WorldWideScience

Sample records for bbaatt del gen

  1. Sobre el significado del descubrimiento del gen FOXP2

    OpenAIRE

    Víctor Manuel LONGA MARTÍNEZ

    2006-01-01

    El reciente descubrimiento del gen FOXP2 ha ofrecido la primera evidencia clara de la base genética del lenguaje, mostrando una correlación inequívoca desde la perspectiva genética entre una versión mutada de F0XP2 y los trastornos lingüísticos de diferente tipo sufridos por una familia inglesa, conocida como KE. El objetivo central del presente trabajo es discutir diferentes aspectos relacionados con tal descubrimiento; especialmente, la discusión del significado de FOXP2 con ...

  2. Genética molecular del alcoholismo

    OpenAIRE

    Mauricio Rey-Buitrago

    2015-01-01

    El alcoholismo es una patología psiquiátrica compleja y de origen multifactorial en la que el factor genético explica alrededor del 50 % del fenómeno. Son numerosos los genes que se han asociado a esta enfermedad, pero su aporte individual es mínimo y contradictorio. Estos genes operan a través de características intermedias como la impulsividad y la sensibilidad al alcohol, lo que hace compleja la definición del fenotipo del alcoholismo. Los estudios de asociación de SNPs, de asociación a to...

  3. Análisis del promotor del gen del receptor de prosatglandina D2, PTGDR en pacientes con asma

    OpenAIRE

    García Solaesa, Virginia

    2012-01-01

    [ES] Esta tesis presenta un análisis del promotor del gen del receptor del prosatglandina D2, PTGDR en pacientes con asma. [ES]This thesis presents an analysis of gene promoter prosatglandina D2 receptor, PTGDR in patients with asthma.

  4. Distancias genéticas en poblaciones del NOA

    Directory of Open Access Journals (Sweden)

    Acreche, Noemí

    1996-01-01

    Full Text Available La mayor parte de los trabajos realizados en nuestro país sobre polimorfismos hematológicos, abordan la necesaria descripción de las poblaciones. Se pone de relieve la importancia de encarar estudios, en base a la valiosa información publicada, que vinculen los grupos con técnicas que permitan realizar nuevas inferencias sobre sus relaciones. Conocidas en gran medida en cuanto a sus manifestaciones culturales, pueden aportar desde lo genético a la comprensión de los procesos microevolutivos ocurridos en una región. Para el NOA, se ha considerado la presencia de comunidades aborígenes incluídas en cuatro familias lingüísticas. Se tendrán en cuenta estos complejos como representativos de afinidades que se establecen a partir de estrechas relaciones entre las etnias, no sólo por la lengua, sino también por las características de sus sistemas productivos, religiosidad y organización. En base a las frecuencias génicas publicadas correspondientes a los siguientes alelos: I*A, I*B, I*O; M, N, S, s; Dia , Dib; P1, P2; C, c; D, d, E, e; Le, le; Fya, Fyb; Jka, Jkb; K y k se construyeron tablas de frecuencias. Se estimaron los coeficientes de distancias genéticas que fueron analizados y posteriormente incluídos en la construcción de un fenograma de los grupos de estudio, mediante agrupaciones (Sahn Cluster secuenciales, aglomerativas, jerárquicas y anidadas. De acuerdo a la información recopilada de las frecuencias de los 25 alelos estudiados en trece poblaciones de aborígenes del NOA y Paraguay, las distancias genéticas obtenidas reflejan los caracteres lingüístico-culturales.

  5. Análisis funcional del promotor I del gen de la gamma-glutamil-transpeptidasa

    OpenAIRE

    Iglesias Iglesias, Ana Aurelia

    2002-01-01

    RESUMEN La transcripción es una de las etapas más importantes de la expresión génica. El gen de la gamma-glutamiltranspeptidasa (GGT) de rata posee una estructura y patrón de expresión que posibilitan el estudio de la regulación de la expresión de los genes a nivel de la transcripción. El objetivo de esta Tesis ha sido el estudio de los mecanismos que están implicados en la regulación del promotor I del gen de la GGT de rata a nivel de la transcripción. Con este fin se han llevado a cabo d...

  6. Estructura y diversidad genética en vacas Holstein de Antioquia usando un polimorfismo del gen bGH

    Directory of Open Access Journals (Sweden)

    Juan Rincon F.

    2013-03-01

    Full Text Available Objetivo. Determinar las frecuencias alélicas y genotípicas del polimorfismo del intrón 3 del gen bGH y estimar algunos parámetros de estructura poblacional en ganado Holstein. Materiales y métodos. El estudio se realizó con 1366 vacas Holstein en 120 hatos de 11 municipios del departamento de Antioquia. Se extrajo DNA por el método de Salting out y la genotipificación se realizó usando la técnica de PCR-RFLPs. La diversidad genética se determinó mediante la comparación de las heterocigosidades, El equilibrio de Hardy-Weinberg (HW y la diferenciación genética entre las poblaciones se realizó usando el software Arlequín 2.0 Las frecuencias alélicas y genotípicas se evaluaron mediante el paquete estadístico SAS®. Resultados. Las frecuencias genotípicas encontradas fueron 0.764 (+/+, 0.223 (+/- y 0.013 (-/- y las frecuencias alélicas 0.876 (+ y 0.124 (-. No se encontraron desviaciones del Equilibrio de Hardy Weinberg en ninguna de las subpoblaciones. La diversidad genética determinada mediante la comparación de las heterocigosidades fue relativamente baja entre poblaciones pero al interior de estas no. El valor de FST de toda la población fue de 0.0068 y significativo (p<0.05, algunos FST pareados también lo fueron, tomando valores desde 0.0 a 0.13. Los estadísticos FIT y FIS no fueron significativos. Conclusiones. El gen bGH es un candidato interesante para evaluar características de importancia económica ya que no parece haber sido sometido a selección directa, presenta una variabilidad media en las poblaciones, observándose diferenciación genética significativa entre distintos municipios, producto de los diferentes sistemas de producción y acceso a las biotecnologías.

  7. Ambiente genético del Gen blaCTX-M-12 en aislamientos hospitalarios de Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    Yamile Adriana Celis Bustos

    2009-06-01

    Full Text Available The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del gen blaCTX-M-12 en 21 aislamientos clínicos de K. pneumoniae. Se evaluó por conjugación la transferencia de resistencia a antibióticos. Integrones, secuencias de inserción y otros elementos genéticos fueron detectados por amplificación del ADN plasmídico con la reacción en cadena de la polimerasa (PCR. Mediante análisis por PCR se determinó la relación entre el gen blaCTX-M-12 y los elementos genéticos detectados. En todos los aislamientos, el gen blaCTX-M-12 se encontró en plásmidos conjugativos de tamaños entre 65 y 106 kpb. La transferencia por conjugación de estos elementos móviles puede explicar la amplia diseminación de este gen entre enterobacterias causantes de infección nosocomial en hospitales de Bogotá, Colombia. El gen blaCTX-M-12 se encontró corriente abajo de ISEcp1, secuencia de inserción que se ha asociado con la movilización de determinantes genéticos de resistencia. Los promotores de ISEcp1, detectados por análisis de secuencia, pueden facilitar la expresión de la cefotaximasa codificada por este gen.Palabras clave: resistencia a antibióticos; elementos genéticos móviles; gen blaCTX-M-12; plásmidos conjugativos;  Klebsiella pneumoniae. Abstract: Genes from CTX-M-1 group have been detected with great frequency in Colombia in intrahospital infection-causing Klebsiella pneumoniae isolates. Knowledge regarding the genetic factors favouring such genes’ dissemination amongst bacterial species is an

  8. Ambiente genético del gen blactx-m-12 en aislamientos hospitalarios de klebsiella pneumoniae

    OpenAIRE

    Celis Bustos, Yamile Adriana; Pulido Manrique, Ingrid Yamile; Valenzuela de Silva, Emilia María; Reguero Reza, María Teresa; Mantilla Anaya, José Ramón

    2009-01-01

    The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del ge...

  9. Ambiente genético del Gen blaCTX-M-12 en aislamientos hospitalarios de Klebsiella pneumoniae

    OpenAIRE

    Yamile Adriana Celis Bustos; Ingrid Yamile Pulido Manrique; Emilia María Valenzuela de Silva; María Teresa Reguero Reza; José Ramón Mantilla Anaya

    2009-01-01

    The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del ge...

  10. Avances del mejoramiento genético participativo del frijol en Cuba

    Directory of Open Access Journals (Sweden)

    Rodobaldo Ortiz-P\\u00E9rez

    2006-01-01

    Full Text Available Las actividades de Fitomejoramiento Participativo fueron conducidas con agricultores del municipio de San Antonio de los Baños de la provincia La Habana y campesinos de la comunidad la Palma de la provincia de Pinar del Río durante 2001 al 2004. En la fase de diagnóstico en las áreas de intervención del proyecto, más del 80 % de los agricultores no utilizaban la semilla del sistema formal; por lo tanto, las variedades obtenidas por los programas de mejoramiento no llegaban a la mayoría de los agricultores. Se buscó un mecanismo alternativo para introducir diversidad genética a las localidades mediante las ferias de diversidad, cuyo objetivo principal ha estado dirigido a facilitar el flujo de semilla de los institutos de investigaciones hacia el agricultor y viceversa. Posterior al desarrollo de las ferias de diversidad se continúa con la experimentación campesina en fincas y cooperativas, desarrollándose una amplia red experimental difícil de lograrse sin la participación de los productores. La experimentación campesina, el aumento de la eficiencia en la finca, incluyendo el aumento del rendimiento de sus parcelas, el aumento de la diversidad por el uso de mayor número de variedades, y una mayor proporción de área dedicada a estas variedades; todo lo cual redunda en un mejoramiento de la vida del campesino y su familia

  11. Métodos de análisis genéticos, espaciales y de conectividad en genética del paisaje

    OpenAIRE

    Tania Garrido-Garduño; Ella Vázquez-Domínguez

    2013-01-01

    La genética del paisaje tiene como objetivo evaluar la interacción de características del paisaje (es decir, montañas, corredores) y variables ambientales como temperatura o humedad con procesos microevolutivos como flujo genético, deriva génica o selección. Para ello, la genética del paisaje se apoya en métodos de análisis de otras disciplinas como genética de poblaciones, ecología del paisaje y estadística espacial, y cuenta además con métodos propios. En este trabajo explicamos qué es la g...

  12. Factors genètics de la leishmaniosi canina: caracterització del Nramp1 com a gen candidat

    OpenAIRE

    Altet i Sanahujes, Laura

    2003-01-01

    Descripció del recurs: el 22 d'octubre de 2003 L'objectiu d'aquesta tesi és la recerca de gens candidats de resistència o susceptibilitat a leishmaniosi canina. Aquesta malaltia, que és endèmica en l'area mediterranea, és una zoonosi causada pel paràsit Leishmania infantum, on el gos és el principal reservori. A més, està guanyant molta importància en l'home, ja que ha esdevingut una de les coinfeccions principals en malalts del virus de la SIDA. El món dels gossos aporta un material molt ...

  13. Asociación de polimorfismos del gen del receptor de la vitamina D (VDR) con el hiperparatiroidismo

    OpenAIRE

    Suárez Vega, I.; Alía Ramos, P.; García Santamarina, S.; Rigo Bonnin, R. F.; Rosel Soria, P.; Villabona Artero, Carlos; Moreno Llorente, Pablo; Navarro Moreno, Miguel Ángel

    2005-01-01

    El hiperparatiroidismo (HPT) se caracteriza por el aumento de la secreción de la paratirina (PTH) y se manifiesta por la descalcificación ósea e hipercalcemia. Aunque se desconocen la mayoría de los procesos implicados en la patogenia de esta lesión, diversos autores han descrito una asociación entre los polimorfismos del gen VDR con la presencia de esta enfermedad. El objetivo de este trabajo es comprobar si los polimorfismos del gen VDR se asocian a la presencia de HPT.

  14. Análisis genético del virus peruano de la fiebre amarilla

    OpenAIRE

    Carlos Yábar V; Yván Campos B; Kelly Quispe T; Carlos Carrillo P; Ysabel Montoya P

    2002-01-01

    Objetivo: Determinar las variantes genéticas de aislamientos del virus peruano de la Fiebre Amarilla (FA). Materiales y métodos: la región carboxiterminal del gen de la envoltura (E) de cinco aislamientos de FA obtenidas de pacientes provenientes de Ayacucho 1978 (PER1), Junín 1995 (PER2), Cerro de Pasco (PER3), Cusco (1998) y San Martín (1999) fue amplificada por PCR, secuenciada y analizada con programas software de ADN. Resultados: el índice de similaridad de la secuencia de nucleótidos en...

  15. Utilización conjunta del gen de la insulina y del gen de la glucoquinasa en el desarrollo de aproximaciones terapéuticas para la diabetes mellitus

    OpenAIRE

    Bosch i Tubert, Fàtima; Otaegui, Pedro José; Riu Pastor, Efrén; Ferri Masferrer, Tura; Mas Monteys, Alexandre

    2002-01-01

    Utilización conjunta del gen de la insulina y del gen de la glucoquinasa en el desarrollo de aproximaciones terapéuticas para la diabetes mellitus. La presente invención se refiere a un animal doble transgénico que expresa simultáneamente el gen o el cDNA (ADN complementario) de la insulina y el gen o el cDNA (ADN complementario) de la glucoquinasa dirigidos por un promotor o fusión de promotores que permiten expresar insulina y glucoquinasa en músculo y su utilización en el desarrollo de apr...

  16. CLONACIÓN Y FILOGENIA MOLECULAR DE UN SEGMENTO DEL GEN CODANTE DE LA ACTINA DE MYRCIARIA DUBIA “CAMU-CAMU”: UN CANDIDATO PARA GEN DE REFERENCIA

    OpenAIRE

    Juan Castro Gómez; Marianela Cobos Ruiz; Alina Egoavil Reátegui; Roberson Ramírez Saavedra; Sixto Imán Correa; Pedro Adrianzen Julca; Jorge Marapara del Águila

    2012-01-01

    Myrciaria dubia “camu-camu” es un frutal amazónico caracterizado por su amplia variación de vitamina C. Pero los estudios genético moleculares que puedan explicar esta variación son limitados. Por ello nuestro objetivo fue realizar la clonación y filogenia molecular de un segmento del gen codante de la actina de M. dubia. Las muestras fueron obtenidas de la colección de germoplasma del INIA. Luego, el ARN fue purificado y mediante RT-PCR con cebadores degenerados se amplificó un segmento del ...

  17. Actitud del consumidor frente a los alimentos genéticamente modificados

    OpenAIRE

    Viedma, Inmaculada; López Nicolás, José Manuel; Serrano Megías, Marta; Balanza Galindo, Serafín

    2014-01-01

    Uno de los grandes retos en materia de seguridad alimentaria con los que se enfrenta la sociedad del siglo XXI es la aparición de una gran variedad de nuevos alimentos entre los que se encuentran los alimentos genéticamente modificados. Sin embargo, el futuro de estos alimentos va a depender de cómo sean percibidos por los consumidores y de la aceptación de los mismos. En este trabajo se analiza el grado de conocimiento que el consumidor de la Región de Murcia tiene sobre los alimentos genéti...

  18. La Dislexia del Desarrollo: Gen, Cerebro y Cognición Developmental Dyslexia: Gen, Brain, and Cognition

    Directory of Open Access Journals (Sweden)

    Alberto M Galaburda

    2006-11-01

    Full Text Available La dislexia del desarrollo es un trastorno que se caracteriza por dificultades en el aprendizaje de la lectura. Recientemente se ha podido vincular la dislexia a cuatro distintos genes candidatos de riesgo: DYX1C1, KIAA0319, DCDC2 y ROBO1. Estos cuatro genes participan en el desarrollo cerebral, y anomalías de dicho desarrollo constituyen los elementos conocidos del cuadro biológico que subyace a la dislexia. En animales experimentales, la inducción de anomalías del desarrollo cerebral similares produce problemas en el procesamiento de ciertos sonidos. En humanos, problemas de procesamiento de sonidos semejantes se asocian a un trastorno de aprendizaje de la lectura. Por consiguiente, es posible por primera vez, trazar una trayectoria tentativa entre una característica genética, variaciones del desarrollo del cerebro, y trastornos conductuales y cognitivos asociados a la dislexia.Developmental dyslexia is a disorder characterized by difficulties in reading acquisition. Recently, dyslexia has been related to four different genes which are prone-risk candidates: DYX1C1, KIAA0319, DCDC2, and ROBO1. These four genes participate in brain development, and anomalies in that development comprise the known elements of the biological constellation underlying dyslexia. The induction of similar brain development anomalies in experimental animals produces problems in the processing of certain sounds. In humans, similar sound processing problems are related to a reading acquisition disorder. Consequently, for the first time it is possible to delineate a tentative path between a genetic characteristic, brain development variations, and behavioral and cognitive disorders related to dyslexia.

  19. Algunas aplicaciones de la estructura booleana del código genético

    Directory of Open Access Journals (Sweden)

    Gladys Casas Cardoso

    2011-10-01

    Full Text Available Las estructuras boolenas del código genético constituyen modelos matemáticos minimales y muy simplificados que nos ayudan a comprender mejor la lógica subyacente del código genético. Más específicamente, estas estructuras reflejan una fuerte conexión entre los órdenes del código genético y las propiedades físico-químicas de los aminoácidos. En este artículo presentamos dos aplicaciones de esta estructura algebraica en problemas típicos de Bioinformática. El primer es el de la clasificación de las mutaciones de una proteína dada. El siguiente es un caso particular del problema de predicción de estructura secundaria. Usamos además técnicas estadísticas y de inteligencia artificial en la solución de ellos.

  20. Enfermedades genéticas del ADN mitocondrial humano

    OpenAIRE

    Solano Abelardo; Playán Ana; López-Pérez Manuel J.; Montoya Julio

    2001-01-01

    Las enfermedades mitocondriales son un grupo de trastornos que están producidos por un fallo en el sistema de fosforilación oxidativa (sistema Oxphos), la ruta final del metabolismo energético mitocondrial, con la consiguiente deficiencia en la biosíntesis del trifosfato de adenosina (ATP, por sus siglas en inglés). Parte de los polipéptidos que componen este sistema están codificados en el ácido desoxirribonucleico (DNA) mitocondrial y, en los últimos años, se han descrito mutaciones que se ...

  1. VARIABILIDAD DEL GEN NUCLEAR G3PDH EN JATROPHA CURCAS L.

    Directory of Open Access Journals (Sweden)

    Sonia Castro Guzmán

    2015-11-01

    Full Text Available Jatrophacurcas L.es una especie nativa de América tropical; en nuestro país se ha venido utilizando principalmente como medicinal y alimenticia desde la época prehispánica. Actualmente el aceite extraído de sus semillas ha adquirido importancia internacional ya que puede ser transformado a biodiesel. El conocimiento que existe sobre la variabilidad genética de la especie es escaso. Un gen utilizado con éxito para el estudio de patrones de variación y origen de la yuca (ManihotesculentaL. y del caco (Theobromacacao L. es el gen nuclearG3pdh(Gliceraldehído3 fosfato deshidrogenasa involucrado en la fotosíntesis. Con base en ello, en este trabajo se exploró la variabilidad del gen G3pdh en individuos deJ. curcasprovenientes de 15 poblaciones de los estados de Veracruz, Campeche, Yucatán y Quintana Roo. Para obtener el gen G3pdh completo de alrededor de 1000 pares de bases, se amplificó utilizando losprimersdiseñados porStrandet al. (1997 y los dosprimersinternos reverse diseñados porOlsenySchaal(1999 para obtener segmentos más cortos, de 600 y 800 pares de bases aproximadamente. Por primera vez se amplificaron aproximadamente 500pby los resultados demuestran que el gen G3pdh es útil para analizar la variabilidad deJ. curcas, y con un importante potencial para evaluar la distribución y evolución de sus poblaciones en México, conocer las relaciones ancestro descendiente a nivel poblacional y explicar las causas de la distribución de los distintoshaplotipos.

