identification of six stored-product pest Tribolium species including T. castaneum, T. confusum, T. destructor, T. madens, T. freemani and T. brevicornis. We detected the mitochondrial DNA cytochrome oxidase subunit I (COI) barcodes for Tribolium from 18 geographic populations and 101 individuals, built a Tribolium DNA barcode library, and designed species-specific primers and TaqMan probes for the above six Tribolium species. The three techniques were applied to identify Tribolium collected from stored samples and samples captured from quarantine ports. The results demonstrated that three techniques were all able to identify the six species of Tribolium both rapidly and accurately. PMID:27352804

  12. Sublethal exposure to diatomaceous earth increases net fecundity of flour beetles (Tribolium confusum by inhibiting egg cannibalism.

    Directory of Open Access Journals (Sweden)

    Allen W Shostak

    Full Text Available Population regulation results from an interplay of numerous intrinsic and external factors, and for many insects cannibalism is such a factor. This study confirms a previously-reported observation that sublethal exposure to the fossilized remains of diatoms (i.e. diatomaceous earth increases net fecundity (eggs produced minus eggs destroyed/day of flour beetles, Tribolium confusum. The aim was to experimentally test two non-mutually-exclusive ecological mechanisms potentially responsible for the increased net fecundity: higher egg production and lower egg cannibalism. Adult T. confusum were maintained at low or high density in medium containing sublethal (0-4% diatomaceous earth. Net fecundity increased up to 2.1× control values during diatomaceous earth exposure, and returned to control levels following removal from diatomaceous earth. Cannibalism assays on adults showed that diatomaceous earth reduced the number of eggs produced to 0.7× control values at low density and to 0.8× controls at high density, and also reduced egg cannibalism rates of adults to as little as 0.4× control values, but at high density only. Diatomaceous earth also reduced cannibalism by larvae on eggs to 0.3× control values. So, while the presence of diatomaceous earth reduced egg production, net fecundity increased as a result of strong suppression of the normal egg cannibalism by adults and larvae that occurs at high beetle density. Undisturbed cultures containing sublethal diatomaceous earth concentrations reached higher population densities than diatomaceous earth-free controls. Cohort studies on survival from egg to adult indicated that this population increase was due largely to decreased egg cannibalism by adult females. This is the first report of inhibition of egg cannibalism by diatomaceous earth on larval or adult insects. The ability of diatomaceous earth to alter cannibalism behavior without causing mortality makes it an ideal investigative tool for

  13. Activities of modified Cry3A-type toxins on the red flour beetle, Tribolium castaneum (Herbst)

    Czech Academy of Sciences Publication Activity Database

    Mostafa, Moataz; Vlasák, Josef; Sehnal, František

    2013-01-01

    Roč. 137, č. 9 (2013), s. 684-692. ISSN 0931-2048 R&D Projects: GA MZe QI91A229; GA MZe QH71290 Institutional support: RVO:60077344 Keywords : Bacillus thuringensis * biocontrol * Cry3Aa Subject RIV: ED - Physiology Impact factor: 1.701, year: 2013 http://onlinelibrary.wiley.com/doi/10.1111/jen.12054/pdf

  14. Chirality determines pheromone activity for flour beetles

    Science.gov (United States)

    Levinson, H. Z.; Mori, K.

    1983-04-01

    Olfactory perception and orientation behaviour of female and male flour beetles ( Tribolium castaneum, T. confusum) to single stereoisomers of their aggregation pheromone revealed maximal receptor potentials and optimal attraction in response to 4R,8R-(-)-dimethyldecanal, whereas its optical antipode 4S,8S-(+)-dimethyldecanal was found to be inactive in this respect. Female flour beetles of both species were ≈ 103 times less attracted to 4R,8S-(+)- and 4S,8R-(-)-dimethyldecanal than to 4R,8R-(-)-dimethyldecanal, while male flour beetles failed to respond to the R,S-(+)- and S,R-(-)-stereoisomers. Pheromone extracts of prothoracic femora from unmated male flour beetles elicited higher receptor potentials in the antennae of females than in those of males. The results suggest that the aggregation pheromone emitted by male T. castaneum as well as male T. confusum has the stereochemical structure of 4R,8R-(-)-dimethyl-decanal, which acts as sex attractant for the females and as aggregant for the males of both species.

  15. Chemical Constituents and Toxicity of Essential Oils of Oriental Arborvitae, Platycladus orientalis (L.) Franco, against Three Stored-Product Beetles Componentes Químicos y Toxicidad de Aceites Esenciales de Tuya Oriental, Platycladus orientalis (L.) Franco, contra Tres Escarabajos de Productos Almacenados

    OpenAIRE

    Seyed Mehdi Hashemi; Seyed Ali Safavi

    2012-01-01

    Plant secondary metabolites play an important role in plant-insect interactions and therefore such compounds may have insecticidal or biological activity against insects. Fumigant toxicity of essential oils of leaves and fruits from oriental arborvitae (Platycladus orientalis (L.) Franco) (Cupressaceae) was investigated against adults of cowpea weevil (Callosobruchus maculatus Fab.), rice weevil (Sitophilus oryzae L.), and red flour beetle (Tribolium castaneum Herbst). Fresh leaves and fruits...

  16. The red flour beetle as a model for bacterial oral infections.

    Directory of Open Access Journals (Sweden)

    Barbara Milutinović

    Full Text Available Experimental infection systems are important for studying antagonistic interactions and coevolution between hosts and their pathogens. The red flour beetle Tribolium castaneum and the spore-forming bacterial insect pathogen Bacillus thuringiensis (Bt are widely used and tractable model organisms. However, they have not been employed yet as an efficient experimental system to study host-pathogen interactions. We used a high throughput oral infection protocol to infect T. castaneum insects with coleopteran specific B. thuringiensis bv. tenebrionis (Btt bacteria. We found that larval mortality depends on the dietary spore concentration and on the duration of exposure to the spores. Furthermore, differential susceptibility of larvae from different T. castaneum populations indicates that the host genetic background influences infection success. The recovery of high numbers of infectious spores from the cadavers indicates successful replication of bacteria in the host and suggests that Btt could establish infectious cycles in T. castaneum in nature. We were able to transfer plasmids from Btt to a non-pathogenic but genetically well-characterised Bt strain, which was thereafter able to successfully infect T. castaneum, suggesting that factors residing on the plasmids are important for the virulence of Btt. The availability of a genetically accessible strain will provide an ideal model for more in-depth analyses of pathogenicity factors during oral infections. Combined with the availability of the full genome sequence of T. castaneum, this system will enable analyses of host responses during infection, as well as addressing basic questions concerning host-parasite coevolution.

  17. The influence of rearing medium on the irradiation sensitivity of eggs and larvae of the flour beetle, Tribolium confusum J. du Val

    International Nuclear Information System (INIS)

    In this study, gamma radiation was applied at six dose levels over the range of 5–40 Gy for 0–2-day-old eggs, and at eight dose levels between 10–80 Gy for 16–18-day-old larvae of Tribolium confusum. Sterility, mortality and other effects of gamma radiation were investigated. All experiments were performed in incubators maintained at 27 ± 0.5 °C and 70 ± 5% r.h. The development of adults reared on different flours from irradiated eggs and larvae was prevented by exposure to 40 and 50 Gy of gamma radiation, respectively. Rate of development of these stages on different flours and the yield of adults was influenced by rearing medium. Rapidly developing flour beetles are more susceptible to killing by gamma radiation. For each stage reared on different media (wheat, barley and maize flours), LD50 and LD99.9 values were determined, together with sterilizing dose levels (SD50 and SD99.9)

  18. The influence of rearing medium on the irradiation sensitivity of eggs and larvae of the flour beetle, Tribolium confusum J. du Val

    International Nuclear Information System (INIS)

    In this study, gamma radiation was applied at six dose levels over the range of 5–40 Gy for 0–2-day-old eggs, and at eight dose levels between 10–80 Gy for 16–18-day-old larvae of Tribolium confusum. Sterility, mortality and other effects of gamma radiation were investigated. All experiments were performed in incubators maintained at 27 ± 0.5 °C and 70 ± 5% r.h. The development of adults reared on different flours from irradiated eggs and larvae was prevented by exposure to 40 and 50 Gy of gamma radiation, respectively. Rate of development of these stages on different flours and the yield of adults was influenced by rearing medium. Rapidly developing flour beetles are more susceptible to killing by gamma radiation. For each stage reared on different media (wheat, barley and maize flours), LD50 and LD99.9 values were determined, together with sterilizing dose levels (SD50 and SD99.9). (author)

  19. Combined effect of gamma radiation and methyl bromide fumigation on the confused flour beetle, tribolium confusum, DUV

    International Nuclear Information System (INIS)

    A laboratory study was carried out in egypt to determine the effect of combining treatments of gamma radiation and methyl bromide fumigation applied to to adults of tribolium confusum (D uv.) An interaction between radiation and insecticidal treatment was obvious, with additive effects noted at most combination treatments. When radiation treatments were applied first and followed by fumigation within 24 hr, very low dosages of radiation (2-6 krad) decreased the susceptibility of the insects to marginally effective dosages of methyl bromide after 14 days. Irradiation pretreatment followed by fumigation after 21 days enhanced the fumigant effectiveness. Irradiation treatments using dosages from 5-50 krad followed by fumigant treatments after 7 days killed more insects than did either treatment applied alone. When sublethal dosages of fumigation preceded irradiation, the insects became more radio-sensitive. In general, the effects of irradiation and fumigation combinations were higher than the effects of either treatment given singly, irrespective which treatment was given first. 3 tab

  20. Studying the organization of genes encoding plant cell wall degrading enzymes in Chrysomela tremula provides insights into a leaf beetle genome.

    Science.gov (United States)

    Pauchet, Y; Saski, C A; Feltus, F A; Luyten, I; Quesneville, H; Heckel, D G

    2014-06-01

    The ability of herbivorous beetles from the superfamilies Chrysomeloidea and Curculionoidea to degrade plant cell wall polysaccharides has only recently begun to be appreciated. The presence of plant cell wall degrading enzymes (PCWDEs) in the beetle's digestive tract makes this degradation possible. Sequences encoding these beetle-derived PCWDEs were originally identified from transcriptomes and strikingly resemble those of saprophytic and phytopathogenic microorganisms, raising questions about their origin; e.g. are they insect- or microorganism-derived? To demonstrate unambiguously that the genes encoding PCWDEs found in beetle transcriptomes are indeed of insect origin, we generated a bacterial artificial chromosome library from the genome of the leaf beetle Chrysomela tremula, containing 18 432 clones with an average size of 143 kb. After hybridizing this library with probes derived from 12 C. tremula PCWDE-encoding genes and sequencing the positive clones, we demonstrated that the latter genes are encoded by the insect's genome and are surrounded by genes possessing orthologues in the genome of Tribolium castaneum as well as in three other beetle genomes. Our analyses showed that although the level of overall synteny between C. tremula and T. castaneum seems high, the degree of microsynteny between both species is relatively low, in contrast to the more closely related Colorado potato beetle. PMID:24456018

  1. Pheromone synthesis. Part 245: Synthesis and chromatographic analysis of the four stereoisomers of 4,8-dimethyldecanal, the male aggregation pheromone of the red flour beetle, Tribolium castaneum

    Science.gov (United States)

    All four stereoisomers of 4,8-dimethyldecanal (1) were synthesized from the enantiomers of 2-methyl-1-butanol and citronellal. Enantioselective GC analysis enabled separation of (4R,8R)-1 and (4R,8S)-1 from a mixture of (4S,8R)-1 and (4S,8S)-1, when octakis- (2,3-di-O-methoxymethyl-6-O-t-butyldimet...

  2. Identification of irradiated insects: changes in the midgut of the confused flour beetle, Tribolium confusum Duv., induced by gamma radiation

    International Nuclear Information System (INIS)

    The radiation doses applied for quarantine treatment does not generally cause immediate death of insects and mites. Alive pests may be present in the agricultural commodities for several days. This can be a disadvantage if the product is for immediate export and there is a nil insect requirement. A simple test is needed to ensure the quarantine personnel that a pest of quarantine importance has been irradiated and it does not pose a quarantine risk. Development of a practical technique for identification of irradiated pests was recommended by the ICGFI Task Force Meeting on Irradiation as Quarantine Treatment. The midgut, metabolically very active tissue, is the main site for digestion and absorption of the products of digestion. The old epithelium is replaced by new cells produced by the regenerative nidi. Regenerative cells are very sensitive to radiation. Its damage results in loss of the midgut epithelium in irradiated insects. The following changes in the midgut structure of the confused flour beetle were observed: 1. destruction of the regenerative nidi; 2. elongation and enlargement of epithelial cells; 3. vacuolization of the epithelial cells; 4. fading of cells boundaries in the epithelium; 5. damage of the nuclei (chromatin grains scattered throughout the cytoplasm of epithelial cells); 6. loss of the brush border; 7. disintegration and further loss of epithelium. The most expressed effect of the irradiation treatment was the destruction of regenerative cells of the midgut. Their destruction prevented the replacement of the secretory cells of the epithelium. As a result the epithelium disappeared and the gut lumen enlarged. Causes other than ionizing radiation resulting in disintegration of the midgut epithelium of insects are unknown. Since the degenerative changes in the midgut are positively correlated with both dose and time elapsed after irradiation exposure, a pathological syndrome of irradiation effects on the midgut may be used for a rapid and

  3. Research on quality properties of flour infected by red flour beetle (Tribolium canstaneum)%赤拟谷盗对小麦粉品质的影响

    Institute of Scientific and Technical Information of China (English)

    董秋晨; 王晓曦; 刘亚楠

    2012-01-01

    赤拟谷盗是小麦粉加工及储存过程中的重要害虫之一.选用普通小麦粉180 g,向其中投入赤拟谷盗成虫,研究小麦粉在感染头数分别为0、10、30、60、100、200,感染时间为0、15、25、35、45 d时的品质变化.实验表明:随着虫口密度的增大和感染时间的延长,小麦粉的水分稍有上升,灰分变化不大;粗淀粉含量降低,粗蛋白质含量升高,湿面筋含量和面筋指数则呈现不规律的波动;清蛋白、球蛋白、谷蛋白含量下降,醇溶蛋白的含量上升;降落数值下降明显.在较低虫口密度下时,小麦粉的峰值黏度、最低黏度、黏度破损值和最终黏度有升高趋势,但随着虫口密度的增大又逐步降低.%Red flour beetle(Tribulium canstaneum) is one kind of important pest during wheat flour processing and preservation. Quality properties of flour were measured after different flour infecting time in five densities of adults of red flour beetle. The density of adults was 0/10/30/60/100/200 individuals in per 180 g of flour. Quality properties of flour were measured after 0/15/25/35/45 days. The result showed that along with insect density or time increasing,the moisture,protein was increased, the wet gluten content and gluten index showed irregular fluctuation; Flour protein types was changed, albumin,globulin and glutenin content decreased, but gliadin increased; The falling number decreased significantly. Peak viscosity, trough viscosity, breakdown value,consistency,and final viscosity increased at lower insect density, but decreased gradually with insect density increasing.

  4. The Effect of Temperature and Humidity on the Susceptibility of Flour Beetles to Organophosphorus Insecticides

    Directory of Open Access Journals (Sweden)

    D. B. Chadha

    1965-01-01

    Full Text Available The effect of the temperature and humidity on the susceptibility of Tribolium castaneum Herbst. to malathion and diazinon, has been investigated. It has been found that temperature significantly influences the susceptibility of T. castaneum to malathion though not to diazinon. Humidity, however, influences the susceptibility if the insect to both insecticides.

  5. Large-scale RNAi screen of G protein-coupled receptors involved in larval growth, molting and metamorphosis in the red flour beetle

    Directory of Open Access Journals (Sweden)

    Shah Kapil

    2011-08-01

    Full Text Available Abstract Background The G protein-coupled receptors (GPCRs belong to the largest superfamily of integral cell membrane proteins and play crucial roles in physiological processes including behavior, development and reproduction. Because of their broad and diverse roles in cellular signaling, GPCRs are the therapeutic targets for many prescription drugs. However, there is no commercial pesticide targeting insect GPCRs. In this study, we employed functional genomics methods and used the red flour beetle, Tribolium castaneum, as a model system to study the physiological roles of GPCRs during the larval growth, molting and metamorphosis. Results A total of 111 non-sensory GPCRs were identified in the T. castaneum genome. Thirty-nine of them were not reported previously. Large-scale RNA interference (RNAi screen was used to study the function of all these GPCRs during immature stages. Double-stranded RNA (dsRNA-mediated knockdown in the expression of genes coding for eight GPCRs caused severe developmental arrest and ecdysis failure (with more than 90% mortality after dsRNA injection. These GPCRs include dopamine-2 like receptor (TC007490/D2R and latrophilin receptor (TC001872/Cirl. The majority of larvae injected with TC007490/D2R dsRNA died during larval stage prior to entering pupal stage, suggesting that this GPCR is essential for larval growth and development. Conclusions The results from our study revealed the physiological roles of some GPCRs in T. castaneum. These findings could help in development of novel pesticides targeting these GPCRs.

  6. Control of Three Stored−Product Beetles with Artemisia haussknechtii (Boiss (Asteraceae Essential Oil

    Directory of Open Access Journals (Sweden)

    Seyed Mehdi Hashemi

    2012-12-01

    Full Text Available Fumigant toxicity of the essential oil of aerial parts from Artemisia haussknechtii (Boiss (Asteraceae was investigated against the cowpea weevil Callosobruchus maculatus (Fab., the rice weevil Sitophilus oryzae (L., and the red flour beetle Tribolium castaneum (Herbst. Dry ground plants were subjected to hydro−distillation using a Clevenger−type apparatus and the chemical composition of the volatile oil was studied by gas chromatography−mass spectrometry (GC−MS. The major components of the oil were camphor (29.24%, 1, 8−cineol (27.62%, yomogi alcohol (5.23%, and camphene (4.80%. The essential oil in same concentrations was assayed against (1−7 days old adults of insect species and percentage mortality was recorded after 24, 48, and 72 h exposure times. LC50 values were varied between 19.84 and 103.59 μL L-1 air, depending on insect species and exposure time. Callosobruchus maculatus was more susceptible than other species. These results suggested that A. haussknechtii oil might have potential as a control agent against C. maculatus, S. oryzae and T. castaneum.

  7. Identification and Biochemical Characterization of Protein Phosphatase 5 from the Cantharidin-Producing Blister Beetle, Epicauta chinensis

    Directory of Open Access Journals (Sweden)

    Xi'en Chen

    2013-12-01

    Full Text Available Protein phosphatase 5 (PP5 is a unique member of serine/threonine phosphatases which has been recognized in regulation of diverse cellular processes. A cDNA fragment encoding PP5 (EcPP5 was cloned and characterized from the cantharidin-producing blister beetle, E. chinensis. EcPP5 contains an open reading frame of 1500 bp that encodes a protein of 56.89 kDa. The deduced amino acid sequence shares 88% and 68% identities to the PP5 of Tribolium castaneum and humans, respectively. Analysis of the primary sequence shows that EcPP5 has three TPR (tetratricopeptide repeat motifs at its N-terminal region and contains a highly conserved C-terminal catalytic domain. RT-PCR reveals that EcPP5 is expressed in all developmental stages and in different tissues. The recombinant EcPP5 (rEcPP5 was produced in Escherichia coli and purified to homogeneity. The purified protein exhibited phosphatase activity towards pNPP (p-nitrophenyl phosphate and phosphopeptides, and its activity can be enhanced by arachidonic acid. In vitro inhibition study revealed that protein phosphatase inhibitors, okadaic acid, cantharidin, norcantharidin and endothall, inhibited its activity. Further, protein phosphatase activity of total soluble protein extract from E. chinensis adults could be impeded by these inhibitors suggesting there might be some mechanism to protect this beetle from being damaged by its self-produced cantharidin.

  8. Formation of rigid, non-flight forewings (elytra of a beetle requires two major cuticular proteins.

    Directory of Open Access Journals (Sweden)

    Yasuyuki Arakane

    Full Text Available Insect cuticle is composed primarily of chitin and structural proteins. To study the function of structural cuticular proteins, we focused on the proteins present in elytra (modified forewings that become highly sclerotized and pigmented covers for the hindwings of the red flour beetle, Tribolium castaneum. We identified two highly abundant proteins, TcCPR27 (10 kDa and TcCPR18 (20 kDa, which are also present in pronotum and ventral abdominal cuticles. Both are members of the Rebers and Riddiford family of cuticular proteins and contain RR2 motifs. Transcripts for both genes dramatically increase in abundance at the pharate adult stage and then decline quickly thereafter. Injection of specific double-stranded RNAs for each gene into penultimate or last instar larvae had no effect on larval-larval, larval-pupal, or pupal-adult molting. The elytra of the resulting adults, however, were shorter, wrinkled, warped, fenestrated, and less rigid than those from control insects. TcCPR27-deficient insects could not fold their hindwings properly and died prematurely approximately one week after eclosion, probably because of dehydration. TcCPR18-deficient insects exhibited a similar but less dramatic phenotype. Immunolocalization studies confirmed the presence of TcCPR27 in the elytral cuticle. These results demonstrate that TcCPR27 and TcCPR18 are major structural proteins in the rigid elytral, dorsal thoracic, and ventral abdominal cuticles of the red flour beetle, and that both proteins are required for morphogenesis of the beetle's elytra.

  9. Chemical Constituents and Toxicity of Essential Oils of Oriental Arborvitae, Platycladus orientalis (L. Franco, against Three Stored-Product Beetles Componentes Químicos y Toxicidad de Aceites Esenciales de Tuya Oriental, Platycladus orientalis (L. Franco, contra Tres Escarabajos de Productos Almacenados

    Directory of Open Access Journals (Sweden)

    Seyed Mehdi Hashemi

    2012-06-01

    Full Text Available Plant secondary metabolites play an important role in plant-insect interactions and therefore such compounds may have insecticidal or biological activity against insects. Fumigant toxicity of essential oils of leaves and fruits from oriental arborvitae (Platycladus orientalis (L. Franco (Cupressaceae was investigated against adults of cowpea weevil (Callosobruchus maculatus Fab., rice weevil (Sitophilus oryzae L., and red flour beetle (Tribolium castaneum Herbst. Fresh leaves and fruits were subjected to hydrodistillation using a Clevenger-type apparatus and the chemical composition of the volatile oils was studied by gas chromatography-mass spectrometry (GC-MS. Twenty-six compounds (92.9% and 23 constituents (97.8% were identified in the leaf and the fruit oils, respectively. The major components of both leaves and fruits oils were α-pinene (35.2%, 50.7%, α-cedrol (14.6%, 6.9% and Δ-3-carene (6.3%, 13.8%, respectively. Both oils in the same concentration were tested for their fumigant toxicity on each species. Results showed that leaf oils were more toxic than fruit oils against three species of insects. Callosobruchus maculatus was more susceptible than S. oryzae and T. castaneum. LC510 values of the leaf and the fruit oils at 24 h were estimated 6.06 and 9.24 μL L¹ air for C. maculatus, 18.22 and 21.56 μL L-1 air for S. oryzae, and 32.07 and 36.58 μL L4 air for T. castaneum, respectively. These results suggested that P. orientalis oils may have potential as a control agent against C. maculatus, S. oryzae, and T. castaneum.Los metabolitos secundarios de las plantas juegan un papel importante en las interacciones planta-insecto, y por lo tanto pueden tener actividad insecticida o biológica en los insectos. La toxicidad fumigante de los aceites esenciales de hojas y frutos del árbol oriental de la vida (Platycladus orientalis (L. Franco (Cupressaceae fue investigada contra adultos de gorgojo del guisante (Callosobruchus maculatus Fab

  10. Asparagus Beetle and Spotted Asparagus Beetle

    OpenAIRE

    Erin W Hodgson; Drost, Dan

    2007-01-01

    Asparagus beetle, Crioceris asparagi, and spotted asparagus beetle, C. duodecimpunctata are leaf beetles in the family Chrysomelidae. These beetles feed exclusively on asparagus and are native to Europe. Asparagus beetle is the more economically injurious of the two species.

  11. Hormonal enhancement of insecticide efficacy in Tribolium castaneum: Oxidative stress and metabolic aspects

    Czech Academy of Sciences Publication Activity Database

    Plavšin, Ivana; Stašková, Tereza; Šerý, Michal; Smýkal, Vlastimil; Hackenberger, B. K.; Kodrík, Dalibor

    2015-01-01

    Roč. 170, APR 07 (2015), s. 19-27. ISSN 1532-0456 R&D Projects: GA ČR GA14-07172S Institutional support: RVO:60077344 Keywords : adipokinetic hormone * insecticide * RNA interference Subject RIV: ED - Physiology Impact factor: 2.301, year: 2014 http://www.sciencedirect.com/science/article/pii/S153204561500006X

  12. Kinetics of interaction of hyperthermia and ionizing radiation in Tribolium confusum

    International Nuclear Information System (INIS)

    The interaction of hyperthermia and ionizing radiation was investigated using the flour beetle, Tribolium confusum. A series of temperature-tolerance curves from 43.5 to 46.00C in 0.50C increments were determined. Three nonlethal hyperthermia schemes, i.e., 45.00C for 2 hr, 43.00C for 2 hr, and 43.00C for 12 hr, were applied either immediately before or immediately after irradiation. The sensitizing effect of hyperthermia was indicated by the shifting of the regression line of survival in probits on dose to the left of that of the control. The sensitizing effect as measured by decreased LD50 did not reveal any definite trend related to the order of application of the two modalities in immediate sequence. The importance of the order of application of the two modalities was immediately apparent if various time intervals intervened between a fixed radiation dose and a fixed hyperthermia treatment. The effect of hyperthermia given 60 min or longer after irradiation of male beetles was not detectable, as the survival was indistinguishable from that of the irradiated controls. This disappearance of interaction within 60 min seemed to be independent of radiation dose and of the temperature of hyperthermic treatment. In contrast, hyperthermia before irradiation exerted as effect lasting at least 5 hr. The results are in keeping with the hypothesis that hyperthermia affects the repair capability of the beetles

  13. Chemical constituents and biological activities against Tribolium castaneum (Herbst) of the essential oil from Citrus wilsonii leaves

    OpenAIRE

    Chen Hai Ping; Yang Kai; You Chun Xue; Du Shu Shan; Cai Qian; He Qing; Geng Zhu Feng; Deng Zhi Wei

    2014-01-01

    The essential oil obtained from Citrus wilsonii Tanaka leaves with hydrodistillation was investigated by GC and GC-MS. The main components of the essential oil were identified to be citronellol (16.94%), nerol acetate (10.35%), γ-terpinen (9.85%), citronellal (9.36%) and β-pinene (6.72%). Among them, the four active constituents, predicted with a bioactivity-test, were isolated and identified as citronellol, γ-terpinene, nerol (neryl) acetate and β-pinene. ...

  14. Bark beetle management guidebook

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-31

    This guidebook is designed to provide a background to bark beetle management practices consistent with the British Columbia Forest Practices Code, as well as specific practices for managing mountain pine beetle (Dendroctonus ponderosae), spruce beetle (Dendroctonus rufipennis), and Douglas-fir beetle (Dendroctonus pseudotsugae). It describes their general biology and distribution in British Columbia, their life cycles and population dynamics, and symptoms of bark beetle attack. General management strategies presented include prevention (a long-term approach), suppression, holding actions, and salvage. Strategies appropriate to specific bark beetles include aerial surveys, ground detection, baiting, harvesting, and use of insecticides. The guidebook includes brief mention of other bark beetles (Scolytids and other Dendroctonus species) and a glossary.

  15. Avidin expressed in transgenic rice confers resistance to the stored-product insect pests Tribolium confusum and Sitotroga cerealella.

    Science.gov (United States)

    Yoza, Koh-Ichi; Imamura, Taro; Kramer, Karl J; Morgan, Thomas D; Nakamura, Sumiko; Akiyama, Kohki; Kawasaki, Shinji; Takaiwa, Fumio; Ohtsubo, Ken'ichi

    2005-05-01

    Rice (Oryza sativa var. Nipponbare) was transformed with an artificial avidin gene. The features of this construct are as follows: (1) a signal peptide sequence derived from barley alpha amylase was added at the N-terminal region, (2) codon usage of the gene was optimized for rice, and (3) the gene was driven by rice glutelin GluB-1, an endosperm-specific promoter. Avidin was produced in the grain of the transgenic rice but not in the leaves. The concentration of avidin in the kernels was about 1,800 ppm. All larvae of the confused flour beetle (Tribolium confusum) and Angoumois grain moth (Sitotroga cerealella) died when fed transgenic avidin rice powder or kernels, respectively, whereas most of the test insects developed into adults when they were fed a nontransgenic rice control diet. Avidin extracted from the transgenic rice kernel lost most biotin-binding activity after 5 min heating at 95 degrees C. PMID:15914917

  16. The Spruce Beetle

    OpenAIRE

    Holsten, E H; Their, R W; Munson, A. S.; Gibson, K.E.

    1999-01-01

    The spruce beetle, Dendroctonus rufipennis (Kirby), is the most significant natural mortality agent of mature spruce. Outbreaks of this beetle have caused extensive spruce mortality from Alaska to Arizona and have occurred in every forest with substantial spruce stands. Spruce beetle damage results in the loss of 333 to 500 million board feet of spruce saw timber annually. More than 2.3 million acres of spruce forests have been infested in Alaska in the last 7 years with an estimated 30 milli...

  17. Determining lethal dose of gamma radiation on different stages of Tribolium Cosmonauts H b s t

    International Nuclear Information System (INIS)

    Pest infestation causes great losses to stored grain through out the world. This is specially true in developing countries where the technology is less advanced, and climatic conditions are extremely favourable for the development of pests. Irradiation is on approved method of direct control for stored-product insect in wheat and wheat flour in many countries, and in dictation are that it will soon be approved for all grain, grain products and other dry food commodities. Radiation doses required to kill or sterilized the most important storage pests in all stages are known. However irradiation is very effective in preventing insect development and in producing sterility. A detailed analysis of the radiosensitivity of stored-product insects shows the different groups of pests have very different sensitivities and quarantine doses can be tailored to kill or sterilize the species of quarantine concern. The effect of irradiation on insects are many, and varied, depending primarily on the species, stage, age and physical factors. The aim is to survey the effect of gamma radiation on stored pest, which can categorized under following classes: 1-The effect of gamma radiation on different stages grow of tribolium castaneum (H B S T); 2-Determination of lethal doses.; 3-The study of gamma radiation on products. In summary these information indicated that fairly low dosages of gamma radiation could be used on commodities such as bulk grain in which some infestation by insect stages of irradiation would be required on products such package foods where hundred percent mortality must be obtain. (author)

  18. Insecticidal Activities of Tunisian Halophytic Plant Extracts against Larvae and Adults of Tribolium confusum

    Directory of Open Access Journals (Sweden)

    Mighri, Z.

    2007-01-01

    Full Text Available Salt marsh plants were tested for their insecticidal activities against adults and larvae of Tribolium confusum. Sixteen aerial part extracts of Frankenia laevis, Statice echioides, Suaeda fructicosa and Tamarix boveana were obtained using organic solvents of increasing polarity and tested for their insect growth, antifeedant and toxicity effects. Responses varied with plant material, extract type, insect stage and exposition time. Larval growth inhibition was significantly induced by chloroformic, ethyl acetate extracts of F. laevis, S. echioides and T. boveana, and petroleum ether extract of F. laevis. On the other hand, all extracts of S. fructicosa and the methanolic ones of the four plants tested didn't show any significant activity. In addition, ethyl acetate extracts of F. laevis, S. echioides and T. boveana and petroleum ether extract of F. laevis presented antifeedant property. S. fructicosa seemed to be, however, slightly attractive to the flour beetle. For all extracts, mortality was higher for larvae than adults. By using ethyl acetate extracts of F. laevis, S. echioides and T. boveana, and petroleum ether extract of F. laevis, mortality reached respectively 97, 87, 97 and 80%, when applied at a dose of 1%, mixed with the insect diet.

  19. Chemical constituents and fumigant toxicity of essential oil from Carum copticum against two stored product beetles

    Institute of Scientific and Technical Information of China (English)

    BIBI ZAHRA SAHAF; SAEID MOHARRAMIPOUR; MOHAMMAD HADI MESHKATALSADAT

    2007-01-01

    Plant secondary metabolites play an important role in plant-insect interactions and therefore such compounds may have insecticidal or antifeedant activity against insects. Carum copticum C. B. Clarke (Apiaceae) is one of these plants that have medicinal effects on humans. The chemical composition of the essential oil from dry seeds of C. copticum was studied by gas chromatography (GC) and gas chromatography mass spectrometry (GC-MS). Thymol (41.34%), α-terpinolene (17.46%) and ρ-cymene (11.76%) were found to be the major constituents of the oil. In fumigant toxicity tests with the essential oil against adults of Sitophilus oryzae (L.) and Tribolium castaneum (Herbst) at 27 +-1℃ and 60%+-5% RH, it was observed that S. oryzae (LC50= 0.91 μL/L) were significantly susceptible than T. castaneum (LC50= 33.14 μL/L). The mortalities of the insect species reached 100% at concentrations higher than 185.2 μL/L and 12-h exposure time. The findings indicate the strong insecticidal activity of C. copticum oil and its potential role as a fumigant for storedproduct insects.

  20. Variation in susceptibility of laboratory and field strains of three stored-grain insect species to beta-cyfluthrin and chlorpyrifos-methyl plus deltamethrin applied to concrete surfaces

    Science.gov (United States)

    The efficacy of beta-cyfluthrin and chlorpyrifos-methyl plus deltamethrin applied to clean, concrete floors of empty bins prior to grain storage against field strains of stored-grain insects is unknown. We exposed adults of 16 strains of the red flour beetle, Tribolium castaneum (Herbst); 8 strains ...

  1. Effects of Short Exposures to Spinosad-Treated Wheat or Maize on Four Stored-Grain Insects

    Science.gov (United States)

    The effect of short exposures to spinosad-treated wheat and maize was evaluated against adults of four stored-product insects: the lesser grain borer, Rhyzopertha dominica (F.), the rice weevil, Sitophilus oryzae (L.), the red flour beetle, Tribolium castaneum (Herbst), and the psocid Lepinotus reti...

  2. Molecular identification of the first SIFamide receptor

    DEFF Research Database (Denmark)

    Jørgensen, Lars M; Hauser, Frank; Cazzamali, Giuseppe;

    2006-01-01

    . Database searches revealed SIFamide receptor orthologues in the genomes from the malaria mosquito Anopheles gambiae, the silkworm Bombyx mori, the red flour beetle Tribolium castaneum, and the honey bee Apis mellifera. An alignment of the five insect SIFamide or SIFamide-like receptors showed, again, an...

  3. Food source and residual efficacy of chlorfenapyr on sealed and unsealed concrete

    Science.gov (United States)

    Adult Tribolium castaneum (Herbst), the red flour beetle, were exposed at 1 day, and 2, 4, and 6 weeks post-treatment on sealed and unsealed concrete arenas treated with chlorfenapyr at rates of 2.8, 6.9, 13.5, 20.6, 27.5 mg active ingredient/m2. Beetles were held either with or without flour, and a...

  4. Volatile Hydrocarbon Pheromones from Beetles

    Science.gov (United States)

    This chapter reviews literature about hydrocarbons from beetles that serve as long-range pheromones. The most thoroughly studied beetles that use volatile hydrocarbon pheromones belong to the family Nitidulidae in the genera Carpophilus and Colopterus. Published pheromone research deals with behav...

  5. Beetle wings are inflatable origami

    Science.gov (United States)

    Chen, Rui; Ren, Jing; Ge, Siqin; Hu, David

    2015-11-01

    Beetles keep their wings folded and protected under a hard shell. In times of danger, they must unfold them rapidly in order for them to fly to escape. Moreover, they must do so across a range of body mass, from 1 mg to 10 grams. How can they unfold their wings so quickly? We use high-speed videography to record wing unfolding times, which we relate to the geometry of the network of blood vessels in the wing. Larger beetles have longer unfolding times. Modeling of the flow of blood through the veins successfully accounts for the wing unfolding speed of large beetles. However, smaller beetles have anomalously short unfolding times, suggesting they have lower blood viscosity or higher driving pressure. The use of hydraulics to unfold complex objects may have implications in the design of micro-flying air vehicles.

  6. Genetics of Ophraella leaf beetles

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This proposal is to collect samples of each species of Ophraella leaf beetle encountered, not to exceed 50 specimens per species, for genetic analysis using DNA...

  7. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    Here, we review Charles Darwin’s relation to beetles and developments in coleopteran systematics in the last two centuries. Darwin was an enthusiastic beetle collector. He used beetles to illustrate different evolutionary phenomena in his major works, and astonishingly, an entire sub-chapter is dedicated to beetles in “The Descent of Man”. During his voyage on the Beagle, Darwin was impressed by the high diversity of beetles in the tropics, and he remarked that, to his surprise, the majority of species were small and inconspicuous. However, despite his obvious interest in the group, he did not get involved in beetle taxonomy, and his theoretical work had little immediate impact on beetle classification. The development of taxonomy and classification in the late nineteenth and earlier twentieth century was mainly characterised by the exploration of new character systems (e.g. larval features and wing venation). In the mid-twentieth century, Hennig’s new methodology to group lineages by derived characters revolutionised systematics of Coleoptera and other organisms. As envisioned by Darwin and Ernst Haeckel, the new Hennigian approach enabled systematists to establish classifications truly reflecting evolution. Roy A. Crowson and Howard E. Hinton, who both made tremendous contributions to coleopterology, had an ambivalent attitude towards the Hennigian ideas. The Mickoleit school combined detailed anatomical work with a classical Hennigian character evaluation, with stepwise tree building, comparatively few characters and a priori polarity assessment without explicit use of the outgroup comparison method. The rise of cladistic methods in the 1970s had a strong impact on beetle systematics. Cladistic computer programs facilitated parsimony analyses of large data matrices, mostly morphological characters not requiring detailed anatomical investigations. Molecular studies on beetle phylogeny started in the 1990s with modest taxon sampling and limited DNA data

  8. The Beetle Reference Manual

    CERN Document Server

    Van Bakel, N; Van den Brand, J F J; Feuerstack-Raible, M; Harnew, N; Hofmann, W; Knöpfle, K-T; Löchner, S; Schmelling, M; Sexauer, E; Smale, N J; Trunk, U; Verkooijen, H

    2001-01-01

    This paper details the port de nitions, electrical speci cations, modes of operation and programming sequences of the 128 channel readout chip Beetle . The chip is developed for the LHCb experiment and ful lls the requirements of the silicon vertex detector, the inner tracker, the pile-up veto trigger and the RICH detector in case of multianode photomultiplier readout. It integrates 128 channels with low-noise charge-sensitive preampli ers and shapers. The risetime of the shaped pulse is 25 ns with a 30% remainder of the peak voltage after 25 ns. A comparator per channel with con gurable polarity provides a binary signal. Four adjacent comparator channels are being ORed and brought o chip via LVDS ports. Either the shaper or comparator output is sampled with the LHC-bunch-crossing frequency of 40 MHz into an analogue pipeline with a programmable latency of max. 160 sampling intervalls and an integrated derandomizing bu er of 16 stages. For analog readout data is multiplexed with up to 40 MHz onto 1 or 4 ports...

  9. EST Table: FS796464 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to putative lysosomal glucocerebrosidase [Tribolium castaneum] 10/09/09 32 %/334 aa FBpp0237202|DvirGJ227...milar to putative lysosomal glucocerebrosidase [Tribolium castaneum] FS796494 ffbm ...

  10. EST Table: BB985913 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to putative lysosomal glucocerebrosidase [Tribolium castaneum] 10/08/28 30 %/249 aa FBpp0129766|DereGG112...EDICTED: similar to putative lysosomal glucocerebrosidase [Tribolium castaneum] BB985877 MSV3 ...

  11. EST Table: CK487719 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available to putative lysosomal glucocerebrosidase [Tribolium castaneum] 10/08/30 32 %/192 aa FBpp0283246|DpseGA26980-...CTED: similar to putative lysosomal glucocerebrosidase [Tribolium castaneum] BB985877 swa ...

  12. Fumigant Components from the Essential Oil of Evodia Rutaecarpa Hort Unripe Fruits

    OpenAIRE

    Zhi Long Liu; Shu Shan Du

    2011-01-01

    Essential oil of chinese medicinal herb, Evodia rutaecarpa unripe fruits was found to possess insecticidal activity against maize weevils, Sitophilus zeamais and red flour beetles Tribolium castaneum. The essential oil of E. rutaecarpa was obtained by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS). A total of 38 components of the essential oil were identified. The principal compounds in E. rutaecarpa essential oil were β-myrcene (17.7%), (Z)-β-ocimene (14.8%), ...

  13. Effects of flour conditioning on cannibalism of T. castaneum eggs and pupae

    Science.gov (United States)

    Cannibalism is a very important factor regulating population dynamics of the red flour beetle. After several days of feeding, the flour becomes conditioned by the beetles, which can affect rates of cannibalism. Flour conditioning is caused by an accumulation of feces, pheromones, and ethylquinone, w...

  14. Disinfestation of stored rice and corn grains by gamma irradiation. 3. Survival values for irradiated rice weevil and flour beetle and comparison of gamma irradiation and fumigation of weevil infested grains

    International Nuclear Information System (INIS)

    Survival values for Sitophilus oryzae and Tribolium castaneum adults were studied using gamma radiation dosage of 25, 50, 100 and 150 krad. Results with the two species seemed similar, although the rice weevil appeared the more sensitive. Rice and corn grains were artificially infested with Sitophilus oryzae and then treated with gamma radiation or fumigation. Both treatment reduced or eliminated adult emergence although fumigation left some insecticidal residues in corn. Sterility in the adult weevils was induced by 15 or 25 krad treatment of gamma radiation. A practical control level for bulk irradiation of rice or corn grains could probably be achieved by a 25 krad treatment although complete disinfestation should be achieved by a 50 krad treatment

  15. NCBI nr-aa BLAST: CBRC-PMAR-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0383 ref|NP_001034492.1| chitin synthase 2 [Tribolium castaneum] gb|AA...Q55061.1| chitin synthase CHS2 [Tribolium castaneum] gb|AAQ62692.1| chitin synthase [Tribolium castaneum] NP_001034492.1 0.021 22% ...

  16. NCBI nr-aa BLAST: CBRC-PMAR-01-0127 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0127 ref|NP_001034492.1| chitin synthase 2 [Tribolium castaneum] gb|AA...Q55061.1| chitin synthase CHS2 [Tribolium castaneum] gb|AAQ62692.1| chitin synthase [Tribolium castaneum] NP_001034492.1 0.007 21% ...

  17. EST Table: DC551801 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 67 %/161 aa gnl|Amel|GB17664-PA 10/09/10 76 %/160 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 phe- ...

  18. EST Table: BP125083 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] gb|EEZ98786... 68 %/102 aa gnl|Amel|GB16370-PA 10/09/10 69 %/102 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fbpv ...

  19. EST Table: DC546776 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 67 %/174 aa gnl|Amel|GB17664-PA 10/09/10 77 %/173 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 phe- ...

  20. Approaches to engineer stability of beetle luciferases

    OpenAIRE

    Mikhail Koksharov; Natalia Ugarova

    2012-01-01

    Luciferase enzymes from fireflies and other beetles have many important applications in molecular biology, biotechnology, analytical chemistry and several other areas. Many novel beetle luciferases with promising properties have been reported in the recent years. However, actual and potential applications of wild-type beetle luciferases are often limited by insufficient stability or decrease in activity of the enzyme at the conditions of a particular assay. Various examples of genetic enginee...

  1. Pheromone production in bark beetles.

    Science.gov (United States)

    Blomquist, Gary J; Figueroa-Teran, Rubi; Aw, Mory; Song, Minmin; Gorzalski, Andrew; Abbott, Nicole L; Chang, Eric; Tittiger, Claus

    2010-10-01

    The first aggregation pheromone components from bark beetles were identified in 1966 as a mixture of ipsdienol, ipsenol and verbenol. Since then, a number of additional components have been identified as both aggregation and anti-aggregation pheromones, with many of them being monoterpenoids or derived from monoterpenoids. The structural similarity between the major pheromone components of bark beetles and the monoterpenes found in the host trees, along with the association of monoterpenoid production with plant tissue, led to the paradigm that most if not all bark beetle pheromone components were derived from host tree precursors, often with a simple hydroxylation producing the pheromone. In the 1990 s there was a paradigm shift as evidence for de novo biosynthesis of pheromone components began to accumulate, and it is now recognized that most bark beetle monoterpenoid aggregation pheromone components are biosynthesized de novo. The bark beetle aggregation pheromones are released from the frass, which is consistent with the isoprenoid aggregation pheromones, including ipsdienol, ipsenol and frontalin, being produced in midgut tissue. It appears that exo-brevocomin is produced de novo in fat body tissue, and that verbenol, verbenone and verbenene are produced from dietary α-pinene in fat body tissue. Combined biochemical, molecular and functional genomics studies in Ips pini yielded the discovery and characterization of the enzymes that convert mevalonate pathway intermediates to pheromone components, including a novel bifunctional geranyl diphosphate synthase/myrcene synthase, a cytochrome P450 that hydroxylates myrcene to ipsdienol, and an oxidoreductase that interconverts ipsdienol and ipsdienone to achieve the appropriate stereochemistry of ipsdienol for pheromonal activity. Furthermore, the regulation of these genes and their corresponding enzymes proved complex and diverse in different species. Mevalonate pathway genes in pheromone producing male I. pini

  2. Insecticidal Activity of the Essential Oil Isolated from Azilia eryngioides (Pau Hedge et Lamond Against Two Beetle Pests Actividad Insecticida del Aceite Esencial Aislado de Azilia eryngioides (Pau Hedge et Lamond contra Dos Escarabajos Plaga

    Directory of Open Access Journals (Sweden)

    Asgar Ebadollah

    2011-09-01

    Full Text Available A large number of plant essential oils have been used against diverse insect pests since they, unlike conventional pesticides, present no risk to humans and the environment. This study was conducted to determine the toxicity of Azilia eryngioides (Pau Hedge et Lamond (Apiaceae essential oil against 1- to 7-d-old Sitophilus granarius (L. (Curculionidae and Tribolium castaneum (Herbst (Tenebrionidae adults. The essential oil was obtained from aerial parts of the plant using a Clevenger apparatus and analyzed by gas chromatography and mass spectrometry. The major constituents of the oil were α-Pinene and bornyl acetate. Fumigation bioassays revealed that A. eryngioides oil had a strong insecticidal activity on adult test insects that were exposed to 37.03, 74.07, 111.11, and 148.14 µL L-1 to estimate mean lethal time (LT50 values. Mortality increased as concentration and exposure time increased, and reached 100% at the 39-h exposure time and concentrations higher than 111.11 µL L-1. Another experiment was designed to determine the mean lethal concentration at the 24-h exposure time (LC50-, and these values indicated that S. granarius was more susceptible than T. castaneum. It can be concluded that the essential oil of A. eryngioides has potential against two stored-product pests, S. granarius and T. castaneum.Una gran cantidad de aceites esenciales de plantas se han utilizado como agentes de control biológico contra diversos insectos plaga, ya que no presentan riesgo para los seres humanos y el medio ambiente, a diferencia de los pesticidas convencionales. Se determinó la toxicidad del aceite esencial de Azilia eryngioides (Pau Hedge et Lamond (Apiaceae contra adultos de 1 a 7 días de edad de Sitophilus granarius (L. (Curculionidae y Tribolium castaneum (Herbst (Tenebrionidae. El aceite esencial se obtuvo de las partes aéreas de la planta utilizando un aparato de Clevenger y se analizó por cromatografía de gases por espectrometría de

  3. Identification of carboxylesterase genes and their expression profiles in the Colorado potato beetle Leptinotarsa decemlineata treated with fipronil and cyhalothrin.

    Science.gov (United States)

    Lü, Feng-Gong; Fu, Kai-Yun; Li, Qian; Guo, Wen-Chao; Ahmat, Tursun; Li, Guo-Qing

    2015-07-01

    Based on the Leptinotarsa decemlineata transcriptome dataset and the GenBank sequences, 70 novel carboxylesterases and 2 acetylcholinesterases were found. The 72 members belong to a multifunctional carboxylesterase/cholinesterase superfamily (CCE). A phylogenetic tree including the 72 LdCCEs and the CCEs from Tribolium castaneum, Drosophila melanogaster and Apis mellifera revealed that all CCEs fell into three main phylogenetic groups: dietary/detoxification, hormone/semiochemical processing, and neurodevelopmental classes. Numbers of L. decemlineata CCEs in the three classes were 52, 12 and 8, respectively. The dietary/detoxification class includes two clades: coleopteran xenobiotic metabolizing and α-esterase type CCEs. CCEs in the two clades have independently expanded in L. decemlineata. The hormone/semiochemical processing class has three clades: integument CCEs, β- and pheromone CCEs and juvenile hormone CCEs. Integument CCEs in L. decemlineata have also expanded. The neurodevelopmental CCEs are implicated the most ancient class, containing acetylcholinesterase, neuroligin, neurotactin, glutactin, gliotactin and others. Among the 70 novel CCE genes, KM220566, KM220530, KM220576, KM220527 and KM220541 were fipronil-inducible, and KM220578, KM220566, KM220542, KM220564, KM220561, KM220554, KM220527, KM220538 and KM220541 were cyhalothrin-inducible. They were the candidates involving in insecticide detoxification. Moreover, our results also provided a platform to understand the functions and evolution of L. decemlineata CCE genes. PMID:26071812

  4. Improving Efficacy of Beauveria bassiana against Stored Grain Beetles with a Synergistic Co-Formulant.

    Science.gov (United States)

    Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife

    2016-01-01

    The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 10(10) conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107

  5. Long-Term Residual Efficacy of Spinetoram on Concrete and Steel Surfaces for the Management of Three Stored Product Beetle Species.

    Science.gov (United States)

    Vassilakos, Thomas N; Athanassiou, Christos G

    2015-08-01

    In this study, the residual efficacy of spinetoram on concrete and galvanized steel surfaces was evaluated under fixed laboratory conditions against the rice weevil, Sitophilus oryzae (L.), the confused flour beetle, Tribolium confusum Jacquelin du Val, and the sawtoothed grain beetle, Oryzaephilus surinamensis (L.). Spinetoram was applied at the dose rates of 0.025 and 0.1 mg (active ingredient)/cm(2), on steel surfaces that were stored in continuous darkness and on concrete surfaces that were stored either in continuous darkness or in 12:12 (L:D) photoperiod. The experimental period for the residual effect of spinetoram was 6 mo. Bioassays were conducted for all types of surfaces and storage conditions at monthly intervals starting from the initial application period (seven bioassays in total). For each bioassay, mortality of the exposed adult beetles was measured after 3 and 7 d of exposure. Among the tested species, T. confusum was the least susceptible, regardless of the surface type, storage conditions, and dose rate. Regarding the bioassays conducted in the surfaces stored in darkness, spinetoram proved very persistent and no reduction in the efficacy was noted throughout the experimental period. Moreover, there were no differences in spinetoram efficacy between the two types of surfaces. Conversely, in light [12:12 (L:D)] conditions spinetoram efficacy was notably reduced after the first month, but remained stable for the rest of the period. The results of this study indicate that spinetoram was persistent with long residual efficacy against major stored grain beetle species on the most common types of surfaces in continuous darkness, while the presence of light reduced its efficacy. PMID:26470356

  6. US Forest Service Western Bark Beetle Strategy

    Data.gov (United States)

    US Forest Service, Department of Agriculture — A map service on the www depicting Western Bark Beetle Strategy (WBBS) activities reported through the U.S. Forest Service FACTS database. Activities include...

  7. Approaches to engineer stability of beetle luciferases

    Directory of Open Access Journals (Sweden)

    Mikhail Koksharov

    2012-09-01

    Full Text Available Luciferase enzymes from fireflies and other beetles have many important applications in molecular biology, biotechnology, analytical chemistry and several other areas. Many novel beetle luciferases with promising properties have been reported in the recent years. However, actual and potential applications of wild-type beetle luciferases are often limited by insufficient stability or decrease in activity of the enzyme at the conditions of a particular assay. Various examples of genetic engineering of the enhanced beetle luciferases have been reported that successfully solve or alleviate many of these limitations. This mini-review summarizes the recent advances in development of mutant luciferases with improved stability and activity characteristics. It discusses the common limitations of wild-type luciferases in different applications and presents the efficient approaches that can be used to address these problems.

  8. American burying beetle site records : Valentine NWR

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is specific site records of American burying beetle on Valentine Nationl Wildlife Refuge to date. It includes a map of site location. A discussion...

  9. Cucurbitacins as kairomones for diabroticite beetles.

    Science.gov (United States)

    Metcalf, R L; Metcalf, R A; Rhodes, A M

    1980-07-01

    The characteristic bitter substances of the Cucurbitaceae act as kairomones for a large group of diabroticite beetles (Chrysomelidae, Galerucinae, Luperini), promoting host selection and compulsive feeding behavior. These beetles (e.g., Diabrotica undecimpunctata howardi) respond to as little as 1 ng of cucurbitacin (Cuc) B on thin-layer plates by arrest and compulsive feeding. Six species of diabroticite beetles were about 10 times more responsive to Cuc B than to Cuc E and less responsive to Cuc D, I, and L. Chloroform extracts of 18 species of Cucurbita were developed on thin-layer chromatograms and exposed to diabroticite beetles. The feeding patterns showed pronounced beetle responses to three general Cuc distribution patterns: Cuc B and D as in Cucurbita andreana and C. ecuadorensis; Cuc E and I as in C. okeechobeensis and C. martinezii; and Cuc E glycoside in C. texana. All the diabroticites responded in exactly the same feeding patterns. The results demonstrate a coevolutionary association between the Cucurbitaceae and the Luperini, during which the intensely bitter and toxic Cucs that arose to repel herbivores and protect the plants from attack became specific kairomone feeding stimulants for the beetles. PMID:16592849

  10. Effect of gamma radiation treatment on the mortality of the flour beetle

    International Nuclear Information System (INIS)

    Research has been carried out for many years on the disinfestation of stored agricultural products. Recently, such investigations have been initiated at the Gamma Irradiation Center of the Atomic Energy Organization of Iran. The red flour beetle (Tribolium confusum) is the most common and most destructive pest of wheat, wheat flour and other stored grains in Iran. Different stages in the development of the red flour beetle were exposed to various doses of gamma radiation and the effects of the doses have been studied. A cobalt-60 source was used for irradiation. Five doses in the range of 0.1-1.5 kGy were used. The doses were delivered at a rate of 0.6 kGy/h. Insects were obtained from the northern regions of Iran and reared in an incubator in the laboratory. The research objectives included: (1) determining the doses of radiation required to destroy red flour beetles at their various stages of development; (2) determining the physical and chemical changes of wheat flour corresponding to the required dose level. In the paper, the radiosensitivity of various stages (larvae, pupae and adults) is discussed. At 0.1 and 0.25 kGy, the mortality rate increased in the range of 15 to 20 times more than that of the control group during the 20 d period. During one week, post-irradiation mortality rates of 15, 40 and 100% at 0.5, 1 and 1.5 kGy dose levels, respectively, were observed. The pupae were more sensitive than were larvae and adults. One hundred per cent mortality at 0.1, 0.25, 0.5, 1 and 1.5 kGy was observed at 23, 21, 19, 11 and 7 days post-irradiation. The lethal dose 50 (LD50) obtained (8 d) at 30 deg. C temperature was 1 kGy. Doses of 0.25 kGy sterilized the males and females, but at 0.10 kGy, mating took place and viable eggs were produced and hatched. (author). 7 refs, 2 tabs

  11. Experimental study of the efficiency of a reduced index in Tribolium

    Directory of Open Access Journals (Sweden)

    Turrado Herminio

    2000-09-01

    Full Text Available Abstract The relative efficiency of a reduced index (IR relative to a full index (IF was compared in an experiment with Tribolium. The selection objective included pupal length, adult weight, and egg mass. The reduced index was based on pupal length and adult weight, whereas the full index was based on these traits and also on egg mass. There were five generations of selection with four replicates, and a selected proportion of 20%. For each replicate, an unselected control was produced. Responses were significant in the IF and IR lines. Responses for the selection objective differed significantly between lines (p

  12. Volatile emissions from the lesser mealworm beetle Alphitobius diaperinus

    Science.gov (United States)

    The lesser mealworm beetle Alphitobius diaperinus (Panzer) is a serious, cosmopolitan pest in poultry production facilities, consuming grain, carrying disease organisms, and causing structural damage in poultry house walls. Pheromones have been described for many economically important beetle speci...

  13. Small hive beetles survive in honeybee prisons by behavioural mimicry

    Science.gov (United States)

    Ellis, J. D.; Pirk, C. W. W.; Hepburn, H. R.; Kastberger, G.; Elzen, P. J.

    2002-05-01

    We report the results of a simple experiment to determine whether honeybees feed their small hive beetle nest parasites. Honeybees incarcerate the beetles in cells constructed of plant resins and continually guard them. The longevity of incarcerated beetles greatly exceeds their metabolic reserves. We show that survival of small hive beetles derives from behavioural mimicry by which the beetles induce the bees to feed them trophallactically. Electronic supplementary material to this paper can be obtained by using the Springer LINK server located at htpp://dx.doi.org/10.1007/s00114-002-0326-y.

  14. Dispersal of the spruce beetle, `dendroctonus rufipennis`, and the engraver beetle, `ips perturbatus`, in Alaska. Forest Service research paper

    Energy Technology Data Exchange (ETDEWEB)

    Werner, R.A.; Holsten, E.H.

    1997-09-01

    Mark-release-recapture experiments were performed with spruce beetles (Dendroctonus rufipennis (Kirby)) and Ips engraver beetles (Ips perturbatus (Eichhoff)) to determine distance and direction of dispersal. The recapture rate of beetles marked with fluorescent powder was extremely low. Most I. perturbatus beetles dispersed up to 30 m from their overwintering sites compared to most D. rufipennis, which dispersed from 90 to 300 m. Ips perturbatus beetles were caught up to 90 m and D. rufipennis up to 600 m from the point of release.

  15. Pathogens, promising candidates for bark beetle control

    Czech Academy of Sciences Publication Activity Database

    Wegensteiner, R.; Weiser, Jaroslav

    Georgetown: International Union of Forestry Research Organizations., 2003. s. 35. [Integrated Control of Scolytid Bark Beetles.. 29.09.2003-02.10.2003, Georgetown] Institutional research plan: CEZ:AV0Z5007907 Keywords : Rhizopoda * Sporozoa Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection

  16. Molecular phylogeny of beetle associated diplogastrid nematodes suggests host switching rather than nematode-beetle coevolution

    Directory of Open Access Journals (Sweden)

    Sommer Ralf J

    2009-08-01

    Full Text Available Abstract Background Nematodes are putatively the most species-rich animal phylum. They have various life styles and occur in a variety of habitats, ranging from free-living nematodes in aquatic or terrestrial environments to parasites of animals and plants. The rhabditid nematode Caenorhabditis elegans is one of the most important model organisms in modern biology. Pristionchus pacificus of the family of the Diplogastridae has been developed as a satellite model for comparison to C. elegans. The Diplogastridae, a monophyletic clade within the rhabditid nematodes, are frequently associated with beetles. How this beetle-association evolved and whether beetle-nematode coevolution occurred is still elusive. As a prerequisite to answering this question a robust phylogeny of beetle-associated Diplogastridae is needed. Results Sequences for the nuclear small subunit ribosomal RNA and for 12 ribosomal protein encoding nucleotide sequences were collected for 14 diplogastrid taxa yielding a dataset of 5996 bp of concatenated aligned sequences. A molecular phylogeny of beetle-associated diplogastrid nematodes was established by various algorithms. Robust subclades could be demonstrated embedded in a phylogenetic tree topology with short internal branches, indicating rapid ancestral divergences. Comparison of the diplogastrid phylogeny to a comprehensive beetle phylogeny revealed no major congruence and thus no evidence for a long-term coevolution. Conclusion Reconstruction of the phylogenetic history of beetle-associated Diplogastridae yields four distinct subclades, whose deep phylogenetic divergence, as indicated by short internal branch lengths, shows evidence for evolution by successions of ancient rapid radiation events. The stem species of the Diplogastridae existed at the same time period when the major radiations of the beetles occurred. Comparison of nematode and beetle phylogenies provides, however, no evidence for long-term coevolution of

  17. Confinement of small hive beetles (Aethina tumida) by Cape honeybees (Apis mellifera capensis)

    OpenAIRE

    James D. Ellis Jr.,; Hepburn, Randall; Elzen, Patti

    2004-01-01

    International audience In this study we quantify small hive beetle (Aethina tumida Murray) and Cape honeybee (A.m. capensis Esch., an African subspecies) behaviours that are associated with beetle confinement in an effort to understand why Cape bees can withstand large beetle infestations. Four observation hives were each inoculated with 25 beetles and were observed for 11-17 days. Data collected included guard bee (worker bees who guard beetle confinement sites) and confined beetle behavi...

  18. Effect of four Rearing Diets and Gamma irradiation on larval growth rate and the development of the confused flour beetle Tribolium Confusum (DUV)

    International Nuclear Information System (INIS)

    The effects of rearing diet and gamma irradiation on the growth rate development of T. Confusum were investigated. The test larvae were fed on four different rearing diets. Three-day old eggs were irradiated by dosages 20, 40 and 60 Gy. There was a variation of the weight gain, feeding period, and growth rate of larvae according to the effect of rearing diet. when larvae were fed on wheat bran, the highest growth rate was recorded. There is an inverse relationship between the weight gain, the growth rate of larvae and the dosage dosage of gamma ray. The feeding period increased as the doses increased from 0.0 -60 Gy. The average number number of the total progeny depends on the type of the rearing diet. Samples of the diets were analyzed to determine protein % and carbohydrate % which were higher in flour extraction. The moisture %, total fiber %, ash content %, most minerals and vitamins were found in higher content as bran only used

  19. Dung beetle database: comparison with other invertebrate transcriptomes

    OpenAIRE

    Khanyile, Lucky M; Hull, Rodney; Ntwasa, Monde

    2008-01-01

    The dung beetle E. intermedius, a member of the highly diverse order, Coleoptera has immense economic benefits. It was estimated that insect ecological services in the United States amounted to some $60 billion in 2006 with dung beetles being major contributors. E. intermedius may be endowed with a robust immune system given its microbe-rich habitat. Dung beetles live on juice and microbes from the dung and are therefore, potential models for the study of infectious agents and ecological dama...

  20. The bacterial community of entomophilic nematodes and host beetles.

    Science.gov (United States)

    Koneru, Sneha L; Salinas, Heilly; Flores, Gilberto E; Hong, Ray L

    2016-05-01

    Insects form the most species-rich lineage of Eukaryotes and each is a potential host for organisms from multiple phyla, including fungi, protozoa, mites, bacteria and nematodes. In particular, beetles are known to be associated with distinct bacterial communities and entomophilic nematodes. While entomopathogenic nematodes require symbiotic bacteria to kill and reproduce inside their insect hosts, the microbial ecology that facilitates other types of nematode-insect associations is largely unknown. To illuminate detailed patterns of the tritrophic beetle-nematode-bacteria relationship, we surveyed the nematode infestation profiles of scarab beetles in the greater Los Angeles area over a five-year period and found distinct nematode infestation patterns for certain beetle hosts. Over a single season, we characterized the bacterial communities of beetles and their associated nematodes using high-throughput sequencing of the 16S rRNA gene. We found significant differences in bacterial community composition among the five prevalent beetle host species, independent of geographical origin. Anaerobes Synergistaceae and sulphate-reducing Desulfovibrionaceae were most abundant in Amblonoxia beetles, while Enterobacteriaceae and Lachnospiraceae were common in Cyclocephala beetles. Unlike entomopathogenic nematodes that carry bacterial symbionts, insect-associated nematodes do not alter the beetles' native bacterial communities, nor do their microbiomes differ according to nematode or beetle host species. The conservation of Diplogastrid nematodes associations with Melolonthinae beetles and sulphate-reducing bacteria suggests a possible link between beetle-bacterial communities and their associated nematodes. Our results establish a starting point towards understanding the dynamic interactions between soil macroinvertebrates and their microbiota in a highly accessible urban environment. PMID:26992100

  1. What is Next in Bark Beetle Phylogeography?

    Directory of Open Access Journals (Sweden)

    Dimitrios N. Avtzis

    2012-05-01

    Full Text Available Bark beetle species within the scolytid genera Dendroctonus, Ips, Pityogenes and Tomicus are known to cause extensive ecological and economical damage in spruce and pine forests during epidemic outbreaks all around the world. Dendroctonus ponderosae poses the most recent example having destroyed almost 100,000 km2 of conifer forests in North America. The success and effectiveness of scolytid species lies mostly in strategies developed over the course of time. Among these, a complex system of semiochemicals promotes the communication and aggregation on the spot of infestation facilitating an en masse attack against a host tree’s defenses; or an association with fungi that evolved either in the form of nutrition (ambrosia fungi or even by reducing the resistance of host trees (blue-stain fungi. Although often specific to a tree genus or species, some bark beetles are polyphagous and have the ability to switch on to new hosts and extend their host range (i.e., between conifer genera such as Pityogenes chalcographus or even from conifer to deciduous trees as Polygraphus grandiclava. A combination of these capabilities in concert with life history or ecological traits explains why bark beetles are considered interesting subjects in evolutionary studies. Several bark beetle species appear in phylogeographic investigations, in an effort to improve our understanding of their ecology, epidemiology and evolution. In this paper investigations that unveil the phylogeographic history of bark beetles are reviewed. A close association between refugial areas and postglacial migration routes that insects and host trees have followed in the last 15,000 BP has been suggested in many studies. Finally, a future perspective of how next generation sequencing will influence the resolution of phylogeographic patterns in the coming years is presented. Utilization of such novel

  2. EST Table: FS762128 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS762128 E_FL_fcaL_29K18_F_0 10/09/28 41 %/220 aa ref|XP_974945.1| PREDICTED: similar to elbow... [Tribolium castaneum] gb|EEZ99244.1| elbow B [Tribolium castaneum] 10/09/08 30 %/207 aa FBpp0232.../220 aa gi|91076862|ref|XP_974945.1| PREDICTED: similar to elbow [Tribolium castaneum] BP116537 fcaL ...

  3. EST Table: FS878759 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS878759 E_FL_ftes_13I21_F_0 10/09/28 36 %/150 aa ref|NP_001137203.1| bloated tubul...es [Tribolium castaneum] gb|ACH86322.1| bloated tubules [Tribolium castaneum] 10/09/11 32 %/160 aa FBpp01275...:AGAP004932 10/09/10 low homology 10/09/10 36 %/150 aa gi|198386300|gb|ACH86322.1| bloated tubules [Tribolium castaneum] FS928389 ftes ...

  4. EST Table: FS888260 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS888260 E_FL_ftes_41L16_F_0 10/09/28 35 %/160 aa ref|NP_001137203.1| bloated tubul...es [Tribolium castaneum] gb|ACH86322.1| bloated tubules [Tribolium castaneum] 10/09/12 32 %/163 aa FBpp01275...:AGAP004932 10/09/10 low homology 10/09/10 35 %/160 aa gi|198386300|gb|ACH86322.1| bloated tubules [Tribolium castaneum] FS928389 ftes ...

  5. EST Table: DC545455 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC545455 E_FL_phe-_03C18_F_0 10/09/28 36 %/150 aa ref|NP_001137203.1| bloated tubul...es [Tribolium castaneum] gb|ACH86322.1| bloated tubules [Tribolium castaneum] 10/09/02 32 %/160 aa FBpp01275...:AGAP004932 10/09/10 low homology 10/09/10 36 %/150 aa gi|198386300|gb|ACH86322.1| bloated tubules [Tribolium castaneum] FS928389 phe- ...

  6. EST Table: FS760075 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 65 %/156 aa gnl|Amel|GB17664-PA 10/09/10 74 %/155 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fcaL ...

  7. EST Table: FS925839 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 83 %/196 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  8. EST Table: FS934387 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  9. EST Table: FY757896 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 66 %/222 aa gnl|Amel|GB17664-PA 11/11/04 71 %/232 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 famL ...

  10. EST Table: FS923498 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 84 %/194 aa gnl|Amel|GB16370-PA 10/09/10 86 %/193 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  11. EST Table: FS777069 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 63 %/216 aa gnl|Amel|GB17664-PA 10/09/10 69 %/226 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 fcaL ...

  12. EST Table: FS762540 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 68 %/183 aa gnl|Amel|GB17664-PA 10/09/10 77 %/183 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fcaL ...

  13. EST Table: FS933586 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 69 %/210 aa gnl|Amel|GB17664-PA 10/09/10 77 %/209 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  14. EST Table: FS921402 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  15. EST Table: FS931305 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  16. EST Table: DC556509 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...3:29203672:1|gene:AGAP002909 10/09/10 81 %/143 aa gnl|Amel|GB16370-PA 10/09/10 84 %/141 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 wd-- ...

  17. EST Table: DC547346 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...3:29203672:1|gene:AGAP002909 10/09/10 83 %/154 aa gnl|Amel|GB16370-PA 10/09/10 84 %/152 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 phe- ...

  18. EST Table: FS936167 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 69 %/215 aa gnl|Amel|GB17664-PA 10/09/10 76 %/214 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  19. EST Table: FS939021 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 68 %/217 aa gnl|Amel|GB17664-PA 10/09/10 75 %/216 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  20. EST Table: FS933173 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  1. EST Table: FY759828 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 63 %/179 aa gnl|Amel|GB17664-PA 11/11/04 68 %/189 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 famL ...

  2. EST Table: FY738547 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 65 %/222 aa gnl|Amel|GB17664-PA 11/11/04 70 %/237 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 famL ...

  3. EST Table: FS754257 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 64 %/215 aa gnl|Amel|GB17664-PA 10/09/10 69 %/225 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 caL- ...

  4. EST Table: FS758787 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 84 %/190 aa gnl|Amel|GB16370-PA 10/09/10 86 %/188 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fcaL ...

  5. EST Table: FS748683 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 65 %/214 aa gnl|Amel|GB17664-PA 10/09/10 71 %/214 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 caL- ...

  6. EST Table: FS926679 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  7. EST Table: FY762662 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 63 %/169 aa gnl|Amel|GB17664-PA 11/11/04 69 %/179 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 famL ...

  8. EST Table: DC438513 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 67 %/161 aa gnl|Amel|GB17664-PA 10/09/10 76 %/160 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 epM- ...

  9. EST Table: FS923994 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 84 %/194 aa gnl|Amel|GB16370-PA 10/09/10 86 %/193 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  10. EST Table: FS929767 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 66 %/127 aa gnl|Amel|GB17664-PA 10/09/10 72 %/126 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  11. EST Table: FS936705 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...3:29203672:1|gene:AGAP002909 10/09/10 70 %/172 aa gnl|Amel|GB16370-PA 10/09/10 73 %/170 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  12. EST Table: FS929662 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  13. EST Table: FY744829 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 68 %/207 aa gnl|Amel|GB17664-PA 11/11/04 77 %/206 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 famL ...

  14. EST Table: AU004990 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available us to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] gb|EEZ98786....|gene:AGAP002909 10/09/10 82 %/156 aa gnl|Amel|GB16370-PA 10/09/10 85 %/154 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 ws3 ...

  15. EST Table: FS933867 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...3:29203672:1|gene:AGAP002909 10/09/10 84 %/171 aa gnl|Amel|GB16370-PA 10/09/10 86 %/169 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  16. EST Table: DC436713 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 67 %/161 aa gnl|Amel|GB17664-PA 10/09/10 76 %/160 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 epM- ...

  17. EST Table: DC435786 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 67 %/161 aa gnl|Amel|GB17664-PA 10/09/10 76 %/160 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 epM- ...

  18. EST Table: BY928153 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS891693 fcP8 ...

  19. EST Table: FY750570 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 68 %/197 aa gnl|Amel|GB17664-PA 11/11/04 77 %/196 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 famL ...

  20. EST Table: FS938656 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 66 %/180 aa gnl|Amel|GB17664-PA 10/09/10 75 %/179 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  1. EST Table: FS922092 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 84 %/194 aa gnl|Amel|GB16370-PA 10/09/10 86 %/193 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  2. EST Table: FY743942 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 11/11/04 84 %/194 aa gnl|Amel|GB16370-PA 11/11/04 86 %/193 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 famL ...

  3. EST Table: FY752330 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 11/11/04 66 %/210 aa gnl|Amel|GB17664-PA 11/11/04 70 %/220 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 famL ...

  4. EST Table: FS938066 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...3:29203672:1|gene:AGAP002909 10/09/10 83 %/187 aa gnl|Amel|GB16370-PA 10/09/10 86 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  5. EST Table: BY928142 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/185 aa gnl|Amel|GB16370-PA 10/09/10 87 %/183 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS891693 fcP8 ...

  6. EST Table: FS923432 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castaneum] ...R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 87 %/185 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  7. EST Table: DC433839 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available tein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castaneum] g...:43321197:-1|gene:AGAP009790 10/09/10 68 %/178 aa gnl|Amel|GB17664-PA 10/09/10 77 %/177 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 epM- ...

  8. EST Table: DC539837 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC539837 E_FL_dpe-_03A08_F_0 10/09/28 50 %/113 aa ref|XP_970926.1| PREDICTED: similar to wind...beutel CG7225-PA [Tribolium castaneum] gb|EFA09214.1| windbeutel [Tribolium castaneum] 10/09/02 46...aa gi|91087911|ref|XP_970926.1| PREDICTED: similar to windbeutel CG7225-PA [Tribolium castaneum] FS904508 dpe- ...