  2. Análisis genético del virus peruano de la fiebre amarilla

    Directory of Open Access Journals (Sweden)

    Carlos Yábar V

    2002-01-01

    Full Text Available Objetivo: Determinar las variantes genéticas de aislamientos del virus peruano de la Fiebre Amarilla (FA. Materiales y métodos: la región carboxiterminal del gen de la envoltura (E de cinco aislamientos de FA obtenidas de pacientes provenientes de Ayacucho 1978 (PER1, Junín 1995 (PER2, Cerro de Pasco (PER3, Cusco (1998 y San Martín (1999 fue amplificada por PCR, secuenciada y analizada con programas software de ADN. Resultados: el índice de similaridad de la secuencia de nucleótidos entre los cinco aislamientos reveló valores oscilantes entre 94,3% y 99,3%, mientras que la secuencia de aminoácidos presentó valores entre 97,6% y 99,7% de similaridad. El análisis filogenético demostró una distancia genética entre 0,40 y 6,50 mediante la secuencia de nucleótidos y a través de la secuencia de aminoácidos se observó un rango de 0,30 y 4,29. Sin embargo, las secuencias correspondientes a los sitios de glicosilación y a los epítopes de reconocimiento humoral fueron conservadas entre los cinco aislamientos, con excepción de algunos aislamientos de referencia reportados por otros autores. Conclusiones: los virus de FA peruanos forman un grupo filogenético distinto a otros virus de FA sudamericanos, basados en el análisis genéticos del gen E.

  3. CLONACIÓN Y FILOGENIA MOLECULAR DE UN SEGMENTO DEL GEN CODANTE DE LA ACTINA DE MYRCIARIA DUBIA “CAMU-CAMU”: UN CANDIDATO PARA GEN DE REFERENCIA

    Directory of Open Access Journals (Sweden)

    Juan Castro Gómez

    2012-12-01

    Full Text Available Myrciaria dubia “camu-camu” es un frutal amazónico caracterizado por su amplia variación de vitamina C. Pero los estudios genético moleculares que puedan explicar esta variación son limitados. Por ello nuestro objetivo fue realizar la clonación y filogenia molecular de un segmento del gen codante de la actina de M. dubia. Las muestras fueron obtenidas de la colección de germoplasma del INIA. Luego, el ARN fue purificado y mediante RT-PCR con cebadores degenerados se amplificó un segmento del gen. En base a la secuencia obtenida se diseñaron cebadores específicos para PCR en tiempo real. Los resultados muestran que se ha aislado, clonado y secuenciado un segmento del gen codante de actina de M. dubia y detectado su expresión en hojas, pulpa y cáscara de M. dubia. Así, con el soporte de herramientas bioinformáticas y uso de técnicas de biología molecular hemos aislado, clonado y secuenciado un segmento del gen codante de la actina de M. dubia. Asimismo, los análisis realizados muestran que el gen se expresa y presenta niveles similares de expresión en hojas, pulpa y cáscara de M. dubia. Sin embargo, es necesario realizar más experimentos a fin de verificar su estabilidad de expresión.

  4. Una revisión de la genética del autismo.

    Directory of Open Access Journals (Sweden)

    Alison Mcinnes

    2002-01-01

    Full Text Available El autismo es un severo trastorno del desarrollo neuropsicológico, caracterizado por una alteración de la comunicación y de la interacción social, y por restringidas, repetitivas y obsesivas pautas de conducta. Afecta más a hombres que a mujeres y, con frecuencia, existe un bajo cociente intelectual. Recientes estimaciones de su prevalencia en California muestran un creciente aumento. Se piensa en posibles causas genéticas y ambientales con un carácter fuertemente hereditario. Existen progresos recientes en lo que respecta al aislamiento de los genes de susceptibilidad, habiéndose confirmado definitivamente los factores de predisposición no ambientales. En la presente revisión se exponen los más recientes hallazgos epidemiológicos, así como los resultados de los actuales estudios sobre la genética del trastorno.

  5. Polimorfismos del gen BoLA-DRB3.2* en ganado criollo colombiano

    Directory of Open Access Journals (Sweden)

    Darwin Hernández H.

    2013-10-01

    Full Text Available Objetivo. Caracterizar el polimorfismo del gen BoLA-DRB3.2* en las razas bovinas criollas y colombianas. Materiales y métodos. En 360 muestras de ADN de ocho razas bovinas criollas (Blanco Orejinegro, Casanareño, Costeño con Cuernos, Chino Santandereano, Caqueteño, Hartón del Valle, Romosinuano y San Martinero, dos razas sintéticas Colombianas (Lucerna y Velásquez y dos razas foráneas (Brahman y Holstein se evaluó el polimorfismo del gen BoLA-DRB3.2 mediante técnicas moleculares (PCR-RFLP; se calculó el número promedio de alelos (NPA, las frecuencias, la heterocigocidad esperada (He y observada (Ho, el equilibrio de Hardy-Weinberg, la estructura genética y los valores de FST y FIS. Resultados. El NPA fue 14.6 ± 3.8 siendo Caqueteño la raza con mayor NPA (25 y el menor el Chino Santandereano (10. Se encontraron 41 alelos BoLA-DRB3.2* los más frecuentes fueron *28, *37, *24, *23, *20, *27, *8, *16, *39 (0.17, 0.11, 0.10, 0.09, 0.09, 0.07, 0.07 y 0.06 respectivamente. Se encontró alta diversidad genética (He = 0.878 con mayor valor en Caqueteño (0.96 y menor en San Martinero (0.81. Todas las razas se encontraron en equilibrio de Hardy-Weinberg, se encontraron valores altamente significativos de diferenciación genética (FST= 0.044 y de coeficiente de endogamia (FIS = 0.249. Conclusiones. El ganado criollo colombiano posee alto polimorfismo del gen BoLA-DRB3.2* representado en los altos valores de NPA y diversidad génetica.

  6. Célula del SMF modificada genéticamente para sobreexpresar NGAL y su uso como medicamento

    OpenAIRE

    Hotter, Georgina; Jung, Michaela; Solà, Anna M.

    2009-01-01

    Célula del SMF modificada genéticamente para sobreexpresar NGAL y su uso como medicamento. La presente invención se encuadra dentro del campo de la biomedicina. Específicamente, la presente invención se refiere a una célula del Sistema Mononuclear Fagocítico o SMF, preferiblemente un monocito o un macrófago, modificada genéticamente para sobreexpresar la lipocalina asociada a gelatinasa de neutrófilos (NGAL, en sus siglas en inglés), a un método para su obtención y a s...

  7. Variabilidad genética del Aedes aegypti determinada mediante el análisis del gen mitocondrial Nd4 en once áreas endémicas para dengue en el Perú

    OpenAIRE

    Pamela Yáñez; Enrique Mamani; Jorge Valle; María Paquita García; Walter León; Pablo Villaseca; Dina Torres; César Cabezas

    2013-01-01

    Con el objetivo de establecer la variabilidad genética de Aedes aegypti determinada por el análisis del gen mitocondrial ND4, se analizaron 51 especímenes de Ae. aegypti en once regiones endémicas para dengue en el Perú. La variabilidad genética se determinó mediante la amplificación y secuenciación de un fragmento de 336 pares de bases del gen mitocondrial ND4. El análisis de filogenia intraespecífica se realizó con el programa Network Ver. 4.6.10; y el análisis filogenético, con el método d...

  8. Variabilidad genética del crecimiento en progenies selectas de Pinus radiata.

    Directory of Open Access Journals (Sweden)

    Freddy Mora

    2010-08-01

    Full Text Available Heredabilidad en sentido estricto (h2, correlación genética intra-clase (Γ2IC y componentes de varianza para la altura, diámetro a la altura del pecho (DAP y volumen del fuste, a los siete años de edad después de la plantación, fueron analizados en dos ensayos de progenie de Pinus radiata establecidos en el sur de Chile, en orden a examinar la variabilidad genética del crecimiento en una generación avanzada de la especie. Estos ensayos incluyeron árboles provenientes de propagación vegetativa y generativa. Las heredabilidades fueron estimadas para los árboles originados de semillas, y mostraron los siguientes valores: altura, 0.08-0.13; diámetro a la altura del pecho, 0-0.13; volumen del fuste, 0-0.09. Los valores de la correlación genética intra-clase, estimados para el grupo de árboles originados de propagación vegetativa, fueron moderados a bajos (Γ2IC: altura, 0.1-0.11; diámetro a la altura del pecho, 0.01-0.05; volumen del fuste, 0.03-0.06. No obstante la presencia de heredabilidades y correlaciones moderadas para algunas características y, la variación relativamente limitada entre grupos de árboles reflejan la fuerte selección realizada a las progenies. En general, los árboles provenientes de estacas presentaron una tendencia a la menor variación intra-genotípica, y evidenciaron magnitudes relativas de las varianzas debida al grupo (σ2G mayores a las varianzas familiares (σ2F, en cuatro de seis caracteres evaluados, indicando una tendencia a la mayor homogeneidad en el crecimiento, característica común de la propagación vegetativa.

  9. Variabilidad genética del crecimiento en progenies selectas de Pinus radiata

    Directory of Open Access Journals (Sweden)

    Freddy Mora

    2006-01-01

    Full Text Available Heredabilidad en sentido estricto (h2, correlación genética intra-clase (Γ2 IC y componentes de varianza para la altura, diámetro a la altura del pecho (DAP y volumen del fuste, a los siete años de edad después de la plantación, fueron analizados en dos ensayos de progenie de Pinus radiata establecidos en el sur de Chile, en orden a examinar la variabilidad genética del crecimiento en una generación avanzada de la especie. Estos ensayos incluyeron árboles provenientes de propagación vegetativa y generativa. Las heredabilidades fueron estimadas para los árboles originados de semillas, y mostraron los siguientes valores: altura, 0.08-0.13; diámetro a la altura del pecho, 0-0.13; volumen del fuste, 0-0.09. Los valores de la correlación genética intra-clase, estimados para el grupo de árboles originados de propagación vegetativa, fueron moderados a bajos (Γ2 IC: altura, 0.1-0.11; diámetro a la altura del pecho, 0.01-0.05; volumen del fuste, 0.03-0.06. No obstante la presencia de heredabilidades y correlaciones moderadas para algunas características y, la variación relativamente limitada entre grupos de árboles reflejan la fuerte selección realizada a las progenies. En general, los árboles provenientes de estacas presentaron una tendencia a la menor variación intra-genotípica, y evidenciaron magnitudes relativas de las varianzas debida al grupo (σ2 G mayores a las varianzas familiares (σ2 F, en cuatro de seis caracteres evaluados, indicando una tendencia a la mayor homogeneidad en el crecimiento, característica común de la propagación vegetativa.

  10. Estudi comparatiu de l'estructura del gen "Adh" a vàries espècies de "Drosophila"

    OpenAIRE

    Marfany i Nadal, Gemma

    1991-01-01

    S'ha caracterizat l'estructura de la regió genòmica del gen "Adh" a quatre espècies del gènere "Drosophila", pertanyents al subgrup "obscura": "D. ambigua", "D. subobscura", "D. madeirensis" i "D. guanche" amb els objectius d'analitzar l'organització i l'evolució d'aquesta regió genòmica dins d'aquest gènere i clarificar les relacions filogenètiques d'aquestes espècies. Per assolir aquestes fites, es van construir llibreries genòmiques de cada espècie que es van crivellar amb una sonda que co...

  11. La figura del autor en el arte genético y transgénico

    OpenAIRE

    Matewecki, Natalia

    2006-01-01

    Las prácticas artísticas contemporáneas redefinen constantemente el estatuto del arte tradicional al tensionar, por ejemplo, los límites entre el arte y la ciencia. El arte genético y el arte transgénico plantean un trabajo multidisciplinario en el que participan artistas y científicos a la vez, dando lugar así a la construcción de nuevas figuras de autor como las de artista-científico, artista-investigador, artista-técnico o científico-artista. La figura de artista se configura, según Dan...

  12. Una revisión de la genética del autismo.

    OpenAIRE

    Alison Mcinnes

    2002-01-01

    El autismo es un severo trastorno del desarrollo neuropsicológico, caracterizado por una alteración de la comunicación y de la interacción social, y por restringidas, repetitivas y obsesivas pautas de conducta. Afecta más a hombres que a mujeres y, con frecuencia, existe un bajo cociente intelectual. Recientes estimaciones de su prevalencia en California muestran un creciente aumento. Se piensa en posibles causas genéticas y ambientales con un carácter fuertemente hereditario. Existen progres...

  13. Evaluación del polimorfismo del gen leptina en bovinos en el sistema doble proposito en Chiapas, México.

    OpenAIRE

    Ortiz Salazar, Jorge Alberto

    2011-01-01

    La leptina es una hormona proteica de 16 KDa, compuesta de 146 aminoácidos y es sintetizada principalmente por el tejido adiposo. En el eje hipotálamo-hipófisisgonadal, la leptina juega un papel muy importante en la regulación de la reproducción de los mamíferos. La mutación del gen leptina TT está asociado con la calidad de la carne y leche en bovinos. El objetivo de este estudio fue estimar las frecuencias genotípicas y alélicas del polimorfismo (SNP, Single Nucleotide Polymorphism) del gen...

  14. Exploración del empleo de fórmulas electorales en algoritmos genéticos

    OpenAIRE

    Egido Manso, Federico

    2010-01-01

    Este proyecto surge de la idea de explorar el uso de las fórmulas electorales en un campo que con el que a priori guarda poca relación: los algoritmos genéticos. El proyecto consiste en explorar cómo funcionaría un algoritmo genético con un mecanismo de selección que utilice alguna de estas fórmulas frente a un algoritmo genético que utilice los operadores de selección habituales. En muchos programas y en la bibliografía se presentan diversas variantes u opciones habituales del operador selec...

  15. Avances del mejoramiento genético participativo del frijol en Cuba

    OpenAIRE

    Rodobaldo Ortiz-P\\u00E9rez; Humberto R\\u00EDos-Labrada; Sandra Miranda-Lorigados; Manuel Ponce-Brito; Edilio Quintero-Fern\\u00E1ndez; Orlando Chaveco-P\\u00E9rez

    2006-01-01

    Las actividades de Fitomejoramiento Participativo fueron conducidas con agricultores del municipio de San Antonio de los Baños de la provincia La Habana y campesinos de la comunidad la Palma de la provincia de Pinar del Río durante 2001 al 2004. En la fase de diagnóstico en las áreas de intervención del proyecto, más del 80 % de los agricultores no utilizaban la semilla del sistema formal; por lo tanto, las variedades obtenidas por los programas de mejoramiento no lleg...

  16. El reto de la genética del siglo XXI en el Homo Sapiens

    OpenAIRE

    Santandreu Ramón, Rafael

    2011-01-01

    El Homo sapiens es el resultado de la expresión de dos códigos: el código genético que compartimos con todos los seres vivos y el código cultural desarrollado exclusivamente por él. Mientras que el primero ha sido una caja negra durante siglos, el código cultural ha avanzado de forma espectacular. El siglo XX quedó marcado por cuatro grandes revoluciones científicas, a saber: el conocimiento del átomo y la energía que contiene, la física del estado sólido y la construcció...

  17. Comportamiento productivo de cerdos portadores del gen del halotano en condiciones medioambientales no controladas

    Directory of Open Access Journals (Sweden)

    Sánchez-Chiprés, David Román

    2008-05-01

    Full Text Available El síndrome de estrés porcino es una enfermedad genética que afecta acerdos de crecimiento rápido, manifestándose con muerte súbita durante las condiciones de manejo o al sacrificio, como carne pálida, suave y exudativa. Se econoce que el síndrome de estrés porcino (PSS, el síndrome de la carne pálida suave y exudativa (PSE así como la hipertermia maligna (MH, comparten una mutación en el gen receptor de la rianodina (RYR1. Un método de diagnóstico basado en DNA y el uso de la técnica de reacción en cadena de la polimerasa, permite hacer una distinción de los genotipos para el locus halotano.

  18. Variabilidad del gen de la envoltura del VIH-1 en tres grupos humanos con diferentes conductas sexuales de riesgo para adquirir ITS-VIH

    Directory of Open Access Journals (Sweden)

    Carlos Yábar V

    2007-07-01

    Full Text Available Objetivo: Determinar la variabilidad genética del gen de la envoltura porción C2-V3-C3 (env del VIH-1 infectando grupos humanos con diferente conducta sexual de riesgo para adquirir ITS-VIH. Materiales y métodos: Se seleccionaron 50 sujetos infectados con VIH-1 de los cuales 19 fueron hombres trabajadores sexuales (HTS, 8 mujeres trabajadoras sexuales (MTS y 23 sujetos heterosexuales (SH. Se realizó la extracción de ADN genómico y la amplificación del gen env por PCR. Se identificó el subtipo genético por ensayo de movilidad de heterodúplex (HMA y se confirmaron los resultados por análisis filogenético. Asimismo, se realizó el análisis de recombinación intragenética, diversidad y distancia genética en las tres poblaciones. Resultados: Se amplificó el gen env en 49 muestras (98% y se logró secuenciar el fragmento en 40 de ellas. Se observó que el 97,5% de las muestras de VIH fueron subtipo B mientras que una muestra no pudo ser clasificada filogenéticamente. Asimismo, se encontraron pequeños tramos de recombinación en el gen env de VIH en MTS (33%, HTS (43% y SH (45%. El mayor índice de diversidad de nucleótidos (Pi de env se encontró entre las muestras de VIH provenientes de SH y HTS (0,12 y 0,13 respectivamente. Conclusiones: Se encontró una mayor variabilidad genética del gen env de VIH-1 en las poblaciones de HTS y SH, sin embargo, el subtipo genético y la frecuencia de recombinación de este fragmento genético fue similar en los tres grupos estudiados.

  19. Revisión sobre la genética del origen del ganado vacuno y las aportaciones del ADN antiguo

    Directory of Open Access Journals (Sweden)

    Lira, J.

    2010-01-01

    Full Text Available Actualmente el ganado vacuno es la especie doméstica económicamente más importante de todas las que explota el hombre. Por este motivo este trabajo hace un repaso de los estudios que se han llevado a cabo sobre la aparación del ganado doméstico, teniendo en cuenta las evidencias aruqeológicas y genéticas. Durante las dos últimas décadas el análisis del ADN mitocondrial se ha mostrado como una herramienta muy útil para profundizar en los focos de origen, migración y posibles eventos independientes de domesticación, tanto del ganado taurino como del ganado cebú. Se ofrece una revisión de los estudios que se han centrado en el desarrollo de los linajes maternos del ganado doméstico, analizando ADN mitocondrial de individuos modernos y de restos antiguos de diferentes cronologías. Además, exponemos los resultados complementarios obtenidos a partir del análisis del cromosoma Y extraído de muestras antiguas.

  20. Historia y genética del poblamiento de Marinilla y su zona de influencia (MZI

    Directory of Open Access Journals (Sweden)

    Andrés Ruiz

    2001-04-01

    Full Text Available

    Diferentes estudios sugieren que ciertas regiones de Antioquia han estado aisladas geográficamente, desde su fundación en la colonia, hasta principios del siglo XX. La información existente sobre MZI, uno de los núcleos principales de poblamiento en Antioquia, es incipiente e incluso anecdótica. A pesar de que se cuenta con varios
    estudios históricos, de isonimia y prevalencia de algunos rasgos recesivos, aún no se comprende a cabalidad cómo se originó este grupo poblacional, ni su relación histórico-genética con el núcleo mayor de Santafé.

     

     

  1. Variabilidad genética de Hartón del Valle mediante RAM

    Directory of Open Access Journals (Sweden)

    Ana M Piedrahíta

    2008-01-01

    Full Text Available El Hartón del Valle (HV hace parte de las siete razas criollas de ganado bovino colombiano y de acuerdo con los criterios de la FAO está considerado como vulnerable. Para estudiar su variabilidad genética fueron muestreados 33 individuos HV y tres animales de la raza Holstein, como control externo. Se extrajo ADN utilizando el método de Salting Out y las muestras fueron analizadas mediante la técnica molecular RAM (Randon amplified microsatellites. Se utilizaron los cebadores CGA, CCA, TG, y CT. El valor promedio de heterocigosidad esperada fue de 0.26 y el F ST fue 0.39 ± 0.03. Con el índice de Dice-Nei Li y agrupando con el método UPGMA se distinguieron dos grupos: uno integrado por dos hatos de conservación y el otro por cuatro fincas que han compartido reproductores.

  2. Genotipificación del gen HLA DQB1 en diabetes autoinmune del adulto (lada HLA DQB1 genotyping in latent autoimmune diabetes of adults (LADA

    Directory of Open Access Journals (Sweden)

    Mariela Caputo

    2005-06-01

    Full Text Available La diabetes autoinmune es una enfermedad multifactorial causada por factores genéticos predisponentes y ambientales desencadenantes. Se manifiesta en la edad infantojuvenil (diabetes tipo 1, DMID y en la edad adulta (diabetes autoinmune latente del adulto, LADA. La predisposición genética es de tipo poligénico, se ha establecido asociación con alelos polimórficos del gen DQB del sistema HLA, VNTR del gen de insulina y polimorfismos en el gen CTLA4. En el presente trabajo se analizaron las frecuencias de los alelos polimórficos del gen HLA DQB1 en 63 pacientes LADA, 70 pacientes DMID y 79 individuos normales. La tipificación de los alelos del gen DQB1 se llevó a cabo mediante el Kit SSP TM DQ Olerup. Se observó una mayor frecuencia del genotipo *0201-*0302 y *0201-*0201 en ambas poblaciones diabéticas con respecto a normales (pAutoimmune diabetes is a complex, multifactorial disease caused by the interaction of genetic and environmental factors. This autoimmune diabetes is commonly manifested in childhood and adolescence with a fast onset (type 1 diabetes, IDDM and it can occur in adult patients with a slow onset with delayed insulin requirement, (latent autoimmune diabetes in adults, LADA . Autoimmune diabetes has strong class II HLA association mainly with DQB gene which constitutes the first susceptibility locus. However, association with the 5’INS- VNTR and CTLA-4 genes has been established. In this study, we analysed the polimorphic allele frequencies of DQB HLA gene in 63 LADA patients, 70 IDDM and 79 control subjects. The HLA DQB1 alleles typing was detected through Olerup SSP TM DQ kit using sequence specific primers. We observed a positive association of *0201-*0302 and *0201-*0201 genotypes in both types of diabetic patients compared to the control group (p<0.05. Moreover, *0201-*0302 genotype was higher in IDDM than in LADA (p<0.05. On the other hand, the *0602 protective allele analysis showed a high prevalence in the

  3. Enfermedades genéticas del ADN mitocondrial humano Genetic diseases of the mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Abelardo Solano

    2001-04-01

    Full Text Available Las enfermedades mitocondriales son un grupo de trastornos que están producidos por un fallo en el sistema de fosforilación oxidativa (sistema Oxphos, la ruta final del metabolismo energético mitocondrial, con la consiguiente deficiencia en la biosíntesis del trifosfato de adenosina (ATP, por sus siglas en inglés. Parte de los polipéptidos que componen este sistema están codificados en el ácido desoxirribonucleico (DNA mitocondrial y, en los últimos años, se han descrito mutaciones que se han asociado con síndromes clínicos bien definidos. Las características genéticas del DNA mitocondrial, herencia materna, poliplasmia y segregación mitótica, confieren a estas enfermedades propiedades muy particulares. Las manifestaciones clínicas de estas enfermedades son muy heterogéneas y afectan a distintos órganos y tejidos por lo que su correcto diagnóstico implica la obtención de datos clínicos, morfológicos, bioquímicos y genéticos. El texto completo en inglés de este artículo está disponible en: http://www.insp.mx/salud/index.htmlMitochondrial diseases are a group of disorders produced by defects in the oxidative phosphorylation system (Oxphos system, the final pathway of the mitochondrial energetic metabolism, resulting in a deficiency of the biosynthesis of ATP. Part of the polypeptide subunits involved in the Oxphos system are codified by the mitochondrial DNA. In the last years, mutations in this genetic system have been described and associated to well defined clinical syndromes. The clinical features of these disorders are very heterogeneous affecting, in most cases, to different organs and tissues and their correct diagnosis require precise clinical, morphological, biochemical and genetic data. The peculiar genetic characteristics of the mitochondrial DNA (maternal inheritance, polyplasmia and mitotic segregation give to these disorders very distinctive properties. The English version of this paper is available at

  4. Variabilidad genética del Aedes aegypti determinada mediante el análisis del gen mitocondrial Nd4 en once áreas endémicas para dengue en el Perú

    Directory of Open Access Journals (Sweden)

    Pamela Yáñez

    2013-06-01

    Full Text Available Con el objetivo de establecer la variabilidad genética de Aedes aegypti determinada por el análisis del gen mitocondrial ND4, se analizaron 51 especímenes de Ae. aegypti en once regiones endémicas para dengue en el Perú. La variabilidad genética se determinó mediante la amplificación y secuenciación de un fragmento de 336 pares de bases del gen mitocondrial ND4. El análisis de filogenia intraespecífica se realizó con el programa Network Ver. 4.6.10; y el análisis filogenético, con el método de distancia Neighbor Joining. Se identificó la presencia de cinco haplotipos de Ae. aegypti agrupados en dos linajes: el primero agrupa a los haplotipos 1, 3 y 5 y el segundo agrupa los haplotipos 2 y 4, se muestra además la distribución geográfica de cada uno de los haplotipos encontrados. Se concluye que esta variabilidad se debe tanto a la migración activa de este vector como a la migración pasiva mediada por la actividad humana.

  5. Clonación y Transcripción del Gen EBER-1 del Virus Epatein-Barr: estudio de su expresión genética en linfomas por hibridación in situ

    Directory of Open Access Journals (Sweden)

    I Guerrero

    1999-01-01

    Full Text Available La capacidad del virus de Epstein Barr (VEB de inducir transformación e inmortalización de linfocitos y su alta prevalencia en algunas neoplasias linfoides ha motivado intensa investigación de su biología y comportamiento. Describimos la hibridación in situ (HIS, para la identificación de transcriptos del virus de Epstein-Barr, desarrollado en la Unidad de Biología Molecular del Centro de Investigación en Cáncer Maes - Heller, en biopsias de linfoma incluidas en parafina. El gen EBER-1(Epstein Barr-encoded RNA fue clonado y transcrito, el ARN transcrito fue evaluado con óptimos resultados en las líneas celulares Raji y Daudi que expresan EBER. Este transcrito marcado fue usado como sonda para determinar la expresión genética del virus en 159 especímenes biológicos en estudio y en controles positivos y negativos conocidos empleando la HIS. La actividad transcripcional del virus fue observada en 44% de los casos estudiados. Concluimos que la HIS en tejido incluido en parafina es una buena alternativa para detectar actividad del VEB y la presencia o ausencia de EBER puede ser considerada como marcador biológico en la etiopatología de estos linfomas.

  6. Bases genéticas del dolor Genetic foundations of pain

    Directory of Open Access Journals (Sweden)

    P. Armero

    2004-11-01

    Full Text Available La percepción de la sensación dolorosa es un proceso complejo en el que intervienen mútiples procesos bioquímicos bien conocidos junto con otros de integración cortical desconocidos hasta el momento. La existencia de diferencias individuales en la respuesta al estímulo doloroso es una observación bien conocida que sugiere qué factores genéticos pueden estar implicados en la modulación de la respuesta a estímulos dolorosos. Existen dos aproximaciones experimentales para estudiar la implicación del genotipo en la respuesta al estímulo doloroso, los estudios de ligamiento y los estudios de asociación. Hasta el momento los estudios de ligamiento han permitido asociar mutaciones en el gen TRKA con el síndrome de insensibilidad congénita al dolor con anhidrosis (CIPA y el gen CACNL1A4 y la migraña hemipléjica familiar (FHM. Los estudios de asociación son escasos y se han centrado principalmente en el estudio de pacientes con migraña. En este trabajo revisamos los estudios llevados a cabo hasta el momento en diferentes laboratorios y planteamos nuevas perspectivas de futuro.Perception of pain is a complex process which implies multiple biochemical pathways together with unknown processes of cortical integration. The existence of individual differences in the response to painful stimuli suggests that genetic factors can be involved in its modulation. Two different experimental approaches have been developed to study the implication of genotype in the response to pain: linkage studies and the association studies. Up to now linkage studies have allowed the association of TRKA gene mutations with the syndrome of congenital insensitivity to pain with anhidrosis (CIPA and CACNL1A4 gene mutations with the familial hemiplegic migraine (FHM. Few association studies have been performed until now, and have been focused on the study of patients with migraine. Here we review the studies carried out up to now in different laboratories and suggest

  7. Estudio de bioequivalencia del ibuprofeno genérico 400mg tabletas

    Directory of Open Access Journals (Sweden)

    Ofelia Villalva-Rojas

    2007-10-01

    Full Text Available Objetivo. Determinar la biodisponibilidad de dos formulaciones de ibuprofeno 400mg tabletas, para establecer si el medicamento multifuente (genérico es bioequivalente al de referencia (Motrin® 400mg. Materiales y métodos. Se diseñó un estudio abierto, randomizado, cruzado, dos periodos, con siete días de lavado, con 12 voluntarios sanos de ambos sexos, entre 21 y 48 años, quienes ingirieron una tableta del medicamento genérico o de referencia, según randomización, con 200mL de agua. Luego de ingerir el medicamento se colectó 4mL de sangre por voluntario para la cuantificación plasmática de ibuprofeno. Las muestras de plasma se analizaron por cromatografía líquida acoplada al espectrofotómetro de masas (LC-MS/MS con ionización electrospray ión negativo, aplicando monitoreo de reacción selectiva. La bioequivalencia se determinó con los parámetros farmacocinéticos de área bajo la curva AUC(0-t, AUC(0-∞ y concentración máxima (Cmax. Resultados. Según análisis estadístico, se encontraron: AUCmultifuente(0-t = 86,85 (μg*h/ mL, AUCRef.(0-t= 81,20 (μg*h/mL, AUCmultifuente(0-∞= 88,67 (μg*h/mL, AUCRef.(0-∞= 82,83(μg*h/mL, Cmαxmultifuente = 17,70 ug/mL, CmαxRef. =18,09 μg/mL, con rango de 0,93-1,24 para AUC(0-t, 0,93-1,24 para AUC(0-∞ y 0,81-1,19 para Cmax. Conclusión. Los valores encontrados de ibuprofeno están dentro de los requisitos de la OMS y la FDA, para establecer bioequivalencia (0,80-1,25, demostrándose que el ibuprofeno genérico es bioequivalente al de referencia en velocidad y cantidad de ibuprofeno absorbido en el organismo.

  8. La Dislexia del Desarrollo: Gen, Cerebro y Cognición Developmental Dyslexia: Gen, Brain, and Cognition

    OpenAIRE

    Alberto M Galaburda; Joseph Lo Turco; Franck Ramus; R. Holly Fitch; Rosen, Glenn D; Emily Fisher Landau

    2006-01-01

    La dislexia del desarrollo es un trastorno que se caracteriza por dificultades en el aprendizaje de la lectura. Recientemente se ha podido vincular la dislexia a cuatro distintos genes candidatos de riesgo: DYX1C1, KIAA0319, DCDC2 y ROBO1. Estos cuatro genes participan en el desarrollo cerebral, y anomalías de dicho desarrollo constituyen los elementos conocidos del cuadro biológico que subyace a la dislexia. En animales experimentales, la inducción de anomalías del desarrollo cerebral simila...

  9. Identificacion de marcadores genéticos del agente causal del marchitamiento del clavel fusarium oxysporum f.sp. dianthi mediante amplificacion arbitraria de fragmentos polimórficos de adn

    OpenAIRE

    Arbeláez G.; Hernández J.; Junca H.; Posada M.; Portillo P. Del

    2011-01-01

    La técnica de Amplificación Arbitraria de Fragmentos Polimórficos de ADN (RAPD) fue utilizada para identificar marcadores genéticos útiles para el desarrollo de un método diagnóstico para Fusarium oxysporum f.sp. dianthi, el agente etiológico de la enfermedad del marchitamiento del clavel. Con el fin de identificar fragmentos genéticos característicos de este patógeno, un total de 18 aislados diferentes, provenientes de diferentes lugares del mundo y 17 cepas de F. oxysporum de otras formas e...

  10. Competencias genéricas en docentes del nivel superior en el Estado de Guerrero

    Directory of Open Access Journals (Sweden)

    Leonila Román Fernández

    2016-02-01

    Full Text Available El objetivo del presente trabajo es identificar las competencias genéricas de los docentes que orientan la práctica educativa de nivel superior en el estado de Guerrero, en opinión de los estudiantes. Para ello se utilizó el método de estudio descriptivo y longitudinal en el periodo 2012-2014, y se aplicó un cuestionario a estudiantes de 7 instituciones. La muestra consistió en 37 % docentes y 41 % estudiantes por institución, evaluando a cada académico 10 jóvenes. La información se adaptó con valores de la escala de Likert, posteriormente a escala numérica de Sampieri para obtener cuartiles, clasificando en competencias altas, medianas y bajas. Las fortalezas y debilidades en indicadores fueron calculadas utilizando la media aritmética, y clasificadas con la mediana. Los resultados fueron: a nivel estatal 56 % de los docentes poseen competencias altas y 44 % entre medianas y bajas.

  11. Aplicaciones del Ensayo Cometa en Genética Ecotoxicológica

    Directory of Open Access Journals (Sweden)

    Yadira Ansoar-Rodríguez

    2015-01-01

    Full Text Available El ensayo de electroforesis alcalina de células individuales embebidas en microgel, más conocido como Ensayo Cometa (EC, ha logrado ubicarse en una posición privilegiada dentro de los ensayos utilizados para evaluar la respuesta de las células frente a agentes genotóxicos, estreses bióticos y abióticos que conducen a daño al ADN. Diferentes versiones del ensayo se han desarrollado con el fin de ampliar el espectro de las lesiones al ADN que pueden ser detectadas. Igualmente, se han proporcionado directrices para su uso en la genética ecotoxicológica. El EC se distingue por su demostrada sensibilidad para detectar bajos niveles de daño, su rapidez y simplicidad en el análisis de los datos a nivel de células individuales, el pequeño tamaño de muestra requerido, su flexibilidad, bajo costo y aplicabilidad a cualquier población de células. Este grupo de ventajas justifica su amplio uso en la evaluación genotóxica in vitro, de productos químicos industriales y agroquímicos, fármacos, principios activos, así como en el biomonitoreo ambiental y humano de sustancias genotóxicas. La gran diversidad de organismos en los cuales este ensayo puede ser aplicado, aumenta su espectro de utilidad y aplicación creciente en ecotoxicología. Por tanto, en esta revisión se aborda el empleo del EC en los principales modelos de organismos (plantas, protozoos, pequeños crustáceos, insectos, lombriz de tierra, moluscos, peces, anfibios y mamíferos silvestres utilizados en estudios de ecotoxicología. La gran variedad de estudios que utilizan este ensayo y sus múltiples ventajas para detectar efectos genotóxicos en organismos de diferentes ecosistemas, lo hacen muy recomendable para análisis ecotoxicológicos.

  12. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Directory of Open Access Journals (Sweden)

    Jenny Chirinos

    2011-05-01

    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  13. Estudio comparativo de algoritmos genéticos y algoritmos de búsqueda tabú para la resolución del Flow Shop Problem

    OpenAIRE

    Franco Flores, Abel

    2009-01-01

    El presente proyecto tiene como objeto la comparación de la efectividad de diversas variantes de un Algoritmo Genético y de un procedimiento de Búsqueda Tabú para atacar el problema combinatorio del Flow Shop Problem. El proyecto incluye programar los algoritmos y realizar una experiencia computacional sobre un conjunto de ejemplares del problema.

  14. Estudio de las aneuplodías del cromosoma 17 y deleción del gen tp53 en neoplasias hematológicas por la técnica del fish-bicolor

    Directory of Open Access Journals (Sweden)

    Carlos Mario Muñetón Peña

    2008-12-01

    Full Text Available Las neoplasias hematológicas se caracterizan por presentar una amplia diversidad de alteraciones genéticas. Se analizaron 15 muestras de diferentes tipos de neoplasias hematológicas mediante el FISH, para detectar aneuplodías del cromosoma17 y la deleción del gen TP53. En 11 de las 15 muestras se realizaron análisis cromosómicos por citogenética convencional; 6 de las 11 muestras tenían cariotipo anormal (54.5%, se detectaron 3 translocaciones y 3 mosaicismos. Análisis de FISH en 15 muestras mostró un 26.7% de aneuplodía del cromosoma 17 y un 33.3% con deleción del gen TP53. De los 6 casos con cariotipo anormal, 2 tenían alteraciones por FISH. En 5 casos se detectaron alteraciones cromosómicas por FISH, las cuales no se observaron por citogenética convencional. Solo 3 (20% de las 15 muestras analizadas fueron normales para el análisis cromosómico por citogenética convencional y FISH. En este trabajo se corrobora que la aneuplodía del cromosoma 17 y la deleción del gen TP53 tienen una baja incidencia en las neoplasias hematológicas. Si embargo, el valor pronóstico de estas alteraciones genéticas no esta bien definido.

  15. Genetica del trigo. Los cereales. Biología Molecular e Ingeniería Genética

    OpenAIRE

    García Olmedo, Francisco; Sanchez Monge, Enrique

    1986-01-01

    El presente artículo revisa sucintamente un conjunto de investigaciones sobre los cereales, realizadas en el Departamento de Bioquímica de la E.T.S. de Ingenieros Agrónomos de la Universidad Politécnica de Madrid. En dichas investigaciones se han utilizado técnicas bioquímicas, citogenéticas y de ingeniería genética para el conocimiento básico y la manipulación práctica del conjunto de especies cultivadas denominadas cereales. Los estudios realizados han abarcado los siguientes aspectos princ...

  16. Estudi dels gens FGFR3, EGFR, PTEN, CXCR4 i del gen de fusió TMPRSS2-ERG en càncer de pròstata

    OpenAIRE

    De Muga Salleras, Silvia

    2012-01-01

    El càncer de pròstata és el tumor maligne no cutani més freqüent i una de les principals causes de mort per càncer en la població masculina. Tot i així, són menys els estudis moleculars realitzats sobre aquest tipus de càncer que en altres càncers (www.ncbi.nih.gov). L’objectiu de la tesi ha estat estudiar quins mecanismes moleculars estan implicats en la iniciació i progressió del càncer de pròstata. En el primer treball es va analitzar la freqüència de mutacions del gen FGFR3 ja que h...

  17. Identificación de un polimorfismo del gen Est9 relacionado con resistencia a piretroides en Rhipicephalus (Boophilus microplus

    Directory of Open Access Journals (Sweden)

    Edgar Diaz R.

    2013-10-01

    Full Text Available Objetivo. Mediante procedimientos de PCR-RFLP, detectar un polimorfismo en el gen Est9 de garrapatas Rhipicephalus (Boophilus microplus resistentes a piretroides en Ibagué, Colombia, determinando el grado de asociación entre los fenotipos y los genotipos resultantes. Materiales y métodos. El ADN de 30 teleoginas R. (Boophilus microplus fenotípicamente susceptibles, resistentes o medianamente resistentes a piretroides en una prueba de Drummond modificada, fue amplificado por PCR con cebadores específicos para obtener un fragmento de 372 pb del gen Est9, que fue sometido a digestión con la enzima EcoRI para estudiar los RFLPs generados y poder diferenciar los respectivos genotipos. El grado de asociación entre los fenotipos y los genotipos resultantes se determinó mediante la prueba exacta de Fisher. Resultados. Luego de digerir el fragmento con la endonucleasa, se generaron dos segmentos en teleoginas con algún nivel de resistencia, mientras en las teleoginas susceptibles no hubo división del fragmento de 372 pb, demostrándose así la presencia de una mutación puntual y los genotipos homocigoto natural, homocigoto mutante y heterocigoto. Las diferencias altamente significativas (p<0.01 entre teleoginas susceptibles y aquellas con algún nivel de resistencia, mostraron una relación directa entre el genotipo y el fenotipo con un nivel de confianza de p=0.0009852. Conclusiones. Se comprobó, por primera vez en Colombia, la presencia de una mutación puntual en el gen Est9 de garrapatas R. (Boophilus microplus resistentes a piretroides, sugiriendo la necesidad de realizar estudios para detectar alteraciones moleculares en otros genes relacionados con quimioresistencia.