  9. EST Table: CK543352 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CK543352 rswhb0_010139.y1 10/09/29 49 %/150 aa ref|XP_970926.1| PREDICTED: similar to wind...beutel CG7225-PA [Tribolium castaneum] gb|EFA09214.1| windbeutel [Tribolium castaneum] 10/08/31 43 %/...gi|91087911|ref|XP_970926.1| PREDICTED: similar to windbeutel CG7225-PA [Tribolium castaneum] FS904508 swh ...

  10. EST Table: CK492091 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CK492091 rswab0_010833.y1 10/09/29 53 %/139 aa ref|XP_970926.1| PREDICTED: similar to wind...beutel CG7225-PA [Tribolium castaneum] gb|EFA09214.1| windbeutel [Tribolium castaneum] 10/08/30 43 %/...gi|91087911|ref|XP_970926.1| PREDICTED: similar to windbeutel CG7225-PA [Tribolium castaneum] FS904508 swa ...

  11. EST Table: FS803120 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS803120 E_FL_fmgV_11I07_F_0 10/09/28 74 %/111 aa ref|NP_001034501.1| extradenticle... [Tribolium castaneum] emb|CAD57734.1| extradenticle [Tribolium castaneum] 10/09/09 68 %/113 aa FBpp0123364|...XD_ANOGA 10/09/10 low homology 10/09/10 74 %/111 aa gi|38490515|emb|CAD57734.1| extradenticle [Tribolium castaneum] FS924788 fmgV ...

  12. Influence of fumigant applying height on the mortality of Tribolium castaneum(Herbst) and Rhyzopertha dominica(Fabricius) adults exposed to ethyl formate%甲酸乙酯的施药高度对仓内空间杀虫效果的影响

    Institute of Scientific and Technical Information of China (English)

    王斌; 王殿轩; 唐多; 于志刚; 连桂荣; 洪玉程; 袁林

    2011-01-01

    在储粮容量7000t的高大平房仓空仓内,设置一个高7.50 m、直径300mm的熏蒸室,分别在7.50m、5.61m、3.74m、1.87m和0.1m的高度放置试虫,先后从0.10m、3.74m和7.50m的高度施药,测定了甲酸乙酯对处于不同高度的赤拟谷盗(Tribolium castaneum(Herbst))和谷蠹(Rhyzopertha dominica(Fabricius))成虫的杀虫效果。结果为:在0.10m高度施药,甲酸乙酯对于靠近施药点的试虫可完全致死,而在1.87m及其以上高度处的害虫死亡%The influence of applying height of ethyl formate on mortality of Tribolium castaneum(Herbst) and Rhyzopertha dominica(Fabricius) was examined in a fumigation chamber that is 300 millimeter in diameter and 7500 millimeter in height which was located in a horizontal storage that capacity is 7000 t of wheat.The insect cages were hanged in the fumigation chamber with the height of 7.50 m、5.61 m、3.74 m、1.87 m和 0.1 m separately.The results involved in that there was a full mortality of insect cages on the bottom of the chamber when fumigant was applied in the height of 0.10 meter.The insect died a little on the level of 1.87 meter high above the ethyl formate applying position.There was an increasing of insect mortality both for T.castaneum and R.dominica with the height lowing for 3.74m fumigant applying.Furthermore,the mortality of R.dominica was 100% for each applying height.While that of T.castaneum was 100%,96.7% and 81.0% for the insect height of 0.10m,1.87m and 3.74m respectively.After fumigant applying in the height of 7.50 m,the mortality was less and less with the going up of insect location.The results indicate that ethyl formate can kill the insect quickly near the applied fumigant.It is difficulty to kill the insect above two meters high after applying.There existed an obvious phenomenon that ethyl format can go down rapidly after applying in space fumigation.It is necessary that some mixing techniques should be used in space

  13. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  14. Disinfestation of whole and ground spices by gamma-irradiation

    International Nuclear Information System (INIS)

    Number of insect species were identified in chilli (Capsicum annum Linn), turmeric (Curcuma longa Linn), ginger (Zingiber officinale Roscoe), pepper (Piper nigrum Linn) and coriander (Coriandrum sativum) and also in two commercial brands of prepacked ground spices. Lasioderma serricorne (Cigarette beetle), Oryzaephilus surinamensis (Saw toothed grain beetle), Rhizopertha dominica (Lesser grain borer), Sitotroga cerealella (Angoumois grain moth) and Tribolium castaneum (Red flour beetle) were the predominant pest species found in these spices. Exposure of spices to Co60 gamma irradiation at 1 kGy dose level did not show adult emergence of insects in these species during storage at ambient temperature (28-30degC) indicating that the radiation dose (10 kGy) that has been shown to be effective for microbial decontamination of spices destroys insect pests as well. (author). 8 refs

  15. Chemical Composition and Bioactivity of Essential Oil of Atalantia guillauminii against Three Species Stored Product Insects.

    Science.gov (United States)

    Yang, Kai; You, Chun-Xue; Wang, Cheng-Fang; Lei, Ning; Guo, Shan-Shan; Geng, Zhu-Feng; Du, Shu-Shan; Ma, Ping; Deng, Zhi-Wei

    2015-01-01

    The toxic and repellent activities of the essential oil extracted from the leaves of Atalantia guillauminii Swingle were evaluated against three stored product insects, red flour beetles (Tribolium castaneum), cigarette beetles (Lasioderma serricorne) and booklice (Liposcelis bostrychophila). The essential oil obtained by hydrodistillation was investigated by GC-MS. The main constituents of the essential oil were β-thujene (27.18%), elemicin (15.03%), eudesma-3, 7(11)-diene (9.64%), followed by (-)-4-terpeniol (6.70%) and spathulenol (5.25%). The crude oil showed remarkable contact toxicity against T. castaneum, L. serricorne adults and L. bostrychophila with LD50 values of 17.11, 24.07 µg/adult and 55.83 µg/cm(2) respectively and it also displayed strong fumigant toxicity against T. castaneum, L. serricorne adults with LC50 values of 17.60 and 12.06 mg/L respectively, while weak fumigant toxicity against L. bostrychophila with a LC50 value of 16.75 mg/L. Moreover, the essential oil also exhibited the same level repellency against the three stored product insects, relative to the positive control, DEET. At the same concentrations, the essential oil was more repellent to T. castaneum than to L. serricorne. Thus, the essential oil of A. guillauminii may be potential to be developed as a new natural fumigant/repellent in the control of stored product insects. PMID:26369599

  16. Evolution of exocrine chemical defense in leaf beetles (Coleoptera: Chrysomelidae)

    OpenAIRE

    Pasteels, Jacques M.; Rowell-Rahier, Martine; Braekman, J.C.; Daloze, D.; Duffey, S.

    2009-01-01

    In this review we speculate on possible scenarios for the evolution of the very high diversity in chemical compounds liberated by exocrine glands of adults Chrysomelidae. Shift in host plant affinities and subsequent adaptation of the beetles to the plant toxins strongly influence the nature of the beetles' chemical defense.

  17. Cucumber Beetle Antifeedants: Laboratory Screening of Natural Products

    OpenAIRE

    Reed, D. K.; Jacobson, M.; Warthen, J. D. Jr; Uebel, E. C.; Tromley, N. J.; Jurd, L.; Freedman, B

    1981-01-01

    Cucumber beetles are destructive pests of melons in the Midwest both because of their feeding and transmission of bacterial wilt disease. Because an effective antifeedant would be an ideal control measure, more than 350 materials of biological origin have been screened against striped cucumber beetle. Such materials as neem derivatives, neriifolin, -tung, and napthoquinones appear promising and will be tested more extensively.

  18. Observations on the Life History of Small Hive Beetles

    Science.gov (United States)

    DeGuzman, L.I.& A.M. Frake. Observations on the Life History of Small Hive Beetles - The life history of small hive beetles (SHB) kept in an incubator (34ºC) and at room temperature (24-28ºC) was compared. Six slides of eggs, obtained using the glass slide technique, were placed individually in rear...

  19. Formulating entompathogens for control of boring beetles in avocado orchards

    Science.gov (United States)

    A foam formulation of Beauveria bassiana was adapted to control boring beetles in avocado orchards. The two geographically independent avocado growing areas in the United States are threatened by emerging diseases vectored by boring beetles. In the California growing region, Fusarium dieback is vect...

  20. Improvement of the Insecticidal Capacity of Two Purpureocillium Lilacinum Strains against Tribolium Confusum

    Science.gov (United States)

    Barra, Paula; Etcheverry, Miriam; Nesci, Andrea

    2015-01-01

    Entomopathogenic fungi can regulate insect populations. They have extracellular enzymes that degrade cuticle components, mainly hydrocarbons, used as an energy source. The increase in insecticidal activity of fungi in a medium supplemented with cuticular hydrocarbons was assayed and the hydrolytic enzyme profiles of two strains of Purpureocillium lilacinum were evaluated. A spore suspension of P. lilacinum was inoculated in Petri plates with different values (0.99–0.97–0.95) of water activity (Aw) using the substrates gelatin, starch and tween-20. Growth rate on the different substrates and the enzymatic activity index for proteases, amylases and lipases at different incubation times, pH and Aw, was evaluated. Moreover, the insecticidal efficiency of strains grown in media supplemented with n-hexadecane and n-octacosane was analyzed. LT50 was calculated against adults of Tribolium confusum and showed that mortality increased about 15% when the strains grew in amended culture medium. High amylolytic activity was detected, but proteases were the main enzymes produced. Optimal protease production was observed in a range of acid and alkaline pH and lower Aw. The greatest growth rate was obtained in presence of gelatin. Lipase and amylase production was detected in small amounts. Fungal growth in media with hydrocarbon mixtures increased the pathogenicity of the two strains of P. lilacinum, with the strain JQ926223 being more virulent. The information obtained is important for achieving both an increase in insecticidal capacity and an understanding of physiological adaptation of the fungus. PMID:26463076

  1. Structure of Phoretic Mite Assemblages Across Subcortical Beetle Species at a Regional Scale.

    Science.gov (United States)

    Pfammatter, Jesse A; Coyle, David R; Gandhi, Kamal J K; Hernandez, Natalie; Hofstetter, Richard W; Moser, John C; Raffa, Kenneth F

    2016-02-01

    Mites associated with subcortical beetles feed and reproduce within habitats transformed by tree-killing herbivores. Mites lack the ability to independently disperse among these habitats, and thus have evolved characteristics that facilitate using insects as transport between resources. Studies on associations between mites and beetles have historically been beetle-centric, where an assemblage of mite species is characterized on a single beetle species. However, available evidence suggests there may be substantial overlap among mite species on various species of beetles utilizing similar host trees. We assessed the mite communities of multiple beetle species attracted to baited funnel traps in Pinus stands in southern Wisconsin, northern Arizona, and northern Georgia to better characterize mite dispersal and the formation of mite-beetle phoretic associations at multiple scales. We identified approximately 21 mite species totaling 10,575 individuals on 36 beetle species totaling 983 beetles. Of the mites collected, 97% were represented by eight species. Many species of mites were common across beetle species, likely owing to these beetles' common association with trees in the genus Pinus. Most mite species were found on at least three beetle species. Histiostoma spp., Iponemus confusus Lindquist, Histiogaster arborsignis Woodring and Trichouropoda australis Hirschmann were each found on at least seven species of beetles. While beetles had largely similar mite membership, the abundances of individual mite species were highly variable among beetle species within each sampling region. Phoretic mite communities also varied within beetle species between regions, notably for Ips pini (Say) and Ips grandicollis (Eichhoff). PMID:26496952

  2. Curcurbita pepo subspecies delineates striped cucumber beetle (Acalymma vittatum) preference

    Science.gov (United States)

    Brzozowski, L; Leckie, B M; Gardner, J; Hoffmann, M P; Mazourek, M

    2016-01-01

    The striped cucumber beetle (Acalymma vittatum (F.)) is a destructive pest of cucurbit crops, and management could be improved by host plant resistance, especially in organic farming systems. However, despite the variation in striped cucumber beetle preference observed within the economically important species, Cucurbita pepo L., plant breeders and entomologists lacked a simple framework to classify and exploit these differences. This study used recent phylogenetic evidence and bioassays to organize striped cucumber beetle preference within C. pepo. Our results indicate preference contrasts between the two agriculturally relevant subspecies: C. pepo subsp. texana and C. pepo subsp. pepo. Plants of C. pepo subsp. pepo were more strongly preferred than C. pepo subsp. texana plants. This structure of beetle preference in C. pepo will allow plant breeders and entomologists to better focus research efforts on host plant non-preference to control striped cucumber beetles. PMID:27347423

  3. Spruce Beetle Biology, Ecology and Management in the Rocky Mountains: An Addendum to Spruce Beetle in the Rockies

    Directory of Open Access Journals (Sweden)

    Michael J. Jenkins

    2014-01-01

    Full Text Available Spruce beetle outbreaks have been reported in the Rocky Mountains of western North America since the late 1800s. In their classic paper, Spruce Beetle in the Rockies, Schmid and Frye reviewed the literature that emerged from the extensive outbreaks in Colorado in the 1940s. A new wave of outbreaks has affected Rocky Mountain subalpine spruce-fir forests beginning in the mid-1980s and continuing to the present. These outbreaks have spurred another surge of basic and applied research in the biology, ecology and management of spruce and spruce beetle populations. This paper is a review of literature on spruce beetle focusing on work published since the late 1970s and is intended as an addendum to Spruce Beetle in the Rockies.

  4. Improvement of the Insecticidal Capacity of Two Purpureocillium Lilacinum Strains against Tribolium Confusum

    Directory of Open Access Journals (Sweden)

    Paula Barra

    2015-03-01

    Full Text Available Entomopathogenic fungi can regulate insect populations. They have extracellular enzymes that degrade cuticle components, mainly hydrocarbons, used as an energy source. The increase in insecticidal activity of fungi in a medium supplemented with cuticular hydrocarbons was assayed and the hydrolytic enzyme profiles of two strains of Purpureocillium lilacinum were evaluated. A spore suspension of P. lilacinum was inoculated in Petri plates with different values (0.99–0.97–0.95 of water activity (Aw using the substrates gelatin, starch and tween-20. Growth rate on the different substrates and the enzymatic activity index for proteases, amylases and lipases at different incubation times, pH and Aw, was evaluated. Moreover, the insecticidal efficiency of strains grown in media supplemented with n-hexadecane and n-octacosane was analyzed. LT50 was calculated against adults of Tribolium confusum and showed that mortality increased about 15% when the strains grew in amended culture medium. High amylolytic activity was detected, but proteases were the main enzymes produced. Optimal protease production was observed in a range of acid and alkaline pH and lower Aw. The greatest growth rate was obtained in presence of gelatin. Lipase and amylase production was detected in small amounts. Fungal growth in media with hydrocarbon mixtures increased the pathogenicity of the two strains of P. lilacinum, with the strain JQ926223 being more virulent. The information obtained is important for achieving both an increase in insecticidal capacity and an understanding of physiological adaptation of the fungus.

  5. Role of oxygen in enhancement in repair of radiation injuries in Tribolium

    International Nuclear Information System (INIS)

    The oxygen enhancement ratio (OER) was determined for various biological responses in Tribolium confusum McGill Black. The biological responses included acute lethality of the adults and larvae; sexual sterilization of the male and female adults; fecundity of the females and hatchability of their eggs as well as the competitiveness of the males. The OER for acute lethality for the male and female adults was found to be 2.25-2.38, regardless of the type of inert gas used to achieve anaerobiosis. Acute lethality for the larvae showed an OER of 2.79. The OER for male and female sexual sterilization was 2.35 and 3.37 respectively. With irradiation carried out in oxygen, the results suggested that at the tissue level of the adults and the male reproductive organ, there is a certain degree of hypoxia. Sexual sterilization of the males by radiation is attributed to the induction of dominant lethal mutation in the sperms, and that of the females involves a combination of dominant lethals and decreased egg production. The OER for egg hatchability at a hatchability level of 50% of the control for irradiated females was 4.0, a surprisingly higher value than that of any other biological responses studied. The OER for fecundity of irradiated females and for male competitiveness were roughly estimated to be 2.8 and 2.3-2.7 respectively. Since the OER for male sexual sterilization is basically the same as that for acute lethality for adults, it is expected that the competitiveness, which depends on the amount of somatic damage by radiation, will not be protected to a much greater extent by anaerobic irradiation than sterilization. It is clearly demonstrated that OER values are specific for the particular end point scored. Even within the same organism, different OER can be obtained with different biological responses

  6. Photonic nanoarchitectures of biologic origin in butterflies and beetles

    Energy Technology Data Exchange (ETDEWEB)

    Biro, L.P., E-mail: biro@mfa.kfki.h [Research Institute for Technical Physics and Materials Science, H-1525 Budapest, POB 49 (Hungary)

    2010-05-25

    Photonic nanoarchitectures occurring in butterflies and beetles, which produce structural color in the visible range of the electromagnetic spectrum by the selective reflection of light, are investigated under the aspect of being used as possible 'blueprints' for artificial, bioinspired nanoarchitectures. The role of order and disorder and of regularity/irregularity in photonic nanoarchitectures of biologic origin is discussed. Three recent case studies are briefly reviewed for butterflies (Albulina metallica, Cyanophrys remus, Troides magellanus) and three for beetles (Hoeplia coerulea, Chrysochroa vittata, Charidotella egregia). The practical realization of bioinspired artificial structures is discussed for the A. metallica butterfly and for the C. vittata beetle.

  7. Photonic nanoarchitectures of biologic origin in butterflies and beetles

    International Nuclear Information System (INIS)

    Photonic nanoarchitectures occurring in butterflies and beetles, which produce structural color in the visible range of the electromagnetic spectrum by the selective reflection of light, are investigated under the aspect of being used as possible 'blueprints' for artificial, bioinspired nanoarchitectures. The role of order and disorder and of regularity/irregularity in photonic nanoarchitectures of biologic origin is discussed. Three recent case studies are briefly reviewed for butterflies (Albulina metallica, Cyanophrys remus, Troides magellanus) and three for beetles (Hoeplia coerulea, Chrysochroa vittata, Charidotella egregia). The practical realization of bioinspired artificial structures is discussed for the A. metallica butterfly and for the C. vittata beetle.

  8. Atlas of Iberian water beetles (ESACIB database).

    Science.gov (United States)

    Sánchez-Fernández, David; Millán, Andrés; Abellán, Pedro; Picazo, Félix; Carbonell, José A; Ribera, Ignacio

    2015-01-01

    The ESACIB ('EScarabajos ACuáticos IBéricos') database is provided, including all available distributional data of Iberian and Balearic water beetles from the literature up to 2013, as well as from museum and private collections, PhD theses, and other unpublished sources. The database contains 62,015 records with associated geographic data (10×10 km UTM squares) for 488 species and subspecies of water beetles, 120 of them endemic to the Iberian Peninsula and eight to the Balearic Islands. This database was used for the elaboration of the "Atlas de los Coleópteros Acuáticos de España Peninsular". In this dataset data of 15 additional species has been added: 11 that occur in the Balearic Islands or mainland Portugal but not in peninsular Spain and an other four with mainly terrestrial habits within the genus Helophorus (for taxonomic coherence). The complete dataset is provided in Darwin Core Archive format. PMID:26448717

  9. Managing invasive populations of Asian longhorned beetle and citrus longhorned beetle: a worldwide perspective.

    Science.gov (United States)

    Haack, Robert A; Hérard, Franck; Sun, Jianghua; Turgeon, Jean J

    2010-01-01

    The Asian longhorned beetle (ALB), Anoplophora glabripennis (Motschulsky), and citrus longhorned beetle (CLB), Anoplophora chinensis (Forster) (Coleoptera: Cerambycidae), are polyphagous xylophages native to Asia and are capable of killing healthy trees. ALB outbreaks began in China in the 1980s, following major reforestation programs that used ALB-susceptible tree species. No regional CLB outbreaks have been reported in Asia. ALB was first intercepted in international trade in 1992, mostly in wood packaging material; CLB was first intercepted in 1980, mostly in live plants. ALB is now established in North America, and both species are established in Europe. After each infestation was discovered, quarantines and eradication programs were initiated to protect high-risk tree genera such as Acer, Aesculus, Betula, Populus, Salix, and Ulmus. We discuss taxonomy, diagnostics, native range, bionomics, damage, host plants, pest status in their native range, invasion history and management, recent research, and international efforts to prevent new introductions. PMID:19743916

  10. Comparative resistance of Russian and Italian honey bees (Hymenoptera: Apidae) to small hive beetles (Coleoptera: Nitidulidae).

    Science.gov (United States)

    Frake, Amanda M; De Guzman, Lilia I; Rinderer, Thomas E

    2009-02-01

    To compare resistance to small hive beetles (Coleoptera: Nitidulidae) between Russian and commercial Italian honey bees (Hymenoptera: Apidae), the numbers of invading beetles, their population levels through time and small hive beetle reproduction inside the colonies were monitored. We found that the genotype of queens introduced into nucleus colonies had no immediate effect on small hive beetle invasion. However, the influence of honey bee stock on small hive beetle invasion was pronounced once test bees populated the hives. In colonies deliberately freed from small hive beetle during each observation period, the average number of invading beetles was higher in the Italian colonies (29 +/- 5 beetles) than in the Russian honey bee colonies (16 +/- 3 beetles). A similar trend was observed in colonies that were allowed to be freely colonized by beetles throughout the experimental period (Italian, 11.46 +/- 1.35; Russian, 5.21 +/- 0.66 beetles). A linear regression analysis showed no relationships between the number of beetles in the colonies and adult bee population (r2 = 0.1034, P = 0.297), brood produced (r2 = 0.1488, P = 0.132), or amount of pollen (P = 0.1036, P = 0.295). There were more Italian colonies that supported small hive beetle reproduction than Russian colonies. Regardless of stock, the use of entrance reducers had a significant effect on the average number of small hive beetle (with reducer, 16 +/- 3; without reducer, 27 +/- 5 beetles). However, there was no effect on bee population (with reducer, 13.20 +/- 0.71; without reducer, 14.60 +/- 0.70 frames) or brood production (with reducer, 6.12 +/- 0.30; without reducer, 6.44 +/- 0.34 frames). Overall, Russian honey bees were more resistant to small hive beetle than Italian honey bees as indicated by fewer invading beetles, lower small hive beetle population through time, and lesser reproduction. PMID:19253612

  11. The artificial beetle, or a brief manifesto for engineered biomimicry

    Science.gov (United States)

    Bartl, Michael H.; Lakhtakia, Akhlesh

    2015-03-01

    The artificial beetle is possibly the Holy Grail for practitioners of engineered biomimicry. An artificial beetle could gather and relay data and images from compromised environments on earth and other planets to decision makers. It could also be used for surveillance of foes and friends alike, and will require ethical foresight and oversight. What would it take to develop an artificial beetle? Several biotemplating techniques can be harnessed for the replication of external structural features of beetle bodies, and thus preserve functionalities such as coloration of the exoskeleton and the hydrophobicity of wings. The body cavity must host a power supply, motors to move the wings for flight, sensors to capture ambient conditions and images, and data transmitters and receivers to communicate with a remote command center. All of these devices must be very small and reliable.

  12. Biologically inspired optics: analog semiconductor model of the beetle exoskeleton

    Science.gov (United States)

    Buhl, Kaia; Roth, Zachary; Srinivasan, Pradeep; Rumpf, Raymond; Johnson, Eric

    2008-08-01

    Evolution in nature has produced through adaptation a wide variety of distinctive optical structures in many life forms. For example, pigment differs greatly from the observed color of most beetles because their exoskeletons contain multilayer coatings. The green beetle is disguised in a surrounding leaf by having a comparable reflection spectrum as the leaves. The Manuka and June beetle have a concave structure where light incident at any angle on the concave structures produce matching reflection spectra. In this work, semiconductor processing methods were used to duplicate the structure of the beetle exoskeleton. This was achieved by combining analog lithography with a multilayer deposition process. The artificial exoskeleton, 3D concave multilayer structure, demonstrates a wide field of view with a unique spectral response. Studying and replicating these biologically inspired nanostructures may lead to new knowledge for fabrication and design of new and novel nano-photonic devices, as well as provide valuable insight to how such phenomenon is exploited.

  13. Host plant preference in Colorado potato beetle (Coleoptera: Chrysomelidae)

    Science.gov (United States)

    Field and laboratory-choice tests were conducted to better understand host plant preference by the Colorado potato beetle, Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae), in Virginia. In laboratory olfactometer studies, L. decemlineata preferred potato over both tomato and eggplant foli...

  14. New generic synonyms in the Oriental flea beetles (Coleoptera: Chrysomelidae)

    Science.gov (United States)

    The following new synonyms are proposed for the genera of flea beetles from Oriental Region: Pseudocrypta Medvedev, 1996 and Sebaethiella Medvedev, 1993 = Acrocrypta Baly, 1862: 457; Bhutajana Scherer, 1979 = Aphthona Chevrolat, 1836; Burmaltica Scherer, 1969 = Aphthonaltica Heikertinger, 1924; Apht...

  15. Bergamot versus beetle: evidence for intraspecific chemical specialization

    OpenAIRE

    Keefover-Ring, Ken

    2015-01-01

    Many plant-eating insects have developed the ability to eat plants that synthesize toxins which they use to defend themselves against herbivores. While these specialized insects are good at dealing with specific plant toxins, plant species with highly variable chemistry can present a challenge. This study tested for reciprocal effects of a specialist tortoise beetle feeding on a host plant with individuals contained two different essential oil toxins. Overall, beetles showed higher survival, ...

  16. Pulpability of beetle-killed spruce. Forest Service research paper

    Energy Technology Data Exchange (ETDEWEB)

    Scott, G.M.; Bormett, D.W.; Sutherland, N.R.; Abubakr, S.; Lowell, E.

    1996-08-01

    Infestation of the Dendroctonus rufipennis beetle has resulted in large stands of dead and dying timber on the Kenai Peninsula in Alaska. Tests were conducted to evaluate the value of beetle-killed spruce as pulpwood. The results showed that live and dead spruce wood can be pulped effectively. The two least deteriorated classes and the most deteriorated class of logs had similar characteristics when pulped; the remaining class had somewhat poorer pulpability.

  17. Chemical defense: Aquatic beetle (Dineutes hornii) vs. fish (Micropterus salmoides)

    OpenAIRE

    Eisner, Thomas; Aneshansley, Daniel J.

    2000-01-01

    Captive largemouth bass (Micropterus salmoides) reject the gyrinid beetle, Dineutes hornii. They also reject edible items (mealworms) treated by topical addition of the norsesquiterpene gyrinidal, the principal component of the defensive secretion of the beetle. The bass' oral tolerance of gyrinidal varies broadly as a function of the gyrinidal dosage and the state of satiation of the fish. When taking a D. hornii or a gyrinidal-treated mealworm in the mouth, the f...

  18. Juvenile Hormone Regulates Extreme Mandible Growth in Male Stag Beetles

    OpenAIRE

    Gotoh, Hiroki; Cornette, Richard; Koshikawa, Shigeyuki; Okada, Yasukazu; Lavine, Laura Corley; Emlen, Douglas J.; Miura, Toru

    2011-01-01

    The morphological diversity of insects is one of the most striking phenomena in biology. Evolutionary modifications to the relative sizes of body parts, including the evolution of traits with exaggerated proportions, are responsible for a vast range of body forms. Remarkable examples of an insect trait with exaggerated proportions are the mandibular weapons of stag beetles. Male stag beetles possess extremely enlarged mandibles which they use in combat with rival males over females. As with o...

  19. Spectral information as an orientation cue in dung beetles.

    Science.gov (United States)

    El Jundi, Basil; Foster, James J; Byrne, Marcus J; Baird, Emily; Dacke, Marie

    2015-11-01

    During the day, a non-uniform distribution of long and short wavelength light generates a colour gradient across the sky. This gradient could be used as a compass cue, particularly by animals such as dung beetles that rely primarily on celestial cues for orientation. Here, we tested if dung beetles can use spectral cues for orientation by presenting them with monochromatic (green and UV) light spots in an indoor arena. Beetles kept their original bearing when presented with a single light cue, green or UV, or when presented with both light cues set 180° apart. When either the UV or the green light was turned off after the beetles had set their bearing in the presence of both cues, they were still able to maintain their original bearing to the remaining light. However, if the beetles were presented with two identical green light spots set 180° apart, their ability to maintain their original bearing was impaired. In summary, our data show that ball-rolling beetles could potentially use the celestial chromatic gradient as a reference for orientation. PMID:26538537

  20. Intraguild predation and native lady beetle decline.

    Science.gov (United States)

    Gardiner, Mary M; O'Neal, Matthew E; Landis, Douglas A

    2011-01-01

    Coccinellid communities across North America have experienced significant changes in recent decades, with declines in several native species reported. One potential mechanism for these declines is interference competition via intraguild predation; specifically, increased predation of native coccinellid eggs and larvae following the introduction of exotic coccinellids. Our previous studies have shown that agricultural fields in Michigan support a higher diversity and abundance of exotic coccinellids than similar fields in Iowa, and that the landscape surrounding agricultural fields across the north central U.S. influences the abundance and activity of coccinellid species. The goal of this study was to quantify the amount of egg predation experienced by a native coccinellid within Michigan and Iowa soybean fields and explore the influence of local and large-scale landscape structure. Using the native lady beetle Coleomegilla maculata as a model, we found that sentinel egg masses were subject to intense predation within both Michigan and Iowa soybean fields, with 60.7% of egg masses attacked and 43.0% of available eggs consumed within 48 h. In Michigan, the exotic coccinellids Coccinella septempunctata and Harmonia axyridis were the most abundant predators found in soybean fields whereas in Iowa, native species including C. maculata, Hippodamia parenthesis and the soft-winged flower beetle Collops nigriceps dominated the predator community. Predator abundance was greater in soybean fields within diverse landscapes, yet variation in predator numbers did not influence the intensity of egg predation observed. In contrast, the strongest predictor of native coccinellid egg predation was the composition of edge habitats bordering specific fields. Field sites surrounded by semi-natural habitats including forests, restored prairies, old fields, and pasturelands experienced greater egg predation than fields surrounded by other croplands. This study shows that intraguild

  1. Intraguild predation and native lady beetle decline.

    Directory of Open Access Journals (Sweden)

    Mary M Gardiner

    Full Text Available Coccinellid communities across North America have experienced significant changes in recent decades, with declines in several native species reported. One potential mechanism for these declines is interference competition via intraguild predation; specifically, increased predation of native coccinellid eggs and larvae following the introduction of exotic coccinellids. Our previous studies have shown that agricultural fields in Michigan support a higher diversity and abundance of exotic coccinellids than similar fields in Iowa, and that the landscape surrounding agricultural fields across the north central U.S. influences the abundance and activity of coccinellid species. The goal of this study was to quantify the amount of egg predation experienced by a native coccinellid within Michigan and Iowa soybean fields and explore the influence of local and large-scale landscape structure. Using the native lady beetle Coleomegilla maculata as a model, we found that sentinel egg masses were subject to intense predation within both Michigan and Iowa soybean fields, with 60.7% of egg masses attacked and 43.0% of available eggs consumed within 48 h. In Michigan, the exotic coccinellids Coccinella septempunctata and Harmonia axyridis were the most abundant predators found in soybean fields whereas in Iowa, native species including C. maculata, Hippodamia parenthesis and the soft-winged flower beetle Collops nigriceps dominated the predator community. Predator abundance was greater in soybean fields within diverse landscapes, yet variation in predator numbers did not influence the intensity of egg predation observed. In contrast, the strongest predictor of native coccinellid egg predation was the composition of edge habitats bordering specific fields. Field sites surrounded by semi-natural habitats including forests, restored prairies, old fields, and pasturelands experienced greater egg predation than fields surrounded by other croplands. This study shows

  2. EST Table: BB986379 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to putative lysosomal glucocerebrosidase [Tribolium castaneum] 10/08/28 low homology 10/08/27 35 %/211 aa... %/206 aa gnl|Amel|GB13722-PA 10/09/10 43 %/206 aa gi|91087345|ref|XP_975608.1| PREDICTED: similar to putative lysosomal glucocerebrosidase [Tribolium castaneum] BB985877 MSV3 ...

  3. EST Table: BB986249 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to putative lysosomal glucocerebrosidase [Tribolium castaneum] 10/08/28 low homology 10/08/27 35 %/211 aa... %/206 aa gnl|Amel|GB13722-PA 10/09/10 42 %/206 aa gi|91087345|ref|XP_975608.1| PREDICTED: similar to putative lysosomal glucocerebrosidase [Tribolium castaneum] BB985877 MSV3 ...

  4. EST Table: BB994526 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DICTED: similar to Rho guanine nucleotide exchange factor 11 (PDZ-RhoGEF) [Tribolium castaneum] 10/08/28 33 ...l|GB13906-PA 10/09/10 33 %/234 aa gi|189235145|ref|XP_967883.2| PREDICTED: similar to Rho guanine nucleotide exchange factor 11 (PDZ-RhoGEF) [Tribolium castaneum] BB994526 PSV3 ...

  5. EST Table: FS816912 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS816912 E_FL_fmgV_49O17_F_0 10/09/28 56 %/182 aa ref|XP_001812240.1| PREDICTED: similar to clas ... (differentially expressed in chondrocytes) (mdec) (sharp ) [Tribolium castaneum] 10/09/09 50 %/173 aa FBpp01 ... (differentially expressed in chondrocytes) (mdec) (sharp ) [Tribolium castaneum] FS845099 fmgV ...

  6. EST Table: FS845099 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS845099 E_FL_fner_22L02_F_0 11/12/09 GO hit GO:0005634(nucleus)|GO:0030528(transcription regula ... (differentially expressed in chondrocytes) (mdec) (sharp ) [Tribolium castaneum] 10/09/10 low homology 10/08 ... (differentially expressed in chondrocytes) (mdec) (sharp ) [Tribolium castaneum] FS845099 fner ...

  7. New records of predaceous diving beetles (Coleoptera:Dytiscidae) in Maine

    Science.gov (United States)

    Boobar, L.R.; Gibbs, K.E.; Longcore, J.R.; Perillo, A.M.

    1996-01-01

    Locations, habitat descriptions, and collection dates are listed for new records of 4 genera and 12 species of predaceous diving beetles (Coleoptera: Dytiscidae) in Maine. Previously, 17 genera and 53 species of the aquatic beetle were reported from Maine.

  8. Oviposition by small hive beetles elicits hygienic responses from Cape honeybees.

    Science.gov (United States)

    Ellis, J D; Richards, C S; Hepburn, H R; Elzen, P J

    2003-11-01

    Two novel behaviours, both adaptations of small hive beetles ( Aethina tumida Murray) and Cape honeybees ( Apis mellifera capensis Esch.), are described. Beetles puncture the sides of empty cells and oviposit under the pupae in adjoining cells. However, bees detect this ruse and remove infested brood (hygienic behaviour), even under such well-disguised conditions. Indeed, bees removed 91% of treatment brood (brood cells with punctured walls caused by beetles) but only 2% of control brood (brood not exposed to beetles). Only 91% of treatment brood actually contained beetle eggs; the data therefore suggest that bees remove only that brood containing beetle eggs and leave uninfected brood alone, even if beetles have accessed (but not oviposited on) the brood. Although this unique oviposition strategy by beetles appears both elusive and adaptive, Cape honeybees are able to detect and remove virtually all of the infested brood. PMID:14610654

  9. Distance and sex determine host plant choice by herbivorous beetles.

    Directory of Open Access Journals (Sweden)

    Daniel J Ballhorn

    Full Text Available BACKGROUND: Plants respond to herbivore damage with the release of volatile organic compounds (VOCs. This indirect defense can cause ecological costs when herbivores themselves use VOCs as cues to localize suitable host plants. Can VOCs reliably indicate food plant quality to herbivores? METHODOLOGY: We determined the choice behavior of herbivorous beetles (Chrysomelidae: Gynandrobrotica guerreroensis and Cerotoma ruficornis when facing lima bean plants (Fabaceae: Phaseolus lunatus with different cyanogenic potential, which is an important constitutive direct defense. Expression of inducible indirect defenses was experimentally manipulated by jasmonic acid treatment at different concentrations. The long-distance responses of male and female beetles to the resulting induced plant volatiles were investigated in olfactometer and free-flight experiments and compared to the short-distance decisions of the same beetles in feeding trials. CONCLUSION: Female beetles of both species were repelled by VOCs released from all induced plants independent of the level of induction. In contrast, male beetles were repelled by strongly induced plants, showed no significant differences in choice behavior towards moderately induced plants, but responded positively to VOCs released from little induced plants. Thus, beetle sex and plant VOCs had a significant effect on host searching behavior. By contrast, feeding behavior of both sexes was strongly determined by the cyanogenic potential of leaves, although females again responded more sensitively than males. Apparently, VOCs mainly provide information to these beetles that are not directly related to food quality. Being induced by herbivory and involved in indirect plant defense, such VOCs might indicate the presence of competitors and predators to herbivores. We conclude that plant quality as a food source and finding a potentially enemy-free space is more important for female than for male insect herbivores

  10. Rain forest provides pollinating beetles for atemoya crops.

    Science.gov (United States)

    Blanche, Rosalind; Cunningham, Saul A

    2005-08-01

    Small beetles, usually species of Nitidulidae, are the natural pollinators of atemoya (Annona squamosa L. x A. cherimola Mill. hybrids; custard apple) flowers but commercial atemoya growers often need to carry out labor-intensive hand pollination to produce enough high-quality fruit. Because Australian rain forest has plant species in the same family as atemoya (Annonaceae) and because many rain forest plants are beetle pollinated, we set out to discover whether tropical rain forest in far north Queensland harbors beetles that could provide this ecosystem service for atemoya crops. Orchards were chosen along a gradient of increasing distance from tropical rain forest (0.1-24 km). We sampled 100 flowers from each of nine atemoya orchards and determined the identity and abundance of insects within each flower. To assess the amount of pollination due to insects, we bagged six flowers per tree and left another six flowers per tree accessible to insects on 10 trees at an orchard near rain forest. Results indicated that atemoya orchards < or = 0.5 km from rain forest were predominantly visited by five previously unrecognized native beetle pollinators that are likely to originate in tropical rain forest. These native beetles occurred reliably enough in crops near rain forest to have a positive effect on the quantity of fruit produced but their contribution was not great enough to satisfy commercial production needs. Management changes, aimed at increasing native beetle abundance in crops, are required before these beetles could eliminate the need for growers to hand pollinate atemoya flowers. Appreciation of the value of this resource is necessary if we are to develop landscapes that both conserve native biodiversity and support agricultural production. PMID:16156571

  11. 7 CFR 301.48-6 - Movement of live Japanese beetles.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Movement of live Japanese beetles. 301.48-6 Section... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and Regulations § 301.48-6 Movement of live Japanese beetles. Regulations requiring a permit for and...