  18. Expresión transitoria del gen GUS en caña de azúcar usando Agrobacterium tumefaciens

    Directory of Open Access Journals (Sweden)

    Martha Liliana Bonilla Betancourt

    2008-10-01

    Full Text Available En el estudio se desarrolló una metodología de transformación genética mediante Agrobacterium tumefaciens en cultivares colombianos de caña de azúcar. La transformación se evaluó mediante la expresión del gen GUS. Callos embriogénicos y explantes meristemáticos de los genotipos CC85-92, CC84-75 y CC87-505 se transformaron usando tres cepas (AGL-1, LBA4404 y EHA105 con el plásmido pCambia 1305.2 y dos (EHA105 y LBA4404 con pCambia 2301. Se usó el medio de infiltración (IM con acetosiringona y se evaluó el tiempo de cocultivo y la densidad óptica de la bacteria al momento de la inducción. Los genotipos mostraron respuesta diferencial con las combinaciones cepa-plásmido: obtuvieron mayor expresión del gen GUS cuando el genotipo CC85-92 se transformó con la cepa AGL-1-pCambia 1305.2. CC84-75 y CC87-505 mostraron mayor expresión cuando se transformaron con la cepa EHA105-pCambia 1305.2. Mayor eficiencia en la expresión se obtuvo cuando la bacteria se indujo en IM después de siete días de cocultivo y cuando la densidad óptica de la bacteria fue de 0.2(600nm al momento de la inducción. Se demostró superioridad de los explantes en la eficiencia de transformación.

  19. Identificación de los polimorfismos G1 y G8 del gen GDF9 en ovinos criollos Araucanos

    Directory of Open Access Journals (Sweden)

    E Paz

    2014-01-01

    Full Text Available En la especie ovina se han descrito una serie de polimorfismos en genes de efecto mayor relacionados con la actividad reproductiva. Las mutaciones ubicadas en el gen de efecto mayor GDF9 se han asociado con el incremento de la tasa ovulatoria y el tamaño de la camada. GDF9 es un factor celular secretado por el ovocito y es miembro de la familia de factores de crecimiento transformante (TGF-β localizado en el cromosoma 5 ovino. El objetivo de este trabajo fue identificar la presencia de los polimorfismos en los sitios G1 y G8 en el gen GDF9 en ovinos criollos Araucanos. Se extrajo el ADN de 100 muestras sanguíneas para posteriormente determinar la presencia de las mutaciones utilizando la técnica PCR-RFLP. Fue amplificada una región de 462 pb correspondiente al exón 1, la cuál fue digerida con la enzima de restricción HhaI, el siguiente fragmento amplificado fue de 139 pb correspondiente al exón 2, siendo digerido con la enzima Ddel. Se identificó la presencia del polimorfismo G1 con una frecuencia genotípica del 0,56 (genotipo GG, 0,44 (genotipo GA y una frecuencia alélica de 0,78 para el alelo (G y 0,22 para el alelo (A. No se detectó la presencia de polimorfismo G8. Este es el primer reporte de este polimorfismo en ovinos en Chile que podría servir como un marcador genético de prolificidad para la selección de ovinos criollos Araucanos.

  20. Base Molecular del asesoramiento genético de fibrosis quística

    OpenAIRE

    Muñoz Domínguez, Carlos

    1997-01-01

    La Fibrosis Quística (FQ) es una enfermedad autosómica recesiva producida por mutaciones en el gen CFTR. Dicho gen produce una proteína (CFTR) implicada en el transporte de iones Cl- a través de la membrana plasmática. La alteración ... La consecuencia de estas secreciones afecta principalmente a pulmones, páncreas exocrino, aparato reproductor masculino y glándulas sudoríparas, provocando un cuadro clínico muy variable de unos pacientes a otros. Tanto la elevada concentración iónica en el su...

  1. Baja diferenciación genética entre poblaciones de sardina, Sardinella aurita, del oriente venezolano

    Directory of Open Access Journals (Sweden)

    2005-01-01

    Full Text Available Debido a la gran importancia de Sardinella aurita como recurso pesquero de la región del Caribe, se estudió la diferenciación genética entre las poblaciones de Mochima, Golfo de Cariaco y Morro de Puerto Santo, en el oriente de Venezuela, y se compararon los niveles de variación y subdivisión poblacional con las poblaciones del Mediterráneo y la costa Atlántica de África, anteriormente reportadas. Para esto, se obtuvieron 15 individuos de cada una de tres poblaciones, utilizando una muestra de músculo para extraer el ADN total. Se amplificó un fragmento que incluye la región de control del ADN mitocondrial y se determinaron los patrones de restricción por medio del análisis por RFLP con las enzimas Taq I, Eco RI, Hae III y Alu I. La amplificación de esta región produjo un fragmento de aproximadamente 1000 bp o, rara vez, uno de 1100 pb. El análisis de RFLP demostró la presencia de sólo un haplotipo con las dos variantes de tamaño. El FST resultante del análisis de las diferencias entre poblaciones venezolanas fue menor de 0.06 y el AMOVA demostró que no existían diferencias significativas entre ellas. Estos resultados concuerdan con la presencia de poca diferenciación genética entre estas poblaciones, por lo que no se puede descartar la presencia de una población panmíctica en esta región. Una comparación de las poblaciones venezolanas con las poblaciones del Mediterráneo y África, reportadas con anterioridad, produjeron valores de FST muy bajos entre las venezolanas y las del Mediterráneo, mientras que las comparaciones entre las de Mauritania, Senegal, Costa de Marfil y Ghana produjeron valores de FST diez veces mayores.

  2. Evaluación del efecto de cuatro polimorfismos en el gen del receptor adrenérgico beta-2 en el parto pretérmino

    Directory of Open Access Journals (Sweden)

    Juan Carlos Ríos

    2008-03-01

    Full Text Available Objetivo: Determinar si los polimorfismos de nucleótido único encontrados en la secuencia del receptor b-2 adrenérgico b2AR se asocian con el parto pretérmino espontáneo.Método: Se realizó un estudio de casos y controles no pareado en el que se determinaron y compararon las frecuencias alélicas, genotípicas y haplotípicas de cuatro polimorfismos, -47 C/T, -20 C/T, Arg16Gly y Gln27Glu del gen del b2AR, entre 35 mujeres con parto pretérmino (casos y 105 mujeres con parto a término (controles. El estudio se hizo con pacientes de tres instituciones hospitalarias de la ciudad de Medellín, Colombia. Se aisló el ADN genómico de sangre periférica, se amplificó el segmento del gen mediante la reacción en cadena de la polimerasa (PCR y se determinaron los polimorfismos por secuenciación directa. Resultados: No se encontraron diferencias significativas de las frecuencias alélicas de los loci polimórficos -47 C/T, -20 C/T, Arg16Gly y Gln27Glu entre el grupo de casos (21.5%, 21.5%, 51.5% y 21.5%, respectivamente y los controles (21.5%, 21.5%, 57% y 21.5%, respectivamente (p>0.05. Las frecuencias genotípicas también fueron similares entre las pacientes con parto pretérmino y las de parto a término (p>0.05 para todos los genotipos. De los 16 posibles haplotipos, resultantes de la combinación entre los distintos alelos, sólo se presentaron tres en toda la población de estudio (CCGG, TTGC, TTAC. Las frecuencias haplotípicas tampoco tuvieron diferencias significativas entre los grupos comparados (p>0.05. Conclusión: No se observó una asociación entre el parto pretérmino y cualquiera de los polimorfismos o sus haplotipos. Estos resultados no apoyan una participación de los polimorfismos del b2AR en el trabajo de parto pretérmino espontáneo en estas pacientes.

  3. Expresión heteróloga del gen phoC de Morganella morganii en Escherichia coli CC118 hpir

    Directory of Open Access Journals (Sweden)

    Reinaldo H. Fraga

    2006-01-01

    Full Text Available Las fosfatasas ácidas juegan un rol importante en la mineralización del fósforo de origen orgánico que está presente en el suelo. La transferencia de genes que codifican para estas enzimas, mediante ingeniería genética, es una vía para la obtención de cepas mejoradas en cuanto a la solubilización de fósforo. Se tuvo como objetivo el subclonaje del gen phoC de Morganella morganii en un vector para su integración estable en el cromosoma de bacterias promotoras del crecimiento de las plantas y su expresión en Escherichia coli CC118 pir. Se empleó un vector de acoplamiento, el pUC18NotI y posteriormente el vector de liberación suicida pJMT6 (derivado de pUT/mini Tn5, para construir el vector de integración que porta el gen que codifica para la fosfatasa ácida PhoC de Morganella morganii. La construcción recombinante fue transferida a Escherichia coli CC118 pir. Se analizó la expresión del gen phoC en la cepa transformada por medio de la cuantificación de la actividad fosfatasa ácida en el extracto celular y en el sobrenadante del cultivo, y se detectó un aumento significativo respecto a E.coli CC118 pir sin el plásmido recombinante, lo cual demostró la expresión del gen subclonado.

  4. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  5. Actualización en marcadores genéticos ultrasonográficos del 1º trimestre del embarazo

    Directory of Open Access Journals (Sweden)

    Felicia Amaralis Trull Martínez

    2010-01-01

    Full Text Available Se aborda el tema de los marcadores ultrasonográficos del 1º trimestre del embarazo, brindando una actualización del tema. Se hace énfasis en los marcadores predictivos de las anomalías congénitas más frecuentes y se concluyó con importantes aspectos a tener en cuenta para una correcta interpretación de estos hallazgos.

  6. Implicación de rs924607 del gen CEP72 en la neurotoxicidad asociada a la vincristina en pacientes con leucemia linfoblastica aguda (LLA)

    OpenAIRE

    De Vicente Martínez, Beatriz

    2016-01-01

    Este trabajo se trata de un estudio estadístico de asociación entre el genotipo del SNP rs924607 presente en la región promotora del gen CEP72, y la neurotoxicidad asociada a la vincristina, en pacientes pediátricos de Leucemia Linfoblástica Aguda. El objetivo es determinar si el alelo presente en dicho SNP puede ser empleado como biomarcador para predecir la neurotoxicidad asociada a la vincristina.

  7. Genómica Funcional de Plantas: Estudio del Desarrollo de Flores y Frutos

    OpenAIRE

    Nayelli Marsch Martínez; Víctor Manuel Zúñiga Mayo; José Irepan Reyes Olalde; Octavio Rubén Salazar Moya; Stefan de Folter

    2009-01-01

    La última fase del desarrollo fl oral es la fertilización de los óvulos y la formación de los frutos, que son muy importantes tanto biológica como económicamente. Notoriamente, más del 80% de los alimentos que son consumidos por el ser humano proviene de fl ores y frutos. La obtención de conocimientos acerca de las bases moleculares del desarrollo de frutos en especies modelo es de gran interés científi co, y un paso indispensable para poder facilitar investigaciones y de ser factible, aplica...

  8. Alteraciones del gen c-Myc en la oncogénesis = c-Myc gene alterations in oncogenesis

    Directory of Open Access Journals (Sweden)

    Ospina Pérez, Mariano

    2011-12-01

    Full Text Available La familia de protooncogenes MYC (c-Myc, N-Myc y L-Myc se relaciona con el origen de diversas neoplasias en seres humanos. Estos genes actúan como factores de transcripción y participan en la regulación del ciclo celular, la proliferación y diferenciación celulares, la apoptosis y la inmortalización. Los genes MYC se expresan en diferentes tejidos y responden a diversas señales internas y externas; codifican para la síntesis de factores de transcripción que se unen al ADN para regular la expresión de múltiples genes. El gen más ampliamente estudiado de esta familia es c-Myc, que se expresa en las células con mayor tasa de proli­feración. C-Myc se encuentra alterado en un gran número de tumores sólidos, leucemias y linfomas. Las alteraciones de c-Myc encontradas con mayor frecuencia en células cancero­sas son las amplificaciones, translocaciones, mutaciones y reordenamientos cromosómicos que involucran el locus de este gen y conducen a que se desregule su expresión en diversas neoplasias humanas. La amplificación de c-Myc es una alteración común en los cánceres de mama, pulmón, ovario y próstata, así como en leucemias y linfomas, mientras que la pérdida de su regulación es común en el cáncer de colon, en tumores ginecológicos y melanoma. En neoplasias con defectos de c-Myc los estudios actuales están dirigidos al desarrollo de nuevas estrategias terapéuticas.

  9. El uso de alteraciones genéticas en la estratificación por riesgo del mieloma múltiple

    Directory of Open Access Journals (Sweden)

    Esteban Braggio

    2013-08-01

    Full Text Available Los estudios genéticos han alcanzado un papel central en el estudio del mieloma múltiple (MM, al convertirse en un componente crítico en la estratificación basada en el riesgo de la enfermedad. Se han hecho grandes esfuerzos para identificar cambios genéticos que puedan predecir el resultado clínico e incluirlos en la práctica clínica diaria. La hibridización in situ fluorescente (FISH es todavía la técnica genética más utilizada en la práctica clínica, mayormente debido a su sencilla implementación y su simplicidad para el análisis de datos. El advenimiento de la genómica (hibridización genómica comparativa, secuenciación exónica o genómica completa y del transcriptoma de alta resolución (perfiles de expresión de genes - GEP y secuenciación de ARNm proveen un análisis exhaustivo de los ya definidos factores pronósticos genéticos y son herramientas útiles para la identificación de potenciales nuevos marcadores pronósticos de enfermedad en el clon tumoral de MM. Más aún, GEP ha sido exitosamente implementado en MM como una herramienta de estratificación de riesgo, siendo la de mayor poder de discriminación de resultados. De todas maneras, algunos aspectos técnicos y logísticos complejos (necesidad de una elevada purificación del clon tumoral, costo de los ensayos y complejidad en los análisis de los datos deben ser considerados antes de la incorporación definitiva de estas tecnologías de alto rendimiento dentro de los ensayos clínicos de rutina. Hasta entonces, FISH continúa siendo la herramienta estándar para la detección de anormalidades genéticas y de valoración pronóstico de enfermedad.

  10. Identificacion de marcadores genéticos del agente causal del marchitamiento del clavel fusarium oxysporum f.sp. dianthi mediante amplificacion arbitraria de fragmentos polimórficos de adn

    Directory of Open Access Journals (Sweden)

    Arbeláez G.

    1998-12-01

    Full Text Available La técnica de Amplificación Arbitraria de Fragmentos Polimórficos de ADN (RAPD fue utilizada para identificar marcadores genéticos útiles para el desarrollo de un método diagnóstico para Fusarium oxysporum f.sp. dianthi, el agente etiológico de la enfermedad del marchitamiento del clavel. Con el fin de identificar fragmentos genéticos característicos de este patógeno, un total de 18 aislados diferentes, provenientes de diferentes lugares del mundo y 17 cepas de F. oxysporum de otras formas especiales fueron amplificadas utilizando 15 iniciadores diferentes. Aunque ninguno de los iniciadores empleados en este estudio amplificó una banda común a todas las formas especiales dianthi, el iniciador OPA 17 mostró un patrón de RAPD que permitió la identificación de cuatro grupos polimórficos dentro de este grupo taxonómico. Este mismo iniciador, permitió la discriminación entre aislados de Fusarium oxysporum f.sp. dianthi y cepas de F. oxysporum de otras formas especiales. No se observó una correlación directa entre el patrón de RAPD y las razas reportadas para F. oxysporum f.sp. dianthi, previamente determinadas mediante ensayos biológicos por otros grupos de investigadores. Los análisis de hibridación molecular con fragmentos escogidos de estos patrones de RAPD, permitieron el reconocimiento selectivo de los cuatro grupos descritos. Los fragmentos genómicos identificados, son candidatos para el desarrollo de un  sistema diagnóstico por PCR para este patógeno del clavel.

  11. BÚSQUEDA DE LA MUTACIÓN Phe-809 EN EL GEN DEL SUSTRATO DEL RECEPTOR DE INSULINA -1 (IRS-1 EN RATAS DIABÉTICAS eSS

    Directory of Open Access Journals (Sweden)

    Stella Maris Daniele

    2010-01-01

    Full Text Available El gen del sustrato del receptor de insulina IRS-1 juega un rol clave en la transducción de señales de insulina en músculo esquelético. Diversos polimorfismos del gen IRS-1 han sido reportados en estados de insulinorresistencia como obesidad y diabetes tipo 2.Las ratas eSS desarrollan espontáneamente diabetes tipo 2 magra, con insulinoresistencia caracterizada por hiperglucemia e hiperinsulinemia. Durante el segundo año existe disminución progresiva de la insulinemia y agravamiento del síndrome. Nuestro propósito fue buscar la mutación Phe-809 en el gen IRS-1, que implica sustitución del aminoácido Ser por Phe en el codon 809; dicho sitio se halla conservado en la rata. Esta variante fue identificada en pacientes diabéticos tipo 2. El gen del IRS-1 consta de un solo exón.Se analizó un fragmento de 281pb del gen IRS-1, que posee 90% de homología con el mismo fragmento en humanos. Se purificó ADN de leucocitos de un pool de sangre de ratas machos eSS y controles Wistar. Se cuantificó y amplificó por PCR utilizando un par de primers para amplificar ese mismo fragmento en el gen IRS-1 en humanos. Se usó sangre humana como control de amplificación. Se empleó el método de Sanger en la secuenciación del fragmento obtenido por PCR, previa extracción del mismo de un gel de agarosa al 2%. Se observó que la rata eSS y las controles mantuvieron la lectura esperada para ese fragmento, no encontrándose la mutación investigada. Se descarta la mutación Phe-809 como origen de la insulinoresistencia de la rata eSS.

  12. Trastornos generalizados del desarrollo: Aspectos clínicos y genéticos Pervasive developmental disorders: Clinical and genetics aspects

    OpenAIRE

    Víctor Ruggieri; Claudia Arberas

    2007-01-01

    Los Trastornos Generalizados del Desarrollo se expresan con compromiso en la socialización, trastorno en el desarrollo del lenguaje (verbal y no verbal) e intereses restringidos con conductas repetitivas. La frecuencia estimada en la población general es de 27.5/10.000. En nuestro trabajo analizamos los aspectos clínicos y genéticos de los TGD: Autismo, Síndrome de Asperger, TGD no Especificado, Síndrome de Rett y Trastorno desintegrativo de la niñez. Desde el punto de vista clínico jerarquiz...

  13. Aplicaciones del Ensayo Cometa en Genética Ecotoxicológica

    OpenAIRE

    Yadira Ansoar-Rodríguez; Fontanetti, Carmem S.; Cintya A. Christofoletti; Silvia del Carmen Díaz-Llera

    2015-01-01

    El ensayo de electroforesis alcalina de células individuales embebidas en microgel, más conocido como Ensayo Cometa (EC), ha logrado ubicarse en una posición privilegiada dentro de los ensayos utilizados para evaluar la respuesta de las células frente a agentes genotóxicos, estreses bióticos y abióticos que conducen a daño al ADN. Diferentes versiones del ensayo se han desarrollado con el fin de ampliar el espectro de las lesiones al ADN que pueden ser detectadas. Igualmente, se han proporcio...

  14. Historia y genética del poblamiento de Marinilla y su zona de influencia (MZI)

    OpenAIRE

    Andrés Ruiz; Gabriel Bedoya Berrío; Jorge Ospina; Patricia Montoya; Carlos López; Soto, Iván D.

    2001-01-01

    Diferentes estudios sugieren que ciertas regiones de Antioquia han estado aisladas geográficamente, desde su fundación en la colonia, hasta principios del siglo XX. La información existente sobre MZI, uno de los núcleos principales de poblamiento en Antioquia, es incipiente e incluso anecdótica. A pesar de que se cuenta con varios
    estudios históricos, de isonimia y prevalencia de algunos rasgos recesivos, aún no se comprende a cabalidad cómo se originó este grupo poblacion...

  15. Gen quimérico que permite expresar el gen o el cDNA del factor de crecimiento similar a la insulina de tipo i (IGF-I) en pancreas y su utilización para la terapia génica de la diabetes mellitus.

    OpenAIRE

    Bosch i Tubert, Fàtima

    2001-01-01

    Gen quimérico que permite expresar el gen o el cDNA del factor de crecimiento similar a la insulina de tipo I (IGF-I) en páncreas y su utilización para la terapia génica de la diabetes mellitus. Se refiere a un gen quimérico que utiliza el gen o el cDNA del factor de crecimiento similar a la insulina de tipo I (IGF-I) dirigido por un promotor o fusión de promotores que permite la expresión regulada del IGF-I en páncreas. También se refiere a un vector de expresión que permite expresar IGF-I e...

  16. La Comunidad Andina frente al reto del acceso a los recursos genéticos y la distribución de beneficios

    Directory of Open Access Journals (Sweden)

    Martha Isabel Gómez Lee

    2012-11-01

    Full Text Available Este artículo estudia las medidas jurídicas y políticas que ha adoptado la Comunidad Andina (CAN sobre el acceso a los recursos genéticos y la distribución de beneficios a la luz de los estudios de equidad en la distribución de beneficios de Bram de Jonge y Niels Louwaar (2009. Según estos autores, el principio de Acceso y Distribución de Beneficios (ADB se justifica por tres asimetrías que están presentes en este asunto. Por un lado, la doble asimetría entre la asignación y la explotación de los recursos y, por otro, la asimetría entre los derechos de propiedad intelectual y los derechos legales de los recursos genéticos y los conocimientos tradicionales. En este contexto, la CAN ratifica los principios de soberanía de los recursos genéticos y de Acceso y Distribución de Beneficios del Convenio sobre Diversidad Biológica. Las principales respuestas que ha dado la CAN al reto del acceso a los recursos genéticos y distribución de beneficios son las Decisiones 391, 486 y 523. En este contexto, el Programa BIOCAN está trabajando en los temas de especial relevancia para la región, dentro de los cuales están los desafíos de asignarle valor a los recursos genéticos y el de la biopiratería.

  17. Estimación mediante RAPD's de la diversidad genética en Guadua en el departamento del Cauca, Colombia

    Directory of Open Access Journals (Sweden)

    Palacio M. Juan Diego

    2006-06-01

    Full Text Available

    Mediante RAPD's se analizaron 120 muestras foliares de 12 biotipos de Guadua angustifolia Kunth clasificados morfológicamente, procedentes de la cuenca del río Cauca, en el departamento del Cauca, Colombia, para determinar diversidad genética. El ADN se extrajo mediante el protocolo modificado de Dellaporta (1983. Se emplearon los cebadores; OPF-12, OPG-19, OPN-19 y OPP-16 con mayor número de bandas polimórficas. El índice de Shannon (HT = 0.4556 ± 0.1849 señaló diversidad genética total alta y diversidad entre los biotipos y al interior de ellos. El Índice de estructura genética (Gst = 0.5200 e Indice de migración efectiva (Nm = 0.4615 definieron biotipos bien diferenciados. El análisis de similaridad conformó tres grupos a un coeficiente de 0.64. El grupo G1 incluyó los biotipos Curvado, Rayada frecuente, Amarilla Playón, Rayada ancha, Rayada escasa, Convexa, Amarilla, Hembra, Verde irregular y algunos individuos de verde alta. El grupo G2, Verde alta y Macho. El grupo G3, Rayada negra. El estudio molecular agrupó los individuos de forma similar al estudio morfológico, con excepción de los individuos del biotipo Hembra.

    Palabras claves: Guadua angustifolia, caracterización molecular, variación genética.

  18. Variabilidad genética de Hartón del Valle mediante RAM Genetic variability of Harton del Valle by RAM

    Directory of Open Access Journals (Sweden)

    Ana M Piedrahíta

    2008-01-01

    Full Text Available El Hartón del Valle (HV hace parte de las siete razas criollas de ganado bovino colombiano y de acuerdo con los criterios de la FAO está considerado como vulnerable. Para estudiar su variabilidad genética fueron muestreados 33 individuos HV y tres animales de la raza Holstein, como control externo. Se extrajo ADN utilizando el método de Salting Out y las muestras fueron analizadas mediante la técnica molecular RAM (Randon amplified microsatellites. Se utilizaron los cebadores CGA, CCA, TG, y CT. El valor promedio de heterocigosidad esperada fue de 0.26 y el F ST fue 0.39 ± 0.03. Con el índice de Dice-Nei Li y agrupando con el método UPGMA se distinguieron dos grupos: uno integrado por dos hatos de conservación y el otro por cuatro fincas que han compartido reproductores.Harton del Valle (HV breed belong to the seven Creole breeds of the Colombian bovine livestock, according to FAO criteria it is considered as vulnerable. To study its genetical variability, 33 HV animals and three and 3 animals of Holstein breed as a external control were sampled. Simples of DNA were isolated using the Salting Out method and RAM (Random amplified microsatellites technique was used. CGA, CCA, TG and CT primers were used. The mean value of expected heterocigozity was 0.26 and F ST fue 0.39 ± 0.03. Using Dice-Nei Li index and UPGMA clustering method, two groups were distinguished: the first one integrated for two conservation herds and other one by tour faros that have been sharing breeding bulls.

  19. Estimación de la varianza genética y ambiental en caracteres métricos del esqueleto humano

    Directory of Open Access Journals (Sweden)

    Varela, Héctor Hugo

    2003-01-01

    Full Text Available En la teoría evolutiva de rasgos cuantitativos el conocimiento de la varianza genética (VG es determinante para hacer inferencias acerca del parentesco. En muchos casos no es posible estimar dicha componente sin la información obtenida a partir de la correlación entre parientes o de experimentos de selección. Por esta razón, en ausencia de datos apropiados es posible lograr una aproximación mediante el análisis de la repetibilidad de caracteres cuantitativos. En este trabajo se estima la proporción de la varianza genética máxima (VGmax o repetibilidad de medidas del cráneo y del esqueleto postcraneal, empleando la información obtenida por la Dra. Silvia Quevedo en el grupo prehistórico de Punta Teatinos (Norte Semiárido de Chile. La VG es igual a la varianza fenotípica (VP menos la varianza ambiental (VE. Esta última se puede particionar en una varianza ambiental especial (VEe y en una varianza ambiental general (VEg. Como la VEe se puede conocer por la medición de caracteres simétricos del lado derecho e izquierdo del individuo, entonces es posible calcular la varianza genética máxima de la siguiente manera, VGmax=VP-VEe. La proporción de la VGmax se obtuvo para siete variables del esqueleto postcraneano en individuos femeninos (n=56, masculinos (n=55, de ambos sexos (n=115 e infantiles (n=66, y para nueve mediciones del cráneo en un único grupo (n=54. Los resultados indican que la proporción media de la VGmax es menor en el cráneo que en el esqueleto postcraneal sugiriendo una distribución diferencial del efecto ambiental desde el punto de vista topográfico. Además, dicha cantidad es mayor en individuos infantiles que en masculinos y femeninos posiblemente por la existencia en aquellos de una mayor influencia del efecto ambiental general confundido con la VGmax.

  20. Polimorfismos del gen de la enzima convertidora de angiotensina (Inserción/Delección y factores de riesgo asociados en pacientes con infarto agudo del mioicardio

    Directory of Open Access Journals (Sweden)

    Lizbeth Salazar Sánchez

    2009-06-01

    Full Text Available Introducción. Los factores clásicos de riesgo cardiovascular están ampliamente estudiados y estrechamente vinculados con el desarrollo de infarto agudo del miocardio, accidente vascular cerebral y enfermedad vascular periférica. Entre los factores genéticos que subyacen a estas condiciones están las mutaciones en el gen de la enzima convertidora de angiotensina. El principal objetivo de este estudio fue establecer la relación entre polimorfismos Inserción/Delección de la enzima conversora de angiotensina en una grupo de pacientes con cardiopatía isquémica. Métodos: Se realizó un estudio prospectivo de casos y controles en un grupo de pacientes con infarto agudo del miocardio referidos para coronariografía. Se obtuvo información clínica a partir de los expedientes clínicos y la entrevista personal. La obtención de ácido desoxirribunocleico y el análisis del polimorfismo de la enzima convertidora de angiotensina (Inserción / Delección, se realizaron con técnicas de biología molecular previamente descritas. Resultados: Se incluyeron en el estudio 33 casos y 67 controles. El 87.7% de los pacientes fueron de sexo masculino y el índice de masa corporal fue mayor en los casos (35.6 que en los controles (24.8. En el grupo de casos, el fumado (pAbstract Angiotensin converting enzime gene polimorphisms Insertion/Deletion and cardiovascular risk factors in patients with acute myocardial infarction Introduction Traditional cardiovascular risk factors are widely studied and closely linked with the development of acute myocardial infarction, stroke and peripheral vascular disease. The underlying genetic background includes the angiotensin converting enzyme gene mutations. The main objective of this study is to establish an association between the polymorphism Insertion/Deletion of angiotensin converting enzyme in a group of patients with coronary artery disease. Methods. We performed a prospective, case-control study, in a group of

  1. Expresión transitoria del gen GUS en caña de azúcar usando Agrobacterium tumefaciens Transient gene expression in sugarcane using Agrobacterium tumefaciens

    OpenAIRE

    Martha Liliana Bonilla Betancourt; Jaime Eduardo Muñoz Flórez; Fernando ángel Sánchez

    2008-01-01

    En el estudio se desarrolló una metodología de transformación genética mediante Agrobacterium tumefaciens en cultivares colombianos de caña de azúcar. La transformación se evaluó mediante la expresión del gen GUS. Callos embriogénicos y explantes meristemáticos de los genotipos CC85-92, CC84-75 y CC87-505 se transformaron usando tres cepas (AGL-1, LBA4404 y EHA105) con el plásmido pCambia 1305.2 y dos (EHA105 y LBA4404) con pCambia 2301. Se usó el medio de infiltración (IM) con acetosiringona...

  2. Mamífero no humano carente de la expresión del gen Vav3, procedimiento de obtención y sus aplicaciones

    OpenAIRE

    García Bustelo, Xosé Ramón; Sauzeau, Vincent

    2005-01-01

    Mamífero no humano carente de la expresión del gen Vav3, procedimiento de obtención y sus aplicaciones. La invención se relaciona con un mamífero no humano knockout útil como modelo experimental cuyo genoma posee el gen Vav3 mutado y cuyos niveles de RNA mensajero o proteína para la proteína Vav3 endógena se encuentran alterados. Otro objeto de la invención lo constituye un procedimiento de obtención de dicho animal no humano, así como una célula eucariota mutada. Este...

  3. Criterios de selección y de evaluación de nuevas obtenciones autocompatibles en un programa de mejora genética del almendro (Prunus amygdalus Batsch)

    OpenAIRE

    Kodad, Ossama

    2006-01-01

    Se han estudiado distintos aspectos morfológicos, fisiológicos, productivos y cualitativos en una población de selecciones auto-compatibles de almendro (Prunus amygdalus Batsch) del programa de mejora genética del CITA de Aragón. La evaluación de los caracteres morfológicos permitió ratificar la variabilidad genética y ambiental sobre su expresión, permitiendo considerar la morfología del árbol como un objetivo alcanzable en un programa de mejora. La densidad floral y la capaci...

  4. Caracterización molecular, genética poblacional y relación biológica del nemertino Malacobdella arrokeana endocomensal de la almeja gigante Panopea abbreviata

    OpenAIRE

    Alfaya, José E. F.

    2014-01-01

    [ES] Malacobdella arrokeana Ivanov et al., 2002 es un nemertino que vive en la cavidad del manto de la almeja gigante Panopea abbreviata, ambas especies endemicas del Mar Argentino. Mediante la secuenciación y análisis del gen mitocondrial citocromo oxidasa I (COI), se corroboró que M arrokeana diverge genéticamente de M. grossa en un 11,6%, y 10,4% con respecto a M. japonica. Tanto M. arrokeana como P. abbreviata comparten el mismo nivel trófico y los mismos ítems alimentarios, compuestos en...

  5. Parámetros genéticos del crecimiento y la reproducción en ganado cebú

    Directory of Open Access Journals (Sweden)

    Mario Pino Pérez de Utrera

    2009-06-01

    Full Text Available Con el propósito de conocer las correlaciones genéticas entre los rasgos de crecimiento en toros y las características reproductivas en vacas cebú de Cuba, se utilizaron 9490 registros de toros que terminaron la prueba de comportamiento en pastoreo, a los cuales se les registró el peso final (PF a los 18 meses de edad; así mismo se emplearon 13.575 registros de sus medio hermanas, a las que se les registró la edad a la primera inseminación (EPI, la edad al primer parto (EPP y los servicios por gestación (SXG. Los datos fueron colectados en cinco centros genéticos entre 1988 y 2001. Todos los animales eran hijos de 267 toros. Los valores promedios encontrados fueron 343,3 kg, 26,5 meses, 37,7 meses y 1,76 para PF, EPI, EPP y SXG, respectivamente. Los índices de herencia (h2 fueron 0,245, 0,054, 0,091 y 0,021 para PF, EPI, EPP y SXG, respectivamente. Las correlaciones genéticas entre PF y los rasgos reproductivos oscilaron entre -0,216 y -0,340. Entre los caracteres reproductivos, las correlaciones genéticas fueron de 0,544 a 0,982. Se concluyó que los valores de h2 estimados para el ganado cebú en Cuba están dentro del rango publicado en la literatura internacional y que la selección continuada para el incremento del peso corporal a los 18 meses de edad en los toros no afectaría negativamente la eficiencia reproductiva en las vacas.

  6. Filogenética Molecular de Peces del Complejo Midas Cichlidae que habitan lagos y lagunas de Nicaragua, utilizando el gen COI

    Directory of Open Access Journals (Sweden)

    Lucía Páiz-Medina

    2012-12-01

    Full Text Available Las lagunas cratéricas de Nicaragua se consideran verdaderos "laboratorios" naturales de investigación debido a que son geológicamente jóvenes y por su pequeña dimensión, lo que permite el estudio de procesos evolutivos y de especiación. En estas lagunas se encuentran especies endémicas (familia Cichlidae que representan recursos valiosos para estudios de especiación, incluyendo la velocidad y fuerzas con las que el aislamiento geográfico, la selección natural y sexual provocan la diversificación fenotípica y, finalmente, la especiación misma. Los peces de la familia Cichlidae han sido objeto de mucha controversia debido a que morfológicamente es difícil diferenciarlos y se requieren de nuevas herramientas moleculares para descifrar las diferencias a nivel genético y entender mejor los procesos de especiación de este fascinante grupo de peces. En este estudio se utilizó el gen Citocromo Oxidasa I, COI, para determinar las relaciones filogenéticas entre los peces del Complejo presente en lagos y lagunas de Nicaragua. El COI ha sido propuesto como "código de barras" genético y como técnica ha sido estandarizada para animales. Este trabajo es parte de una investigación más grande que se enmarca en el Proyecto "DNA Barcoding de la biodiversidad nicaragüense" y se realiza en el Centro de Biología Molecular de la Universidad Centroamericana. Con este estudio se ha logrado determinar que: (1 el gen COI discrimina entre especies de diferentes lagunas, (2 las relaciones entre las especies Midas Cichlidae son complejas y es necesario más de un gen para obtener resultados concluyentes, (3 las especies fundadoras de las lagunas cratéricas provienen del lago de Nicaragua, (4 en las lagunas habitan más de una especie del Complejo Midas Cichlidae y (5 se infiere que la especiación simpátrica es el mecanismo evolutivo que ha conducido a la creación de estas especies, confirmando la hipótesis de otros autores y aportando nuevos

  7. Explotación de la nueva variación genética y mejora genética del complejo de Phaseolus vulgaris L.

    OpenAIRE

    Samayoa López, Luis Fernando

    2010-01-01

    125 páginas, 51 figuras, 27 tablas.-- Trabajo realizado en el Grupo de Leguminosas del Departamento de Recursos Fitogenéticos de la Misión Biológica de Galicia, Consejo Superior de Investigaciones Científicas, (MBG–CSIC), Pontevedra, España.

  8. Genetic variability of Harton del Valle by RAM Variabilidad genética de Hartón del Valle mediante RAM

    Directory of Open Access Journals (Sweden)

    Alvarez Franco Luz Angela

    2008-03-01

    Full Text Available Harton del Valle (HV breed belong to the seven Creole breeds of the Colombian bovine livestock, according to FAO criteria it is considered as vulnerable. To study its genetical variability, 33 HV animals and three and 3 animals of Holstein breed as a external control were sampled. Simples of DNA were isolated using the Salting Out method and RAM (Random amplified microsatellites technique was used. CGA, CCA, TG and CT primers were used. The mean value of expected heterocigozity was 0.26 and FST fue 0.39 ± 0.03. Using Dice–Nei Li index and UPGMA clustering method, two groups were distinguished: the first one integrated for two conservation herds and other one by tour faros that have been sharing breeding bulls.El Hartón del Valle (HV hace parte de las siete razas criollas de ganado bovino colombiano y de acuerdo con los criterios de la FAO está considerado como vulnerable. Para estudiar su variabilidad genética fueron muestreados 33 individuos HV y tres animales de la raza Holstein, como control externo. Se extrajo ADN utilizando el método de Salting Out y las muestras fueron analizadas mediante la técnica molecular RAM (Randon amplified microsatellites. Se utilizaron los cebadores CGA, CCA, TG, y CT. El valor promedio de heterocigosidad esperada fue de 0.26 y el FST fue 0.39 ± 0.03. Con el índice de Dice–Nei Li y agrupando con el método UPGMA se distinguieron dos grupos: uno integrado por dos hatos de conservación y el otro por cuatro fincas que han compartido reproductores.

  9. Genética de la esclerosis múltiple: papel del HLA-DRB1 en la susceptibilidad y expresión fenotípica

    OpenAIRE

    Romero Pinel, Lucía María

    2010-01-01

    [spa] La esclerosis múltiple (EM) es una enfermedad debida a factores genéticos y ambientales. Se ha demostrado que existe agregación familiar y que los genes del haplotipo HLA-DR2 son los que mayoritariamente se asocian con la susceptibilidad a padecer la enfermedad. Si el fenotipo clínico se ve modificado en las formas familiares de EM respecto a las esporádicas o debido a determinados genes es un tema de constante estudio. HIPÓTESIS: Si existen diferencias clínicas entre formas familiares ...

  10. Capítulo III: caracterización y evaluación de recursos genéticos del género Lycopersicon

    OpenAIRE

    Sierra Tulio Alberto; Osorio Erika Rocío; Vallejo Cabrera Franco Alirio

    1994-01-01

    Con el fin de determinar el potencial genético de 118 introducciones del género Lycopersicon se realizó la caracterización y evaluación, en el Centro Experimental de la Universidad Nacional Sede Palmira, utilizando los descriptores recomendados por el IBPGR (1981). Se utilizó el diseño experimental de Bloques al azar con dos repeticiones. La parcela experimental estuvo constituida por seis plantas. Se estudiaron nueve caracteres relacionados con la planta, diez caracteres relacionado...

  11. Control biològic del Rhynchophorus ferrugineus a partir de diferents soques de nematodes entomopatògens i la seva problemàtica a Catalunya

    OpenAIRE

    Sarsanedas Palau, Joan; García del Pino, Fernando

    2010-01-01

    En el present treball s'ha avaluat el potencial dels nemàtodes entomopatògens per a controlar la plaga de R. ferrugineus. Per fer-ho, s'ha determinat la susceptibilitat d'aquesta a 4 espècies diferents de nemàtodes: Steinernema carpocasae (soca B14, IDEBIO, BIOVERD), Steinernema feltiae (soca D114), Steinernema sp. (D122) i Heterorhabditis bacteriophora (soca DG46). D'altra banda, s'ha determinat la predació de Steinernema carpocapsae per part de l'àcar Centroupeda almerodai (Acari: Acaridae)...