  12. Flow Visualization of Rhinoceros Beetle (Trypoxylus dichotomus) in Free Flight

    Institute of Scientific and Technical Information of China (English)

    Tien Van Truong; Tuyen Quang Le; Hieu Trung Tran; Hoon Cheol Park; Kwang Joon Yoon; Doyoung Byun

    2012-01-01

    Aerodynamic characteristics of the beetle,Trypoxylus dichotomus,which has a pair of elytra (forewings) and flexible hind wings,are investigated.Visualization experiments were conducted for various flight conditions of a beetle,Trypoxylus dichotomus:free,tethered,hovering,forward and climbing flights.Leading edge,trailing edge and tip vortices on both wings were observed clearly.The leading edge vortex was stable and remained on the top surface of the elytron for a wide interval during the downstroke of free forward flight.Hence,the elytron may have a considerable role in lift force generation of the beetle.In addition,we reveal a suction phenomenon between the gaps of the hind wing and the elytron in upstroke that may improve the positive lift force on the hind wing.We also found the reverse clap-fling mechanism of the T.dichotomus beetle in hovering flight.The hind wings touch together at the beginning of the upstroke.The vortex generation,shedding and interaction give a better understanding of the detailed aerodynamic mechanism of beetle flight.

  13. Origin and Diversification of Dung Beetles in Madagascar

    Directory of Open Access Journals (Sweden)

    Andreia Miraldo

    2011-04-01

    Full Text Available Madagascar has a rich fauna of dung beetles (Scarabaeinae and Aphodiinae withalmost 300 species described to date. Like most other taxa in Madagascar, dung beetles exhibit an exceptionally high level of endemism (96% of the species. Here,we review the current knowledge of the origin and diversification of Malagasy dung beetles. Based on molecular phylogenies, the extant dung beetles originate from eight colonizations, of which four have given rise to extensive radiations. These radiations have occurred in wet forests, while the few extant species in the less successfulradiations occur in open and semi-open habitats. We discuss the likely mechanisms of speciation and the ecological characteristics of the extant communities, emphasizing the role of adaptation along environmental gradients and allopatric speciation in generating the exceptionally high beta diversity in Malagasy dung beetles. Phylogeographic analyses of selected species reveal complex patterns with evidence for genetic introgression between old taxa. The introduction of cattle to Madagascar 1500 years ago created a new abundant resource, onto which a few species haveshifted and thereby been able to greatly expand their geographical ranges.

  14. Origin and Diversification of Dung Beetles in Madagascar.

    Science.gov (United States)

    Miraldo, Andreia; Wirta, Helena; Hanski, Ilkka

    2011-01-01

    Madagascar has a rich fauna of dung beetles (Scarabaeinae and Aphodiinae) withalmost 300 species described to date. Like most other taxa in Madagascar, dung beetles exhibit an exceptionally high level of endemism (96% of the species). Here,we review the current knowledge of the origin and diversification of Malagasy dung beetles. Based on molecular phylogenies, the extant dung beetles originate from eight colonizations, of which four have given rise to extensive radiations. These radiations have occurred in wet forests, while the few extant species in the less successfulradiations occur in open and semi-open habitats. We discuss the likely mechanisms of speciation and the ecological characteristics of the extant communities, emphasizing the role of adaptation along environmental gradients and allopatric speciation in generating the exceptionally high beta diversity in Malagasy dung beetles. Phylogeographic analyses of selected species reveal complex patterns with evidence for genetic introgression between old taxa. The introduction of cattle to Madagascar 1500 years ago created a new abundant resource, onto which a few species haveshifted and thereby been able to greatly expand their geographical ranges. PMID:26467617

  15. EST Table: FS779449 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available r protein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castane...00711:43321197:-1|gene:AGAP009790 10/09/10 65 %/220 aa gnl|Amel|GB17664-PA 10/09/10 70 %/230 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS779449 fcaL ...

  16. EST Table: FS939122 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available r protein analogous to peritrophins 3-B [Tribolium castaneum] gb|ABL73928.1| obstractor B [Tribolium castane...00711:43321197:-1|gene:AGAP009790 10/09/10 69 %/215 aa gnl|Amel|GB17664-PA 10/09/10 76 %/214 aa gi|119387886|gb|ABL73928.1| obstractor B [Tribolium castaneum] FS939122 fwgP ...

  17. EST Table: FS938058 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available r protein analogous to peritrophins 3-D2 [Tribolium castaneum] gb|ABL73931.1| obstractor D [Tribolium castan...ein|2R:29198983:29203672:1|gene:AGAP002909 10/09/10 85 %/187 aa gnl|Amel|GB16370-PA 10/09/10 74 %/231 aa gi|119387892|gb|ABL73931.1| obstractor D [Tribolium castaneum] FS938058 fwgP ...

  18. Hold your breath beetle-Mites!

    Science.gov (United States)

    Gudowska, Agnieszka; Drobniak, Szymon M; Schramm, Bartosz W; Labecka, Anna Maria; Kozlowski, Jan; Bauchinger, Ulf

    2016-01-01

    Respiratory gas exchange in insects occurs via a branching tracheal system. The entrances to the air-filled tracheae are the spiracles, which are gate-like structures in the exoskeleton. The open or closed state of spiracles defines the three possible gas exchange patterns of insects. In resting insects, spiracles may open and close over time in a repeatable fashion that results in a discontinuous gas exchange (DGE) pattern characterized by periods of zero organism-to-environment gas exchange. Several adaptive hypotheses have been proposed to explain why insects engage in DGE, but none have attracted overwhelming support. We provide support for a previously untested hypothesis that posits that DGE minimizes the risk of infestation of the tracheal system by mites and other agents. Here, we analyze the respiratory patterns of 15 species of ground beetle (Carabidae), of which more than 40% of individuals harbored external mites. Compared with mite-free individuals, infested one's engaged significantly more often in DGE. Mite-free individuals predominantly employed a cyclic or continuous gas exchange pattern, which did not include complete spiracle closure. Complete spiracle closure may prevent parasites from invading, clogging, or transferring pathogens to the tracheal system or from foraging on tissue not protected by thick chitinous layers. PMID:26689423

  19. Marking small hive beetles with thoracic notching: effects on longevity, flight ability and fecundity

    OpenAIRE

    De Guzman, Lilia; Frake, Amanda; Rinderer, Thomas

    2012-01-01

    International audience We tested two marking techniques for adult small hive beetles (SHB): dusting and thoracic notching. The use of blue and red chalk dusts to mark beetles was not persistent and caused early death of SHB with an average survival of 52.6 ± 23.8 and 13.9 ± 7.3 days, respectively. In contrast, notched beetles survived longer (mean = 353.6 ± 5.3 days) with the last beetle dying after 383 days. Likewise, notched beetles (presumed to be injured because of oozing hemolymph fro...

  20. Changes in food resources and conservation of scarab beetles

    DEFF Research Database (Denmark)

    Carpaneto, Giuseppe Maria; Mazziotta, Adriano; Piattella, Emanuele

    2005-01-01

    The aim of the research was to show how a change in land use influences the structure of a dung beetle assemblage and affect its conservation. In the Pineto Urban Regional Park (Rome), dog dung is the sole food resource currently available for scarab dung beetles, after the recent removal of wild...... and domestic herbivores. A one-year sampling was conducted to study the scarab assemblage in dog scats (1999) and to compare it with the previous assemblage associated with sheep droppings (1986). Richness, evenness and similarity parameters were compared between the two allochronic assemblages. From...... sheep to dog dung, an impoverishment of the total richness was observed (from 19 to 9 species) together with an increase of individuals (by 7 times). Dog dung harboured 20% of the current scarab dung beetle fauna of Rome, probably as a consequence of the dog mixed diet, rich in cellulose. Both the...

  1. Micro-structure and frictional characteristics of beetle's joint

    Institute of Scientific and Technical Information of China (English)

    DAI Zhendong; Stanislav N. Gorb

    2004-01-01

    Geometric and micro-structure design, tribology properties of beetle joints were experimentally studied, which aimed to enlighten ideas for the joint design of MEMS.The observation by using SEM and microscopy suggested that beetle's joints consist of a concave surface matched with a convex surface. The heads of the beetles, rubbing with flat glass, were tested in fresh and dried statuses and compared with sapphire ball with flat glass. Frictional coefficient of the joint material on glass was significantly lower than that of the sapphire sphere on glass. The material of the joint cuticle for convex surface is rather stiff (the elastic modulus 4.5 Gpa) and smooth. The surface is hydrophobic (the contact angle of distilled water was 88.3° ). It is suggested here that the high stiffness of the joint material and hydrophobicity of the joint surface are parts of the mechanism minimizing friction in insect joints.

  2. The alternative Pharaoh approach: stingless bees mummify beetle parasites alive

    Science.gov (United States)

    Greco, Mark K.; Hoffmann, Dorothee; Dollin, Anne; Duncan, Michael; Spooner-Hart, Robert; Neumann, Peter

    2010-03-01

    Workers from social insect colonies use different defence strategies to combat invaders. Nevertheless, some parasitic species are able to bypass colony defences. In particular, some beetle nest invaders cannot be killed or removed by workers of social bees, thus creating the need for alternative social defence strategies to ensure colony survival. Here we show, using diagnostic radioentomology, that stingless bee workers ( Trigona carbonaria) immediately mummify invading adult small hive beetles ( Aethina tumida) alive by coating them with a mixture of resin, wax and mud, thereby preventing severe damage to the colony. In sharp contrast to the responses of honeybee and bumblebee colonies, the rapid live mummification strategy of T. carbonaria effectively prevents beetle advancements and removes their ability to reproduce. The convergent evolution of mummification in stingless bees and encapsulation in honeybees is another striking example of co-evolution between insect societies and their parasites.

  3. Bird and beetle assemblages in mountain pine beetle killed forests and those subsequently burned: evidence for an effect of compound natural disturbances in British Columbia

    OpenAIRE

    House, Kimberly Nicole

    2014-01-01

    The recent mountain pine beetle (MPB; Dendroctonus ponderosae Hopkins) outbreak in British Columbia (BC) is unprecedented in severity and extent, and has created a landscape of beetle-killed trees through which wildfires are now burning as compound natural disturbances. We asked the question: Is there an impact of grey phase MPB kill severity on bird and beetle assemblages, and does an effect persist following wildfire in BC? We compared the bird community of central interior BC against categ...

  4. Evaluating leaf litter beetle data sampled by Winkler extraction from Atlantic forest sites in southern Brazil

    Directory of Open Access Journals (Sweden)

    Philipp Werner Hopp

    2011-06-01

    Full Text Available Evaluating leaf litter beetle data sampled by Winkler extraction from Atlantic forest sites in southern Brazil. To evaluate the reliability of data obtained by Winkler extraction in Atlantic forest sites in southern Brazil, we studied litter beetle assemblages in secondary forests (5 to 55 years after abandonment and old-growth forests at two seasonally different points in time. For all regeneration stages, species density and abundance were lower in April compared to August; but, assemblage composition of the corresponding forest stages was similar in both months. We suggest that sampling of small litter inhabiting beetles at different points in time using the Winkler technique reveals identical ecological patterns, which are more likely to be influenced by sample incompleteness than by differences in their assemblage composition. A strong relationship between litter quantity and beetle occurrences indicates the importance of this variable for the temporal species density pattern. Additionally, the sampled beetle material was compared with beetle data obtained with pitfall traps in one old-growth forest. Over 60% of the focal species captured with pitfall traps were also sampled by Winkler extraction in different forest stages. Few beetles with a body size too large to be sampled by Winkler extraction were only sampled with pitfall traps. This indicates that the local litter beetle fauna is dominated by small species. Hence, being aware of the exclusion of large beetles and beetle species occurring during the wet season, the Winkler method reveals a reliable picture of the local leaf litter beetle community.

  5. Fungi associated with the beetles of Ips typographus on Norway spruce in southern Poland

    Directory of Open Access Journals (Sweden)

    Robert Jankowiak

    2014-08-01

    Full Text Available The mycobiota of the beetles of the phloem-feeding spruce bark beetle, Ips typographus was studied. The most important group of fungi were the ophiostomatoid fungi. Among them O. penicillatum was very frequent ophiostomatoid species. Other common fungi were O. ainoae, O. bicolor, O. piceaperdum and O. piceae. The ophiostomatoid fungi were often more frequent in beetles collected in galleries than in the beetles caught With a trap. Generally the ophiostomatoid fungi were more ofien isolated from the beetle.s bathed in sterile water for 30 seconds. However C. polonica, O. ainoae, and O. minutum occurred most abundantly in the beetles disinfected in 96% ethyl alcohol for 15 and 30 seconds.

  6. Patterns of functional enzyme activity in fungus farming ambrosia beetles

    Directory of Open Access Journals (Sweden)

    De Fine Licht Henrik H

    2012-06-01

    Full Text Available Abstract Introduction In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae, wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. Results We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Conclusion Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily

  7. Photochemical oxidant injury and bark beetle coleoptera scolytidae infestation of ponderosa pine. I. Incidence of bark beetle infestation in injured trees

    Energy Technology Data Exchange (ETDEWEB)

    Stark, R.W.; Miller, P.R.; Cobb, F.W. Jr.; Wood, D.L.; Parmeter, J.R. Jr.

    1968-05-01

    A total of 107 beetle-killed and 963 nearest-neighbor ponderosa pines were examined to determine the association between severity of atmospheric pollution injury and infestation by bark beetles. Trees exhibiting advanced symptoms of pollution injury were most frequently infested by the western pine beetle, Dendroctonus brevicomis, and the mountain pine beetle, D. ponderosae. The degree of injury and incidence of bark beetle infestation were not related to total height, diameter, length of live and dead crown or crown class. As severity of oxidant injury increased, live crown ratio decreased and incidence of bark beetle infestation increased. One hundred noninfested trees in each of three disease categories, advanced, intermediate, and healthy, were examined for evidence of prior beetle attacks. Thirty-six percent of the advanced-diseased trees versus only 5% of the healthy trees were attacked. Thus, the beetles may discriminate between healthy and diseased trees at a distance, upon contact with the host, or both. These studies indicate strongly that atmospheric pollution injury predisposes ponderosa pine to bark beetle infestations. 3 references, 7 tables.

  8. Spruce Beetle Biology, Ecology and Management in the Rocky Mountains: An Addendum to Spruce Beetle in the Rockies

    OpenAIRE

    Jenkins, Michael J; Hebertson, Elizabeth G; A. Steven Munson

    2014-01-01

    Spruce beetle outbreaks have been reported in the Rocky Mountains of western North America since the late 1800s. In their classic paper, Spruce Beetle in the Rockies, Schmid and Frye reviewed the literature that emerged from the extensive outbreaks in Colorado in the 1940s. A new wave of outbreaks has affected Rocky Mountain subalpine spruce-fir forests beginning in the mid-1980s and continuing to the present. These outbreaks have spurred another surge of basic and applied research in the bio...

  9. Aerosol distribution and efficacy in a commercial food warehouse

    Institute of Scientific and Technical Information of China (English)

    Frank H. Arthur

    2008-01-01

    A series of field trials were conducted in a commercial food storage facility to evaluate exposure of stored-product insects to aerosol formulations of synergized pyrethrins and the insect growth regulator methoprene. When adults of Tribolium castaneum (Herbst), the red flour beetle, and Tribolium confusum (Jacqueline DuVal), the confused flour beetle were exposed with and without a food source to synergized pyrethrin aerosol, there was no difference in adult mortality with respect to availability of food at either 7 or 14 days after exposure (P≥0.05). However, mortality was lower in T. confusum (40.4% and 79.3% with flour at 7 and 14 days, 38.9% and 84.8% without flour at 7 and 14 days) compared to T. castaneum (96.5% and 99.8% with flour at 7 and 14 days, 91.0% and 98.7% without flour at 7 and 14 days). Few late-stage larvae and pupae of either species exposed to the pyrethrin aerosol emerged as adults. In tests with methoprene aerosol, adult emergence of exposed 3- and 4-week-old larvae of T. confusum was less than 2%. Only 0.3% of 4-week-old larvae of T. castaneum exposed in open and obstructed areas emerged as adults. Emergence of adults from eggs of Plodia interpunctella (Huibner), the Indianmeal moth, embedded in culture media and exposed to the methoprene aerosol was 13.2% + 3.5%. Results show that the aerosols evaluated in our study could give effective control of some of the major storedproduct insect pests in commercial food storage facilities, and may offer an alternative to fumigation.

  10. The redbay ambrosia beetle, Xyleborus glabratus: A threat to avocado

    Science.gov (United States)

    Laurel wilt (LW) is a disease caused by Raffaelea sp., a fungal symbiont associated with the recently-introduced redbay ambrosia beetle (RAB), Xyleborus glabratus. Impact of RAB as a vector of the disease to avocado is a threat to avocado production in the U.S. Since 2006, we have a) tested suscepti...

  11. Use of infochemicals to attract carrion beetles into pitfall traps

    Czech Academy of Sciences Publication Activity Database

    Podskalská, H.; Růžička, J.; Hoskovec, Michal; Šálek, M.

    2009-01-01

    Roč. 132, č. 1 (2009), s. 59-64. ISSN 0013-8703 Institutional research plan: CEZ:AV0Z40550506 Keywords : burying beetles * dimethylsulfide * dimethyldisulfide * dimethyltrisulfide Subject RIV: CC - Organic Chemistry Impact factor: 1.568, year: 2009

  12. Surveying an endangered saproxylic beetle, Osmoderma eremita, in Mediterranean woodlands

    DEFF Research Database (Denmark)

    Chiari, Stefano; Zauli, Agnese; Mazziotta, Adriano; Luiselli, Luca; Audisio, Paolo; Carpaneto, Giuseppe M.

    2013-01-01

    . Detection probability and population size estimates were drawn from each of these four capture methods. There were strong differences in detection probability among methods. Despite using pheromone and beetle manipulation, capture histories were not affected by trap-happiness or trap-shyness. Population...

  13. The Pied Piper: A Parasitic Beetle's Melodies Modulate Ant Behaviours.

    Directory of Open Access Journals (Sweden)

    Andrea Di Giulio

    Full Text Available Ants use various communication channels to regulate their social organisation. The main channel that drives almost all the ants' activities and behaviours is the chemical one, but it is long acknowledged that the acoustic channel also plays an important role. However, very little is known regarding exploitation of the acoustical channel by myrmecophile parasites to infiltrate the ant society. Among social parasites, the ant nest beetles (Paussus are obligate myrmecophiles able to move throughout the colony at will and prey on the ants, surprisingly never eliciting aggression from the colonies. It has been recently postulated that stridulatory organs in Paussus might be evolved as an acoustic mechanism to interact with ants. Here, we survey the role of acoustic signals employed in the Paussus beetle-Pheidole ant system. Ants parasitised by Paussus beetles produce caste-specific stridulations. We found that Paussus can "speak" three different "languages", each similar to sounds produced by different ant castes (workers, soldiers, queen. Playback experiments were used to test how host ants respond to the sounds emitted by Paussus. Our data suggest that, by mimicking the stridulations of the queen, Paussus is able to dupe the workers of its host and to be treated as royalty. This is the first report of acoustic mimicry in a beetle parasite of ants.

  14. CUTICULAR HYDROCARBONS OF THE SUNFLOWER BEETLE, ZYGOGRAMMA EXCLAMATIONIS

    Science.gov (United States)

    Hydrocarbons were the major lipid class on the cuticular surface of adults, nymphs, and eggs of the sunflower beetle, Zygogramma exclamationis, characterized by gas chromatography-mass spectrometry. Minor amounts of wax ester from 40 to 48 carbon atoms in size were only detected in larvae. The hyd...

  15. Origin and Diversification of Dung Beetles in Madagascar

    DEFF Research Database (Denmark)

    Miraldo, Andreia; Wirta, Helena; Hanski, Ilkka

    2011-01-01

    and semi-open habitats. We discuss the likely mechanisms of speciation and the ecological characteristics of the extant communities, emphasizing the role of adaptation along environmental gradients and allopatric speciation in generating the exceptionally high beta diversity in Malagasy dung beetles...

  16. Spatio-Temporal Distribution of Bark and Ambrosia Beetles in a Brazilian Tropical Dry Forest.

    Science.gov (United States)

    Macedo-Reis, Luiz Eduardo; Novais, Samuel Matos Antunes de; Monteiro, Graziela França; Flechtmann, Carlos Alberto Hector; Faria, Maurício Lopes de; Neves, Frederico de Siqueira

    2016-01-01

    Bark and the ambrosia beetles dig into host plants and live most of their lives in concealed tunnels. We assessed beetle community dynamics in tropical dry forest sites in early, intermediate, and late successional stages, evaluating the influence of resource availability and seasonal variations in guild structure. We collected a total of 763 beetles from 23 species, including 14 bark beetle species, and 9 ambrosia beetle species. Local richness of bark and ambrosia beetles was estimated at 31 species. Bark and ambrosia composition was similar over the successional stages gradient, and beta diversity among sites was primarily determined by species turnover, mainly in the bark beetle community. Bark beetle richness and abundance were higher at intermediate stages; availability of wood was the main spatial mechanism. Climate factors were effectively non-seasonal. Ambrosia beetles were not influenced by successional stages, however the increase in wood resulted in increased abundance. We found higher richness at the end of the dry and wet seasons, and abundance increased with air moisture and decreased with higher temperatures and greater rainfall. In summary, bark beetle species accumulation was higher at sites with better wood production, while the needs of fungi (host and air moisture), resulted in a favorable conditions for species accumulation of ambrosia. The overall biological pattern among guilds differed from tropical rain forests, showing patterns similar to dry forest areas. PMID:27271969

  17. Fire severity unaffected by spruce beetle outbreak in spruce-fir forests in southwestern Colorado.

    Science.gov (United States)

    Andrus, Robert A; Veblen, Thomas T; Harvey, Brian J; Hart, Sarah J

    2016-04-01

    Recent large and severe outbreaks of native bark beetles have raised concern among the general public and land managers about potential for amplified fire activity in western North America. To date, the majority of studies examining bark beetle outbreaks and subsequent fire severity in the U.S. Rocky Mountains have focused on outbreaks of mountain pine beetle (MPB; Dendroctonus ponderosae) in lodgepole pine (Pinus contorta) forests, but few studies, particularly field studies, have addressed the effects of the severity of spruce beetle (Dendroctonus rufipennis Kirby) infestation on subsequent fire severity in subalpine Engelmann spruce (Picea engelmannii) and subalpine fir (Abies lasiocarpa) forests. In Colorado, the annual area infested by spruce beetle outbreaks is rapidly rising, while MPB outbreaks are subsiding; therefore understanding this relationship is of growing importance. We collected extensive field data in subalpine forests in the eastern San Juan Mountains, southwestern Colorado, USA, to investigate whether a gray-stage (fire) spruce beetle infestation affected fire severity. Contrary to the expectation that bark beetle infestation alters subsequent fire severity, correlation and multivariate generalized linear regression analysis revealed no influence of pre-fire spruce beetle severity on nearly all field or remotely sensed measurements of fire severity. Findings were consistent across moderate and extreme burning conditions. In comparison to severity of the pre-fire beetle outbreak, we found that topography, pre-outbreak basal area, and weather conditions exerted a stronger effect on fire severity. Our finding that beetle infestation did not alter fire severity is consistent with previous retrospective studies examining fire activity following other bark beetle outbreaks and reiterates the overriding influence of climate that creates conditions conducive to large, high-severity fires in the subalpine zone of Colorado. Both bark beetle outbreaks and

  18. Juvenile hormone regulates extreme mandible growth in male stag beetles.

    Science.gov (United States)

    Gotoh, Hiroki; Cornette, Richard; Koshikawa, Shigeyuki; Okada, Yasukazu; Lavine, Laura Corley; Emlen, Douglas J; Miura, Toru

    2011-01-01

    The morphological diversity of insects is one of the most striking phenomena in biology. Evolutionary modifications to the relative sizes of body parts, including the evolution of traits with exaggerated proportions, are responsible for a vast range of body forms. Remarkable examples of an insect trait with exaggerated proportions are the mandibular weapons of stag beetles. Male stag beetles possess extremely enlarged mandibles which they use in combat with rival males over females. As with other sexually selected traits, stag beetle mandibles vary widely in size among males, and this variable growth results from differential larval nutrition. However, the mechanisms responsible for coupling nutrition with growth of stag beetle mandibles (or indeed any insect structure) remain largely unknown. Here, we demonstrate that during the development of male stag beetles (Cyclommatus metallifer), juvenile hormone (JH) titers are correlated with the extreme growth of an exaggerated weapon of sexual selection. We then investigate the putative role of JH in the development of the nutritionally-dependent, phenotypically plastic mandibles, by increasing hemolymph titers of JH with application of the JH analog fenoxycarb during larval and prepupal developmental periods. Increased JH signaling during the early prepupal period increased the proportional size of body parts, and this was especially pronounced in male mandibles, enhancing the exaggerated size of this trait. The direction of this response is consistent with the measured JH titers during this same period. Combined, our results support a role for JH in the nutrition-dependent regulation of extreme mandible growth in this species. In addition, they illuminate mechanisms underlying the evolution of trait proportion, the most salient feature of the evolutionary diversification of the insects. PMID:21731659

  19. Juvenile hormone regulates extreme mandible growth in male stag beetles.

    Directory of Open Access Journals (Sweden)

    Hiroki Gotoh

    Full Text Available The morphological diversity of insects is one of the most striking phenomena in biology. Evolutionary modifications to the relative sizes of body parts, including the evolution of traits with exaggerated proportions, are responsible for a vast range of body forms. Remarkable examples of an insect trait with exaggerated proportions are the mandibular weapons of stag beetles. Male stag beetles possess extremely enlarged mandibles which they use in combat with rival males over females. As with other sexually selected traits, stag beetle mandibles vary widely in size among males, and this variable growth results from differential larval nutrition. However, the mechanisms responsible for coupling nutrition with growth of stag beetle mandibles (or indeed any insect structure remain largely unknown. Here, we demonstrate that during the development of male stag beetles (Cyclommatus metallifer, juvenile hormone (JH titers are correlated with the extreme growth of an exaggerated weapon of sexual selection. We then investigate the putative role of JH in the development of the nutritionally-dependent, phenotypically plastic mandibles, by increasing hemolymph titers of JH with application of the JH analog fenoxycarb during larval and prepupal developmental periods. Increased JH signaling during the early prepupal period increased the proportional size of body parts, and this was especially pronounced in male mandibles, enhancing the exaggerated size of this trait. The direction of this response is consistent with the measured JH titers during this same period. Combined, our results support a role for JH in the nutrition-dependent regulation of extreme mandible growth in this species. In addition, they illuminate mechanisms underlying the evolution of trait proportion, the most salient feature of the evolutionary diversification of the insects.

  20. Dock leaf beetle, Gastrophysa viridula Deg., herbivory on Mossy Sorrel, Rumex confertus Willd: Induced plant volatiles and beetle orientation responses

    Science.gov (United States)

    The invasive weed Rumex confertus Willd. (mossy sorrel) is fed upon and severely defoliated by Gastrophysa viridula Deg. (dock leaf beetle), a highly promising biological control agent for this weed. We report volatile organic compound (VOC) induction when one leaf on R. confertus was damaged by G. ...

  1. Effect of irradiation and exposure to nitrogen on the mortality of adults. Tribolium confusum J. du V

    International Nuclear Information System (INIS)

    For insect control irradiation can be improved by combination with other methods in order to limit the dose and hence to preserve the sensory qualities of some foods like fresh fruits, or to kill more rapidly the adult stage for avoiding the risk that a shipment be rejected because of the presence of living insects. The effect of irradiation with long exposure to inert gaz has not been reported yet. This study presents preliminary results on Tribolium confusum. Irradiation alone from 120 to 1000 Gy killed 100% of adults T. confusum in 12 to 15 days. At 60 Gy 10% insects were living after 28 days and at 40 Gy no mortality was observed. Mortality of adults T. confusum observed 10 days after exposure to nitrogen increased with the exposure time. 100 % mortality was reached for 17 hours exposure. When insects were exposed to nitrogen before or after irradiation synergic effects were observed. The greatest efficiency was obtained when insects were irradiated at 600 Gy after 9 hr exposure. When insects were exposed to nitrogen during irradiation the protective effectt of a short exposure (1/2 hr) was observed only for low doses (< 60 Gy). For a long exposure (9 hr) early irradiation at 600 Gy was more efficient than late irradiation

  2. Ground beetle (Coleoptera: Carabidae) assemblages in narrow hedgerows in a Danish agricultural landscape

    DEFF Research Database (Denmark)

    Lövei, G. L.; Magura, T.

    2015-01-01

    The role of hedgerows in supporting ground beetles (Coleoptera: Carabidae) in a Danish agricultural landscape was examined. Nine old, well established single-row hedges were selected for the study, three each of a native species (hawthorn, Crataegus monogyna), a non-native deciduous one (rowan...... beetle assemblages. The number of ground beetle individuals and species were significantly the highest in the hawthorn hedges and significantly decreased from the hedges with rowan toward the spruce hedges. The elevated number of ground beetle individuals and species in the hawthorn hedges were due...... to the forest specialist species, as the number of forest specialist ground beetle individuals and species were significantly higher in the hawthorn hedges compared to the hedges with rowan and spruce. Differences in the number of the grassland and the cropland specialist ground beetle individuals and species...

  3. Mountain Pine Beetle Dynamics in Lodgepole Pine Forests, Part 1: Course of an Infectation

    OpenAIRE

    Cole, Walter E; Amman, Gene D

    1980-01-01

    Much of this work is original research by the authors. However, published literature on the mountain pine beetle is reviewed with particular reference to epidemic infestations in lodgepole pine forests. The mountain pine beetle and lodgepole pine have evolved into an intensive and highly compatible relationship. Consequently, stand dynamics of lodgepole pine is a primary factor in the development of beetle epidemics. the diameter-growth relationship and the effects of environmental factors on...

  4. Dung beetle assemblages (Coleoptera, Scarabaeinae) in Atlantic forest fragments in southern Brazil

    OpenAIRE

    Renata C. Campos; Malva I. Medina Hernández

    2013-01-01

    Dung beetle assemblages (Coleoptera, Scarabaeinae) in Atlantic forest fragments in southern Brazil. The beetles of the subfamily Scarabaeinae are important organisms that participate in the cycle of decomposition, especially in tropical ecosystems. Most species feed on feces (dung) or carcasses (carrion) and are associated with animals that produce their food resources. Dung beetles are divided into three functional groups: rollers, tunnelers and dwellers. This present work aims to study the ...

  5. Yeast Associated with the Ambrosia Beetle, Platypus koryoensis, the Pest of Oak Trees in Korea

    OpenAIRE

    Yun, Yeo Hong; Suh, Dong Yeon; Yoo, Hun Dal; Oh, Man Hwan; Kim, Seong Hwan

    2015-01-01

    Oak tree death caused by symbiosis of an ambrosia beetle, Platypus koryoensis, and an ophiostomatoid filamentous fungus, Raffaelea quercus-mongolicae, has been a nationwide problem in Korea since 2004. In this study, we surveyed the yeast species associated with P. koryoensis to better understand the diversity of fungal associates of the beetle pest. In 2009, a total of 195 yeast isolates were sampled from larvae and adult beetles (female and male) of P. koryoensis in Cheonan, Goyang, and Paj...

  6. Predaceous diving beetles in Maine: Faunal list and keys to subfamilies

    Science.gov (United States)

    Boobar, L.R.; Spangler, P.J.; Gibbs, K.E.; Longcore, J.R.; Hopkins, K.M.

    1998-01-01

    Records of predaceous diving beetles (Coleoptera: Dytiscidae) collected in Maine are summarized. These records are augmented by field surveys of beetles in Aroostook Co., Maine during 1993-95. Keys to subfamilies are presented with color plates for selected species. A list of diving beetles that have been collected near Maine (state or province) is presented so that investigators will know what additional species might be expected in Maine. Basic taxonomy is presented to facilitate use of keys.

  7. Darkling beetle populations (Tenebrionidae) of the Hanford site in southcentral Washington

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, L.E.; Woodley, N.; Sheldon, J.K.; Uresk, V.A.

    1978-02-01

    This 3-yr study documents the taxonomic composition, relative abundance, and seasonal distribution of darkling beetles occupying the Hanford Site in southcentral Washington. A taxonomic key and species diagnosis are provided to assist in identification by the nonspecialist. Analysis of food plant availability and selection serves to identify transfer pathways through beetle populations and permits construction of food web diagrams depicting the flow of materials through the darkling beetle component.

  8. Spruce Beetle (Dendroctonus rufipennis) Outbreak in Engelmann Spruce (Picea engelmannil) in Central Utah, 1986-1998

    OpenAIRE

    Dymerski, Alan D; Anhold, John A; Munson, Allen S

    2001-01-01

    Extensive Engelmann spruce (Picea engelmannii Parry ex Engelm.) mortality caused by the spruce beetle (Dendroctonus rufipennis Kirby) has been occurring at the southern end of the Wasatch Plateau in central Utah. This spruce beetle outbreak is the largest recorded in Utah history. An extensive ground survey was conducted in 1996 on the Manti-LaSal National Forest, Sanpete and Ferron Ranger Districts, to document mortality and impact of a major spruce beetle outbreak on post-outbreak forest co...

  9. Tracking an invasive honey bee pest: mitochondrial DNA variation in North American small hive beetles

    OpenAIRE

    Jay. D. Evans,; Jeff. S. Pettis,; Michael Hood, W.; Shimanuki, Hachiro

    2003-01-01

    International audience We describe the current and past distributions of North American small hive beetles (Aethina tumida) having two distinct mitochondrial DNA haplotypes. A collection of 539 hive beetles showed irregular distributions of these haplotypes across the southeastern US. Beetles from the first collections made in coastal South Carolina showed haplotype NA1, exclusively. This haplotype is less common in Georgia and was not observed in North Carolina. Later collections from thi...

  10. Multitrophic interaction facilitates parasite–host relationship between an invasive beetle and the honey bee

    OpenAIRE

    Torto, Baldwyn; Boucias, Drion G.; Arbogast, Richard T.; Tumlinson, James H.; Teal, Peter E. A.

    2007-01-01

    Colony defense by honey bees, Apis mellifera, is associated with stinging and mass attack, fueled by the release of alarm pheromones. Thus, alarm pheromones are critically important to survival of honey bee colonies. Here we report that in the parasitic relationship between the European honey bee and the small hive beetle, Aethina tumida, the honey bee's alarm pheromones serve a negative function because they are potent attractants for the beetle. Furthermore, we discovered that the beetles f...

  11. Dutch elm disease and elm bark beetles: a century of association

    OpenAIRE

    Santini A; Faccoli M

    2015-01-01

    Bark beetles of the genus Scolytus Geoffroy are the main vectors of the fungus Ophiostoma ulmi s.l., which causes the Dutch elm disease. The large and small elm bark beetles - S. scolytus (F.) and S. multistriatus (Marsham), respectively - are the most common and important species spreading the pathogen worldwide. The success of the pathogen-insect interactions is mainly due to the characteristic reproductive behavior of the elm bark beetles, which, however, largely depends on the occurrence ...