  12. Genome dynamics, genetic complexity and macroevolution Dinámica del genoma, complejidad genética y macroevolución

    Directory of Open Access Journals (Sweden)

    MILTON GALLARDO

    2003-12-01

    duplicaciones génicas. Esta idea, desarrollada por Ohno (1968 permanece vigente en el estudio de varios organismos cuyos genomas se han secuenciado. El maíz, la levadura y los humanos contienen más paralogones que lo esperado por azar, apoyando así la idea que las familias génicas no se formaron de novo, sino por duplicaciones a gran escala del ADN. La hibridización de linajes emerge como un mecanismo eficiente y diseminado que crea novedades evolutivas por reclutamiento de genes redundantes hacia nuevos roles. La transferencia génica lateral indica una composición quimérica de los genomas de procariontes. Esta peculiar forma de herencia oscurece los límites de los linajes filogenéticos y sugiere anastomización y dicotomización en la forma del árbol de la vida. Las mutaciones adaptativas también han ensanchado el marco genético del pensamiento evolutivo al incorporar un nuevo mecanismo de formación de genes. Además, la biología del desarrollo ha entregado evidencias sólidas de la organización modular onto- y epigenética del organismo. Los cambios rápidos y drásticos generados por los genes del desarrollo han falseado la noción que la adaptación se logra exclusivamente por el reemplazo gradual de alelos, y que el cambio macroevolutivo es microevolución expandida. Con todo, la genómica comparada parece estar gestando una ampliación o un remodelamiento del marco genético en que comprendemos la filogenia y la evolución de la complejidad morfológica

  13. Optimització de l’avaluació genètica de la raça bovina Bruna dels Pirineus

    OpenAIRE

    Fina i Pla, Marta

    2013-01-01

    La raça bovina Bruna dels Pirineus és una raça càrnia autòctona de les àrees muntanyoses de Catalunya. Els treballs que conformen la present tesi doctoral pretenen optimitzar l’avaluació genètica que actualment es duu a terme en aquesta raça. Les anàlisis s'han realitzat a partir de 8.130 registres de pes al naixement i 1.245 registres de pes al deslletament de vedells nascuts entre els anys 1986 i 2010, i procedents de 12 i dos explotacions, respectivament. En aquest sentit, el primer dels t...

  14. Parámetros genéticos de características de tipo y producción en ganado Holstein del departamento de Antioquia

    Directory of Open Access Journals (Sweden)

    Juan Corrales A.

    2012-04-01

    Full Text Available Objetivo. Estimar heredabilidades, correlaciones fenotípicas y genotípicas entre 24 características de tipo y producción de leche en vacas Holstein del departamento de Antioquia. Materiales y métodos. Se analizaron un total de 2395 registros de vacas Holstein. Se estimaron componentes de varianza mediante el procedimiento de máxima verosimilitud restricta con modelos animales bi-característicos. Para las características de tipo, el modelo incluyó los efectos fijos de finca, año de nacimiento y país de origen del padre de la vaca, el grupo contemporáneo (año-mes-clasificador y la covariable edad a la clasificación. Para la producción de leche el modelo incluyó los efectos fijos de finca, año de parto, país y año de nacimiento del padre. Resultados. Las heredabilidades encontradas para las características de tipo variaron de 0.04 a 0.44 y para producción de leche fue de 0.22, los errores estándar de la heredabilidad fueron inferiores a 0.06. Las correlaciones genéticas de producción de leche con las características profundidad de la ubre (-0.72 fue alta, mientras las correlaciones más altas entre las características de tipo fueron entre extremo anterior y tamaño (0.90, ángulo de la pezuña y profundidad del talón (0.98, profundidad del talón y uniformidad de pezuñas (0.85; y ligamento suspensorio medio y colocación de pezones posteriores (0.76. Conclusiónes. Se encontró una considerable variación genética en características de tipo dentro de la población Holstein de Antioquia. Las correlaciones genéticas entre algunas características de tipo fueron altas e indican la posibilidad de reducir el número de características evaluadas en cada animal.

  15. Identification of new genovariants of canine distemper virus in dogs from the State of Mexico by analyzing the nucleocapsid gene Identificación de nuevas genovariantes del virus del distemper canino mediante el análisis del gen de la nucleocápside en perros del Estado de México

    Directory of Open Access Journals (Sweden)

    CE Gámiz-Mejía

    2012-01-01

    Full Text Available Globally, Canine Distemper Disease is one of the most important viral diseases in dogs due to its high mortality and morbidity. It is caused by an RNA canine paramyxovirus with an elevated genetic diversity. We previously reported the presence of an apparently exclusive genovariant in the State of Mexico, but we do not have data on molecular epidemiology of this virus. In order to determine his genetic diversity in this State, samples collected from dogs showing clinical signs of Distemper Disease were analyzed. The samples were processed by RT-PCR and the nucleotide sequence of an N gene fragment was obtained. The data analysis was performed using molecular phylogeny. The results showed that N gene sequences belong to seven Canine Distemper Virus genovariants that had never been reported before in the State of Mexico.A nivel mundial, el distemper canino es una de las más importantes enfermedades virales en los perros, debido a su alta mortalidad y morbilidad. Es causada por el virus del distemper canino, un virus RNA, el cual ha demostrado que posee una elevada diversidad genética. En México no existen datos de epidemiología molecular sobre este virus, pero recientemente se ha registrado la presencia de una variante genética aparentemente exclusiva del país. Para determinar la diversidad genética del virus del distemper canino obtenido en el Estado de México, México, en este trabajo se analizaron muestras de perros que presentaban signos de la enfermedad. Para esto, las muestras obtenidas fueron procesadas por RT-PCR y la secuencia nucleotídica de un fragmento del gen N fue obtenida. El análisis de los datos fue realizado mediante filogenia molecular. Los resultados muestran que las secuencias del gen N pertenecen a siete genovariantes del virus del distemper canino que no habían sido previamente reportadas y se encuentran circulando en el Estado de México.

  16. Evaluación del potencial de mejoramiento genético en el crecimiento en altura de Acacia mangium Willd.

    Directory of Open Access Journals (Sweden)

    Pastrana Vargas Iván Javier

    2012-11-01

    Full Text Available

    En el periodo 2009-2010, en Ayapel, Planeta Rica y Tierralta, departamento de Córdoba (Colombia se evaluó el desempeño en crecimiento en altura total de 90 familias de polinización abierta de Acacia mangium. En estos municipios el clima se clasifica, de acuerdo con Holdridge, como bosque seco tro- pical (Bs-T, excepto Tierralta que es bosque húmedo tropical (Bh-T. Durante el primer año de creci- miento, las plantas en cada familia fueron evaluadas en ensayos de progenie mediante un diseño expe- rimental de bloques completos al azar, con seis bloques en cada una de las tres localidades. La parcela o unidad experimental consistió en seis plantas de polinización abierta por familia, distribuidas aleato- riamente en tres parejas espacialmente separadas dentro de cada bloque. La predicción de parámetros genéticos individuales y de familias se efectuó por medio del procedimiento BLUP y los componentes de varianza por medio del procedimiento REML utilizando el software SELEGEN. Las estimaciones de he- redabilidad variaron entre <1 y 13%, y entre 6 y 68%, para heredabilidad individual en sentido estricto (h2a y heredabilidad media de familias (h2mp, respectivamente. El ranking genético en altura de las

    15 mejores familias indica que las de mayor crecimiento fueron también las más estables y de mayor adaptabilidad a los ambientes. Los resultados sugieren un alto potencial de mejoramiento al nivel de familia en crecimiento y productividad de plantaciones de A. mangium en el departamento de Córdoba,

    #olombia. $on necesarios nuevos estudios a fin de lograr una me%or selección genética

  17. Evaluación del potencial de mejoramiento genético en el crecimiento en altura de Acacia mangium Willd.

    Directory of Open Access Journals (Sweden)

    Iván Javier Pastrana-Vargas

    2012-04-01

    Full Text Available En el periodo 2009-2010, en Ayapel, Planeta Rica y Tierralta, departamento de Córdoba (Colombia se evaluó el desempeño en crecimiento en altura total de 90 familias de polinización abierta de Acacia mangium. En estos municipios el clima se clasifica, de acuerdo con Holdridge, como bosque seco tropical (Bs-T, excepto Tierralta que es bosque húmedo tropical (Bh-T. Durante el primer año de crecimiento, las plantas en cada familia fueron evaluadas en ensayos de progenie mediante un diseño experimental de bloques completos al azar, con seis bloques en cada una de las tres localidades. La parcela o unidad experimental consistió en seis plantas de polinización abierta por familia, distribuidas aleatoriamente en tres parejas espacialmente separadas dentro de cada bloque. La predicción de parámetros genéticos individuales y de familias se efectuó por medio del procedimiento BLUP y los componentes de varianza por medio del procedimiento REML utilizando el software SELEGEN. Las estimaciones de heredabilidad variaron entre <1 y 13%, y entre 6 y 68%, para heredabilidad individual en sentido estricto (h²a y heredabilidad media de familias (h²mp, respectivamente. El ranking genético en altura de las 15 mejores familias indica que las de mayor crecimiento fueron también las más estables y de mayor adaptabilidad a los ambientes. Los resultados sugieren un alto potencial de mejoramiento al nivel de familia en crecimiento y productividad de plantaciones de A. mangium en el departamento de Córdoba, Colombia. Son necesarios nuevos estudios a fin de lograr una mejor selección genética.

  18. Exploración de la variabilidad genética del maracuyá (passiflora edulis f. flavicarpa degener) como base para un programa de fitomejoramiento en colombia

    OpenAIRE

    John Ocampo; Ramiro Urrea; Kris Wyckhuys; Mauricio Salazar

    2014-01-01

    El maracuyá es uno de los principales frutales del Neotrópico y en Colombia existen cerca de 6000 ha cultivadas con esta fruta, con una producción de 90,000 t/año. No obstante este potencial, los cultivos presentan graves problemas fitosanitarios y degeneración genética, lo que se manifiesta por una reducción de la vida útil de la plantación. El objetivo de esta investigación fue evaluar el grado de variabilidad genética del maracuyá cultivado en Colombia como base para un programa de fitomej...

  19. Caracterizaci??n de la regi??n cromos??mica 15q11-q13 del genoma humano. Variabilidad gen??mica en el autismo e identificaci??n de ncRNAs

    OpenAIRE

    Cerrato Rivera, Celia

    2007-01-01

    La tesis doctoral con t??tulo "Caracterizaci??n de la regi??n cromos??mica 15q11-13 del genoma humano. Variabilidad gen??mica en el autismo e identificaci??n de ncRNAs" se basa en el estudio de la regi??n cromos??mica 15q11-q13, centr??ndonos en los aspectos de la variabilidad gen??mica y su significado funcional. En la primera parte del estudio buscamos reordenamientos de 15q11-q13 en pacientes con autismo, mediante la genotipaci??n de marcadores microsat??lites cubriendo dicha regi??n, y de...

  20. Adaptación del tamaño de la población en los algoritmos genéticos / Adaptation of population size in genetic algorithms

    OpenAIRE

    Cantor Monroy, Giovanni Antonio

    2009-01-01

    Este documento describe un algoritmo genético combinado con un autómata celular que utiliza un esquema de población celular para mantener diversidad en la población y determinar automáticamente el tamaño de la población. Los individuos del algoritmo genético son organizados en un autómata celular de 2 dimensiones, donde los individuos son considerados activos o inactivos en cada iteración del proceso evolutivo de acuerdo con una función de transición de estados configurada en el autómata celu...

  1. Mejoramiento genético y taza de autofecundación del Camu Camu arbustivo en la Amazonía Peruana

    Directory of Open Access Journals (Sweden)

    Carlos Oliva Cruz

    2008-06-01

    Full Text Available El camu camu (Myrciaria dubia (H.B.K. MC VAUGH es una frutera silvestre conocida mundialmente como un excepcional productor de vitamina C. Su mejoramiento se encuentra en fase inicial. Este trabajo tuvo por objetivos estudiar el sistema reproductivo (taza de autofecundación, el efecto del origen del polen (autofecundación o polinización abierta en la producción de ácido ascórbico y porcentaje de germinación, la repetibilidad de caracteres productivos y sus implicaciones en el programa de mejoramiento. El sistema reproductivo del camu camu es mixto con variables tazas de autofecundación. No fue confirmada la existencia de efecto del origen del polen para el carácter de producción de ácido ascórbico. La repetibilidad individual de la producción fue de moderada magnitud (0.41; la repetibilidad del promedio de 5 cosechas de fruta fue de 0.77, propiciando exactitud selectiva de 0.88. Genotipos superiores pueden ser seleccionados con precisión y, por lo tanto, cinco a seis cosechas por planta es un número adecuado. La selección y clonación de los diez mejores individuos deberá propiciar una ganancia genética del 237.5 %, elevando la productividad media anual de frutas por planta de 7.75 para 26.17 kg/año.

  2. La virtualización del cuerpo y la investigación genética

    OpenAIRE

    López, Daniel

    2002-01-01

    La presentación del primer borrador de la secuenciación del genoma humano presentada la semana del 12 de febrero del 2001 en Nature (por el Consorcio Público Internacional) y en Science (por Celera Genomics) supone la puesta en escena de algo que ya se comenzó a fraguar cuando Watson y Crick describieron la estructura helicoidal del DNA en 1953. La transformación que ha sufrido la biología molecular a partir de ese momento ha producido un cambio en nuestra concepción del cuerpo. En este artíc...

  3. Nuevos diseños de sistemas de control híbrido, genético-adaptativo, para la regulación de la eficiencia del bloque termoenergético de las empresas del níquel.

    Directory of Open Access Journals (Sweden)

    Antonio Muñoz

    2006-10-01

    Full Text Available El artículo muestra los resultados de la investigación del sistema de avanzado híbrido (genéticoadaptativo para la generación de vapor, a través de lazos de regulación para la reducción de la dispersión de las variables del régimen operacional del proceso, con la aplicación de nuevas estrategias de control óptimo con algoritmos genéticos del gasto de energía, sobre la desviación del régimen de trabajo de las calderas; todo lo cual contribuye a la reducción de las pérdidas de energía para generar vapor, permitiendo implementar sistemas control híbridos, resultantes de la integración de sistemas de control genético-adaptativos.

  4. Trastornos generalizados del desarrollo: Aspectos clínicos y genéticos Pervasive developmental disorders: Clinical and genetics aspects

    Directory of Open Access Journals (Sweden)

    Víctor Ruggieri

    2007-01-01

    Full Text Available Los Trastornos Generalizados del Desarrollo se expresan con compromiso en la socialización, trastorno en el desarrollo del lenguaje (verbal y no verbal e intereses restringidos con conductas repetitivas. La frecuencia estimada en la población general es de 27.5/10.000. En nuestro trabajo analizamos los aspectos clínicos y genéticos de los TGD: Autismo, Síndrome de Asperger, TGD no Especificado, Síndrome de Rett y Trastorno desintegrativo de la niñez. Desde el punto de vista clínico jerarquizamos los aspectos conductuales para su reconocimiento. En los aspectos genéticos puntualizamos diversas entidades con las que se asocian consistentemente estos trastornos, denominados cuadros sindrómicos, (aproximadamente el 20% de los casos y las bases genéticas actualmente propuestas para el 80% restante o formas no sindrómicas. El reconocimiento temprano de estos trastornos del desarrollo y el diagnóstico de una entidad específica asociada permiten un temprano y adecuado abordaje terapéutico, un correcto asesoramiento genético y un control evolutivo específico previendo posibles complicaciones relacionadas a la entidad de base. Finalmente, si bien las bases genéticas del autismo no están identificadas se han propuesto diversos genes candidatos ubicados en los cromosomas: 15q, 2q, 17q, 7q, 12q, y los relacionados al X, entre otros, los que son analizados en este trabajo y permitirán en un futuro cercano comprender mejor estos trastornos.Pervasive developmental disorders (PDD encompass a heterogeneous group of children with deficits of verbal and non-verbal language, social communication, and with a restricted repertoire of activities or repetitive behaviours. The frequency in general population is considered 27.5/10,000. In this study, we analyzed the clinical and genetic aspects of Autism, Asperger Syndrome, PDD Not Otherwise Specified, Rett Syndrome and Childhood Disintegrative Disorder. We analyzed clinical, behavioural and

  5. Bases genómicas del cáncer de mama: avances hacia la medicina personalizada Genomic basis for breast cancer: advances in personalized medicine

    Directory of Open Access Journals (Sweden)

    Alfredo Hidalgo-Miranda

    2009-01-01

    Full Text Available El análisis genómico del cáncer de mama ha permitido el desarrollo de nuevas herramientas de predicción de riesgo y respuesta al tratamiento en esta enfermedad. Los perfiles de expresión génica han generado una mejor clasificación de los tumores e identificado subgrupos tumorales con características clínicas particulares. También se han reconocido patrones de pérdida y ganancia de DNA y expresión de micro-RNA relacionados con la carcinogénesis mamaria, tras identificar nuevos blancos potenciales. Los estudios de asociación del genoma completo han identificado variantes genéticas vinculadas con un mayor riesgo a presentar esta enfermedad, lo que hará posible tomar decisiones de salud pública mejor fundamentadas. Asimismo, los avances en la tecnología de secuenciación de DNA permitirán obtener información acerca de todas las alteraciones genéticas en los tumores. En esta revisión se describe el estado que guarda la investigación genómica en el cáncer de mama, así como la transición de estos hallazgos a la práctica clínica y la creación de las bases para el desarrollo de la medicina personalizada.Genomic analysis of breast cancer has allowed the development of new tools for the prediction of recurrence and the response to treatment of this disease. Gene expression profiles allow better tumor classification, identifying tumor subgroups with particular clinical outcomes. New potential molecular targets involved in breast carcinogenesis have also been identified through the analysis of DNA copy number aberrations and microRNA expression patterns. Whole genome association studies have identified genetic variants associated with a higher risk to develop this tumor, providing more information for public health decisions. Progress in DNA sequencing methods will also allow for the analysis of all the genetic alterations present in a tumor. In this review, we describe the current state of genomic research in breast cancer as

  6. Algoritmos genéticos incrementales

    OpenAIRE

    Nesmachnow, Sergio; Dominioni, Federico; Musso, Pablo

    2005-01-01

    Este artículo presenta el estudio, diseño e implementación de un modelo particular de algoritmos genéticos paralelos, los algoritmos genéticos incrementales. La principal ventaja del motor de algoritmos genéticos implementado es su potencialidad de ejecución en entornos no dedicados, detectando la carga generada por los usuarios del entorno y consumiendo de un modo “inteligente” los recursos computacionales disponibles. Se presenta la descripción teórica del modelo de algoritmos genéticos inc...

  7. Presencia del elemento genético transponible dTdic1 en Dianthus caryophyllus con flores variegadas y no variegadas

    Directory of Open Access Journals (Sweden)

    Karen Rocío López Castro

    2012-08-01

    Full Text Available Título en inglés: Presence of the transposable genetic element  dTdic1 in Dianthus caryophyllus with  variegated and no variegated flowers Resumen: El objetivo de este trabajo era la búsqueda del  EGT (Elemento Genético Transponible dTdic1 que ha sido asociado con la variegación del color de las flores de clavel y su relación con dos genes que codifican para enzimas involucradas en la biosíntesis de antocianinas,  Chalcona isomerasa (CHI y Dihidroflavonol reductasa (DFR.  Su presencia y expresión se evaluó en siete genotipos con flores variegadas (líneas híbridas y en cuatro genotipos de flores no variegadas (una línea híbrida y tres cultivares comerciales.  Un alto número (indefinido de copias del elemento dTdic1 se detectó en todas las líneas variegadas y no variegadas.  En consecuencia, la sola presencia de este EGT no pudo asociarse directamente con la variegación de los pigmentos florales de flores de clavel.  Adicionalmente, dTdic1 se encontró interrumpiendo el gen CHI en cuatro genotipos variegados y uno no variegado. No se observó evidencia de inserción de dTdic1 en el gen DFR en ninguno de los genotipos. Palabras clave: Transposones; chalcona isomerasa; antocianinas Abstract: The objective of this work was to search for the EGT (Transposable Genetic Element dTdic1 that has been associated with color variegation of carnation flowers and its relationship with two genes that code for enzymes involved in the synthesis of anthocyanins, Chalcona isomerase (CHI and Dihidroflavonol reductase (DFR. Its presence and expression was evaluated in seven genotypes of variegated flowers and four no variegated flower genotypes (one hybrid line and three commercial cultivars. A high number of copies (undefined of copies of the dTdic1 element was detected in variegaated and no variegated lines. Therefore, the main presence of this EGT was not associated directly with variegation of floral pigments. Additionally, dTdic1 was

  8. Relación del polimorfismo rs9939609 del gen FTO con factores de riesgo cardiovascular y niveles de adipocitoquinas en pacientes con obesidad mórbida Relation of the rs9939609 gene variant in FTO with cardiovascular risk factor and serum adipokine levels in morbid obese patients

    OpenAIRE

    D. A. De Luis; R. Aller; Conde, R.; O. Izaola; B. de la Fuente; M. González Sagrado; D. Primo; M. Ruiz Mambrilla

    2012-01-01

    Introducción: Algunos polimorfismos del gen asociado con la masa grasa y la obesidad (FTO) se han relacionado con la obesidad y parámetros bioquímicos. Nuestro objetivo fue analizar la relación del polimorfismo rs9939609 del gen FTO con el peso corporal, factores de riesgo cardiovascular y los niveles séricos de adipocitoquinas en una muestra de pacientes con obesidad mórbida. Material y métodos: Una muestra de 129 pacientes con obesidad mórbida (IMC > 40) se analizó en un diseño de corte tra...

  9. Estructura genética del sistema de asimilación de nitrato y regulación global de la asimilación de nitrógeno en la cianobacteria synechococcus sp.

    OpenAIRE

    Luque Romero, Ignacio

    1994-01-01

    Los objetivos de este trabajo han sido profundizar en el estudio de la estructura genética de los genes implicados en la asimilación de nitrato en Synechococcus sp. PCC 7942, y contribuir al esclarecimiento del mecanismo de regulación de dichos genes mediante la proteína NtcA.

  10. Aneuploidías del cromosoma 17 y deleción del Gen TP53 en neoplasias hematológicas

    Directory of Open Access Journals (Sweden)

    Carlos Mario Muñetón Peña

    2006-04-01

    Full Text Available La oncogénesis es considerada un proceo de múltiples etapas, en donde los factores genéticos son esenciales para su origen y desarrollo; se afectan principalmente dos grandes grupos de genes; se afectan principalmente dos grandes grupos de genes: los genes supresores de tumores (GST y los proto-oncogenes.

  11. Estudio del crecimiento, mineralización ósea y genética en pacientes con fenilcetonuria

    OpenAIRE

    Mirás Veiga, Alicia

    2014-01-01

    Estudiar el crecimiento y la incidencia de enfermedad mineral ósea (EMO) en los pacientes fenilcetonúricos, los potenciales factores de riesgo que favorecen el desarrollo de EMO e investigar el genotipo de cada paciente. Pacientes y Métodos Se estudiaron 129 pacientes fenilcetonúricos. Se realizó estudio de crecimiento a 109 pacientes, genético a 105 y estudio de la mineralización ósea a 43 pacientes PKU.

  12. Identificación de un polimorfismo del gen Est9 relacionado con resistencia a piretroides en Rhipicephalus (Boophilus) microplus

    OpenAIRE

    Edgar Diaz R.; Gustavo Vallejo

    2013-01-01

    RESUMENObjetivo. Mediante procedimientos de PCR-RFLP, detectar un polimorfismo en el gen Est9 de garrapatas Rhipicephalus (Boophilus) microplus resistentes a piretroides en Ibagué, Colombia, determinando el grado de asociación entre los fenotipos y los genotipos resultantes. Materiales y métodos. El ADN de 30 teleoginas R. (Boophilus) microplus fenotípicamente susceptibles, resistentes o medianamente resistentes a piretroides en una prueba de Drummond modificada, fue amplificado por PCR con c...

  13. La fábrica de la empatía. Del determinismo genético al origen social de la moral

    Directory of Open Access Journals (Sweden)

    Hernández Castro, David

    2016-06-01

    Full Text Available Preston and De Waal have adopted a theoretical idea known as the “Perception-Action Model” (PAM, which suggests that empathy and morality have genetic and evolutionary roots. In this paper, the author proposes a critical reading of PAM and an alternative interpretation, “the empathy factory”, which reconsiders the “Perception-Action Hypothesis” and the discovery of mirror neurons in the light of Judith Butler’s concept of performativity and the social construction of emotions. The conclusion is that the origin of the moral impulse does not lie in genetic determinism but in social relationships, language and affective communication.Preston y De Waal han adoptado una idea teórica, el Mecanismo de Percepción-Acción (MPA, que sugiere que la empatía y la moral tienen raíces genéticas y evolutivas. En este artículo analizamos críticamente el MPA y proponemos una interpretación alternativa, la fábrica de la empatía, que reconsidera la “Hipótesis de la Percepción-Acción” y el descubrimiento de las neuronas espejo bajo la luz del concepto de performatividad de Judith Butler y la construcción social de las emociones. Frente al determinismo genético, nuestra investigación apunta a las relaciones sociales y el lenguaje.

  14. Desarrollo de nuevas metodologías de evaluación genética de la conformación funcional y del potencial deportivo del caballo de Pura Raza Española

    OpenAIRE

    Sánchez Guerrero, María José

    2016-01-01

    El caballo Pura Raza Español (PRE) es la principal raza equina autóctona de España, tanto por su censo (65% del total de caballos de razas puras y el 80,6% de caballos de razas autóctonas; 180.063 ejemplares vivos) como por su contribución económica en el sector (el impacto económico para la ciudad de Sevilla de SICAB en 2014 fue de 30 millones de euros y un volumen de negocio aproximado de 60 millones). Su programa de mejora genética, aprobado mediante la resolución del 8 d...

  15. Estudi de les alteracions moleculars en els gens reguladors del cicle cel·lular KLF6 i TP53, de les vies de transducció PI3K-AKT i RAS-MAPK, i identificació de nous gens amb potencial valor pronòstic en càncer de pròstata

    OpenAIRE

    Agell i Codina, Laia

    2012-01-01

    Malgrat que el càncer de pròstata és un dels tumors més freqüents en els païssos desenvolupats, no s’han identificat encara quins gens clau podrien estar alterats. L’objectiu de la tesi ha estat estudiar quins mecanismes moleculars estan implicats en la inciació i progressió del càncer de pròstata. En el primer treball es va analitzar la freqüència de mutació de dos gens reguladors del cicle cel·lular (KLF6 i TP53) en tumors de pròstata sobre els quals hi havia publicada bibliografia disc...

  16. Determinación de la estabilidad genética en cuatro especies del banco de germoplasma de papa en Cuba conservadas in vitro

    Directory of Open Access Journals (Sweden)

    J. G. Castillo

    2010-01-01

    Full Text Available Se estudiaron cuatro especies de papa conservadas in vitro durante diez años, con el objetivo de determinar si mantenían su estabilidad genética al compararlas con las de la colección base mantenida en campo. Se realizó una descripción morfoagronómica de las especies de ambas procedencias y se emplearon métodos isoenzimáticos y moleculares, para saber si se producían cambios en los patrones de bandas de las especies conservadas in vitro. Se utilizaron los sistemas isoenzimáticos peroxidasas, esterasas, polifenol oxidasas y anhidrasa carbónica, y el polimorfismo de longitud de fragmentos amplificados (AFLP como marcador molecular. Las cuatro especies conservadas fueron: Solanum schruteri Buk, Solanum dolichostigma Buk, Solanum jamesii Jorr y Solanum tuberosum L. Las plántulas se conservaron en un medio de retardamiento del crecimiento y fueron sub-cultivadas dos veces al año. Se evaluaron los caracteres cualitativos, del rendimiento y sus componentes, para determinar la existencia de cambios fenotípicos en las especies estudiadas. En el análisis de AFLP se emplearon cinco combinaciones de cebadores. Se realizó una prueba t de comparación de medias al rendimiento y sus componentes, para calcular la existencia de diferencias entre las accesiones. No se encontraron cambios fenotípicos notables para los caracteres cualitativos, el rendimiento y sus componentes. Los sistemas isoenzimáticos no detectaron cambios en los patrones de bandas, mientras que en el análisis de AFLP, los patrones de bandas de las plantas conservadas in vitro mostraron diferencias marcadas en cuanto al número de bandas, por lo que se concluye que no se mantiene la estabilidad genética de las accesiones estudiadas en el tiempo de conservación evaluado.

  17. Aprendizaje significativo del concepto de gen entre estudiantes de biología. OPEL-IPC Venezuela

    OpenAIRE

    Díez Escribano, D.

    2009-01-01

    El gen es un conocimiento biológico abstracto y fundamental que se presenta como entidades físicas con funciones específicas y como conocimiento exacto y ahistórico Su tratamiento estructuralista y funcionalista es un obstáculo epistemológico (Bachelard, 1971; El-Hanny, 2005). La intervención didáctica pretendió propiciar un aprendizaje significativo crítico (Moreira,2005). Investigación interpretativa micro-etnográfica con 50 sujetos. Interpreta significados que se construyen en: Biología Ce...

  18. Population genetic structure revealed by a school of the freshwatermigratory fish, Brycon hilarii Estructura genética poblacional revelada por un cardumen del pez migratorio de agua dulce, Brycon hilarii

    Directory of Open Access Journals (Sweden)

    Alexandra Sanches

    2012-07-01

    Full Text Available It is believed that different genetic populations of migratory fishes can co-exist in a single hydrographic system. Although different populations may occupy and explore the river together, they segregate during the spawning season and consequently the population genetic structuring is maintained. Genetic variation of a Brycon hilarii spawning school and samples from different collection sites in the Miranda River basin were surveyed using seven microsatellites. Population structuring was revealed by a significant differentiation of the spawning school related to the supposed local populations. The genetic differentiation detected may be supported by behavior during the reproductive season that promotes the maintenance of the genetic integrity of different populations. These data may contribute toward the understanding of the behavior and biology of these fish as well as fishery management and species conservation programs.Se ha documentado que diferentes poblaciones genéticas de peces migratorios pueden coexistir en un único sistema hidrográfico. Diferentes poblaciones pueden ocupar y explorar el río juntas, pero se segregan durante la temporada de desove y consecuentemente la estructuración genética poblacional se mantiene. La diversidad genética de un cardumen reproductivo de Brycon hilarii y muestras de diferentes sitios en la cuenca del Río Miranda fueron analizadas mediante siete microsatélites. La estructura poblacional fue revelada por una diferenciación genética significativa del cardumen reproductivo con las muestras de las poblaciones locales. La diferenciación genética detectada puede ser resultado de un probable comportamiento durante la temporada reproductiva, que promueve el mantenimiento de la integridad genética de las diferentes poblaciones. Estos datos pueden contribuir a la comprensión del comportamiento y biología de estos peces, así como amparar programas de gestión de la pesca y conservación de las

  19. Desarrollo de un sistema de expresión condicional del gen RHBDD2 para su sobreexpresión en un ratón transgénico

    OpenAIRE

    Lacunza, Ezequiel; Abba, Martin Carlos; Aldaz, C. Marcelo

    2011-01-01

    En estudios previos hemos identificado al gen RHBDD2 sobreexpresado en carcinomas invasores de mama. Hasta el momento se desconoce el rol funcional de dicha alteración aunque existen evidencias de que podría determinar un fenotipo favorable para las células tumorales. A fin de analizar in vivo las consecuencias biológicas de la sobreexpresión del gen RHBDD2, se llevó a cabo la construcción de un sistema de expresión condicional, para su inyección en células madres emb...

  20. Biología, ecología, genética y conservación del topillo nival ("Chionomys nivalis") en Peñalara y Sierra Nevada

    OpenAIRE

    Pérez-Aranda Serrano, Diana

    2009-01-01

    Esta tesis comprende un estudio multidisciplinar e integrado sobre el topillo nival, en el que se cubren tanto aspectos sobre su autoecología y biología básica (ecología espacial, biología reproductiva y dinámica poblacional) así como aspectos de índole genético (caracterización genética de las poblaciones ibéricas utilizando marcadores microsatélites) y molecular (perfil bioquímico sanguíneo), con el fin de poder reconstruir la historia natural del topillo nival y entender el funcionamiento ...

  1. Desarrollo y estado actual del Banco de Recursos Genéticos de las razas autóctonas en peligro de extinción de ganado ovino en Aragón

    OpenAIRE

    Quintín, Francisco J.; M. Hernández; Rioja, L.; Serraller, J.M.; Folch Pera, José; Alabart Alvarez, José Luis; Lahoz Crespo, Belén

    2015-01-01

    La crioconservación de material reproductivo y la formación de Bancos de Recursos Genéticos Animales es fundamental en el desarrollo de los Programas de Mejora, Conservación y Fomento ganadero. Las Administraciones Públicas junto con las Asociaciones de Ganaderos son los principales actores en la creación de los mismos. El objeto de la comunicación pone de relieve las actuaciones que se están llevando a cabo para la creación del Banco de Recursos Genéticos (BRG) de razas autóctonas aragonesas...

  2. Leucemia linfática crónica B: una enfermedad heterogénea. Estudio del rol de las mutaciones de IgVH y BCL-6 en esta heterogeneidad: aproximaciones genómica y funcional.

    OpenAIRE

    Jantus Lewintre, Eloisa

    2008-01-01

    RESUMEN La leucemia linfática crónica B (LLC-B) presenta un comportamiento clínico variable. Los pacientes sin mutaciones en la región variable del gen de la cadena pesada de las inmunoglobulinas (IgVH) sufren una enfermedad agresiva con menor tiempo libre de progresión y supervivencia global que los pacientes con IgVH mutado. Además, las mutaciones en el gen BCL6 proveen información clínica valiosa, permitiendo identificar un subgrupo de pacientes con alto riesgo de progresión, a pesar de...

  3. Clonación del cDNA del gen de la insulina humana en raíces aéreas de Brassica oleracea var italica (brócoli

    Directory of Open Access Journals (Sweden)

    Berenice García Reyes

    2010-01-01

    Full Text Available La insulina humana es una proteína de actividad hormonal que regula los niveles de glucosa en sangre. Cuando la insulina falla se desarrolla el padecimiento conocido como diabetes. La insulina se ha expresado en bacterias, levaduras, hongos, células animales y sistemas vegetales por biotecnología vegetal. En este trabajo presentamos los resultados del uso de raíces transformadas de Brassica oleracea var italica (Brocoli para producir insulina humana. Materiales y Métodos: El cDNA del correspondiente gen humano fue transfectado a Brocoli via Agrobacterium rhizogenes LBA9402 con el vector pCAMBIA1105.1. La transformación del tejido de raíces fue confirmada por PCR, reacciones de restricción y ensayos de B-glucuronidasa. Resultados y Discusión: La presencia del cDNA correspondiente a preproinsulina y proinsulina fue B-glucuronidasa positiva para varias de las líneas. Aunque el rendimiento fue variable, cinco líneas mostraron valores apropiados con potencial para ser usadas como modelo de estudio en la producción en biorreactores.

  4. Estudio del polimorfismo genético de las células de la médula ósea y del sistema nervioso central de ratas mediante la técnica de RAPD

    Directory of Open Access Journals (Sweden)

    Esteban Alberti

    2011-07-01

    Full Text Available Study of genetic polymorphism of the bone marrow and the central nervous system of rats cells by RAPD technique  Título corto: RAPD a células de ratas. ResumenLos modelos experimentales en rata han sido de gran utilidad en las evaluaciones terapéuticas o de reemplazo de células en enfermedades neurodegenerativas. Se ha comprobado que las células de la médula ósea (CMO de ratas pueden diferenciarse en células que no forman parte de sus linajes normales. Hay evidencias de estos procesos de trans-diferenciación, pero aún no se conocen los mecanismos moleculares que activan estos procesos. El propósito de nuestro trabajo fue estudiar el polimorfismo genético del ADN de los tipos celulares que conforman las CMO y las células del sistema nervioso central (SNC, estríatales y de la corteza de ratas mediante la técnica de RAPD. Las CMO, las células mononucleares (CMMO, las células estromales (CEMO y las del SNC fueron obtenidas de ratas, y su ADN genómico fue purificado y amplificado mediante la técnica de RAPD, utilizando 15 cebadores al azar. Se construyó un dendograma de las bandas de amplificación generadas utilizando el método de UPGMA. Las células estudiadas según el análisis del RAPD quedaron en 2 grupos bien definidos, pudiéndose diferenciar las CEMO del resto de las células estudiadas. Los cebadores OPA-6, 7 y 12, mostraron el polimorfismo genético de los linajes de células estudiadas. Mediante la técnica de RAPD se demostró la variabilidad genética entre las CEMO y las CMMO, células estriadas y de corteza que mostraron una homogeneidad genética, proponiéndose marcadores específicos de RAPD para cada grupo de células. Este es el primer estudio del polimorfismo genético de las CMO y del SNC de ratas.  Palabras clave: células de la médula ósea (CMO, células del sistema nervioso central, polimorfismo genético, RAPD. AbstractExperimental models have been of grate usefulness in the therapeutic or

  5. Identidad genética del hongo causante del primer caso de coccidioidomicosis descripto por Alejandro Posadas en 1892 Genetic characterization of the fungus involved in the first case of coccidioidomycosis described by Alejandro Posadas in 1892

    Directory of Open Access Journals (Sweden)

    Cristina E Canteros

    2009-04-01

    Full Text Available En 1892, Alejandro Posadas documentó el primer caso mundial de coccidioidomicosis en un paciente argentino de nombre Domingo Escurra. Con el objetivo de identificar la especie de Coccidioides involucrado en ese caso, analizamos una pieza de necropsia del paciente, conservada en el Museo de Patología de la Facultad de Medicina de la Universidad de Buenos Aires, Argentina. La porción del tejido con mayor número de endosporas del hongo libres e integras fue elegida utilizando una coloración inmunohistoquímica específica. El ADN fúngico fue amplificado usando una PCR anidada que reconoce un fragmento del gen Ag2/PRA cuyo polimorfismo diferencia Coccidioides immitis y C. posadasii. Se amplificó además, el ADN de dos cepas de referencia: C. immitis (M38-05 y C. posadasii (1-NL y de cuatro aislamientos de Coccidioides de pacientes argentinos. Los fragmentos amplificados fueron secuenciados en ambas hebras. Las secuencias fueron editadas, alineadas y comparadas con las depositadas en GenBank C. posadasii (Acceso N° AY536446, cepa Silveira y C. immitis (Acceso N° AY536445. Las secuencias del Coccidioides del caso Escurra, de los aislamientos argentinos y de la cepa 1-NL fueron idénticos entre sí y mostraron una mutación puntual de C→G en la posición 1228 en comparación con la secuencia de C. posadasii, cepa Silveira. Este es el primer trabajo donde se busca ADN de Coccidioides en una pieza anatómica de museo con más de 100 años de antigüedad. Los resultados confirman que el primer caso de coccidioidomicosis o enfermedad de Posadas documentado mundialmente fue producido por el recientemente descripto C. posadasii.In 1892 Alejandro Posadas described the first worldwide case of coccidioidomycosis in a patient named Domingo Escurra. A preserved necropsy piece from the patient's remains is conserved in the Museum of Pathology of the Medical School, Buenos Aires University. Paraffin-embedded specimens obtained from this piece served to

  6. Caracterización y evaluación de recursos genéticos del genero Lycopersicon

    OpenAIRE

    Vallejo Cabrera Franco Alirio; Sierra Tulio Alberto; Osorio Erika Rocío

    1993-01-01

    Mediante los descriptores de IBPGR se caracterizaron y evaluaron 118 introducciones del género Lycopersicon, en el Centro Experimental de la Universidad Nacional Sede Palmira. Se utilizó el diseño experimental de Bloques al azar con dos repeticiones; la parcela experimental estuvo constituida por seis plantas. Se estudiaron nueve caracteres relacionados con la planta, diez caracteres relacionados con el fruto, componentes del rendimiento y presencia o ausencia de plagas y enfermedade...