  12. Population Dynamics of Bean Leaf Beetle, Cerotoma trifurcata (Coleoptera: Chrysomelidae on Edamame Soybean Plants In Nebraska

    Directory of Open Access Journals (Sweden)

    Bamphitlhi Tiroesele

    2013-02-01

    Full Text Available Edamame soybeans are a speciality food item for fresh and processed markets and they are harvested at a physiologically immature (R6 stage. Bean leaf beetle, Cerotoma trifurcata, is a sporadic pest of soybean in Nebraska, however, its pest status and abundance has increased in the recent years due to an increase in soybean acreage. This was a field experiment aimed at determining the population growth rate of bean leaf beetle on two edamame soybean cultivars, ‘Butterbeans’ and ‘Envy,’ at two planting dates during 2004 and 2005 in Nebraska. The population growth of beetles was significantly higher on 'Butterbeans' than on 'Envy' for both the first and second planting periods in both 2004 and 2005 seasons. The beetle infestation differences were noticed on plants at the late reproductive growth stages, R5 and R6. Additionally, the beetle infestation on 'Butterbeans' growth stages in 2004 and 2005 was significantly different for the first and second planting dates. On average, the beetles were higher on plants at the late reproductive stages than the other stages for first and second planting periods. Similarly, ‘Envy’ growth stages showed significant difference in beetle infestation during the first and second planting dates. Significantly high beetle infestations were observed at the vegetative growth stages. The study revealed that population growth of bean leaf beetles on edamame soybeans is affected by the planting date, season and cultivar choice.

  13. Repeated evolution of crop theft in fungus-farming ambrosia beetles.

    Science.gov (United States)

    Hulcr, Jiri; Cognato, Anthony I

    2010-11-01

    Ambrosia beetles, dominant wood degraders in the tropics, create tunnels in dead trees and employ gardens of symbiotic fungi to extract nutrients from wood. Specificity of the beetle-fungus relationship has rarely been examined, and simple vertical transmission of a specific fungal cultivar by each beetle species is often assumed in literature. We report repeated evolution of fungal crop stealing, termed mycocleptism, among ambrosia beetles. The mycocleptic species seek brood galleries of other species, and exploit their established fungal gardens by tunneling through the ambient mycelium-laden wood. Instead of carrying their own fungal sybmbionts, mycocleptae depend on adopting the fungal assemblages of their host species, as shown by an analysis of fungal DNA from beetle galleries. The evidence for widespread horizontal exchange of fungi between beetles challenges the traditional concept of ambrosia fungi as species-specific symbionts. Fungus stealing appears to be an evolutionarily successful strategy. It evolved independently in several beetle clades, two of which have radiated, and at least one case was accompanied by a loss of the beetles' fungus-transporting organs. We demonstrate this using the first robust phylogeny of one of the world's largest group of ambrosia beetles, Xyleborini. PMID:20633043

  14. Social encapsulation of beetle parasites by Cape honeybee colonies (Apis mellifera capensis Esch.)

    Science.gov (United States)

    Neumann, P.; Pirk, C. W. W.; Hepburn, H. R.; Solbrig, A. J.; Ratnieks, F. L. W.; Elzen, P. J.; Baxter, J. R.

    2001-05-01

    Worker honeybees (Apis mellifera capensis) encapsulate the small hive beetle (Aethina tumida), a nest parasite, in propolis (tree resin collected by the bees). The encapsulation process lasts 1-4 days and the bees have a sophisticated guarding strategy for limiting the escape of beetles during encapsulation. Some encapsulated beetles died (4.9%) and a few escaped (1.6%). Encapsulation has probably evolved because the small hive beetle cannot easily be killed by the bees due to its hard exoskeleton and defensive behaviour.

  15. Phylogeny of ambrosia beetle symbionts in the genus Raffaelea.

    Science.gov (United States)

    Dreaden, Tyler J; Davis, John M; de Beer, Z Wilhelm; Ploetz, Randy C; Soltis, Pamela S; Wingfield, Michael J; Smith, Jason A

    2014-12-01

    The genus Raffaelea was established in 1965 when the type species, Raffaelea ambrosia, a symbiont of Platypus ambrosia beetles was described. Since then, many additional ambrosia beetle symbionts have been added to the genus, including the important tree pathogens Raffaelea quercivora, Raffaelea quercus-mongolicae, and Raffaelea lauricola, causal agents of Japanese and Korean oak wilt and laurel wilt, respectively. The discovery of new and the dispersal of described species of Raffaelea to new areas, where they can become invasive, presents challenges for diagnosticians as well as plant protection and quarantine efforts. In this paper, we present the first comprehensive multigene phylogenetic analysis of Raffaelea. As it is currently defined, the genus was found to not be monophyletic. On the basis of this work, Raffaelea sensu stricto is defined and the affinities of undescribed isolates are considered. PMID:25457944

  16. Simulation of light scattering from exoskeletons of scarab beetles.

    Science.gov (United States)

    Valyukh, Sergiy; Arwin, Hans; Järrendahl, Kenneth

    2016-03-21

    An approach for simulation of light scattering from beetles exhibiting structural colors originating from periodic helicoidal structures is presented. Slight irregularities of the periodic structure in the exoskeleton of the beetles are considered as a major cause of light scattering. Two sources of scattering are taken into account: surface roughness and volume non-uniformity. The Kirchhoff approximation is applied to simulate the effect of surface roughness. To describe volume non-uniformity, the whole structure is modeled as a set of domains distributed in space in different orientations. Each domain is modeled as an ideal uniformly twisted uniaxial medium and differs from each other by the pitch. Distributions of the domain parameters are assumed to be Gaussian. The analysis is performed using the Mueller matrix formalism which, in addition to spectral and spatial characteristics, also provides polarization properties of the scattered light. PMID:27136777

  17. Effect of gamma irradiation on khapra beetle Trogoderma granarium everts

    International Nuclear Information System (INIS)

    The effect of gamma irradiation on all developmental stages of khapra beetle was examined. The results showed that when higher doses were applied and immature stages were treated the developmental time, larval and pupal mortality and adults' deformation were increased. Whereas, the fecundity and fertility of the emerged adults resulted from the treatment of immature stages, were increased when old eggs, larvae and pupae were treated with low doses. When newly emerged adults were irradiated the longevity of the male and the female was not affected, while the fecundity and fertility were declined especially when high doses were applied. The female of khapra beetle was more radiosensitive than the male, regardless of the applied dose or/and the treated developmental stage. (author)

  18. Approaches to mimic the metallic sheen in beetles

    DEFF Research Database (Denmark)

    Lenau, Torben Anker; Aggerbeck, Martin; Nielsen, Steffen

    2009-01-01

    A range of different beetles exhibits brilliant colours and metallic sheen. One of the most spectacular species is the Plusiotis resplendens from Central America with gold metal appearance. The beetle shells are made from chitin and have a number of unique properties that apart from spectacular...... aesthetic effects include metal sheen from non-metal surfaces combined with electric and thermal insulation. The reflection mechanism has been studied by a number of authors and is well understood. Basically there are 2 different reflection principles. One is the multilayer reflector where alternating...... layers have high and low refractive index. The other is the Bouligand structure where birefringent chiral nanofibres are organised in spiral structures. The paper describes work done to explore different approaches to mimic these structures using polymer based materials and production methods that are...

  19. Associational Patterns of Scavenger Beetles to Decomposition Stages.

    Science.gov (United States)

    Zanetti, Noelia I; Visciarelli, Elena C; Centeno, Nestor D

    2015-07-01

    Beetles associated with carrion play an important role in recycling organic matter in an ecosystem. Four experiments on decomposition, one per season, were conducted in a semirural area in Bahía Blanca, Argentina. Melyridae are reported for the first time of forensic interest. Apart from adults and larvae of Scarabaeidae, thirteen species and two genera of other coleopteran families are new forensic records in Argentina. Diversity, abundance, and species composition of beetles showed differences between stages and seasons. Our results differed from other studies conducted in temperate regions. Four guilds and succession patterns were established in relation to decomposition stages and seasons. Dermestidae (necrophages) predominated in winter during the decomposition process; Staphylinidae (necrophiles) in Fresh and Bloat stages during spring, summer, and autumn; and Histeridae (necrophiles) and Cleridae (omnivores) in the following stages during those seasons. Finally, coleopteran activity, diversity and abundance, and decomposition rate change with biogeoclimatic characteristics, which is of significance in forensics. PMID:26174466

  20. The Japanese jewel beetle: a painter's challenge

    International Nuclear Information System (INIS)

    Colours as dynamic as the metallic-like hues adorning the Japanese jewel beetle have never been captured on canvas before. Unlike, and unmatched by, the chemical pigments of the artist's palette, the effect is generated by layered microstructures that refract and reflect light to make colour visible. Exclusive to nature for millions of years, such jewel-like colouration is only now being introduced to art. Sustained scientific research into nature's iridescent multilayer reflectors has recently led to the development and manufacture of analogous synthetic structures, notably innovative light interference flakes. For the first time this novel technology offers artists the exciting, yet challenging, potential to accurately depict nature's iridescence. Mimicking the Japanese jewel beetle by using paints with embedded flakes, we demonstrate that the resulting painting, just like the model, displays iridescent colours that shift with minute variation of the angle of light and viewing. (paper)

  1. Chemical Defense of an Ozaenine Bombardier Beetle From New Guinea

    OpenAIRE

    Jerrold Meinwald; Blankespoor, Curtis L.; Maria Eisner; Thomas Eisner; Braden Roach; Aneschansley, Daniel J.; Ball, George E.

    1989-01-01

    We had occasion recently to study 3 live specimens of Pseudozaena orientalis opaca, an ozaenine carabid beetle (subfamily Paussinae, tribe Ozaenini) from New Guinea, and report here on the biology and chemistry of its defensive spray mechanism. A number of New World ozaenines had previously been studied chemically and shown to be “bombardiers” that discharge a hot quinonoid mixture (Aneshansley et al. 1969, 1983; Eisner and Aneshansley 1982; Eisner et al. 1977; Roach et al. 1979). Pseudozaena...

  2. The Evolution of Functionally Redundant Species; Evidence from Beetles

    OpenAIRE

    Scheffer, M.; Vergnon, R.O.H.; Nes, van, S.I.; Cuppen, J.G.M.; Peeters, E.T.H.M.; Leijs, R.; Nilsson, A. N.

    2015-01-01

    While species fulfill many different roles in ecosystems, it has been suggested that numerous species might actually share the same function in a near neutral way. So-far, however, it is unclear whether such functional redundancy really exists. We scrutinize this question using extensive data on the world's 4168 species of diving beetles. We show that across the globe these animals have evolved towards a small number of regularly-spaced body sizes, and that locally co-existing species are eit...

  3. Cost of flight and the evolution of stag beetle weaponry

    OpenAIRE

    Goyens, Jana; Van Wassenbergh, Sam; Dirckx, Joris; Aerts, Peter

    2015-01-01

    Male stag beetles have evolved extremely large mandibles in a wide range of extraordinary shapes. These mandibles function as weaponry in pugnacious fights for females. The robust mandibles of Cyclommatus metallifer are as long as their own body and their enlarged head houses massive, hypertrophied musculature. Owing to this disproportional weaponry, trade-offs exist with terrestrial locomotion: running is unstable and approximately 40% more costly. Therefore, flying is most probably essentia...

  4. Using malaise traps to sample ground beetles (Coleoptera: Carabidae).

    Energy Technology Data Exchange (ETDEWEB)

    Ulyshen, Michael D., James L. Hanula, and Scott Horn

    2005-01-01

    Pitfall traps provide an easy and inexpensive way to sample ground-dwelling arthropods (Spence and Niemela 1994; Spence et al. 1997; Abildsnes and Tommeras 2000) and have been used exclusively in many studies of the abundance and diversity of ground beetles (Coleoptera: Carabidae). Despite the popularity of this trapping technique, pitfall traps have many disadvantages. For example, they often fail to collect both small (Spence and Niemela 1994) and trap-shy species (Benest 1989), eventually deplete the local carabid population (Digweed et al. 1995), require a species to be ground-dwelling in order to be captured (Liebherr and Mahar 1979), and produce different results depending on trap diameter and material, type of preservative used, and trap placement (Greenslade 1964; Luff 1975; Work et al. 2002). Further complications arise from seasonal patterns of movement among the beetles themselves (Maelfait and Desender 1990), as well as numerous climatic factors, differences in plant cover, and variable surface conditions (Adis 1979). Because of these limitations, pitfall trap data give an incomplete picture of the carabid community and should be interpreted carefully. Additional methods, such as use of Berlese funnels and litter washing (Spence and Niemela 1994), collection from lights (Usis and MacLean 1998), and deployment of flight intercept devices (Liebherr and Mahar 1979; Paarmann and Stork 1987), should be incorporated in surveys to better ascertain the species composition and relative numbers of ground beetles. Flight intercept devices, like pitfall traps, have the advantage of being easy to use and replicate, but their value to carabid surveys is largely unknown. Here we demonstrate the effectiveness of Malaise traps for sampling ground beetles in a bottomland hardwood forest.

  5. Using malaise traps to sample ground beetles (Coleoptera. Carabidae)

    Energy Technology Data Exchange (ETDEWEB)

    Ulyshen, Michael D. [USDA Forest Service, Savannah River, New Ellenton, SC (United States); Hanula, James L. [USDA Forest Service, Savannah River, New Ellenton, SC (United States); Horn, Scott [USDA Forest Service, Savannah River, New Ellenton, SC (United States)

    2012-04-02

    Pitfall traps provide an easy and inexpensive way to sample ground-dwelling arthropods (Spence and Niemela 1994; Spence et al. 1997; Abildsnes and Tommeras 2000) and have been used exclusively in many studies of the abundance and diversity of ground beetles (Coleoptera: Carabidae). Despite the popularity of this trapping technique, pitfall traps have many disadvantages. For example, they often fail to collect both small (Spence and Niemela 1994) and trap-shy species (Benest 1989), eventually deplete the local carabid population (Digweed et al. 1995), require a species to be ground-dwelling in order to be captured (Liebherr and Mahar 1979), and produce different results depending on trap diameter and material, type of preservative used, and trap placement (Greenslade 1964; Luff 1975; Work et al. 2002). Further complications arise from seasonal patterns of movement among the beetles themselves (Maelfait and Desender 1990), as well as numerous climatic factors, differences in plant cover, and variable surface conditions (Adis 1979). Because of these limitations, pitfall trap data give an incomplete picture of the carabid community and should be interpreted carefully. Additional methods, such as use of Berlese funnels and litter washing (Spence and Niemela 1994), collection from lights (Usis and MacLean 1998), and deployment of flight intercept devices (Liebherr and Mahar 1979; Paarmann and Stork 1987), should be incorporated in surveys to better ascertain the species composition and relative numbers of ground beetles. Flight intercept devices, like pitfall traps, have the advantage of being easy to use and replicate, but their value to carabid surveys is largely unknown. Here we demonstrate the effectiveness of Malaise traps for sampling ground beetles in a bottomland hardwood forest.

  6. Hit‐and‐run trophallaxis of small hive beetles

    OpenAIRE

    Neumann, Peter; Naef, J.; Crailsheim, K; Crewe, RM; Pirk, CWW

    2015-01-01

    Abstract Some parasites of social insects are able to exploit the exchange of food between nestmates via trophallaxis, because they are chemically disguised as nestmates. However, a few parasites succeed in trophallactic solicitation although they are attacked by workers. The underlying mechanisms are not well understood. The small hive beetle (=SHB), Aethina tumida, is such a parasite of honey bee, Apis mellifera, colonies and is able to induce trophallaxis. Here, we investigate whether SHB ...

  7. Large carrion beetles (Coleoptera, Silphidae) in Western Europe: a review

    OpenAIRE

    Dekeirsschieter, Jessica; Verheggen, François; Lognay, Georges; Haubruge, Eric

    2011-01-01

    This review focuses on carrion beetles (Coleoptera, Silphidae) of the Western Palearctic and their potential use in forensic entomology as bioindicators. Few studies have looked at Silphidae in forensic context and investigations. However, some Silphidae present the desirable characteristics of some Diptera used in postmortem estimates and thus may extend the minimum postmortem interval (PMImin). We review here the taxonomy and distribution of Western Palearctic Silphidae. The anatomical and...

  8. Large carrion beetles (Coleoptera, Silphidae) in Western Europe: a review

    OpenAIRE

    Dekeirsschieter, J.; Verheggen, F.; Lognay, G.; Haubruge, E.

    2011-01-01

    This review focuses on carrion beetles (Coleoptera, Silphidae) of the Western Palearctic and their potential use in forensic entomology as bioindicators. Few studies have looked at Silphidae in forensic context and investigations. However, some Silphidae present the desirable characteristics of some Diptera used in postmortem estimates and thus may extend the minimum postmortem interval (PMImin). We review here the taxonomy and distribution of Western Palearctic Silphidae. The anatomical and ...

  9. Coffee Berry Borer Joins Bark Beetles in Coffee Klatch

    OpenAIRE

    Jaramillo, Juliana; Torto, Baldwyn; Mwenda, Dickson; Troeger, Armin; Borgemeister, Christian; Poehling, Hans-Michael; Francke, Wittko

    2013-01-01

    Unanswered key questions in bark beetle-plant interactions concern host finding in species attacking angiosperms in tropical zones and whether management strategies based on chemical signaling used for their conifer-attacking temperate relatives may also be applied in the tropics. We hypothesized that there should be a common link in chemical signaling mediating host location by these Scolytids. Using laboratory behavioral assays and chemical analysis we demonstrate that the yellow-orange exo...

  10. Effects of Pathogens and Bark Beetles on Forests

    OpenAIRE

    Goheen, D J; Hansen, E M

    1993-01-01

    This chapter addresses the varied roles that root pathogens and bark beetles play in western coniferous forests as (1) regulators of ecological structure and processes, (2) arbiters of management success and (3) agents of significant economic loss. Pathologists, entomologists, and forest managers often speak of the "impact" of fungal and insect "pests" on forest values. This terminology carries connotations of death and destruction that reflect only part of the role that these organisms play ...

  11. EST Table: FS932894 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS932894 E_FL_fwgP_35I15_F_0 10/09/28 36 %/150 aa ref|NP_001137203.1| bloated tubul...es [Tribolium castaneum] gb|ACH86322.1| bloated tubules [Tribolium castaneum] 10/09/13 32 %/160 aa FBpp01275...:AGAP004932 10/09/10 low homology 10/09/10 36 %/150 aa gi|198386300|gb|ACH86322.1| bloated tubules [Tribolium castaneum] FS928389 fwgP ...

  12. EST Table: FY008918 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY008918 bmov26a05 11/11/04 33 %/171 aa ref|XP_966462.1| PREDICTED: escargot [Tribolium ca...staneum] gb|EFA04685.1| escargot [Tribolium castaneum] 11/11/04 n.h 11/11/04 n.h 11/11/04 low homolog...y 11/11/04 n.h 11/11/04 32 %/152 aa gi|91083365|ref|XP_966462.1| PREDICTED: escargot [Tribolium castaneum] FS841374 bmov ...

  13. Influence of Mountain Pine Beetle on Fuels, Foliar Fuel Moisture Content, and Litter and Volatile Terpenes in Whitebark Pine

    OpenAIRE

    Toone, Chelsea

    2013-01-01

    Mountain pine beetle (Dendroctonus ponderosae Hopkins) has caused extensive tree mortality in whitebark pine (Pinus albicaulis Engelm) forests. Previous studies conducted in various conifer forests have shown that fine surface fuels are significantly altered during a bark beetle outbreak. Bark beetle activity in conifer stands has also been shown to alter foliar fuel moisture content and chemistry over the course of the bark beetle rotation.The objective of this study was to evaluate changes ...

  14. ROVE BEETLES (COLEOPTERA, STAPHYLINIDAE AND THEIR MEDICAL IMPORTANCE

    Directory of Open Access Journals (Sweden)

    B. Janbakhsh

    1977-06-01

    Full Text Available Rove beetle dermatitis produced by the family Staphylinidae genus Paederus has world- wide distribution some one hundred species of Paederus have been found, but it is believed that only 30 of these produce dermatitis. Up to 1976 three species of paederus have been found in Iran as: P. fusciped Curtis; P. pietschmanni Bershaner , and P. spectabilis Kraatz . Observations on the biology of Paederus SPP have shown that the greatest activity coincides with a high degree of humidity during the hot season. Some species seem to be attracted to artificial light. The most common pathological feature caused by rose beetles is a viscular dermatitis Eye lesions may occur, but they are the result of spread of the irritant with the fingers, after the insect was crushed on the skin, therefore secondary infection. Experiments have shown that dermatitis only develops when a rove beetle is crushed on the haemolymph. The vesicant substance is pederin which is distinct from cantharidin in terns of its biological, physical, and chemical propertics.

  15. DETECTION OF DRUGSTORE BEETLES IN 9975 PACKAGES USING ACOUSTIC EMISSIONS

    Energy Technology Data Exchange (ETDEWEB)

    Shull, D.

    2013-03-04

    This report documents the initial feasibility tests performed using a commercial acoustic emission instrument for the purpose of detecting beetles in Department of Energy 9975 shipping packages. The device selected for this testing was a commercial handheld instrument and probe developed for the detection of termites, weevils, beetles and other insect infestations in wooden structures, trees, plants and soil. The results of two rounds of testing are presented. The first tests were performed by the vendor using only the hand-held instrument’s indications and real-time operator analysis of the audio signal content. The second tests included hands-free positioning of the instrument probe and post-collection analysis of the recorded audio signal content including audio background comparisons. The test results indicate that the system is promising for detecting the presence of drugstore beetles, however, additional work would be needed to improve the ease of detection and to automate the signal processing to eliminate the need for human interpretation. Mechanisms for hands-free positioning of the probe and audio background discrimination are also necessary for reliable detection and to reduce potential operator dose in radiation environments.

  16. Bacterial and fungal symbionts of parasitic Dendroctonus bark beetles.

    Science.gov (United States)

    Dohet, Loïc; Grégoire, Jean-Claude; Berasategui, Aileen; Kaltenpoth, Martin; Biedermann, Peter H W

    2016-09-01

    Bark beetles (Curculionidae: Scolytinae) are one of the most species-rich herbivorous insect groups with many shifts in ecology and host-plant use, which may be mediated by their bacterial and fungal symbionts. While symbionts are well studied in economically important, tree-killing species, little is known about parasitic species whose broods develop in living trees. Here, using culture-dependent and independent methods, we provide a comprehensive overview of the associated bacteria, yeasts and filamentous fungi of the parasitic Dendroctonus micans, D. punctatus and D. valens, and compare them to those of other tree-inhabiting insects. Despite inhabiting different geographical regions and/or host trees, the three species showed similar microbial communities. Enterobacteria were the most prevalent bacteria, in particular Rahnella, Pantoea and Ewingella, in addition to Streptomyces Likewise, the yeasts Candida/Cyberlindnera were the most prominent fungi. All these microorganisms are widespread among tree-inhabiting insects with various ecologies, but their high prevalence overall might indicate a beneficial role such as detoxification of tree defenses, diet supplementation or protection against pathogens. As such, our results enable comparisons of symbiont communities of parasitic bark beetles with those of other beetles, and will contribute to our understanding of how microbial symbioses facilitate dietary shifts in insects. PMID:27387908

  17. Rove beetles of medical importance in Brazil (Coleoptera, Staphylinidae, Paederinae

    Directory of Open Access Journals (Sweden)

    Juliana S. Vieira

    2014-09-01

    Full Text Available Rove beetles of medical importance in Brazil (Coleoptera, Staphylinidae, Paederinae. The rove beetles of the genus Paederus Fabricius, 1775 are the most important group within Coleoptera causing dermatitis around the world. The medical importance of Paederus depends on its toxic hemolymph released when these beetles are crushed on human skin. The effects are mainly dermatitis linearis and some sporadic cases of conjunctivitis. In Brazil seven species of Paederus are known to cause dermatitis: P. amazonicus Sharp, 1876, P. brasiliensis Erichson, 1840, P. columbinus Laporte, 1835, P. ferus Erichson, 1840, P. mutans Sharp, 1876, P. protensus Sharp, 1876 stat. rev., and Paederus rutilicornis Erichson, 1840. Paederus mutans and P. protensus are for the first time recorded as of medical importance, whereas the record of P. rutilicornis in Brazil is doubtful. All seven species are redescribed and a dichotomous key is provided. The geographic distributions of all species are documented. The results provided here include the most recent and relevant taxonomic revision of Paederus of the Neotropical region, the first identification key for Brazilian species and the increase of recorded species of medical importance in the world.

  18. Assessing meteorological key factors influencing crop invasion by pollen beetle (

    Directory of Open Access Journals (Sweden)

    Jürgen Junk

    2016-09-01

    Full Text Available The pollen beetle, Meligethes aeneus F. (Coleoptera: Nitidulidae, is a severe pest of winter oilseed rape. A phenological model to forecast the first spring invasion of crops in Luxembourg by M. aeneus was developed in order to provide a tool for improving pest management and for assessing the potential effects of climate change on this pest. The model was derived using long-term, multi-site observational datasets of pollen beetle migration and meteorological data, as the timing of crop invasion is determined mainly by meteorological variables. Daily values of mean air and soil temperature, accumulated sunshine duration and precipitation were used to create a threshold-based model to forecast crop invasion. Minimising of the root mean squared error (RMSE of predicted versus observed migration dates was used as the quality criterion for selecting the optimum combination of threshold values for meteorological variables. We identified mean air temperature 8.0 °C, mean soil temperature 4.6 °C, and sunshine duration of 3.4 h as the best threshold values, with a cut-off of 1 mm precipitation and with no need for persistence of those conditions for more than one day (RMSE=9.3days$RMSE=9.3\\,\\text{days}$. Only in six out of 30 cases, differences between observed and predicted immigration dates were >5$>5$ days. In the future, crop invasion by pollen beetles will probably be strongly affected by changes in air temperature and precipitation related to climate change. We used a multi-model ensemble of 15 regional climate models driven by the A1B emission scenario to assess meteorological changes in two 30‑year future periods, near future (2021–2050 and far future (2069–2098 in comparison with the reference period (1971–2000. Air temperature and precipitation were predicted to increase in the first three months of each year, both in the near future and the far future. The pollen beetle migration model indicated that this change would

  19. An illustrated checklist of dung beetles (Coleoptera: Scarabaeinae from the Periyar Tiger Reserve, Kerala, India

    Directory of Open Access Journals (Sweden)

    Nithya Sathiandran

    2015-12-01

    Full Text Available An illustrated checklist of 36 species of dung beetles (Coleoptera: Scarabaeinae from the Periyar Tiger Reserve in the southern Western Ghats is presented.  Records of eight species endemic to the Western Ghats and a rare primitive old world dung beetle group, Ochicanthon nitidus (Paulian, from the forests of Periyar Tiger Reserve are provided. 

  20. Traditional African plant products to protect stored cowpeas against insect damage : the battle against the beetle

    NARCIS (Netherlands)

    Boeke, S.J.

    2002-01-01

    Seeds of the cowpea plant, Vigna unguiculata , a tropical crop, are very susceptible to attack by the cowpea beetle. This specialist beetle needs only the beans to reproduce rapidly.Most farmers in West Africa have few possibilities to treat the beans and they face their stored supply

  1. Control of Chinese rose beetle (Coleoptera: Scarabaeidae) through the use of solar-powered nighttime illumination

    Science.gov (United States)

    Chinese rose beetle, Adoretus sinicus (Burmeister), a scarab beetle found in Asia and the Pacific Islands, was first reported in Hawaii in 1891. Adults feed at night on leaves of a wide range of plant species, including many that are economically important. Aggregate feeding can stunt or even kill ...

  2. Semiochemical based attraction of Small Hive Beetle: a window into evolution and invasive biology

    Science.gov (United States)

    Insect behavioral preferences are tied to individual experience and evolutionary history. The Small hive beetle, Aethina tumida, is seemingly an anomaly among Nitidulids because members of the genus commonly feed on fruit and decaying material in association with fungi but the small hive beetle th...

  3. Irradiation disinfestation of stored cocoa beans

    International Nuclear Information System (INIS)

    The relationship between effective dosages to induce mortality and sterility in several important storage beetles was investigated. To induce 100% mortality, doses ranging from 0.05 to 0.1 kGy require 4-7 weeks, 0.2-1.0 kGy need 1.5-3 weeks and 2.0 kGy require 1 week for Tribolium castaneum, Oryzaephilus surinamensis and Lasioderma serricorne, respectively. Only at 5.0 kGy did instant mortality occur in the insects tested. Total prevention of F1 progeny was achieved at the lowest dosage (0.05 kGy) for T. castaneum and O. surinamensis; for L. serricorne, the sterility level achieved was 92-99% for doses ranging from 0.05 to 1.0 kGy. Semi-pilot scale tests (12 months) were carried out to evaluate the efficacy of gamma irradiation to control insects (artificially infested L. serricorne and T. castaneum) and moulds in cocoa beans packed in either jute or laminated polypropylene or unlaminated polypropylene bags. Good control against insect infestations was achieved for the whole duration of storage. Laminated polypropylene afforded the best protection against insect reinfestation. Other than a change in moisture content, no changes in the physicochemical properties were observed in the flavour or in the total protein, soluble protein, amino acid and free fatty acid contents. 15 refs, 10 tabs

  4. High plasticity in epithelial morphogenesis during insect dorsal closure

    Directory of Open Access Journals (Sweden)

    Kristen A. Panfilio

    2013-09-01

    Insect embryos complete the outer form of the body via dorsal closure (DC of the epidermal flanks, replacing the transient extraembryonic (EE tissue. Cell shape changes and morphogenetic behavior are well characterized for DC in Drosophila, but these data represent a single species with a secondarily reduced EE component (the amnioserosa that is not representative across the insects. Here, we examine DC in the red flour beetle, Tribolium castaneum, providing the first detailed, functional analysis of DC in an insect with complete EE tissues (distinct amnion and serosa. Surprisingly, we find that differences between Drosophila and Tribolium DC are not restricted to the EE tissue, but also encompass the dorsal epidermis, which differs in cellular architecture and method of final closure (zippering. We then experimentally manipulated EE tissue complement via RNAi for Tc-zen1, allowing us to eliminate the serosa and still examine viable DC in a system with a single EE tissue (the amnion. We find that the EE domain is particularly plastic in morphogenetic behavior and tissue structure. In contrast, embryonic features and overall kinetics are robust to Tc-zen1RNAi manipulation in Tribolium and conserved with a more distantly related insect, but remain substantially different from Drosophila. Although correct DC is essential, plasticity and regulative, compensatory capacity have permitted DC to evolve within the insects. Thus, DC does not represent a strong developmental constraint on the nature of EE development, a property that may have contributed to the reduction of the EE component in the fly lineage.

  5. Localized spatial and temporal attack dynamics of the mountain pine beetle in lodgepole pine. Forest Service research paper

    Energy Technology Data Exchange (ETDEWEB)

    Bentz, B.J.; Powell, J.A.; Logan, J.A.

    1996-12-01

    Colonization of a host tree by the mountain pine beetle (Dendroctonus ponderosae) involves chemical communication that enables a massive aggregation of beetles on a single resource, thereby ensuring host death and subsequent beetle population survival. Beetle populations have evolved a mechanism for termination of colonization on a lodgepole pine tree at optimal beetle densities, with a concomitant switch of attacks to nearby trees. Observations of the daily spatial and temporal attack process of mountain pine beetles (nonepidemic) attacking lodgepole pine suggest that beetles switch attacks to a new host tree before the original focus tree is fully colonized, and that verbenone, an antiaggregating pheromone, may be acting within a tree rather than between trees.

  6. Adult beetles compensate for poor larval food conditions.

    Science.gov (United States)

    Müller, Thorben; Müller, Caroline

    2016-05-01

    Life history traits of herbivores are highly influenced by the quality of their hosts, i.e., the composition of primary and secondary plant metabolites. In holometabolous insects, larvae and adults may face different host plants, which differ in quality. It has been hypothesised that adult fitness is either highest when larval and adult environmental conditions match (environmental matching) or it may be mainly determined by optimal larval conditions (silver spoon effect). Alternatively, the adult stage may be most decisive for the actual fitness, independent of larval food exposure, due to adult compensation ability. To determine the influence of constant versus changing larval and adult host plant experiences on growth performance, fitness and feeding preferences, we carried out a match-mismatch experiment using the mustard leaf beetle, Phaedon cochleariae. Larvae and adults were either constantly reared on watercress (natural host) or cabbage (crop plant) or were switched after metamorphosis to the other host. Growth, reproductive traits and feeding preferences were determined repeatedly over lifetime and host plant quality traits analysed. Differences in the host quality led to differences in the development time and female reproduction. Egg numbers were significantly influenced by the host plant species experienced by the adults. Thus, adults were able to compensate for poor larval conditions. Likewise, the current host experience was most decisive for feeding preferences; in adult beetles a feeding preference was shaped regardless of the larval host plant. Larvae or adults reared on the more nutritious host, cabbage, showed a higher preference for this host. Hence, beetles most likely develop a preference when gaining a direct positive feedback in terms of an improved performance, whereby the current experience matters the most. Highly nutritious crop plants may be, in consequence, all the more exploited by potential pests that may show a high plasticity in

  7. Surveying an endangered saproxylic beetle, Osmoderma eremita, in Mediterranean woodlands

    DEFF Research Database (Denmark)

    Chiari, Stefano; Zauli, Agnese; Mazziotta, Adriano;

    2013-01-01

    Measuring population size is riddled with difficulties for wildlife biologists and managers, and in the case of rare species, it is sometimes practically impossible to estimate abundance, whereas estimation of occupancy is possible. Furthermore, obtaining reliable population size estimates is not....... Detection probability and population size estimates were drawn from each of these four capture methods. There were strong differences in detection probability among methods. Despite using pheromone and beetle manipulation, capture histories were not affected by trap-happiness or trap-shyness. Population...

  8. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional α-amylase/subtilisin inhibitor from Oryza sativa

    International Nuclear Information System (INIS)

    The crystallization of rice α-amylase/subtilisin bifunctional inhibitor is reported. Rice bifunctional α-amylase/subtilisin inhibitor (RASI) can inhibit both α-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 Å resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P21212, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 Å. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%

  9. Evaluation of Cymbopogon martinii oil extract for control of postharvest insect deterioration in cereals and legumes.

    Science.gov (United States)

    Kumar, Rajesh; Srivastava, Manisha; Dubey, N K

    2007-01-01

    The essential oil of Cymbopogon martinii was tested for its potency as a botanical pesticide to protect stored wheat (Triticum aestivum) and gram (garbanzo bean, Cicer arietinum) from insect infestation. The C. martinii oil was potent as a fumigant in stored gram. The oil was an effective repellent against the beetles Callosobruchus chinensis and Tribolium castaneum. Geraniol, the major component of the oil, was not as effective as the oil itself. C. martinii oil significantly affected oviposition, adult development, and mortality of C. chinensis in cow peas (Vigna unguiculata). The C. martinii oil when used as fumigant did not affect viability, germination, and seedling growth of gram. Because of its insecticidal and semiochemical nature, the oil could be used as an alternative to synthetic pesticides in an integrated pest management program to protect stored food commodities. PMID:17265877

  10. EFFECTIVNESS OF PURE DIATOMACEUS EARTH AND DIFFERENT MIXTURES OF DIATOMACEUS EARTH WITH PYRETHRINS

    Directory of Open Access Journals (Sweden)

    Irma Kalinović

    2011-12-01

    Full Text Available This study shows results of laboratory experiments on stored soft white wheat infested with two stored pest species: rice weevil - Sitophilus oryzae (L., and red flour beetle - Tribolium castaneum (Herbst, treated with different mixtures of Diatomaceus earth (DE and pyrethrins (Diatect V, Diatect II, Bug-B-Gon, Perma-Guard D-20 , and DE without pyrethrins (Protect-It, Perma-Guard and DE from Croatia. The obtained results confirmed that the mixture of DE and pyrethrin and PBO is useful against test-insects and generated significantly higher effectiveness when compared with the results obtained with DE without pyrethrins. Due to the fact that Croatia has the sources of good DE and indigenous Dalmatian pyrethrum, it is possible to develop and produce safe, natural and ecologically acceptable Croatian insecticide by using mixture of DE and pyrethrins, for domestic market and export.

  11. The amino acid sequence of a 20 kDa bifunctional subtilisin/alpha-amylase inhibitor from bran [correction of brain] of rice (Oryza sativa L.) seeds.

    Science.gov (United States)

    Ohtsubo, K; Richardson, M

    1992-08-31

    A 20 kDa bifunctional inhibitor of the microbial proteinase, subtilisin, and the alpha-amylase from the larvae of the red flour beetle (Tribolium castaneum) was purified from bran of rice seeds by saline extraction, precipitation with ammonium sulphate, ion-exchange chromatography on DEAE-Cellulose and Toyopearl CM-650, and preparative HPLC on Vydac C18. The complete primary structure was determined by automatic degradation of the intact, reduced and S-alkylated protein, and by manual DABITC/PITC micro-sequencing of peptides obtained from the protein following separate enzymic digestions with trypsin, pepsin, chymotrypsin, elastase and the protease from S. aureus V8. The protein sequence, which contained 176 residues, showed strong homology with similar bifunctional inhibitors previously isolated from wheat and barley which are related to the Kunitz family of proteinase inhibitors from legume seeds. PMID:1511747

  12. Management of Chinese Rose Beetle (Adoretus sinicus) Adults Feeding on Cacao (Theobroma cacao) Using Insecticides.

    Science.gov (United States)

    Spafford, Helen; Ching, Alexander; Manley, Megan; Hardin, Chelsea; Bittenbender, Harry

    2016-01-01

    The Chinese rose beetle (Adoretus sinicus Burmeister (Coleoptera: Scarabaeidae)) is an introduced, widely-established pest in Hawai'i. The adult beetles feed on the leaves of cacao (Theobroma cacao L.), which can lead to defoliation and even death of young trees. We evaluated the impact of five commercially available products with different active ingredients (imidacloprid, azadirachtin, Beauveria bassiana (Bals.-Criv.) Vuill., kaolin clay, and pyrethrin) and the presence or absence of weed mat cover in reducing adult beetle feeding on sapling cacao in the field. The use of weed mat cover reduced feeding damage compared to the untreated control, as did foliar application of imidacloprid, azadirachtin, and B. bassiana. In the laboratory, field-collected adult beetles were presented cacao leaf samples dipped in one of the five products and compared to a control. Beetles exposed to pyrethrin died rapidly. Among the other treatments, only exposure to imidacloprid significantly reduced survival relative to the control. Beetles fed very little on leaf samples with azadirachtin but their longevity was not significantly reduced. Imidacloprid, azadirachtin, and weed mat application had the most promise for reducing adult Chinese rose beetle feeding damage in young cacao and deserve further investigation for successful management of this significant pest. PMID:27348004

  13. Landscape-scale analysis of aboveground tree carbon stocks affected by mountain pine beetles in Idaho

    Science.gov (United States)

    Bright, B. C.; Hicke, J. A.; Hudak, A. T.

    2012-12-01

    Bark beetle outbreaks kill billions of trees in western North America, and the resulting tree mortality can significantly impact local and regional carbon cycling. However, substantial variability in mortality occurs within outbreak areas. Our objective was to quantify landscape-scale effects of beetle infestations on aboveground carbon (AGC) stocks using field observations and remotely sensed data across a 5054 ha study area that had experienced a mountain pine beetle outbreak. Tree mortality was classified using multispectral imagery that separated green, red, and gray trees, and models relating field observations of AGC to LiDAR data were used to map AGC. We combined mortality and AGC maps to quantify AGC in beetle-killed trees. Thirty-nine per cent of the forested area was killed by beetles, with large spatial variability in mortality severity. For the entire study area, 40-50% of AGC was contained in beetle-killed trees. When considered on a per-hectare basis, 75-89% of the study area had >25% AGC in killed trees and 3-6% of the study area had >75% of the AGC in killed trees. Our results show that despite high variability in tree mortality within an outbreak area, bark beetle epidemics can have a large impact on AGC stocks at the landscape scale.

  14. Landscape-scale analysis of aboveground tree carbon stocks affected by mountain pine beetles in Idaho

    International Nuclear Information System (INIS)

    Bark beetle outbreaks kill billions of trees in western North America, and the resulting tree mortality can significantly impact local and regional carbon cycling. However, substantial variability in mortality occurs within outbreak areas. Our objective was to quantify landscape-scale effects of beetle infestations on aboveground carbon (AGC) stocks using field observations and remotely sensed data across a 5054 ha study area that had experienced a mountain pine beetle outbreak. Tree mortality was classified using multispectral imagery that separated green, red, and gray trees, and models relating field observations of AGC to LiDAR data were used to map AGC. We combined mortality and AGC maps to quantify AGC in beetle-killed trees. Thirty-nine per cent of the forested area was killed by beetles, with large spatial variability in mortality severity. For the entire study area, 40–50% of AGC was contained in beetle-killed trees. When considered on a per-hectare basis, 75–89% of the study area had >25% AGC in killed trees and 3–6% of the study area had >75% of the AGC in killed trees. Our results show that despite high variability in tree mortality within an outbreak area, bark beetle epidemics can have a large impact on AGC stocks at the landscape scale. (letter)

  15. Dung beetles (Coleoptera, Scarabaeinae attracted to sheep dung in exotic pastures

    Directory of Open Access Journals (Sweden)

    César Murilo de Albuquerque Correa

    2013-03-01

    Full Text Available Dung beetles (Coleoptera, Scarabaeinae attracted to sheep dung in exotic pastures. In this study we provide data on the abundance and richness of dung beetles (Coleoptera, Scarabaeidae, Scarabaeinae attracted to sheep dung in exotic pastures (Brachiaria spp.. In four areas of exotic pasture pitfall traps were installed and baited with fresh sheep dung for sampling of dung beetles. A total of 2,290 individuals were captured belonging to 16 species, 10 genera and five tribes of Scarabaeinae beetles. Trichillum externepunctatum Preudhomme de Borre, 1886 and Dichotomius bos (Blanchard, 1843 were dominant. The guild of dwellers was the most abundant in pastures. We demonstrate that dung beetles are attracted to sheep dung. Since the production of both cattle and sheep in the same area is common in tropical pasturelands, results obtained here highlight the need to investigate the actual role of dung sharing (cattle dung + sheep dung by dung beetles. It is also suggested that experiments be performed for evaluation of the ecological functions performed by dung beetles using sheep dung.

  16. Tropical rain forest fragmentation, howler monkeys (Alouatta palliata), and dung beetles at Los Tuxtlas, Mexico.

    Science.gov (United States)

    Estrada, A; Anzures D, A; Coates-Estrada, R

    1999-01-01

    In Neotropical rain forests, fresh mammal dung, especially that of howler monkeys, constitutes an important resource used by dung beetles as food and for oviposition and further feeding by their larvae. Tropical rain forest destruction, fragmentation, and subsequent isolation causing reductions in numbers of and the disappearance of howler monkeys may result in decreasing numbers of dung beetles, but this has not been documented. In this study, we present information on the presence of howlers and dung beetles in 38 isolated forest fragments and 15 agricultural habitats. Howler monkeys were censused by visual means, while dung beetles were sampled with traps baited with a mixture of howler, cow, horse, and dog dung. Results indicated that loss of area and isolation of forest fragments result in significant decrements in howlers and dung beetles. However, dung beetle abundance was found to be closely related to the presence of howler monkeys at the sites and habitats investigated. Scenarios of land management designed to reduce isolation among forest fragments may help sustain populations of howler monkeys and dung beetles, which may have positive consequences for rain forest regeneration. PMID:10402034

  17. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans. PMID:27341891

  18. Ophiostoma species (Ascomycetes: Ophiostomatales) associated with bark beetles (Coleoptera: Scolytinae) colonizing Pinus radiata in northern Spain.

    Science.gov (United States)

    Romón, Pedro; Zhou, XuDong; Iturrondobeitia, Juan Carlos; Wingfield, Michael J; Goldarazena, Arturo

    2007-06-01

    Bark beetles (Coleoptera: Scolytinae) are known to be associated with fungi, especially species of Ophiostoma sensu lato and Ceratocystis. However, very little is known about these fungi in Spain. In this study, we examined the fungi associated with 13 bark beetle species and one weevil (Coleoptera: Entiminae) infesting Pinus radiata in the Basque Country of northern Spain. This study included an examination of 1323 bark beetles or their galleries in P. radiata. Isolations yielded a total of 920 cultures, which included 16 species of Ophiostoma sensu lato or their asexual states. These 16 species included 69 associations between fungi and bark beetles and weevils that have not previously been recorded. The most commonly encountered fungal associates of the bark beetles were Ophiostoma ips, Leptographium guttulatum, Ophiostoma stenoceras, and Ophiostoma piceae. In most cases, the niche of colonization had a significant effect on the abundance and composition of colonizing fungi. This confirms that resource overlap between species is reduced by partial spatial segregation. Interaction between niche and time seldom had a significant effect, which suggests that spatial colonization patterns are rarely flexible throughout timber degradation. The differences in common associates among the bark beetle species could be linked to the different niches that these beetles occupy. PMID:17668036

  19. Multitrophic interaction facilitates parasite-host relationship between an invasive beetle and the honey bee.

    Science.gov (United States)

    Torto, Baldwyn; Boucias, Drion G; Arbogast, Richard T; Tumlinson, James H; Teal, Peter E A

    2007-05-15

    Colony defense by honey bees, Apis mellifera, is associated with stinging and mass attack, fueled by the release of alarm pheromones. Thus, alarm pheromones are critically important to survival of honey bee colonies. Here we report that in the parasitic relationship between the European honey bee and the small hive beetle, Aethina tumida, the honey bee's alarm pheromones serve a negative function because they are potent attractants for the beetle. Furthermore, we discovered that the beetles from both Africa and the United States vector a strain of Kodamaea ohmeri yeast, which produces these same honey bee alarm pheromones when grown on pollen in hives. The beetle is not a pest of African honey bees because African bees have evolved effective methods to mitigate beetle infestation. However, European honey bees, faced with disease and pest management stresses different from those experienced by African bees, are unable to effectively inhibit beetle infestation. Therefore, the environment of the European honey bee colony provides optimal conditions to promote the unique bee-beetle-yeast-pollen multitrophic interaction that facilitates effective infestation of hives at the expense of the European honey bee. PMID:17483478

  20. Using dung beetles to evaluate the effects of urbanization on Atlantic Forest biodiversity

    Institute of Scientific and Technical Information of China (English)

    Vanesca Korasaki; José Lopes; George Gardner Brown; Julio Louzada

    2013-01-01

    We used dung beetles to evaluate the impact of urbanization on insect biodiversity in three Atlantic Forest fragments in Londrina,Paraná,Brazil.This study provides the first empirical evidence of the impact of urbanization on richness,abundance,composition and guild structure of dung beetle communities from the Brazilian Atlantic Forest.We evaluated the community aspects (abundance,richness,composition and food guilds) of dung beetles in fragments with different degrees of immersion in the urban matrix using pitfall traps with four alternative baits (rotten meat,rotten fish,pig dung and decaying banana).A total of 1719 individuals were collected,belonging to 29 species from 11 genera and six Scarabaeinae tribes.The most urban-immersed fragment showed a higher species dominance and the beetle community captured on dung presented the greatest evenness.The beetle communities were distinct with respect to the fragments and feeding habits.Except for the dung beetle assemblage in the most urbanized forest fragment,all others exhibited contrasting differences in species composition attracted to each bait type.Our results clearly show that the degree of urbanization affects Atlantic Forest dung beetle communities and that the preservation of forest fragments inside the cities,even small ones,can provide refuges for Scarabaeinae.

  1. Behavioral niche partitioning in a sympatric tiger beetle assemblage and implications for the endangered Salt Creek tiger beetle

    Directory of Open Access Journals (Sweden)

    Tierney R. Brosius

    2013-09-01

    Full Text Available How behavioral patterns are related to niche partitioning is an important question in understanding how closely related species within ecological communities function. Behavioral niche partitioning associated with thermoregulation is well documented in tiger beetles as a group. Co-occurring species of salt flat tiger beetles have adapted many thermoregulatory behaviors to cope with this harsh ecosystem. On first examination these beetles appear to occur in overlapping microhabitats and therefore compete for resources. To determine if behavioral niche partitioning is allowing multiple species to occur within the same harsh salt flat ecosystem we observed Cicindela nevadica lincolniana, Cicindela circumpicta, Cicindela fulgida, and Cicindela togata between 8:00 h and 21:00 h and recorded all behaviors related to thermoregulation using a digital voice recorder. Results of this study strongly indicate that competition among these species for resources has been reduced by the adaptation of different thermoregulatory behaviors such as spending time in shallow water, avoiding the sun during the hottest parts of the day, and by positioning their body against or away from the soil. The endangered C. n. lincolniana appears to rely most heavily on the shallow water of seeps for their diurnal foraging behavior (potentially limiting their foraging habitat, but with the advantage of allowing foraging during the hottest times of the day when potential competitors are less frequent. Ironically, this association also may help explain C. n. lincolniana’s susceptibility to extinction: beyond the loss of saline wetlands generally, limited seeps and pools even within remaining saline habitat may represent a further habitat limitation within an already limited habitat.

  2. EST Table: DC543000 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available PREDICTED: similar to neutral sphingomyelinase (n-smase) activation associated factor fan [Nasonia vitripenn..._971631.1| PREDICTED: similar to neutral sphingomyelinase (n-smase) activation associated factor fan [Tribolium castaneum] DC543000 dpe- ...

  3. EST Table: FS759318 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available 25 aa ref|XP_975608.1| PREDICTED: similar to putative lysosomal glucocerebrosidas...%/225 aa gi|91087345|ref|XP_975608.1| PREDICTED: similar to putative lysosomal glucocerebrosidase [Tribolium castaneum] FS759318 fcaL ...

  4. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  5. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  6. EST Table: FS936166 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) ... similar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) isoform 1 [Tribolium castaneum] FS929848 fwgP ...

  7. EST Table: FS929848 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DICTED: similar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia...1| PREDICTED: similar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) isoform 1 [Tribolium castaneum] FS929848 fwgP ...

  8. EST Table: DC540266 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) ... similar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) isoform 1 [Tribolium castaneum] FS929848 dpe- ...

  9. EST Table: BY921544 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) ... similar to Low density lipoprotein receptor adapter protein 1 (Autosomal recessive hypercholesterolemia protein) isoform 1 [Tribolium castaneum] FS929848 ovS0 ...

  10. EST Table: FS748350 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available PREDICTED: similar to fetal alzheimer antigen, falz [Nasonia vitripennis] 10/09/08 37 %/193 aa FBpp0290563|E...811424.1| PREDICTED: similar to fetal alzheimer antigen, falz [Tribolium castaneum] FS748350 caL- ...

  11. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  12. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  13. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  14. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  15. Colonization of disturbed trees by the southern pine bark beetle guild (Coleoptera: Scolytidae)

    Energy Technology Data Exchange (ETDEWEB)

    Flamm, R.O.; Pulley, P.E.; Coulson, R.N. (Texas A M Univ., College Station (United States))

    1993-02-01

    The southern pine bark beetle guild [Dendroctonus frontalis Zimmermann, D. terebrans (Olivier), Ips calligraphus (Germar), I. grandicollis (Eichhoff), and I. avulsus (Eichhoff)] uses disturbed hosts as habitat for establishment of within-tree populations. The process of colonization of disturbed hosts was examined. Using a procedure designed to emulate effects of a lightning strike, pines were severely disturbed. Response was characterized by measuring beetle populations that (1) arrived at the trees and (2) successfully attacked the trees. Establishment of within-tree populations was characterized by measuring length of egg gallery excavated by attacking adults. The time delay between arrival and attack for D. frontalis and I. calligraphus was also calculated. Attack densities of both species became asymptotic as arrival increased. The percentage of arriving beetles that attacked ranged from 9 to 41 for D. frontalis and from 8 to 59 for I. calligraphus. Numbers of beetles that arrived at the tree but did not attack ranged from 2.7 to 50.2 beetles per dm[sup 2] for D. frontalis and from 0.2 to 10.0 beetles per dm[sup 2] for I. calligraphus. Most D. frontalis and I. calligraphus attacked on the day they arrived. The delay between arrival and attack was longer for I. calligraphus than the D. frontalis. Egg gallery excavated by D. frontalis increased throughout the study. Eventually, the Ips species were excluded from the lower half of the hole. The low attack densities observed in this study illustrate the significance of disturbed trees in providing refuges for enzootic levels of bark beetles. The aggregation behavior of beetle populations colonizing disturbed hosts supported the contention that these trees serve as foci for initiation of infestations. Furthermore, in disturbed pines, small numbers of beetles were capable of overcoming host defense systems.

  16. The saproxylic beetle assemblage associated with different host trees in Southwest China

    Institute of Scientific and Technical Information of China (English)

    Jie Wu; Xiao-Dong Yu; Hong-Zhang Zhou

    2008-01-01

    Dead wood is a habitat for many insects and other small animals,some of which may be rare or endangered and in need of effective protection.In this paper,saproxylic beetle assemblages associated with different host trees in the subtropical forests in southwestern China were investigated.A total of 277 species (1 439 specimens) in 36 beetle families were collected from 117 dead wood samples,of which 101 samples were identified and respectively belonged to 12 tree genera.The number of saproxylic beetle species varied greatly among logs of different tree genera,with the highest diversity on logs of Juglans.Generally,broad-leaved trees had a higher richness and abundance of saproxylic species than coniferous trees.Cluster analysis revealed that assemblages from broad-leaved tree genera were generally similar (except for Betula) and assemblages from coniferous trees formed another distinct cluster.The subsequent indicator analysis proposed that there are different characteristic species for different cluster groups of host tree genera.In our study,log diameter has no positive influence on beetle species density.Conversely,comparisons of individual-based rarefaction curves suggested that beetle species richness was highest in the small diameter class both in coniferous and broad-leaved tree genera.With increased wood decay,proportion of habitat specialists (saproxylic beetles living on one tree genus)decreased,whereas proportion of habitat generalists (living on more than three tree genera)increased.The beetle species density was found to be higher in early stages,and decreased in later stages as well.A negative influence of altitude on saproxylic beetle species richness and abundance was detected.It was indicated that different tree genera and altitudes possibly display cross effects in modulating the altitudinal distribution and host preference of the beetles.

  17. Benefits of Dung Beetles (Coleoptera: Scarabaeidae) on Nutrient Cycling and Forage Growth in Alpaca Pastures

    OpenAIRE

    Arnaudin, Mary Elin

    2012-01-01

    Alpacas have been gaining prominence in the U.S. since the early 1980s. In pastures, dung beetle activity has been shown to enhance the degradation and incorporation of dung into the soil. The benefits of this activity have been quantified for cattle, but not for alpacas. The objectives of this study were to document the dung beetle species present in alpaca pastures, and to evaluate the impact of dung beetle activity on the growth of a common summer annual grass. In 2010 and 2011, dun...

  18. Significantly higher Carabid beetle (Coleoptera: Carabidae) catch in conventionally than in organically managed Christmas tree plantations

    DEFF Research Database (Denmark)

    Bagge, Søren; Lund, Malthe; Rønn, Regin;

    2012-01-01

    Carabid beetles play an important role as consumers of pest organisms in forestry and agriculture. Application of pesticides may negatively affect abundance and activity of carabid beetles, thus reducing their potential beneficial effect. We investigated how abundance and diversity of pitfall...... managed sites. Carabid beetle abundance and richness did not decline more between two sampling periods at sites with pesticide application than at unamended sites. Apparently, the amount of bare ground, which dominated in the conventionally managed, herbicide treated sites, correlated closely with the...

  19. Significantly Higher Carabid Beetle (Coleoptera: Carabidae) Catch in Conventionally than in Organically Managed Christmas Tree Plantations

    DEFF Research Database (Denmark)

    Bagge, Soren; Lund, Malthe; Ronn, Regin;

    2012-01-01

    Carabid beetles play an important role as consumers of pest organisms in forestry and agriculture. Application of pesticides may negatively affect abundance and activity of carabid beetles, thus reducing their potential beneficial effect. We investigated how abundance and diversity of pitfall...... managed sites. Carabid beetle abundance and richness did not decline more between two sampling periods at sites with pesticide application than at unamended sites. Apparently, the amount of bare ground, which dominated in the conventionally managed, herbicide treated sites, correlated closely with the...

  20. Hypogean carabid beetles as indicators of global warming?

    International Nuclear Information System (INIS)

    Climate change has been shown to impact the geographical and altitudinal distribution of animals and plants, and to especially affect range-restricted polar and mountaintop species. However, little is known about the impact on the relict lineages of cave animals. Ground beetles (carabids) show a wide variety of evolutionary pathways, from soil-surface (epigean) predatory habits to life in caves and in other subterranean (hypogean) compartments. We reconstructed an unprecedented set of species/time accumulation curves of the largest carabid genera in Europe, selected by their degree of ‘underground’ adaptation, from true epigean predators to eyeless highly specialized hypogean beetles. The data show that in recent periods an unexpectedly large number of new cave species were found lying in well established European hotspots; the first peak of new species, especially in the most evolved underground taxa, occurred in the 1920–30s and a second burst after the 70s. Temperature data show large warming rates in both periods, suggesting that the temperature increase in the past century might have induced cave species to expand their habitats into large well-aired cavities and superficial underground compartments, where they can be easily sampled. An alternative hypothesis, based on increased sampling intensity, is less supported by available datasets. (letter)

  1. Species radiation of carabid beetles (broscini: mecodema in new zealand.

    Directory of Open Access Journals (Sweden)

    Julia Goldberg

    Full Text Available New Zealand biodiversity has often been viewed as Gondwanan in origin and age, but it is increasingly apparent from molecular studies that diversification, and in many cases origination of lineages, postdate the break-up of Gondwanaland. Relatively few studies of New Zealand animal species radiations have as yet been reported, and here we consider the species-rich genus of carabid beetles, Mecodema. Constrained stratigraphic information (emergence of the Chatham Islands and a substitution rate for Coleoptera were separately used to calibrate Bayesian relaxed molecular clock date estimates for diversification of Mecodema. The inferred timings indicate radiation of these beetles no earlier than the mid-Miocene with most divergences being younger, dating to the Plio-Pleistocene. A shallow age for the radiation along with a complex spatial distribution of these taxa involving many instances of sympatry implicates recent ecological speciation rather than a simplistic allopatric model. This emphasises the youthful and dynamic nature of New Zealand evolution that will be further elucidated with detailed ecological and population genetic analyses.

  2. Hypogean carabid beetles as indicators of global warming?

    Science.gov (United States)

    Brandmayr, Pietro; Giorgi, Filippo; Casale, Achille; Colombetta, Giorgio; Mariotti, Laura; Vigna Taglianti, Augusto; Weber, Friedrich; Pizzolotto, Roberto

    2013-12-01

    Climate change has been shown to impact the geographical and altitudinal distribution of animals and plants, and to especially affect range-restricted polar and mountaintop species. However, little is known about the impact on the relict lineages of cave animals. Ground beetles (carabids) show a wide variety of evolutionary pathways, from soil-surface (epigean) predatory habits to life in caves and in other subterranean (hypogean) compartments. We reconstructed an unprecedented set of species/time accumulation curves of the largest carabid genera in Europe, selected by their degree of ‘underground’ adaptation, from true epigean predators to eyeless highly specialized hypogean beetles. The data show that in recent periods an unexpectedly large number of new cave species were found lying in well established European hotspots; the first peak of new species, especially in the most evolved underground taxa, occurred in the 1920-30s and a second burst after the 70s. Temperature data show large warming rates in both periods, suggesting that the temperature increase in the past century might have induced cave species to expand their habitats into large well-aired cavities and superficial underground compartments, where they can be easily sampled. An alternative hypothesis, based on increased sampling intensity, is less supported by available datasets.

  3. The Evolution of Functionally Redundant Species; Evidence from Beetles.

    Directory of Open Access Journals (Sweden)

    Marten Scheffer

    Full Text Available While species fulfill many different roles in ecosystems, it has been suggested that numerous species might actually share the same function in a near neutral way. So-far, however, it is unclear whether such functional redundancy really exists. We scrutinize this question using extensive data on the world's 4168 species of diving beetles. We show that across the globe these animals have evolved towards a small number of regularly-spaced body sizes, and that locally co-existing species are either very similar in size or differ by at least 35%. Surprisingly, intermediate size differences (10-20% are rare. As body-size strongly reflects functional aspects such as the food that these generalist predators can eat, these beetles thus form relatively distinct groups of functional look-a-likes. The striking global regularity of these patterns support the idea that a self-organizing process drives such species-rich groups to self-organize evolutionary into clusters where functional redundancy ensures resilience through an insurance effect.

  4. Effects of nitrogen application on beetle communities in tea plantations

    Institute of Scientific and Technical Information of China (English)

    Shao-Bo Chen; Zhi-Juan Wei; Zhao-Hua Zeng; Li-Lin Chen; Hui-Tao Chen; Min-Sheng You

    2009-01-01

    In contrast to grassland and forest ecosystems, little is known about insect response to nitrogen deposition in agricultural ecosystems. This study was carried out to investigate the effects of short-term (1-2 years) nitrogen application (0, 172.5, 345.0, 690.0, families, 89 species of beetles, was obtained from a tea plantation in Wuyishan, China. Among them, herbivores, predators and detritivores had 52, 29, and eight species, respectively. Species richness, effective diversity and abundance (measured as the number of individuals and insect biomass) of the beetle community were not significantly related to the rate of nitrogen application. However, nitrogen application changed the species distribution and weakly increased the evenness of species distribution, while this did not significantly change the species evenness. Species richness and abundance of herbivores and predators were not significantly related to the rate of nitrogen application. However, there were some variations in trophic responses to nitrogen. Species richness and abundance of detritivores increased with increasing nitrogen application.

  5. Quantification of motility of carabid beetles in farmland.

    Science.gov (United States)

    Allema, A B; van der Werf, W; Groot, J C J; Hemerik, L; Gort, G; Rossing, W A H; van Lenteren, J C

    2015-04-01

    Quantification of the movement of insects at field and landscape levels helps us to understand their ecology and ecological functions. We conducted a meta-analysis on movement of carabid beetles (Coleoptera: Carabidae), to identify key factors affecting movement and population redistribution. We characterize the rate of redistribution using motility μ (L2 T-1), which is a measure for diffusion of a population in space and time that is consistent with ecological diffusion theory and which can be used for upscaling short-term data to longer time frames. Formulas are provided to calculate motility from literature data on movement distances. A field experiment was conducted to measure the redistribution of mass-released carabid, Pterostichus melanarius in a crop field, and derive motility by fitting a Fokker-Planck diffusion model using inverse modelling. Bias in estimates of motility from literature data is elucidated using the data from the field experiment as a case study. The meta-analysis showed that motility is 5.6 times as high in farmland as in woody habitat. Species associated with forested habitats had greater motility than species associated with open field habitats, both in arable land and woody habitat. The meta-analysis did not identify consistent differences in motility at the species level, or between clusters of larger and smaller beetles. The results presented here provide a basis for calculating time-varying distribution patterns of carabids in farmland and woody habitat. The formulas for calculating motility can be used for other taxa. PMID:25673121

  6. Effectiveness of spinosad against seven major storedgrain insects on corn

    Institute of Scientific and Technical Information of China (English)

    FANGNENG HUANG; BHADRIRAJU SUBRAMANYAM

    2007-01-01

    In January 2005, the United States Environmental Protection Agency registered spinosad as a stored grain protectant. No referenced data on the efficacy of spinosad on corn in suppressing major stored-grain insects have been published. In this paper, we evaluated the efficacy of spinosad against seven major stored-grain insects on shelled corn in the laboratory. Insect species tested were the red flour beetle, Tribolium castaneum (Jacquelin duVal); rusty grain beetle, Cryptolestes ferrugineus (Stephens); lesser grain borer, Rhyzopertha dominica (F.); sawtoothed grain beetle, Oryzaephilus surinamensis (L.); rice weevil, Sitophilus oryzae (L.); maize weevil, Sitophilus zeamais (Motschulsky); and Indian meal moth, Plodia interpunctella (Hübner). Corn kernels were treated with spinosad at 0,0.1, 0.5, 1, and 2 active ingredient (a.i.) mg/kg for controlling the seven species. Beetle adults or P.interpunctella eggs were introduced into each container holding 100 g of untreated or insecticide-treated corn. The seven insect species survived well on the control treatment, produced 28 to 336 progeny, and caused significant kernel damage after 49 days. On spinosad-treated corn, adult mortality of C. ferrugineus, R. dominica, O. surinamensis, S. oryzae, and S. zeamais was > 98% at 1 and 2 mg/kg after 12 days. Spinosad at > 0.5 mg/kg completely suppressed egg-to-larval survival after 21 days and egg-to-adult emergence of P. interpunctella after 49 days, whereas 16% T. castaneum adults survived at 1 mg/kg after 12 days. Spinosad at 1 or 2 mg/kg provided complete or near complete suppression of progeny production and kernel damage of all species after 49 days. Our results indicate that spinosad at the current labeled rate of 1 mg/kg is effective against the seven stored-grain insect pests on corn.

  7. EST Table: FS902354 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS902354 E_FL_ftes_47C16_R_0 11/12/09 n.h 10/09/28 31 %/102 aa ref|XP_973013.1| PREDICTED: simil ... ar to chromosome 15 open reading ... frame 26 [Tribolium castaneum] gb|EFA10210.1| hypo ... 973013.1| PREDICTED: similar to chromosome 15 open reading ... frame 26 [Tribolium castaneum] FS902354 ftes ...

  8. EST Table: FS786414 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS786414 E_FL_fcaL_18C22_R_0 10/09/28 62 %/206 aa ref|XP_973797.1| PREDICTED: similar to NADH-ub ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] gb|EFA09221.1| hypothe ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] FS873341 fcaL ...

  9. EST Table: FS741663 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS741663 E_FL_bmmt_20K24_R_0 10/09/28 56 %/248 aa ref|XP_973797.1| PREDICTED: similar to NADH-ub ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] gb|EFA09221.1| hypothe ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] FS873341 bmmt ...

  10. EST Table: AV404000 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available AV404000 pg--0319 10/09/28 58 %/129 aa ref|XP_973797.1| PREDICTED: similar to NADH-ubiquinone ox ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] gb|EFA09221.1| hypothe ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] CK549469 pg-- ...

  11. EST Table: CK515489 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CK515489 rswjb0_002804.y1 10/09/29 63 %/169 aa ref|XP_973797.1| PREDICTED: similar to NADH-ubiqu ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] gb|EFA09221.1| hypothe ... subunit, mitochondrial precursor (Complex I-75kD) (CI -75kD) [Tribolium castaneum] CK549469 swj ...

  12. EST Table: DC570093 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available DC570093 E_FL_wd--_19N19_R_0 11/12/09 GO hit GO:0003676(nucleic acid binding)|GO:0005622(intrace ... 67 %/128 aa ref|XP_969046.1| PREDICTED: similar to egalitarian ... CG4051-PA [Tribolium castaneum] gb|EFA05719.1| ega ... gi|91084227|ref|XP_969046.1| PREDICTED: similar to egalitarian ... CG4051-PA [Tribolium castaneum] DC570093 wd-- ...

  13. EST Table: FS913906 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS913906 E_FL_fufe_30K16_F_0 11/12/09 GO hit GO:0006355(regulation of transcription, DNA-depende ... 40 %/332 aa ref|XP_967427.2| PREDICTED: similar to hypoxia -inducible factor 1 alpha [Tribolium castaneum] 10/ ... i|189237669|ref|XP_967427.2| PREDICTED: similar to hypoxia -inducible factor 1 alpha [Tribolium castaneum] FS9 ...

  14. EST Table: FS764096 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS764096 E_FL_fcaL_35M01_F_0 11/12/09 GO hit GO:0004871(signal transducer activity)|GO:0007165(s ... 48 %/117 aa ref|XP_967427.2| PREDICTED: similar to hypoxia -inducible factor 1 alpha [Tribolium castaneum] 10/ ... i|189237669|ref|XP_967427.2| PREDICTED: similar to hypoxia -inducible factor 1 alpha [Tribolium castaneum] FS7 ...

  15. Dicty_cDB: SHC302 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHC302 (Link to dictyBase) - - - Contig-U16307-1 SHC302P (Link to Original ... m BAC library Tribolium castaneum genomic, genomic survey ... sequence. 38 0.13 2 CW955469 |CW955469.1 TcB45.3_G ... m BAC library Tribolium castaneum genomic, genomic survey ... sequence. 38 0.13 2 CW955095 |CW955095.1 TcB44.4_G ...

  16. Dicty_cDB: VHA176 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHA176 (Link to dictyBase) - - - Contig-U15241-1 VHA176P (Link to Original ... m BAC library Tribolium castaneum genomic, genomic survey ... sequence. 30 0.072 4 CW954836 |CW954836.1 TcB44.3_ ... m BAC library Tribolium castaneum genomic, genomic survey ... sequence. 30 0.077 4 CG768735 |CG768735.1 TcB47.3_ ...

  17. Primary types of longhorned woodboring beetles (Coleoptera: Cerambycidae and Disteniidae) of the Smithsonian Institution

    Science.gov (United States)

    The primary types of longhorned woodboring beetles (Coleoptera: Cerambycidae, Disteniidae) of the National Museum of Natural History (Smithsonian Institution) are catalogued and figured, current through 2012 (but also including some 2013 holotypes). Data on the original combination, current combina...

  18. Mechanisms of Odor Coding in Coniferous Bark Beetles: From Neuron to Behavior and Application

    Directory of Open Access Journals (Sweden)

    Martin N. Andersson

    2012-01-01

    Full Text Available Coniferous bark beetles (Coleoptera: Curculionidae: Scolytinae locate their hosts by means of olfactory signals, such as pheromone, host, and nonhost compounds. Behavioral responses to these volatiles are well documented. However, apart from the olfactory receptor neurons (ORNs detecting pheromones, information on the peripheral olfactory physiology has for a long time been limited. Recently, however, comprehensive studies on the ORNs of the spruce bark beetle, Ips typographus, were conducted. Several new classes of ORNs were described and odor encoding mechanisms were investigated. In particular, links between behavioral responses and ORN responses were established, allowing for a more profound understanding of bark beetle olfaction. This paper reviews the physiology of bark beetle ORNs. Special focus is on I. typographus, for which the available physiological data can be put into a behavioral context. In addition, some recent field studies and possible applications, related to the physiological studies, are summarized and discussed.

  19. REVIEW: Research on insect biodiversity in Indonesia: Dung beetles (Coleoptera: Scarabaeidae and its role in ecosystem

    Directory of Open Access Journals (Sweden)

    SYAFRIDA MANUWOTO

    2005-04-01

    Full Text Available Research on insect biodiversity in Indonesia which is known as megabiodiversity still not yet a lot of done. Dung beetles represent one of insect group owning very important ecological role and enough suscebtible to condition change of an ecosistem so that is often made as one of bioindicator. Although it was estimated that there is about 1000 to 2000 species of dung beetle in Indo-Australia archipelago but the exact species number of Indonesia’s dung beetles not yet been known, since the are more than 17,000 islands in the country and different islands posseses a lot of endemic species. The lack of entomologist especially taxonomist and the limited of identification key available also become the problems of study on dung beetles biodiversity as well as another group of insect in Indonesia. Therefore, we need some effort expected to solve these problem in order to accelarate the research of insect biodiversity in Indonesia.

  20. Using lake sediment records to reconstruct bark beetle disturbances in western North America

    Directory of Open Access Journals (Sweden)

    Jesse Lee Morris

    2013-12-01

    Full Text Available The recent outbreak of native bark beetles in western North America is unprecedented in severity and scale, at least during the historical period. The aim of this work is to develop a proxy-based methodology to understand how bark beetle disturbances are recorded in lake sediments. Three hypotheses are tested to determine how the ecological impacts of severe spruce beetle (Dendroctonus rufipennis disturbances are recorded following mortality of Engelmann spruce (Picea engelmannii. Outbreaks are hypothesized to: (1 decrease the ratio of spruce to fir pollen; (2 increase soil erosion and mobilize terrestrial C; and (3 leach foliar N, enhancing algal productivity. To test these hypotheses, sediment cores from spruce beetle-affected basins were analyzed for pollen, insect remains, organic and minerogenic content, and isotopic and elemental concentrations. The dataset was tested statistically using generalized linear mixed models (GLMMs to determine if the response variables differed significantly between outbreak and non-outbreak periods. 

  1. Biological control of saltcedar (Tamarix spp.) by saltcedar leaf beetles (Diorhabda spp.): effects on small mammals

    Science.gov (United States)

    The spread of introduced saltcedar (Tamarix spp.) throughout many riparian systems across the western United States motivated the introduction of biological control agents that are specific to saltcedar, saltcedar leaf beetles (Diorhabda carinulata, D. elongata; Chrysomelidae). I monitored small mam...

  2. Critical Assessment of Risk Classification Systems for the Mountain Pine Beetle

    OpenAIRE

    Bentz, B J; Amman, G D; J. A. Logan

    1993-01-01

    Hazard/risk systems developed for mountain pine beetle management traditionally have attempted to describe the potential for timber loss in pine stands due to outbreak phase populations. A variety of stand and site characteristics, as well as climatic conditions, have been used. In this study, four hazard/risk systems were evaluated using data from 105 stands in northern Montana. None of the systems evaluated were found to predict adequately mountain pine beetle induced mortality which occurr...

  3. Plant-derived visual signals may protect beetle herbivores from bird predators

    OpenAIRE

    Tamar Keasar; Miriam Kishinevsky; Avi Shmida; Yoram Gerchman; Nicka Chinkov; Avi Koplovich; Gadi Katzir

    2013-01-01

    Insect herbivores often use chemical signals obtained from their food plants to deter enemies and/or attract sexual partners. Do plant-based visual signals act similarly, i.e., repel consumers' enemies and appeal to potential mates? We explored this question using the pollen-feeding beetle Pygopleurus israelitus (Glaphyridae), a specialized pollinator of Anemone coronaria's chemically defended red-morph flowers. We presented dead beetles, which had fed either on anemones or on cat-food, to yo...

  4. Bark beetles and fire: two forces of nature transforming western forests

    OpenAIRE

    Wells, Gail

    2012-01-01

    Bark beetles are chewing a wide swath through forests across North America. Over the past few years, infestations have become epidemic in lodgepole and spruce-fir forests of the Intermountain West. The resulting extensive acreages of dead trees are alarming the public and raising concern about risk of severe fire. Researchers supported by the Joint Fire Science Program (JFSP) are examining the complicated relationship between bark beetles and wildfire, the two most influential natural disturb...

  5. Contribution of Augosoma centaurus beetle to rural livelihoods in the East region of Cameroon : study report

    OpenAIRE

    F. J. Muafor; Le Gall, Philippe; Levang, Patrice

    2012-01-01

    This report describes the level to which forest dependent people in the East region of Cameroon rely on the consumption of Augosoma centaurus beetle (Dynastidae) for food security and rural livelihood. In total, 14 villages and 2 small towns, comprising of 9 ethnic groups in 10 sub-divisions were surveyed using quantitative and qualitative socioeconomic approaches. From the results of this study, both the larvae and adult individuals of the Augosoma beetle are traditional delic...

  6. The tiger beetles ( Coleoptera , Carabidae , Cicindelinae ) of Israel and adjacent lands

    OpenAIRE

    Matalin, Andrey V.; Chikatunov, Vladimir I.

    2016-01-01

    Abstract Based on field studies, museums collections and literature sources, the current knowledge of the tiger beetle fauna of Israel and adjacent lands is presented. In Israel eight species occur, one of them with two subspecies, while in the Sinai Peninsula nine species of tiger beetles are now known. In the combined regions seven genera from two tribes were found. The Rift Valley with six cicindelids species is the most specious region of Israel. Cylindera contorta valdenbergi and Cicinde...

  7. The tiger beetles (Coleoptera, Carabidae, Cicindelinae) of Israel and adjacent lands

    OpenAIRE

    Matalin,Andrey; I. Chikatunov,Vladimir

    2016-01-01

    Based on field studies, museums collections and literature sources, the current knowledge of the tiger beetle fauna of Israel and adjacent lands is presented. In Israel eight species occur, one of them with two subspecies, while in the Sinai Peninsula nine species of tiger beetles are now known. In the combined regions seven genera from two tribes were found. The Rift Valley with six cicindelids species is the most specious region of Israel. Cylindera contorta valdenbergi and Cicindela javeti...

  8. Contrasting needs of grassland dwellers: habitat preferences of endangered steppe beetles (Coleoptera)

    Czech Academy of Sciences Publication Activity Database

    Čížek, Lukáš; Hauck, David; Pokluda, Pavel

    2012-01-01

    Roč. 16, č. 2 (2012), s. 281-293. ISSN 1366-638X R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z50070508 Keywords : blister beetle * carpathian basin * darkling beetle Subject RIV: EH - Ecology, Behaviour Impact factor: 1.801, year: 2012 http://www.springerlink.com/content/h7523m513164v7l3/

  9. Analysis of the Wing Mechanism Movement Parameters of Selected Beetle Species (Coleoptera

    Directory of Open Access Journals (Sweden)

    Geisler T.

    2015-02-01

    Full Text Available This study presents a structural and functional analysis of the wing bending and folding mechanism of a selected beetle species. Insect motility studies, with regard to the anatomical structure, were performed. The main inner wing structures were highlighted and their mechanical properties and functions were determined. The structure parameters as mechanisms bodies that allow wings of various beetle species to bend and fold were defined.

  10. Aquatic beetles of the alpine lakes: diversity, ecology and small-scale population genetics

    OpenAIRE

    Čiamporová-Zaovičová Z.; Čiampor F.

    2011-01-01

    In this study, we summarize water beetle fauna of the alpine lakes and ponds of the Tatra Mountains. The literature and recent data were used to assess species diversity. Out of around 95 studied alpine water bodies, beetles were found in 61. Altogether, 54 taxa from six families were identified. The different altitudinal zones and lake areas were compared with species richness and species incidence concerning the sites sampled. Besides ...

  11. Dung beetles in an avian-dominated island ecosystem: feeding and trophic ecology.

    Science.gov (United States)

    Stavert, J R; Gaskett, A C; Scott, D J; Beggs, J R

    2014-09-01

    Globally, dung beetles (Scarabaeidae: Scarabaeinae) are linked to many critical ecosystem processes involving the consumption and breakdown of mammal dung. Endemic New Zealand dung beetles (Canthonini) are an anomaly, occurring at high abundance and low diversity on an island archipelago historically lacking terrestrial mammals, except bats, and instead dominated by birds. Have New Zealand's dung beetles evolved to specialise on bird dung or carrion, or have they become broad generalist feeders? We test dietary preferences by analysing nitrogen isotope ratios of wild dung beetles and by performing feeding behaviour observations of captive specimens. We also use nitrogen and carbon stable isotopes to determine if the dung beetle Saphobius edwardsi will consume marine-derived carrion. Nitrogen isotope ratios indicated trophic generalism in Saphobius dung beetles and this was supported by behavioural observations where a broad range of food resources were utilised. Alternative food resource use was further illustrated experimentally by nitrogen and carbon stable isotope signatures of S. edwardsi, where individuals provided with decomposed squid had δ(15)N and δ(13)C values that had shifted toward values associated with marine diet. Our findings suggest that, in the absence of native mammal dung resources, New Zealand dung beetles have evolved a generalist diet of dung and carrion. This may include marine-derived resources, as provided by the seabird colonies present in New Zealand forests before the arrival of humans. This has probably enabled New Zealand dung beetles to persist in indigenous ecosystems despite the decline of native birds and the introduction of many mammal species. PMID:24974270

  12. Agricultural Land Use Determines the Trait Composition of Ground Beetle Communities.

    Directory of Open Access Journals (Sweden)

    Helena I Hanson

    Full Text Available In order to improve biological control of agricultural pests, it is fundamental to understand which factors influence the composition of natural enemies in agricultural landscapes. In this study, we aimed to understand how agricultural land use affects a number of different traits in ground beetle communities to better predict potential consequences of land-use change for ecosystem functioning. We studied ground beetles in fields with different agricultural land use ranging from frequently managed sugar beet fields, winter wheat fields to less intensively managed grasslands. The ground beetles were collected in emergence tents that catch individuals overwintering locally in different life stages and with pitfall traps that catch individuals that could have a local origin or may have dispersed into the field. Community weighted mean values for ground beetle traits such as body size, flight ability and feeding preference were estimated for each land-use type and sampling method. In fields with high land-use intensity the average body length of emerging ground beetle communities was lower than in the grasslands while the average body length of actively moving communities did not differ between the land-use types. The proportion of ground beetles with good flight ability or a carnivorous diet was higher in the crop fields as compared to the grasslands. Our study highlights that increasing management intensity reduces the average body size of emerging ground beetles and the proportion of mixed feeders. Our results also suggest that the dispersal ability of ground beetles enables them to compensate for local management intensities.

  13. Agricultural Land Use Determines the Trait Composition of Ground Beetle Communities.

    Science.gov (United States)

    Hanson, Helena I; Palmu, Erkki; Birkhofer, Klaus; Smith, Henrik G; Hedlund, Katarina

    2016-01-01

    In order to improve biological control of agricultural pests, it is fundamental to understand which factors influence the composition of natural enemies in agricultural landscapes. In this study, we aimed to understand how agricultural land use affects a number of different traits in ground beetle communities to better predict potential consequences of land-use change for ecosystem functioning. We studied ground beetles in fields with different agricultural land use ranging from frequently managed sugar beet fields, winter wheat fields to less intensively managed grasslands. The ground beetles were collected in emergence tents that catch individuals overwintering locally in different life stages and with pitfall traps that catch individuals that could have a local origin or may have dispersed into the field. Community weighted mean values for ground beetle traits such as body size, flight ability and feeding preference were estimated for each land-use type and sampling method. In fields with high land-use intensity the average body length of emerging ground beetle communities was lower than in the grasslands while the average body length of actively moving communities did not differ between the land-use types. The proportion of ground beetles with good flight ability or a carnivorous diet was higher in the crop fields as compared to the grasslands. Our study highlights that increasing management intensity reduces the average body size of emerging ground beetles and the proportion of mixed feeders. Our results also suggest that the dispersal ability of ground beetles enables them to compensate for local management intensities. PMID:26730734

  14. Diagnostic methods of pollen beetle and other winter rape pests resistance to insecticides

    OpenAIRE

    Herman, Jan

    2013-01-01

    The literature review summarizes informations about pests of winter oilseed rape, problem of pest resistance to insecticides, mechanisms of resistance of insects to insecticides and methods, how to evaluate the resistance, and the emergence and development of resistance of pollen beetle to pyrethroids in Europe and in the Czech Republic. In the experimental part of the master‘s thesis, resistance of pollen beetle from 5 locations in the Czech Republic to the three selected pyrethroids (deltam...

  15. Impact of anthropogenic disturbances on beetle communities of French Mediterranean coastal dunes

    OpenAIRE

    Comor, V.N.R.; Orgeas, J.; Ponel, P; Rolando, C.; Delettre, Y.R.

    2008-01-01

    In coastal dunes, influenced by anthropogenic activities such as tourism, it is important to determine the relative influence of environmental factors at different spatial scales to evaluate the sensitivity of local communities to disturbances. We analyzed beetle communities of 14 dunes of the French Mediterranean coast: four in the relatively preserved Camargue area, and ten in the Var department, where tourism is intensive. Beetle communities were studied three times in early spring using s...

  16. Parental effects and flight behaviour in the burying beetle, Nicrophorus vespilloides

    OpenAIRE

    Attisano, Alfredo; Kilner, Rebecca M.

    2015-01-01

    Parents play a key role in determining the phenotype of their offspring. However, relatively few studies have investigated whether parents can change their offspring's behaviour in a sustained way that persists into adulthood. With experiments on the burying beetle, Nicrophorus vespilloides, we investigated how the developmental environment created by parents affects their offspring's wing morphology in adulthood, and the correlated effects on adult flight behaviour. Burying beetles exhibit c...

  17. Beetle-Grow: An Effective Intelligent Tutoring System to Support Conceptual Change

    OpenAIRE

    Farrow, Elaine; Moore, Johanna D.

    2016-01-01

    We will demonstrate the Beetle-Grow intelligent tutoring system, which combines active experimentation, self-explanation, and formative feedback using natural language interaction. It runs in a standard web browser and has a fresh, engaging design. The underlying back-end system has previously been shown to be highly effective in teaching basic electricity and electronics concepts.Beetle-Grow has been designed to capture student interaction and indicators of learning in a form suitable for da...

  18. Saproxylic Beetle Assemblage Selection as Determining Factor of Species Distributional Patterns: Implications for Conservation

    OpenAIRE

    García López, Alejandra; Galante, Eduardo; Micó, Estefanía

    2016-01-01

    The knowledge of the distributional patterns of saproxylic beetles is essential for conservation biology due to the relevance of this fauna in the maintenance of ecological processes and the endangerment of species. The complex community of saproxylic beetles is shaped by different assemblages that are composed of species linked by the microhabitats they use. We evaluate how different the species distribution patterns that are obtained can be, depending on the analyzed assemblage and to what ...

  19. Evaluating leaf litter beetle data sampled by Winkler extraction from Atlantic forest sites in southern Brazil

    OpenAIRE

    Philipp Werner Hopp; Edilson Caron; Richard Ottermanns; Martina Roß-Nickoll

    2011-01-01

    Evaluating leaf litter beetle data sampled by Winkler extraction from Atlantic forest sites in southern Brazil. To evaluate the reliability of data obtained by Winkler extraction in Atlantic forest sites in southern Brazil, we studied litter beetle assemblages in secondary forests (5 to 55 years after abandonment) and old-growth forests at two seasonally different points in time. For all regeneration stages, species density and abundance were lower in April compared to August; but, assemblage...

  20. Mountain pine beetles and emerging issues in the management of woodland caribou in Westcentral British Columbia

    Directory of Open Access Journals (Sweden)

    Deborah Cichowski

    2005-05-01

    Full Text Available The Tweedsmuir—Entiako caribou (Rangifer tarandus caribou herd summers in mountainous terrain in the North Tweedsmuir Park area and winters mainly in low elevation forests in the Entiako area of Westcentral British Columbia. During winter, caribou select mature lodgepole pine (Pinus contorta forests on poor sites and forage primarily by cratering through snow to obtain terrestrial lichens. These forests are subject to frequent large-scale natural disturbance by fire and forest insects. Fire suppression has been effective in reducing large-scale fires in the Entiako area for the last 40—50 years, resulting in a landscape consisting primarily of older lodgepole pine forests, which are susceptible to mountain pine beetle (Dendroctonus ponderosae attack. In 1994, mountain pine beetles were detected in northern Tweedsmuir Park and adjacent managed forests. To date, mountain pine beetles have attacked several hundred thousand hectares of caribou summer and winter range in the vicinity of Tweedsmuir Park, and Entiako Park and Protected Area. Because an attack of this scale is unprecedented on woodland caribou ranges, there is no information available on the effects of mountain pine beetles on caribou movements, habitat use or terrestrial forage lichen abundance. Implications of the mountain pine beetle epidemic to the Tweedsmuir—Entiako woodland caribou population include effects on terrestrial lichen abundance, effects on caribou movement (reduced snow interception, blowdown, and increased forest harvesting outside protected areas for mountain pine beetle salvage. In 2001 we initiated a study to investigate the effects of mountain pine beetles and forest harvesting on terrestrial caribou forage lichens. Preliminary results suggest that the abundance of Cladina spp. has decreased with a corresponding increase in kinnikinnick (Arctostaphylos uva-ursi and other herbaceous plants. Additional studies are required to determine caribou movement and

  1. Comparative analysis of microbial diversity in Longitarsus flea beetles (Coleoptera: Chrysomelidae).

    Science.gov (United States)

    Kelley, Scott T; Dobler, Susanne

    2011-05-01

    Herbivorous beetles comprise a significant fraction of eukaryotic biodiversity and their plant-feeding adaptations make them notorious agricultural pests. Despite more than a century of research on their ecology and evolution, we know little about the diversity and function of their symbiotic microbial communities. Recent culture-independent molecular studies have shown that insects possess diverse gut microbial communities that appear critical for their survival. In this study, we combined culture-independent methods and high-throughput sequencing strategies to perform a comparative analysis of Longitarsus flea-beetles microbial community diversity (MCD). This genus of beetle herbivores contains host plant specialists and generalists that feed on a diverse array of toxic plants. Using a deep-sequencing approach, we characterized the MCD of eleven Longitarsus species across the genus, several of which represented independent shifts to the same host plant families. Database comparisons found that Longitarsus-associated microbes came from two habitat types: insect guts and the soil rhizosphere. Statistical clustering of the Longitarsus microbial communities found little correlation with the beetle phylogeny, and uncovered discrepancies between bacterial communities extracted directly from beetles and those from frass. A Principal Coordinates Analysis also found some correspondence between beetle MCD and host plant family. Collectively, our data suggest that environmental factors play a dominant role in shaping Longitarsus MCD and that the root-feeding beetle larvae of these insects are inoculated by soil rhizosphere microbes. Future studies will investigate MCD of select Longitarsus species across their geographic ranges and explore the connection between the soil rhizosphere and the beetle MCD. PMID:20844936

  2. Microsatellite loci for the small hive beetle, Aethina tumida, a nest parasite of honey bees.

    Science.gov (United States)

    Evans, J D; Spiewok, S; Teixeira, E W; Neumann, P

    2008-05-01

    Aethina tumida, a beetle parasite of honey bee colonies, has recently and dramatically expanded its range and now parasitizes honey bees on three continents. Polymorphic microsatellite loci for this beetle species will help map this continuing range expansion, and will also prove useful for exploring the mating system and local gene flow patterns for this important parasite. We describe 15 loci that are polymorphic in both the native and introduced ranges of this species, showing from two to 22 alleles. PMID:21585875

  3. The influence of light on small hive beetle (Aethina tumida) behavior and trap capture

    OpenAIRE

    Duehl, Adrian; Arbogast, Richard; Sheridan, Audrey; Teal, Peter

    2012-01-01

    International audience The small hive beetle (Aethina tumida, Murray) is a major pest of honeybee (Apis mellifera) colonies, particularly in the Southeastern USA. We evaluated the small hive beetle's (SHB) response to different wavelengths of the light spectrum and found that SHB larvae and adults were most attracted to the 390 nm wavelength. Early instar larvae were not significantly attracted to light, while wandering larvae and adults exhibited strong positive phototaxis. The light resp...

  4. Assessment of post-beetle impacts on natural regeneration of Lodgepole Pine

    OpenAIRE

    Egger, Keith N; Arocena, Joselito; Green, Scott; Kennedy, Nabla; Massicotte, Hugues; Scholefield, Scott

    2009-01-01

    The ecological disturbance from wildfire (2004) on ~ 10,000 hectares of forests near the Kenny Dam presented a unique opportunity to study the natural and artificial regeneration in burned mountain pine beetle (Dendroctonus ponderosae Hopkins) infested stands in north-central British Columbia. Mountain pine beetle (MPB) has been documented as a natural disturbance agent that may precede wildfire in lodgepole pine forests (Pinus contorta var. latifolia). The objectives of this study were to i)...

  5. Mechanistic origins of bombardier beetle (Brachinini) explosion-induced defensive spray pulsation

    OpenAIRE

    Arndt, Eric Michael; Moore, Wendy; Lee, Wah-Keat; Ortiz, Christine

    2014-01-01

    Bombardier beetles (Brachinini) use a rapid series of discrete explosions inside their pygidial gland reaction chambers to produce a hot, pulsed, quinone-based defensive spray. The mechanism of brachinines’ spray pulsation was explored using anatomical studies and direct observation of explosions inside living beetles using synchrotron x-ray imaging. Quantification of the dynamics of vapor inside the reaction chamber indicates that spray pulsation is controlled by specialized, contiguous cuti...

  6. Incorporating a Sorghum Habitat for Enhancing Lady Beetles (Coleoptera: Coccinellidae) in Cotton

    OpenAIRE

    P. G. Tillman; Cottrell, T. E.

    2012-01-01

    Lady beetles (Coleoptera: Coccinellidae) prey on insect pests in cotton. The objective of this 2 yr on-farm study was to document the impact of a grain sorghum trap crop on the density of Coccinellidae on nearby cotton. Scymnus spp., Coccinella septempunctata (L.), Hippodamia convergens Guérin-Méneville, Harmonia axyridis (Pallas), Coleomegilla maculata (De Geer), Cycloneda munda (Say), and Olla v-nigrum (Mulsant) were found in sorghum over both years. Lady beetle compositions in sorghum and ...

  7. Analysis of the Wing Mechanism Movement Parameters of Selected Beetle Species (Coleoptera)

    OpenAIRE

    Geisler T.; Topczewska S.

    2015-01-01

    This study presents a structural and functional analysis of the wing bending and folding mechanism of a selected beetle species. Insect motility studies, with regard to the anatomical structure, were performed. The main inner wing structures were highlighted and their mechanical properties and functions were determined. The structure parameters as mechanisms bodies that allow wings of various beetle species to bend and fold were defined.

  8. Ascarosides coordinate the dispersal of a plant-parasitic nematode with the metamorphosis of its vector beetle.

    Science.gov (United States)

    Zhao, Lilin; Zhang, Xinxing; Wei, Yanan; Zhou, Jiao; Zhang, Wei; Qin, Peijun; Chinta, Satya; Kong, Xiangbo; Liu, Yunpeng; Yu, Haiying; Hu, Songnian; Zou, Zhen; Butcher, Rebecca A; Sun, Jianghua

    2016-01-01

    Insect vectors are required for the transmission of many species of parasitic nematodes, but the mechanisms by which the vectors and nematodes coordinate their life cycles are poorly understood. Here, we report that ascarosides, an evolutionarily conserved family of nematode pheromones, are produced not only by a plant-parasitic nematode, but also by its vector beetle. The pinewood nematode and its vector beetle cause pine wilt disease, which threatens forest ecosystems world-wide. Ascarosides secreted by the dispersal third-stage nematode LIII larvae promote beetle pupation by inducing ecdysone production in the beetle and up-regulating ecdysone-dependent gene expression. Once the beetle develops into the adult stage, it secretes ascarosides that attract the dispersal fourth-stage nematode LIV larvae, potentially facilitating their movement into the beetle trachea for transport to the next pine tree. These results demonstrate that ascarosides play a key role in the survival and spread of pine wilt disease. PMID:27477780

  9. Ascarosides coordinate the dispersal of a plant-parasitic nematode with the metamorphosis of its vector beetle

    Science.gov (United States)

    Zhao, Lilin; Zhang, Xinxing; Wei, Yanan; Zhou, Jiao; Zhang, Wei; Qin, Peijun; Chinta, Satya; Kong, Xiangbo; Liu, Yunpeng; Yu, Haiying; Hu, Songnian; Zou, Zhen; Butcher, Rebecca A.; Sun, Jianghua

    2016-01-01

    Insect vectors are required for the transmission of many species of parasitic nematodes, but the mechanisms by which the vectors and nematodes coordinate their life cycles are poorly understood. Here, we report that ascarosides, an evolutionarily conserved family of nematode pheromones, are produced not only by a plant-parasitic nematode, but also by its vector beetle. The pinewood nematode and its vector beetle cause pine wilt disease, which threatens forest ecosystems world-wide. Ascarosides secreted by the dispersal third-stage nematode LIII larvae promote beetle pupation by inducing ecdysone production in the beetle and up-regulating ecdysone-dependent gene expression. Once the beetle develops into the adult stage, it secretes ascarosides that attract the dispersal fourth-stage nematode LIV larvae, potentially facilitating their movement into the beetle trachea for transport to the next pine tree. These results demonstrate that ascarosides play a key role in the survival and spread of pine wilt disease. PMID:27477780

  10. Treating cattle with antibiotics affects greenhouse gas emissions, and microbiota in dung and dung beetles.

    Science.gov (United States)

    Hammer, Tobin J; Fierer, Noah; Hardwick, Bess; Simojoki, Asko; Slade, Eleanor; Taponen, Juhani; Viljanen, Heidi; Roslin, Tomas

    2016-05-25

    Antibiotics are routinely used to improve livestock health and growth. However, this practice may have unintended environmental impacts mediated by interactions among the wide range of micro- and macroorganisms found in agroecosystems. For example, antibiotics may alter microbial emissions of greenhouse gases by affecting livestock gut microbiota. Furthermore, antibiotics may affect the microbiota of non-target animals that rely on dung, such as dung beetles, and the ecosystem services they provide. To examine these interactions, we treated cattle with a commonly used broad-spectrum antibiotic and assessed downstream effects on microbiota in dung and dung beetles, greenhouse gas fluxes from dung, and beetle size, survival and reproduction. We found that antibiotic treatment restructured microbiota in dung beetles, which harboured a microbial community distinct from those in the dung they were consuming. The antibiotic effect on beetle microbiota was not associated with smaller size or lower numbers. Unexpectedly, antibiotic treatment raised methane fluxes from dung, possibly by altering the interactions between methanogenic archaea and bacteria in rumen and dung environments. Our findings that antibiotics restructure dung beetle microbiota and modify greenhouse gas emissions from dung indicate that antibiotic treatment may have unintended, cascading ecological effects that extend beyond the target animal. PMID:27226475

  11. Striped Cucumber Beetle (Coleoptera: Chrysomelidae) Aggregation in Response to Cultivar and Flowering.

    Science.gov (United States)

    Gardner, Jeffrey; Hoffmann, Michael P; Mazourek, Michael

    2015-04-01

    The striped cucumber beetle [Acalymma vittatum (F.)] is a specialist pest of cucurbits throughout its range in the United States and Canada. Improved integrated pest management options are needed across the pest's range, especially on organic farms where there are few effective controls. Trap cropping in cucurbits is an option, but there are significant challenges to the technique. Because cucurbit flowers are highly attractive to the beetles, four field experiments tested whether cultivar and phenology interact to preferentially aggregate beetles. The first experiment tested the hypothesis that cucurbit flowers were more attractive to striped cucumber beetles than was foliage. The second experiment tested whether there were differences in beetle aggregation between two relatively attractive cultivars. The third and fourth experiments were factorial designs with two plant cultivars and two levels of flowering to specifically test for an interaction of cultivar and flowering. Results indicated that flowers were more attractive than foliage, beetle aggregation was affected by plant cultivar, and that there was an interaction of cultivar with flowering. We conclude that a single cultivar may be sufficient to serve as a generic trap crop to protect a wide variety of cucurbits. PMID:26313184

  12. Intraspecific and interspecific attraction of three Tomicus beetle species during the shoot-feeding phase.

    Science.gov (United States)

    Wang, J; Zhang, Z; Kong, X; Wang, H; Zhang, S

    2015-04-01

    The shoot beetles Tomicus minor, Tomicus yunnanensis, and Tomicus brevipilosus have been decimating Pinus yunnanensis trees for more than 30 years in Southwestern China. To understand the chemical ecological relationship between pines and Tomicus, and among the three beetle species, we compared the attraction of these beetles to damaged shoots, extracts from damaged shoots, and volatiles from damaged shoots collected by the dynamic headspace sampling method. Experiments were performed using a modified open-arena olfactometer. The male T. minor and both sexes of T. brevipilosus were more strongly attracted to damaged shoots than to undamaged shoots and they showed attraction to shoots damaged by the same species. Female T. minor and both sexes of T. yunnanensis were attracted to shoots damaged by female T. brevipilosus. The three beetle species were attracted to shoot extracts and dynamic headspace volatiles from shoots damaged by the same species and sex. Female T. minor and male T. yunnanensis were also attracted to dynamic headspace volatiles from shoots damaged by both sexes of T. brevipilosus. The results suggested that specific semiochemicals that are induced or produced by T. brevipilosus also attract T. minor and T. yunnanensis. The semiochemicals in damaged shoots affect the attraction of the three beetle species and play an important chemical communication role in weakening the host trees during the beetles' shoot-feeding phase. PMID:25632972

  13. The role of dung beetles in reducing greenhouse gas emissions from cattle farming

    Science.gov (United States)

    Slade, Eleanor M.; Riutta, Terhi; Roslin, Tomas; Tuomisto, Hanna L.

    2016-01-01

    Agriculture is one of the largest anthropogenic sources of greenhouse gases (GHGs), with dairy and beef production accounting for nearly two-thirds of emissions. Several recent papers suggest that dung beetles may affect fluxes of GHGs from cattle farming. Here, we put these previous findings into context. Using Finland as an example, we assessed GHG emissions at three scales: the dung pat, pasture ecosystem, and whole lifecycle of milk or beef production. At the first two levels, dung beetles reduced GHG emissions by up to 7% and 12% respectively, mainly through large reductions in methane (CH4) emissions. However, at the lifecycle level, dung beetles accounted for only a 0.05-0.13% reduction of overall GHG emissions. This mismatch derives from the fact that in intensive production systems, only a limited fraction of all cow pats end up on pastures, offering limited scope for dung beetle mitigation of GHG fluxes. In contrast, we suggest that the effects of dung beetles may be accentuated in tropical countries, where more manure is left on pastures, and dung beetles remove and aerate dung faster, and that this is thus a key area for future research. These considerations give a new perspective on previous results perspective, and suggest that studies of biotic effects on GHG emissions from dung pats on a global scale are a priority for current research.

  14. Observations on the Cave-Associated Beetles (Coleoptera of Nova Scotia, Canada

    Directory of Open Access Journals (Sweden)

    Moseley M.

    2009-07-01

    Full Text Available The cave-associated invertebrates of Nova Scotia constitute a fauna at a very early stage of post-glacial recolonization. TheColeoptera are characterized by low species diversity. A staphylinid Quedius spelaeus spelaeus, a predator, is the only regularlyencountered beetle. Ten other terrestrial species registered from cave environments in the province are collected infrequently. Theyinclude three other rove-beetles: Brathinus nitidus, Gennadota canadensis and Atheta annexa. The latter two together with Catopsgratiosus (Leiodidae constitute a small group of cave-associated beetles found in decompositional situations. Quedius s. spelaeusand a small suite of other guanophiles live in accumulations of porcupine dung: Agolinus leopardus (Scarabaeidae, Corticariaserrata (Latrididae, and Acrotrichis castanea (Ptilidae. Two adventive weevils Otiorhynchus ligneus and Barypeithes pellucidus(Curculionidae collected in shallow cave passages are seasonal transients; Dermestes lardarius (Dermestidae, recorded fromone cave, was probably an accidental (stray. Five of the terrestrial beetles are adventive Palaearctic species. Aquatic beetles arecollected infrequently. Four taxa have been recorded: Agabus larsoni (Dytiscidae may be habitual in regional caves; another Agabussp. (probably semivittatus, Dytiscus sp. (Dytiscidae, and Crenitis digesta (Hydrophilidae are accidentals. The distribution andecology of recorded species are discussed, and attention is drawn to the association of beetles found in a Nova Scotia “ice cave”.

  15. Dung beetles use their dung ball as a mobile thermal refuge.

    Science.gov (United States)

    Smolka, Jochen; Baird, Emily; Byrne, Marcus J; el Jundi, Basil; Warrant, Eric J; Dacke, Marie

    2012-10-23

    At midday, surface temperatures in the desert often exceed 60°C. To be active at this time, animals need extraordinary behavioural or physiological adaptations. Desert ants, for instance, spend up to 75% of their foraging time cooling down on elevated thermal refuges such as grass stalks. Ball-rolling dung beetles work under similar thermal conditions in South African savannahs. After landing at a fresh dung pile, a beetle quickly forms a dung ball and rolls it away in a straight line, head down, walking backwards. Earlier studies have shown that some dung beetles maintain an elevated body temperature to gain a competitive advantage, and that heat shunting may prevent overheating during flight. However, we know little about the behavioural strategies beetles might employ to mitigate heat stress while rolling their dung balls. Using infrared thermography and behavioural experiments, we show here that dung beetles use their dung ball as a mobile thermal refuge onto which they climb to cool down while rolling across hot soil. We further demonstrate that the moist ball functions not only as a portable platform, but also as a heat sink, which effectively cools the beetle as it rolls or climbs onto it. PMID:23098590

  16. Long-term dynamics of leafy spurge (Euphorbia esula) and its biocontrol agent, flea beetles in the genus Aphthona

    Science.gov (United States)

    Larson, Diane L.; Grace, James B.; Larson, Jennifer L.

    2008-01-01

    Three flea beetle species (Aphthona spp.), first introduced into North America in 1988, have come to be regarded as effective biological control organisms for leafy spurge (Euphorbia esula). The black flea beetles (Aphthona lacertosa and A. czwalinae) in particular have been shown to cause reductions in leafy spurge stem counts in the northern Great Plains, while the brown flea beetle (A. nigriscutis) has persisted and spread, but has not been found to be as effective at controlling leafy spurge. The ability of black flea beetles to control leafy spurge in any given year, however, has been found to vary. To better understand the long-term effects of flea beetle herbivory on leafy spurge, we monitored stem counts of leafy spurge and numbers of black and brown flea beetles at three sites on two National Wildlife Refuges in east-central North Dakota, USA, from 1998 to 2006. Brown flea beetle numbers were observed to be negligible on these sites. Over the 9 years of the study, black flea beetles were seen to spread over the three study sites and leafy spurge stem counts declined substantially on two of the three sites. Even at low densities of spurge, black flea beetle populations persisted, a necessary prerequisite for long-term control. We used structural equation models (SEM) to assess the yearly effects of black flea beetles, soil texture, and refuge site on leafy spurge stem counts over this time period. We then used equations developed from the SEM analysis to explore flea beetle–leafy spurge dynamics over time, after controlling for soil texture and refuge. Yearly effect strength of black flea beetles on leafy spurge was found to be modest, largely owing to substantial spatial variability in control. However, simulation results based on prediction coefficients revealed leafy spurge to be highly responsive to increases in flea beetle populations on average.

  17. The biology of the small hive beetle (Aethina tumida, Coleoptera: Nitidulidae): Gaps in our knowledge of an invasive species

    OpenAIRE

    Neumann, Peter; Elzen, Patti

    2004-01-01

    International audience Small hive beetles, Aethina tumida, are honeybee parasites native to Africa, where they are a minor pest only. In contrast, the beetles can be harmful parasites of European honeybee subspecies. Resistance of African subspecies to infestations is probably due to quantitative differences in a series of behaviours such as absconding, aggression, removal of parasite eggs and larvae and social encapsulation. The beetles use counter-resistance tactics such as defence postu...

  18. Mimicking unfolding motion of a beetle hind wing

    Institute of Scientific and Technical Information of China (English)

    MUHAMMAD Azhar; PARK Hoon C; HWANG Do Y; BYUN Doyoung; GOO Nam S

    2009-01-01

    This paper presents an experimental research aiming to realize an artificial hind wing that can mimic the wing unfolding motion of Allomyrina dichotoma, an insect in coleopteran order. Based on the understanding of working principles of beetle wing folding/unfolding mechanisms, the hind wing unfolding motion is mimicked by a combination of creative ideas and state-of-art artificial muscle actuator. In this work, we devise two types of artificial wings and the successfully demonstrate that they can be unfolded by actuation of shape memory alloy wires to provide actuation force at the wing base and along the leading edge vein. The folding/unfolding mechanisms may provide an insight for portable nano/micro air vehicles with morphing wings.

  19. The complete mitochondrial genome of the flea beetle Agasicles hygrophila.

    Science.gov (United States)

    Li, Na; Wei, Jia-Ning; Jia, Dong; Li, Shuang; Ma, Rui-Yan

    2016-09-01

    To provide molecular markers for population genetic analysis of the flea beetle Agasicles hygrophila, we determined its mitochondrial genome (mitogenome) for the first time. The mitogenome of A. hygrophila was 15 917 bp in length with an AT content of 75.15%. It had the typical set of 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and an AT-rich control region. Compared with the ancestral mitogenome of insects, no gene rearrangement occurred in A. hygrophila. Incomplete stop codons were present in PCGs of A. hygrophila. All tRNA genes except for trnS(AGN) could form the typical clover-leaf secondary structures. The phylogenetic analysis indicated that A. hygrophila was close to other species belonging to the same family of Chrysomelidae. PMID:26368047

  20. Effects of polyhydroxy compounds on beetle antifreeze protein activity

    Science.gov (United States)

    Amornwittawat, Natapol; Wang, Sen; Banatlao, Joseph; Chung, Melody; Velasco, Efrain; Duman, John G.; Wen, Xin

    2016-01-01

    Antifreeze proteins (AFPs) noncolligatively depress the nonequilibrium freezing point of a solution and produce a difference between the melting and freezing points termed thermal hysteresis (TH). Some low-molecular-mass solutes can affect the TH values. The TH enhancement effects of selected polyhydroxy compounds including polyols and carbohydrates on an AFP from the beetle Dendroides canadensis were systematically investigated using differential scanning calorimetry (DSC). The number of hydroxyl groups dominates the molar enhancement effectiveness of polyhydroxy compounds having one to five hydroxyl groups. However, the above rule does not apply for polyhydroxy compounds having more than five hydroxyl groups. The most efficient polyhydroxy enhancer identified is trehalose. In a combination of enhancers the strongest enhancer plays the major role in determining the TH enhancement. Mechanistic insights into identification of highly efficient AFP enhancers are discussed. PMID:19038370

  1. Mountain pine beetle impacts on vegetation and carbon stocks

    Science.gov (United States)

    Hawbaker, Todd J.; Briggs, Jennifer S.; Caldwell, Megan K.; Stitt, Susan

    2013-01-01

    In the Southern Rocky Mountains, an epidemic outbreak of mountain pine beetle (Dendroctonus ponderosae; MPB) has caused levels of tree mortality unprecedented in recorded history. The impacts of this mortality on vegetation composition, forest structure, and carbon stocks have only recently received attention, although the impacts of other disturbances such as fires and land-use/land-cover change are much better known. This study, initiated in 2010, aims to increase our understanding of MPB outbreaks and their impacts. We have integrated field-collected data with vegetation simulation models to assess and quantify how long-term patterns of vegetation and carbon stocks have and may change in response to MPB outbreaks and other disturbances.

  2. Elastocapilllarity in insect adhesion: the case of beetle adhesive hair

    Science.gov (United States)

    Gernay, Sophie; Gilet, Tristan; Lambert, Pierre; Federle, Walter

    2014-11-01

    The feet of many insects are covered with dense arrays of hair-like structures called setae. Liquid capillary bridges at the tip of these micrometric structures are responsible for the controlled adhesion of the insect on a large variety of substrates. The resulting adhesion force can exceed several times the body weight of the insect. The high aspect-ratio of setae suggests that flexibility is a key ingredient in this capillary-based adhesion mechanism. There is indeed a strong coupling between their elastic deformation and the shape of the liquid meniscus. In this experimental work, we observe and quantify the local deflection of dock beetle seta tips under perpendicular loading using interference microscopy. Our results are then interpreted in the light of an analytic model of elastocapillarity. This research has been funded by the FRIA/FNRS and the Interuniversity Attraction Poles Programme (IAP 7/38 MicroMAST) initiated by the Belgian Science Policy Office.

  3. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  4. Deforestation and apparent extinctions of endemic forest beetles in Madagascar.

    Science.gov (United States)

    Hanski, Ilkka; Koivulehto, Helena; Cameron, Alison; Rahagalala, Pierre

    2007-06-22

    Madagascar has lost about half of its forest cover since 1953 with much regional variation, for instance most of the coastal lowland forests have been cleared. We sampled the endemic forest-dwelling Helictopleurini dung beetles across Madagascar during 2002-2006. Our samples include 29 of the 51 previously known species for which locality information is available. The most significant factor explaining apparent extinctions (species not collected by us) is forest loss within the historical range of the focal species, suggesting that deforestation has already caused the extinction, or effective extinction, of a large number of insect species with small geographical ranges, typical for many endemic taxa in Madagascar. Currently, roughly 10% of the original forest cover remains. Species-area considerations suggest that this will allow roughly half of the species to persist. Our results are consistent with this prediction. PMID:17341451

  5. Fungal farming in a non-social beetle.

    Directory of Open Access Journals (Sweden)

    Wataru Toki

    Full Text Available Culturing of microbes for food production, called cultivation mutualism, has been well-documented from eusocial and subsocial insects such as ants, termites and ambrosia beetles, but poorly described from solitary, non-social insects. Here we report a fungal farming in a non-social lizard beetle Doubledaya bucculenta (Coleoptera: Erotylidae: Languriinae, which entails development of a special female structure for fungal storage/inoculation, so-called mycangium, and also obligate dependence of the insect on the fungal associate. Adult females of D. bucculenta bore a hole on a recently-dead bamboo culm with their specialized mandibles, lay an egg into the internode cavity, and plug the hole with bamboo fibres. We found that the inner wall of the bamboo internode harboring a larva is always covered with a white fungal layer. A specific Saccharomycetes yeast, Wickerhamomyces anomalus ( = Pichia anomala, was consistently isolated from the inner wall of the bamboo internodes and also from the body surface of the larvae. Histological examination of the ovipositor of adult females revealed an exoskeletal pocket on the eighth abdominal segment. The putative mycangium contained yeast cells, and W. anomalus was repeatedly detected from the symbiotic organ. When first instar larvae were placed on culture media inoculated with W. anomalus, they grew and developed normally to adulthood. By contrast, first instar larvae placed on either sterile culture media or autoclaved strips of bamboo inner wall exhibited arrested growth at the second instar, and addition of W. anomalus to the media resumed growth and development of the larvae. These results strongly suggest a mutualistic nature of the D. bucculenta-W. anomalus association with morphological specialization and physiological dependence. Based on these results, we compare the fungal farming of D. bucculenta with those of social and subsocial insects, and discuss ecological factors relevant to the

  6. Impact of Forest Fragmentation on Patterns of Mountain Pine Beetle-Caused Tree Mortality

    Directory of Open Access Journals (Sweden)

    Trisalyn A. Nelson

    2013-04-01

    Full Text Available The current outbreak of mountain pine beetle, Dendroctonus ponderosae Hopkins, has led to extensive tree mortality in British Columbia and the western United States. While the greatest impacts of the outbreak have been in British Columbia, ongoing impacts are expected as the outbreak continues to spread eastward towards Canada’s boreal and eastern pine forests. Successful mitigation of this outbreak is dependent on understanding how the beetle’s host selection behaviour is influenced by the patchwork of tree mortality across the landscape. While several studies have shown that selective mechanisms operate at the individual tree level, less attention has been given to beetles’ preference for variation in spatial forest patterns, namely forest fragmentation, and if such preference changes with changing population conditions. The objective of this study is to explore the influence of fragmentation on the location of mountain pine beetle caused mortality. Using a negative binomial regression model, we tested the significance of a fragmentation measure called the Aggregation Index for predicting beetle-caused tree mortality in the central interior of British Columbia, Canada in 2000 and 2005. The results explain that mountain pine beetle OPEN ACCESS Forests 2013, 4 280 exhibit a density-dependent dynamic behaviour related to forest patterns, with fragmented forests experiencing greater tree mortality when beetle populations are low (2000. Conversely, more contiguous forests are preferred when populations reach epidemic levels (2005. These results reinforce existing findings that bark beetles exhibit a strong host configuration preference at low population levels and that such pressures are relaxed when beetle densities are high.

  7. Nitrogen cycling responses to mountain pine beetle disturbance in a high elevation whitebark pine ecosystem.

    Directory of Open Access Journals (Sweden)

    Megan P Keville

    Full Text Available Ecological disturbances can significantly affect biogeochemical cycles in terrestrial ecosystems, but the biogeochemical consequences of the extensive mountain pine beetle outbreak in high elevation whitebark pine (WbP (Pinus albicaulis ecosystems of western North America have not been previously investigated. Mountain pine beetle attack has driven widespread WbP mortality, which could drive shifts in both the pools and fluxes of nitrogen (N within these ecosystems. Because N availability can limit forest regrowth, understanding how beetle-induced mortality affects N cycling in WbP stands may be critical to understanding the trajectory of ecosystem recovery. Thus, we measured above- and belowground N pools and fluxes for trees representing three different times since beetle attack, including unattacked trees. Litterfall N inputs were more than ten times higher under recently attacked trees compared to unattacked trees. Soil inorganic N concentrations also increased following beetle attack, potentially driven by a more than two-fold increase in ammonium (NH₄⁺ concentrations in the surface soil organic horizon. However, there were no significant differences in mineral soil inorganic N or soil microbial biomass N concentrations between attacked and unattacked trees, implying that short-term changes in N cycling in response to the initial stages of WbP attack were restricted to the organic horizon. Our results suggest that while mountain pine beetle attack drives a pulse of N from the canopy to the forest floor, changes in litterfall quality and quantity do not have profound effects on soil biogeochemical cycling, at least in the short-term. However, continuous observation of these important ecosystems will be crucial to determining the long-term biogeochemical effects of mountain pine beetle outbreaks.

  8. Scarab Beetle (Coleoptera: Scarabaeidae Fauna in Ardabil Province, North West Iran

    Directory of Open Access Journals (Sweden)

    G Mowlavi

    2008-12-01

    Full Text Available Background: Dung beetles of Coleoptera associated to undisturbed cattle droppings in pastures present great diver¬sity and abundance. Dung beetles also play an important role for transmission of some helminthes to human and cat¬tle. This study was made to survey the biodiversity and abundance of these beetles in Ardebil Province, western Iran.Methods: According to the field study all beetles attracted to fresh cow dung in five areas of Ardebil Province in¬cluding Namin, Ardabil, Meshkinshahr, Neer and Sarein were collected and identified. They were collected during summer 2007 from June to September, with general peaks appearing to be correlated with temperature mainly at 11 a.m to 15 p.m. The samples were identified using appropriate systematic key Results: A total of 231 specimens belonging to 9 beetle genera and at least 15 species were identified as Euoniticel¬lus fulvus, Sisyphus schaffaer, Euonthophagus taurus, Copris lunaris, Chironitis pamphilus, Gymnopleurus coriarus, Euonthophagus amyntas, Caccobius schreberi, Onthophagus speculifer, Onthophagus furcatus, Aphodius, lugens, Apho¬dius fimetarius, A. scrutator, Geotrupes spiniger and G. stercorariusThe most abundant and diverse subfamilies were Coprinae, Geotrupinae, and Aphodiinae. Conclusion: We found 15 species of dung beetles occurred in the region. The prevalence of each species is varied depending on location. Some of them play an important role for helminths transmission of veterinary and public health importance. The finding will provide a clue for pasture management as well as public health monitoring and surveillance of the disease transmitted by dung beetles

  9. Scarab Beetle (Coleoptera: Scarabaeidae Fauna in Ardabil Province, North West Iran

    Directory of Open Access Journals (Sweden)

    G Mowlavi

    2008-12-01

    Full Text Available "nBackground: Dung beetles of Coleoptera associated to undisturbed cattle droppings in pastures present great diver¬sity and abundance. Dung beetles also play an important role for transmission of some helminthes to human and cat¬tle. This study was made to survey the biodiversity and abundance of these beetles in Ardebil Province, western Iran."nMethods: According to the field study all beetles attracted to fresh cow dung in five areas of Ardebil Province in¬cluding Namin, Ardabil, Meshkinshahr, Neer and Sarein were collected and identified. They were collected during summer 2007 from June to September, with general peaks appearing to be correlated with temperature mainly at 11 a.m to 15 p.m. The samples were identified using appropriate systematic key "nResults: A total of 231 specimens belonging to 9 beetle genera and at least 15 species were identified as Euoniticel¬lus fulvus, Sisyphus schaffaer, Euonthophagus taurus, Copris lunaris, Chironitis pamphilus, Gymnopleurus coriarus, Euonthophagus amyntas, Caccobius schreberi, Onthophagus speculifer, Onthophagus furcatus, Aphodius, lugens, Apho¬dius fimetarius, A. scrutator, Geotrupes spiniger and G. stercorarius"nThe most abundant and diverse subfamilies were Coprinae, Geotrupinae, and Aphodiinae. "nConclusion: We found 15 species of dung beetles occurred in the region. The prevalence of each species is varied depending on location. Some of them play an important role for helminths transmission of veterinary and public health importance. The finding will provide a clue for pasture management as well as public health monitoring and surveillance of the disease transmitted by dung beetles

  10. Use of a Digital Image Correlation Technique for Measuring the Material Properties of Beetle Wing

    Institute of Scientific and Technical Information of China (English)

    Tailie Jin; Nam Seo Goo; Sung-Choong Woo; Hoon Cheol Park

    2009-01-01

    Beetle wings are very specialized flight organs consisting of the veins and membranes. Therefore it is necessary from a bionic view to investigate the material properties of a beetle wing experimentally. In the present study, we have used a Digital lmage Correlation (DIC) technique to measure the elastic modulus of a beetle wing membrane. Specimens were prepared by carefully cutting a beetle hind wing into 3.0 mm by 7.0 mm segments (the gage length was 5 mm). We used a scanning electron microscope for a precise measurement of the thickness of the beetle wing membrane. The specimen was attached to a designed fixture to induce a uniform displacement by means of a micromanipulator. We used an ARAMISTM system based on the digital image correlation technique to measure the corresponding displacement of a specimen. The thickness of the beetle wing varied at different points of the membrane. The elastic modulus differed in relation to the membrane arrangement showing a structural anisotropy; the elastic modulus in the chordwise direction is approximately 2.65 GPa, which is three times larger than the elastic modulus in the spanwise direction of 0.84 GPa. As a result, the digital image correlation-based ARAMIS system was suc-cessfully used to measure the elastic modulus of a beetle wing. In addition to membrane's elastic modulus, we considered the Poisson's ratio of the membrane and measured the elastic modulus of a vein using an Instron universal tensile machine. The result reveals the Poisson's ratio is nearly zero and the elastic modulus of a vein is about 11 GPa.

  11. Unintended effects of the herbicides 2,4-D and dicamba on lady beetles.

    Science.gov (United States)

    Freydier, Laurène; Lundgren, Jonathan G

    2016-08-01

    Weed resistance to glyphosate and development of new GM crops tolerant to 2,4-dichlorophenoxyacetic acid (2,4-D) and dicamba is expected to lead to increased use of these herbicides in cropland. The lady beetle, Coleomegilla maculata is an important beneficial insect in cropland that is commonly used as an indicator species in safety evaluations of pesticides. Here, we examined the lethal and non-lethal effects of 2,4-D and dicamba active ingredients and commercial formulations to this lady beetle species, and tested for synergistic effects of the herbicides. Second instars of lady beetles were exposed to an experimental treatment, and their mortality, development, weight, sex ratio, fecundity, and mobility was evaluated. Using similar methods, a dose-response study was conducted on 2,4-D with and without dicamba. The commercial formulation of 2,4-D was highly lethal to lady beetle larvae; the LC90 of this herbicide was 13 % of the label rate. In this case, the "inactive" ingredients were a key driver of the toxicity. Dicamba active ingredient significantly increased lady beetle mortality and reduced their body weight. The commercial formulations of both herbicides reduced the proportion of males in the lady beetle population. The herbicides when used together did not act synergistically in their toxicity toward lady beetles versus when the chemistries were used independently. Our work shows that herbicide formulations can cause both lethal and sublethal effects on non-target, beneficial insects, and these effects are sometimes driven by the "inactive" ingredients. The field-level implications of shifts in weed management practices on insect management programs should receive further attention. PMID:27282375

  12. Association of the symbiotic fungi Fusarium euwallaceae, Graphium sp. and Acremonium sp., with the ambrosia beetle Euwallacea nr. fornicatus in avocado

    Science.gov (United States)

    The ambrosia beetle, Euwallacea nr. fornicatus (Coleoptera:Scolytinae), is a new invasive species to Israel. To date, the beetle has been recorded from 48 tree species representing 25 plant families. Amongst the most affected are avocado, castor-bean and box elder. Isolations from beetle heads revea...

  13. Suitability of California bay laurel and other species as potential hosts for the non-native redbay ambrosia beetle and granulate ambrosia beetle

    Science.gov (United States)

    The redbay ambrosia beetle (Xyleborus glabratus Eichhoff) is a non-native invasive forest pest and vector of the pathogen that causes laurel wilt, a deadly disease of trees in the family Lauraceae in the southeastern United States (U.S.). Concern exists that X. glabratus and its fungal symbiont cou...

  14. Behavioral Ecology of Host Selection in the Asian Longhorn Beetle, Anoplophora glabripennis Motschulsky (Coleoptera: Cermabycidae): Implications for Survey, Detection and Monitoring Adult Beetles

    Science.gov (United States)

    Asian Longhorned Beetle, Anoplophora glabripennis (ALB), is among high risk invasive species that recently invaded the U.S. from China, with infestations in New York City and Long Island, NY, Chicago, IL, Jersey City, Carteret and Linden, NJ, and Toronto, Canada. ALB has attacked 25 deciduous tree s...

  15. Functional genomics and microbiome profiling of the Asian longhorned beetle (Anoplophora glabripennis) reveal insights into the digestive physiology and nutritional ecology of wood feeding beetles

    Science.gov (United States)

    The gut microbial communities associated with xylophagous beetles are taxonomically rich and predominately comprised of taxa that are poised to promote survival in woody tissue, which is devoid of nitrogen and essential nutrients. However, the contributions of gut microbes to digestive physiology a...

  16. Leptographium tereforme sp. nov. and other Ophiostomatales isolated from the root-feeding bark beetle, Hylurgus ligniperda, in California

    Science.gov (United States)

    The redhaired pine bark beetle, Hylurgus ligniperda F., is native to Europe but was discovered in Los Angeles, California in 2003. This root- and stump-feeding bark beetle is a common vector of Ophiostomatales, which are potential tree pathogens or causes of blue-stain of conifer sapwood. In this st...

  17. Fusarium symbionts of an ambrosia beetle (Euwallacea sp.) in southern Florida are pathogens of avocado, Persea americana

    Science.gov (United States)

    Fusarium dieback, a destructive disease of avocado (Persea americana), was reported in California and Israel in 2012. It is associated with an ambrosia beetle, Euwallacea sp., and damage caused by an unnamed symbiont of the beetle in Clade 3 of the Fusarium solani species complex (FSSC) designated p...

  18. 甲壳虫是怎么得到颜色的%How Beetle Got Her Colors

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ Long ago in the Amazon rain forest Beetle was just plain brown.In this same forest there lived a rat that used to tease other small animals and insects that lived there.Best of all she liked to torment the beetle.Rat had a gang of other small animals who followed her,and laughed at her mean jokes.

  19. Efficacy and longevity of essential oil lures for capture of the redbay ambrosia beetle Xyleborus glabratus (Coleoptera: Curculionidae: Scolytinae)

    Science.gov (United States)

    The redbay ambrosia beetle Xyleborus glabratus Eichhoff is an exotic wood-boring pest native to southeastern Asia. It carries a symbiotic fungus (Raffaelea lauricola) that causes laurel wilt, a lethal vascular disease of trees in the Lauraceae. First detected in Georgia in 2002, the beetle has spre...

  20. Microsatellite analysis of the Genetic Diversity of Asian Longhorned Beetles from an Invasive Population in Ontario, Canada

    Science.gov (United States)

    Asian Longhorned Beetles (Anoplophora glabripennis Motschulsky) were discovered in Ontario, Canada in 2003 at a commercial warehouse site, where they likely arrived on solid wood packing materials from China. Trees in the area were heavily scarred with oviposition sites, and larvae and adult beetle...

  1. Walking to survive. Searching, feeding and egg production of the carabid beetle Pterostichus coerulescens L. (= Poecilus versicolor Sturm).

    NARCIS (Netherlands)

    Mols, P.J.M.

    1993-01-01

    This study concerns the prey-searching and feeding behaviour of the polyphagous groundbeetle Pterostichus coerulescens L. ( = Poecilus versicolor Sturm), a common species on sandy soils. This ground beetle rarely flies, thus preysearching behaviour involves walking. The beetle is diurnal. As object

  2. Performance of a Beetle 1.2 chip reading out a Micron PR03 R measuring sensor

    CERN Document Server

    Buytaert, J; Eckstein, D; Palacios, J P

    2004-01-01

    The performance of a Beetle 1.2 chip bonded to a Micron PR03 measuring prototype VELO sensor has been studied using test beam data collected by the VELO group. Results concerning the peak signal, signal to noise ratio, signal remainder 25 ns after peaking time, and a scan of the undershoot region for different bias settings of the Beetle are presented.

  3. Draft Genome Sequence of Raffaelea quercivora JCM 11526, a Japanese Oak Wilt Pathogen Associated with the Platypodid Beetle, Platypus quercivorus

    Science.gov (United States)

    Manabe, Ri-ichiroh; Ohkuma, Moriya; Endoh, Rikiya

    2016-01-01

    The Japanese oak wilt pathogen Raffaelea quercivora and the platypodid beetle, Platypus quercivorus, cause serious mass mortality of Quercus spp. in Japan. Here, we present the first draft genome sequence of R. quercivora JCM 11526 to increase our understanding of the mechanism of pathogenicity and symbiosis with the ambrosia beetle. PMID:27469944

  4. Cloning and characterization of an MRNA encoding an insulin receptor from the horned scarab beetle Onthophagus nigriventris (Coleoptera: scarabaeidae)

    Science.gov (United States)

    The insulin signaling pathway has been implicated in the control of insect polyphenisms for some caste-forming insects and potentially has a role in horn dimorphisms in beetles. Males of the sexually dimorphic dung beetle Onthophagus nigriventris develop a magnificent thoracic horn up to twice the l...

  5. Redbay ambrosia beetle/Laurel wilt: Overview of projects at the USDA-ARS Subtropical Horticulture Research Station

    Science.gov (United States)

    ABSTRACT Laurel wilt, a deadly fungal disease of avocado and other trees in the Lauraceae, is vectored by the redbay ambrosia beetle (Xyleborus glabratus). First detected near Savannah, GA in 2002, the beetle and its obligatory pathogen have since spread to South Carolina and Florida. Currently, t...

  6. Fusarium euwallaceae, a novel species cultivated by a Euwallacea ambrosia beetle that threatens avocado production in Israel and California

    Science.gov (United States)

    Avocado production in Israel and California, USA is facing a serious threat due to damage caused by an invasive Euwallacea ambrosia beetle and a novel Fusarium that it cultivates as a source of food. Adult female beetles possess mandibular mycangia within which they carry the Fusarium symbiont. At l...

  7. Management for Mountain Pine Beetle Outbreak Suppression: Does Relevant Science Support Current Policy?

    Directory of Open Access Journals (Sweden)

    Diana L. Six

    2014-01-01

    Full Text Available While the use of timber harvests is generally accepted as an effective approach to controlling bark beetles during outbreaks, in reality there has been a dearth of monitoring to assess outcomes, and failures are often not reported. Additionally, few studies have focused on how these treatments affect forest structure and function over the long term, or our forests’ ability to adapt to climate change. Despite this, there is a widespread belief in the policy arena that timber harvesting is an effective and necessary tool to address beetle infestations. That belief has led to numerous proposals for, and enactment of, significant changes in federal environmental laws to encourage more timber harvests for beetle control. In this review, we use mountain pine beetle as an exemplar to critically evaluate the state of science behind the use of timber harvest treatments for bark beetle suppression during outbreaks. It is our hope that this review will stimulate research to fill important gaps and to help guide the development of policy and management firmly based in science, and thus, more likely to aid in forest conservation, reduce financial waste, and bolster public trust in public agency decision-making and practice.

  8. Associations of Conifer-Infesting Bark Beetles and Fungi in Fennoscandia

    Directory of Open Access Journals (Sweden)

    Michael J. Wingfield

    2012-02-01

    Full Text Available Bark beetles (Coleoptera, Scolytinae have a widespread association with fungi, especially with ophiostomatoid fungi (Ascomycota that cause blue staining of wood, and in some cases, serious tree diseases. In Fennoscandia, most studies of these fungi have focused on economically important bark beetle species and this is likely to have led to a biased view of the fungal biodiversity in the region. Recently, the associations between fungi and bark beetles in Fennoscandia have been shown to be more diverse than previously thought. Furthermore, they form complex and dynamic associations that are only now beginning to emerge. This review examines the current knowledge of the rather poorly known interactions between bark beetles, fungi and their conifer host trees in Fennoscandia. The diversity of ophiostomatoid species is discussed and the possible factors that influence the assemblages of fungal associates are considered for all species that are known to occur in the region. For many ophiostomatoid species found in Fennoscandia, little or nothing is known regarding their pathogenicity, particularly if they were to be transferred to new environments. We, therefore, draw attention to the possible threats of timber trade and climate change-induced invasions of new habitats by bark beetles and the fungi that can be moved along with them.

  9. Recalibrated tree of leaf beetles (Chrysomelidae indicates independent diversification of angiosperms and their insect herbivores.

    Directory of Open Access Journals (Sweden)

    Jesús Gómez-Zurita

    Full Text Available BACKGROUND: The great diversity of the "Phytophaga" (weevils, longhorn beetles and leaf beetles has been attributed to their co-radiation with the angiosperms based on matching age estimates for both groups, but phylogenetic information and molecular clock calibrations remain insufficient for this conclusion. METHODOLOGY: A phylogenetic analysis of the leaf beetles (Chrysomelidae was conducted based on three partial ribosomal gene markers (mitochondrial rrnL, nuclear small and large subunit rRNA including over 3000 bp for 167 taxa representing most major chrysomelid lineages and outgroups. Molecular clock calibrations and confidence intervals were based on paleontological data from the oldest (K-T boundary leaf beetle fossil, ancient feeding traces ascribed to hispoid Cassidinae, and the vicariant split of Nearctic and Palearctic members of the Timarchini. PRINCIPAL FINDINGS: The origin of the Chrysomelidae was dated to 73-79 Mya (confidence interval 63-86 Mya, and most subfamilies were post-Cretaceous, consistent with the ages of all confirmed body fossils. Two major monocot feeding chrysomelid lineages formed widely separated clades, demonstrating independent colonization of this ancient (early Cretaceous angiosperm lineage. CONCLUSIONS: Previous calibrations proposing a much older origin of Chrysomelidae were not supported. Therefore, chrysomelid beetles likely radiated long after the origin of their host lineages and their diversification was driven by repeated radiaton on a pre-existing diverse resource, rather than ancient host associations.

  10. Beetle adhesive hairs differ in stiffness and stickiness: in vivo adhesion measurements on individual setae

    Science.gov (United States)

    Bullock, James M. R.; Federle, Walter

    2011-05-01

    Leaf beetles are able to climb on smooth and rough surfaces using arrays of micron-sized adhesive hairs (setae) of varying morphology. We report the first in vivo adhesive force measurements of individual setae in the beetle Gastrophysa viridula, using a smooth polystyrene substrate attached to a glass capillary micro-cantilever. The beetles possess three distinct adhesive pads on each leg which differ in function and setal morphology. Visualisation of pull-offs allowed forces to be measured for each tarsal hair type. Male discoidal hairs adhered with the highest forces (919 ± 104 nN, mean ± SE), followed by spatulate (582 ± 59 nN) and pointed (127 ± 19 nN) hairs. Discoidal hairs were stiffer in the normal direction (0.693 ± 0.111 N m-1) than spatulate (0.364 ± 0.039 N m-1) or pointed (0.192 ± 0.044 N m-1) hairs. The greater adhesion on smooth surfaces and the higher stability of discoidal hairs help male beetles to achieve strong adhesion on the elytra of females during copulation. A comparison of pull-off forces measured for single setae and whole pads (arrays) revealed comparable levels of adhesive stress. This suggests that beetles are able to achieve equal load sharing across their adhesive pads so that detachment through peeling is prevented.

  11. Dung beetles eat acorns to increase their ovarian development and thermal tolerance.

    Directory of Open Access Journals (Sweden)

    José R Verdú

    Full Text Available Animals eat different foods in proportions that yield a more favorable balance of nutrients. Despite known examples of these behaviors across different taxa, their ecological and physiological benefits remain unclear. We identified a surprising dietary shift that confers ecophysiological advantages in a dung beetle species. Thorectes lusitanicus, a Mediterranean ecosystem species adapted to eat semi-dry and dry dung (dung-fiber consumers is also actively attracted to oak acorns, consuming and burying them. Acorn consumption appears to confer potential advantages over beetles that do not eat acorns: acorn-fed beetles showed important improvements in the fat body mass, hemolymph composition, and ovary development. During the reproductive period (October-December beetles incorporating acorns into their diets should have greatly improved resistance to low-temperature conditions and improved ovarian development. In addition to enhancing the understanding of the relevance of dietary plasticity to the evolutionary biology of dung beetles, these results open the way to a more general understanding of the ecophysiological implications of differential dietary selection on the ecology and biogeography of these insects.

  12. Genetic Structure of Water Chestnut Beetle: Providing Evidence for Origin of Water Chestnut.

    Science.gov (United States)

    Tang, Xiao-Tian; Zheng, Fu-Shan; Qin, Jing; Lu, Ming-Xing; Du, Yu-Zhou

    2016-01-01

    Water chestnut beetle (Galerucella birmanica Jacoby) is a pest of the water chestnut (Trapa natans L.). To analyze the phylogeny and biogeography of the beetle and provide evidence for the origin of T. natans in China, we conducted this by using three mitochondrial genes (COI, COII and Cytb) and nuclear ITS2 ribosomal DNA of G. birmanica. As for mtDNA genes, the beetle could be subdivided into three groups: northeastern China (NEC), central-northern-southern China (CC-NC-SC) and southwestern China (SWC) based on SAMOVA, phylogenetic analyses and haplotype networks. But for ITS2, no obvious lineages were obtained but individuals which were from NEC region clustered into one clade, which might be due to sequence conservation of ITS2. Significant genetic variation was observed among the three groups with infrequent gene flow between groups, which may have been restricted due to natural barriers and events in the Late Pleistocene. Based on our analyses of genetic variation in the CC-NC-SC geographical region, the star-like haplotype networks, approximate Bayesian computation, niche modelling and phylogeographic variation of the beetle, we concluded that the beetle population has been lasting in the lower, central reaches of the Yangtze River Basin with its host plant, water chestnut, which is consistent with archaeological records. Moreover, we speculate that the CC-NC-SC population of G. birmanica may have undergone a period of expansion coincident with domestication of the water chestnut approximately 113,900-126,500 years ago. PMID:27459279

  13. Genetic Structure of Water Chestnut Beetle: Providing Evidence for Origin of Water Chestnut.

    Directory of Open Access Journals (Sweden)

    Xiao-Tian Tang

    Full Text Available Water chestnut beetle (Galerucella birmanica Jacoby is a pest of the water chestnut (Trapa natans L.. To analyze the phylogeny and biogeography of the beetle and provide evidence for the origin of T. natans in China, we conducted this by using three mitochondrial genes (COI, COII and Cytb and nuclear ITS2 ribosomal DNA of G. birmanica. As for mtDNA genes, the beetle could be subdivided into three groups: northeastern China (NEC, central-northern-southern China (CC-NC-SC and southwestern China (SWC based on SAMOVA, phylogenetic analyses and haplotype networks. But for ITS2, no obvious lineages were obtained but individuals which were from NEC region clustered into one clade, which might be due to sequence conservation of ITS2. Significant genetic variation was observed among the three groups with infrequent gene flow between groups, which may have been restricted due to natural barriers and events in the Late Pleistocene. Based on our analyses of genetic variation in the CC-NC-SC geographical region, the star-like haplotype networks, approximate Bayesian computation, niche modelling and phylogeographic variation of the beetle, we concluded that the beetle population has been lasting in the lower, central reaches of the Yangtze River Basin with its host plant, water chestnut, which is consistent with archaeological records. Moreover, we speculate that the CC-NC-SC population of G. birmanica may have undergone a period of expansion coincident with domestication of the water chestnut approximately 113,900-126,500 years ago.

  14. Novel antennal lobe substructures revealed in the small hive beetle Aethina tumida.

    Science.gov (United States)

    Kollmann, Martin; Rupenthal, Anna Lena; Neumann, Peter; Huetteroth, Wolf; Schachtner, Joachim

    2016-03-01

    The small hive beetle, Aethina tumida, is an emerging pest of social bee colonies. A. tumida shows a specialized life style for which olfaction seems to play a crucial role. To better understand the olfactory system of the beetle, we used immunohistochemistry and 3-D reconstruction to analyze brain structures, especially the paired antennal lobes (AL), which represent the first integration centers for odor information in the insect brain. The basic neuroarchitecture of the A. tumida brain compares well to the typical beetle and insect brain. In comparison to other insects, the AL are relatively large in relationship to other brain areas, suggesting that olfaction is of major importance for the beetle. The AL of both sexes contain about 70 olfactory glomeruli with no obvious size differences of the glomeruli between sexes. Similar to all other insects including beetles, immunostaining with an antiserum against serotonin revealed a large cell that projects from one AL to the contralateral AL to densely innervate all glomeruli. Immunostaining with an antiserum against tachykinin-related peptides (TKRP) revealed hitherto unknown structures in the AL. Small TKRP-immunoreactive spherical substructures are in both sexes evenly distributed within all glomeruli. The source for these immunoreactive islets is very likely a group of about 80 local AL interneurons. We offer two hypotheses on the function of such structures. PMID:26496732

  15. The tiger beetles (Coleoptera, Carabidae, Cicindelinae) of Israel and adjacent lands

    Science.gov (United States)

    Matalin, Andrey V.; Chikatunov, Vladimir I.

    2016-01-01

    Abstract Based on field studies, museums collections and literature sources, the current knowledge of the tiger beetle fauna of Israel and adjacent lands is presented. In Israel eight species occur, one of them with two subspecies, while in the Sinai Peninsula nine species of tiger beetles are now known. In the combined regions seven genera from two tribes were found. The Rift Valley with six cicindelids species is the most specious region of Israel. Cylindera contorta valdenbergi and Cicindela javeti azari have localized distributions and should be considered regional endemics. A similarity analysis of the tiger beetles faunas of different regions of Israel and the Sinai Peninsula reveal two clusters of species. The first includes the Great Rift Valley and most parts of the Sinai Peninsula, and the second incorporates most regions of Israel together with Central Sinai Foothills. Five distinct adult phenological groups of tiger beetles can be distinguished in these two clusters: active all-year (three species), spring-fall (five species), summer (two species), spring-summer (one species) and spring (one species). The likely origins of the tiger beetle fauna of this area are presented. An annotated list and illustrated identification key of the Cicindelinae of Israel and adjacent lands are provided. PMID:27110198

  16. Susceptibility of brassicaceous plants to feeding by flea beetles, Phyllotreta spp. (Coleoptera: Chrysomelidae).

    Science.gov (United States)

    Soroka, Juliana; Grenkow, Larry

    2013-12-01

    Crucifer-feeding flea beetles, Phyllotreta spp., are chronic insect pests in Canadian prairie canola production. Multiple laboratory and field feeding bioassays were conducted to determine the susceptibility of a wide range of crucifer species, cultivars, and accessions to feeding by flea beetles with the goal of discovering sources of resistant germplasm. In 62 bioassays of 218 entries, no consistent decreased feeding by flea beetles was seen on any entries of Brassica carinata A. Braun, Brassica juncea (L.) Czern., Brassica napus L., or Brassica rapa L. There was reduced feeding on condiment mustard Sinapis alba L. lines but not on canola-quality lines with reduced amounts of glucosinolates, which were fed on at levels equal to B. napus. Analyses of glucosinolate content found decreased quantities of hydroxybenzyl and butyl glucosinolates in preferred canola-quality S. alba lines and increased levels of hydroxybutenyl glucosinolates compared with levels in condiment S. alba lines. Eruca sativa Mill. was an excellent flea beetle host; Camelina sativa (L.) Crantz lines experienced little feeding. Lines of Crambe abyssinica Hochst. ex R. E. Fries and Crambe hispanica L. had reduced feeding levels compared with Brassica entries, but Crambe glabrata DC did not. The results indicate possible sources of resistance to Phyllotreta flea beetles, while highlighting the complicated roles that glucosinolates may play in Phyllotreta host preference. PMID:24498758

  17. Spatial-temporal modeling of forest gaps generated by colonization from below- and above-ground bark beetle species

    DEFF Research Database (Denmark)

    Zhu, Jun; Rasmussen, Jakob Gulddahl; Møller, Jesper;

    2008-01-01

    Studies of forest declines are important, because they both reduce timber production and affect successional trajectories of landscapes and ecosystems. Of particular interest is the decline of red pines, which is characterized by expanding areas of dead and chlorotic trees in plantations throughout...... the Great Lakes region. Here we examine the impact of two bark beetle groups, red turpentine beetles and pine engraver bark beetles, on tree mortality and the subsequent gap formation over time in a plantation in Wisconsin. We construct spatial-temporal statistical models that quantify the relations...... among red turpentine beetle colonization, pine engraver bark beetle colonization, and mortality of red pine trees while accounting for correlation across space and over time. We extend traditional Markov random-field models to include temporal terms and multiple-response variables aimed at developing a...

  18. Spatial-temporal modeling of forest gaps generated by colonization from below- and above-ground beetle species

    DEFF Research Database (Denmark)

    Zhu, J.; Rasmussen, Jakob Gulddahl; Møller, Jesper;

    Studies of forest declines are important, because they both reduce timber production and aect successional trajectories of landscapes and ecosystems. Of partic- ular interest is the decline of red pines which is characterized by expanding areas of dead and chlorotic trees in plantations throughout...... the Great Lakes Region. Here we examine the impact of two bark beetle groups, namely red turpentine beetles and pine engraver bark beetles, on tree mortality and the subsequent gap formation over time in a plantation in Wisconsin. We construct spatial-temporal statistical models that quantify the...... relations among red turpentine beetle coloniza- tion, pine engraver bark beetle colonization, and mortality of red pine trees, while accounting for correlation across space and over time. For statistical inference, we adopt a Bayesian hierarchical model and devise Markov chain Monte Carlo algorithms for...

  19. Water beetle distribution along a perennial distance gradient in an intermittent stream from the Mediterranean part of Montenegro

    Directory of Open Access Journals (Sweden)

    Pavićević Ana

    2012-01-01

    Full Text Available In this study, we examined the impact of an unstable hydrological regime (floods and seasonal drying on water beetle fauna after a drought period, in an intermittent stream in the Mediterranean part of Montenegro. Aquatic beetles were collected between November 2009 and May 2010 from three intermittent sites along the Rimanić stream at different distances from the perennial part (DP, using quantitative sampling methods. We predicted that water beetle assemblages would vary in structure and composition along DP gradients. Total abundance, taxa richness, main faunal groups and proportion of adults and larvae were assessed in order to describe the changes in the water beetle assemblages. The water beetle fauna in the studied sites recovered slowly from the drought periods in terms of both total abundance and taxa richness. Analysis of similarity (ANOSIM showed no significant changes in community structure between the sites, but revealed changes in terms of date (Rho = 0.403.

  20. Changes in the phenology of the ground beetle Pterostichus madidus

    Institute of Scientific and Technical Information of China (English)

    Gabor Pozsgai; Nick A. Littlewood

    2011-01-01

    A growing body ofevidence shows that climate change can alter the phenology of plants and animals.In this study long-term data from the UK Environmental Change Network (ECN) were analyzed to investigate whether there has been a change in the phenology of the ground beetle Pterostichus madidus (Fabricius,1775).Pitfall trap data were available from 12 ECN sites across the United Kingdom,most of which have been in operation for more than 15 years.Weather and vegetation datasets were also utilized.Pitfall trap lines were categorized to eight vegetation types.Trend analysis over time was carried out first using all the available dates of capture events,then the datasets grouped by vegetation type and site.Shifts in high-activity periods were also analyzed.P.madidus appearance dates advanced significantly at seven sites and in five vegetation types.Peak activity advanced at two sites.At one site the timing of activity became significantly later.The last day of activity did not change significantly,supporting the theory that the cessation of the activity period is more likely to be controlled by photoperiod than temperature.The relationships between phenological variables and climatic factors were also investigated.However,no significant correlations were detected.These results demonstrate that between 1992 and 2008,phenology ofP madidus at seven sites from the eight analyzed has changed.Global warming may be driving these changes and future work will investigate underlying processes.