  7. DEL GEN EGOISTA AL GEN ALTRUISTA

    Directory of Open Access Journals (Sweden)

    Oscar José Fernández Galíndez

    2010-06-01

    Full Text Available The Darwinian thought derived from the interpretations and / or rereadings done on Charles Darwin's work, they have generated many controversy. Even the same Darwin demonstrated in many occasions her, doubts on her, before raised ideas, of there that I dress the evolutionism as paradigm, it suggests a serious review in the frame of the emergent thought and in the most igalitarian search of a society and less fragmented.

  8. Medicina genómica: Aplicaciones del polimorfismo de un nucleótido y micromatrices de ADN Genomic Medicine: Polymorphisms and microarray applications

    Directory of Open Access Journals (Sweden)

    Monica P. Spalvieri

    2004-12-01

    Full Text Available Esta actualización tiene por objeto difundir un nuevo enfoque de las variaciones del ADN entre individuos y comentar las nuevas tecnologías para su detección. La secuenciación total del genoma humano es el comienzo para conocer la diversidad genética. La unidad de medida reconocida de esta variabilidad es el polimorfismo de un solo nucleótido (single nucleotide polymorphism o SNP. El estudio de los SNPs está restringido a la investigación pero las numerosas publicaciones sobre el tema hacen vislumbrar su entrada en la práctica clínica. Se presentan ejemplos del uso de SNPs como marcadores moleculares en la genotipificación étnica, la expresión génica de enfermedades y como potenciales blancos farmacológicos. Se comenta la técnica de las matrices (arrays que facilita el estudio de múltiples secuencias de genes mediante chips de diseño específico. Los métodos convencionales analizan hasta un máximo de 20 genes, mientras que una sola micromatriz provee información sobre decenas de miles de genes simultáneamente con una genotipificación rápida y exacta. Los avances de la biotecnología permitirán conocer, además de la secuencia de cada gen, la frecuencia y ubicación exacta de los SNPs y su influencia en los comportamientos celulares. Si bien la validez de los resultados y la eficiencia de las micromatrices son aún controvertidos, el conocimiento y caracterización del perfil genético de un paciente impulsará seguramente un cambio radical en la prevención, diagnóstico, pronóstico y tratamiento de las enfermedades humanas.This update shows new concepts related to the significance of DNA variations among individuals, as well as to their detection by using a new technology. The sequencing of the human genome is only the beginning of what will enable us to understand genetic diversity. The unit of DNA variability is the polymorphism of a single nucleotide (SNP. At present, studies on SNPs are restricted to basic research

  9. ADAPTACI N AL ESPA OL DEL CUESTIONARIO VEC ET SANTE PER UE DE L ADOLESCENT (VSP-A: UNA MEDIDA GEN RICA DE CALIDAD DE VIDA PARA ADOLESCENTES

    Directory of Open Access Journals (Sweden)

    Vicky Serra-Sutton

    2002-01-01

    Full Text Available Fundamentos: En la última década se han desarrollado diversas medidas de calidad de vida relacionada con la salud para uso exclusivo en niños/as y adolescentes. No obstante, existen pocos instrumentos de estas características adaptados en España. El Vecú et Sante Perçue de l?adolescent (VSP-A es un instrumento genérico de calidad de vida relacionada con la salud para adolescentes de 11 a 17 años desarrollado en Francia. El objetivo de este estudio fue adaptar al español el VSP-A, como primera fase para la obtención del cuestionario. Métodos: Se adaptó la versión del VSP-A de 39 preguntas siguiendo la metodología de traducción directa e inversa incluyendo: 2 traducciones al español, puntuación del grado de dificultad (0 min-10 máx y clasificación de equivalencia semántica y cultural, 2 reuniones y discusión en paneles de adolescentes, así como reuniones de consenso del equipo de investigación. Finalmente se realizó una traducción inversa (retro-traducción al francés y se administró la versión final pre-test en la prueba piloto. Resultados: La mayoría de las preguntas se clasificaron como equivalentes (24 sobre 39. Tras las reuniones con adolescentes se modificaron algunas preguntas. Tras la retro-traducción, 3 preguntas necesitaron cambios menores. Conclusiones: La versión española del VSP-A parece semántica y culturalmente equivalente a la versión original en francés y adecuada para adolescentes en España. La sencillez de las preguntas, los comentarios de los adolescentes y la participación de los autores originales en el proceso de adaptación ha permitido obtener una versión pre-test adecuada. La siguiente fase del estudio es la comprobación de la fiabilidad y validez. Se espera que el VSP-A sea de utilidad para medir la calidad de vida relacionada con la salud en encuestas de salud o como instrumento de cribado en colegios o centros de atención primaria en nuestro medio.

  10. Composición Musical a Través del Uso de Algoritmos Genéticos

    OpenAIRE

    Ezequiel Moldaver; Hernán Merlino; Enrique Fernández

    2014-01-01

    Este trabajo se enfocará en el uso de los algoritmos genéticos (AAGG) con el fin de mezclar armonías y melodías de forma que se genere una composición musical de buen sonido para el oído, lo que significa que el contexto de cada nota respaldará la sonoridad de la misma provocando que no se genere un efecto disonante de forma permanente, que se genere una disonancia momentánea es permisible ya que es parte de la misma música generar tensión a través de pequeños intervalos poco agradables al oí...

  11. Composición Musical a Través del Uso de Algoritmos Genéticos

    Directory of Open Access Journals (Sweden)

    Ezequiel Moldaver

    2014-06-01

    Full Text Available Este trabajo se enfocará en el uso de los algoritmos genéticos (AAGG con el fin de mezclar armonías y melodías de forma que se genere una composición musical de buen sonido para el oído, lo que significa que el contexto de cada nota respaldará la sonoridad de la misma provocando que no se genere un efecto disonante de forma permanente, que se genere una disonancia momentánea es permisible ya que es parte de la misma música generar tensión a través de pequeños intervalos poco agradables al oído.

  12. Hacia una definición del arte genético y transgénico

    OpenAIRE

    Matewecki, Natalia

    2006-01-01

    Este trabajo se presenta como una introducción al proyecto de investigación en curso de la Beca de Perfeccionamiento en Investigación, Desarrollo Científico, Tecnológico y Artístico de la Universidad Nacional de La Plata. El arte genético y el arte transgénico plantean un trabajo multidisciplinario en el que participan artistas y científicos a la vez. Definir cada una de estas prácticas artísticas permitirá conocer y comprender las relaciones entre el arte y la ciencia en la actualidad, así c...

  13. Aislamiento e identificación de proteínas de unión a una secuencia específica del promotor del gen calmodulina de Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Yara Erika L

    2003-06-01

    Full Text Available En este trabajo se sigue la búsqueda de la maquinaria transcripcional de Plasmodium falciparum, aislando proteínas de unión a DNA, que podrían contribuir en un futuro a encontrar nuevos blancos terapéuticos. Con este fin se tomó como modelo el gen de calmodulina, utilizando específicamente un fragmento de DNA de 149 pb (PfCAM149 de la región 5' no traducida. Proteínas parcialmente purificadas provenientes del extracto nuclear total del parásito, se usaron para escalar el microsistema de afinidad DNA PfCAM149-biotina- estreptavidina- magnesferas, previamente desarrollado, para capturar aquellas proteínas de unión específica a la secuencia de DNA PfCAM149. El escalamiento permitió reci-clar tres veces la proteína a través de la matriz cromatográfica y determinar cuáles proteínas permanecían unidas al sistema, indicando interacción específica a la secuencia del promotor del gen de calmodulina (PfCAM149; además, condujo a obtener la cantidad de proteína necesaria para secuenciación. Por otra parte, se realizaron ensayos para rastrear la actividad de unión con secuencias consenso para factores de transcripción eucariotes (CREB, OCT1, MIG y GATA, que permitieron elegir una proteína de 54 kDa, cuya posible identidad corresponde al factor de transcripción E4BP4 o secuencias relacionadas. Con este trabajo se superaron problemas de cantidad, se comprobó la especificidad de la unión y se determinó que la proteína de 54 kDa tenía una modificación intrínseca que impidió la secuenciación de su extremo aminoterminal. Los ensayos realizados evidencian que el factor de trascripción CREB, o factores de trans­cripción relacionados forman parte de la maquinaria transcripcional del parásito. Palabras claves: malaria; Plasmodium falciparum; maquinaria; transcripción; factores de transcripción.

  14. Hipercalcemia hipocalciúrica debida a una mutación de novo del gen del receptor sensor de calcio Hypocalciuric hypercalcemia due to de novo mutation of the calcium sensing receptor

    Directory of Open Access Journals (Sweden)

    Marcelo Sarli

    2004-08-01

    Full Text Available El objetivo de este trabajo es presentar el inusual caso clínico de una paciente de 34 años que consultó para establecer diagnóstico de certeza y conducta terapéutica ante una hipercalcemia asintomática, detectada en un examen bioquímico de rutina. La elevación de la calcemia en ausencia de inhibición de la secreción de parathormona orientó hacia una patología paratiroidea. La persistencia de la hipercalcemia concomitante con hipocalciuria y coincidente con una relación clearance de calcio/clearance de creatinina inferior a 0.01, hicieron sospechar el diagnóstico de hipercalcemia hipocalciúrica familiar. La falta de antecedentes familiares llevó a realizar un estudio molecular de la paciente y su grupo familiar. Los resultados de los estudios nos permitieron concluir que la paciente es portadora de una mutación de novo (inactivante del gen del receptor sensor del calcio. Se incluyen los datos del estudio molecular y una breve revisión bibliográfica del tema.The aim of this paper is to refer the unusual case of a 34 years old woman who consulted because of asymptomatic hypercalcemia, detected in a biochemical routine examination. The elevated values of serum calcium without blunted parathyroid hormone secretion suggested a parathyroid pathology. The concomitance of hypocalciuria with hypercalcemia and a calcium clearance/creatinine clearance ratio less than 0.01 reverted the diagnosis of familial hypocalciuric hypercalcemia, the first option. The absence of familial background led to the molecular study of the patient and her family. The latter confirmed the diagnosis of a de novo inactivating mutation of the calcium sensing receptor. Details on the molecular study and a brief review of this subject are included.

  15. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano

    Directory of Open Access Journals (Sweden)

    A. P. Galeano

    2010-01-01

    Full Text Available Con el objetivo de estimar los componentes de varianza, las heredabilidades, repetibilidades y correlaciones genéticas y fenotípicas para la producción de leche por lactancia (PL, el peso al destete (PD, el intervalo entre partos (IEP y el Índice de Vaca (IV, de las hembras bovinas manejadas en los sistemas de producción de doble propósito del trópico bajo colombiano, se analizaron los registros productivos y reproductivos de 1.687 vacas registradas en la Asociación Colombiana de Criadores de Ganado en Doble Propósito (Asodoble, durante el periodo comprendido entre 1998 y 2007. Se empleó un modelo animal mixto que incluyó los efectos fijos del grupo contemporáneo (finca-sexo-época-año, la composición racial, y la duración de la lactancia como covariable; así como los efectos genéticos aleatorios del animal, el medio ambiente permanente y el residual. Las heredabilidades estimadas para IEP (0,04 y PD (0,11 fueron bajas, y moderadas para PL (0,35 e IV (0,24, respectivamente. La repetibilidad estimada para IEP fue baja (0,08, y para PL (0,41 e IV (0,31 moderada; en el caso de PD este valor fue igual a la heredabilidad (0,11. Las correlaciones genéticas y fenotípicas obtenidas entre PL y PD con respecto a IEP fueron positivas, y se determinó una asociación genética negativa entre PL y PD. Los resultados demostraron que el IV es un buen indicador, desde el punto de vista genético, de la eficiencia productiva y reproductiva de los animales manejados en estos sistemas productivos.

  16. Influencia del polimorfismo -866 G/A del gen de la UCP2 en población infantil obesa Influence of the -866G/A polymorphism of the UCP2 gene on an obese pediatric population

    Directory of Open Access Journals (Sweden)

    R. Zurbano

    2006-02-01

    Full Text Available OBJETIVO: En el presente estudio se pretende evaluar la prevalencia de la mutación -866 G/A del gen de la UCP2 y conocer su influencia sobre el fenotipo de los niños (11- 12 años navarros obesos. ANTECEDENTES Y ÁMBITO DEL ESTUDIO: La obesidad es una enfermedad de origen multifactorial, que puede estar relacionada con la presencia de mutaciones y polimorfismos en diversos genes candidatos. El gen de la proteína desacoplante UCP2 es uno de los más estudiados en relación con la obesidad porque parece participar en el control de la composición corporal y de diversos procesos metabólicos. Se han descrito tres polimorfismos en este gen: una inserción/deleción de 45 nucleótidos, un cambio del nucleótido guanina por adenina en la posición -866 y otro que origina un reemplazo de alanina por valina en el aminoácido 55. Según diferentes estudios, el alelo - 866G está relacionado con un mayor riesgo de desarrollar obesidad, aunque en la literatura aparecen resultados contradictorios en cuanto a esta asociación. SUJETOS: El estudio se llevó a cabo en 125 niños (52% varones obesos de 11-12 años de edad, seleccionados a través de los Servicios de Endocrinología Pediátrica de la Clínica Universitaria y del Hospital Virgen del Camino (Pamplona, obteniendo el consentimiento informado de acuerdo con la declaración de Helsinki. INTERVENCIONES: Tras verificar el cumplimiento de los criterios de inclusión se tomaron medidas antropométricas (peso, talla, IMC, pliegue tricipital y subescapular y se determinó el porcentaje de masa grasa por medio de impedancia bioeléctrica. Además se midieron los niveles plasmáticos de colesterol total, glucosa, insulina y leptina. Se procedió también a la extracción del ADN de las células sanguíneas de la serie blanca para determinar el genotipo mediante la técnica de PCR seguida de una digestión con BstUI y posterior visualización en un gel de agarosa con un 2% de bromuro de etidio. RESULTADOS

  17. Caracterización de la diversidad genética en naranja y comparación del polimorfismo de microsatélites amplificados al azar (RAMs usando electroforesis de poliacrilamida y agarosa

    Directory of Open Access Journals (Sweden)

    Muñoz Flores Jaime Eduardo

    2009-12-01

    Full Text Available Se compararon las eficiencias de tres métodos de electroforesis en agarosa y poliacrilamida, usando la cámara pequeña de DNA Sequencing System y cámara grande OWL Sequi-Gen Sequencing Cell, en la detección del polimorfismo en 21 accesiones de naranja (Citrus sinensis con empleo del cebador CGA. El gel de poliacrilamida dio mejor resolución de los productos amplificados vía PCR producidos por RAMs. Este permitió una mejor detección de bandas de ADN polimórficas, lo que facilitó la identificación de la variabilidad genética. La electroforesis en agarosa puede ser más conveniente en otras aplicaciones, debido al bajo costo y fácil aplicación. El estudio de diversidad genética en naranja usando microsatélites RAMs diferenció 51 accesiones en siete grupos con 0.75 de similaridad y 0.25 de heterocigosidad, lo que revela bajo polimorfismo genético. La técnica RAMs permitió agrupar las accesiones en Comunes o Blancas, Navel y Pigmentadas o Sanguinas.

  18. Efecto del Polimorfismo del Intrón 6 del Gen LTF Bovino con Algunas Enfermedades de Alta Incidencia en la Producción Lechera Effect of the Polymorphism in the Intron 6 of the Bovine LTF Gene with Some Diseases of High Incidence in Dairy Production

    Directory of Open Access Journals (Sweden)

    Nancy Rodríguez Colorado

    2012-06-01

    Full Text Available Resumen. El objetivo de la investigación fue determinar la asociación del polimorfismo (C/T del intrón 6 del gen de la bLTF, con la incidencia de algunas enfermedades en ganado lechero. Para ello fueron observadas 482 vacas Holstein, durante al menos una lactancia, determinando la incidencia de algunas de las enfermedades mas importantes en la ganaderia de leche. La genotipificación para el polimorfismo de bLTF, se hizo usando la técnica de PCR-RFLP con DNA extraído de sangre periférica mediante la técnica de salting out. Para estudiar la asociación de los alelos del gen LTF, se utilizó el alelo B como control y se determinó el Odds Ratio (OR. Como resultados se obtiene que las frecuencias de los alelos A y B para el gen bLTF fueron 0,78 y 0,22 respectivamente. Las frecuencias genotípicas fueron 0,60, 0,36 y 0,04 para AA, AB y BB respectivamente. Una asociación altamente significativa (P≤0,001 fue hallada entre la incidencia de mastitis clínica y el polimorfismo del gen LTF. Los individuos portadores del alelo B tuvieron una probabilidad de incidencia de mastitis dos veces superior a los portadores del alelo A (OR=2.115 IC del 95%, 1.392-3.213. En el caso de la mastitis subclínica la probabilidad de incidencia fue de 1,6 veces más en los portadores del alelo B, con un OR=1.637 IC del 95% 1.184-2.264. Para la incidencia de enfermedades metabólicas, reproductivas, respiratorias, parasitarias, cáncer y cojeras, no se halló diferencia significativa (P>0,05 y se encontró asociación del alelo B del polimorfismo del intrón 6 del gen bLTF con la incidencia de mastitis clínica y subclínica.Abstract. The research objective was to determine the association of polymorphism (C/T of intron 6 bLTF gene, with the incidence of some diseases on dairy cattle. A total of 482 Holstein cows located in different herds in the department of Antioquia - Colombia, were used to follow the incidence of disease, for at least a full lactation

  19. Caracterización de la región cromosómica 15q11-q13 del genoma humano. Variabilidad genómica en el autismo e identificación de ncRNAs

    OpenAIRE

    Cerrato Rivera, Celia

    2007-01-01

    La tesis doctoral con título "Caracterización de la región cromosómica 15q11-13 del genoma humano. Variabilidad genómica en el autismo e identificación de ncRNAs" se basa en el estudio de la región cromosómica 15q11-q13, centrándonos en los aspectos de la variabilidad genómica y su significado funcional. En la primera parte del estudio buscamos reordenamientos de 15q11-q13 en pacientes con autismo, mediante la genotipación de marcadores microsatélites cubriendo dicha región, y definimos una d...

  20. Arquitectura cel.lular i transducció del senyal: El gen CDI/TESKI com a modulador de sevenless.

    OpenAIRE

    Sesé Faustino, Marta

    2007-01-01

    [cat] Durant el desenvolupament dels organismes multicel·lulars els fenòmens de transducció de senyals estan íntimament lligats als mecanismes de comunicació cèl·lula-cèl·lula. En el marc d'un teixit epitelial, la formació i manteniment de l'arquitectura cel·lular i dels contactes que estableixen les cèl·lules són processos altament regulats. Una de les vies de senyalització més coneguda, i alhora estudiada, és la via de Ras/Raf/MAPK. L'activació d'aquesta via es dóna per lligands externs a l...

  1. Paleogeoformas lacustres en los lagos Musters y Colhué huapí, su relación genética con un paleolago Sarmiento previo, centro-sur del Chubut

    Directory of Open Access Journals (Sweden)

    Emilio F González Díaz

    2014-09-01

    Full Text Available El reconocimiento de paleogeoformas lacustres acrecionales y de erosión en la costa este del lago Musters, como así también, en la costa este del adyacente lago Colhué Huapí y fuera del ámbito lagunar al sur del cerro Puricelli en posiciones altimétricas similares, permitió relacionarlas genéticamente a nivel regional, con un cuerpo lagunar previo, aquí denominado Paleolago Sarmiento; generado por la inundación de la depresión preexistente del bajo de Sarmiento, luego de la captura y desvío de las aguas del río Senguerr. Se estimó un máximo nivel para el paleolago Sarmiento de unos 60 m sobre el nivel actual del lago Musters. Las geoformas acrecionales que muestran un arreglo subparalelo y altimetrías declinantes, constituyen un testimonio del progresivo pero intermitente descenso del nivel del paleolago. Se reconocieron tramos de paleocordones en las costas orientales del lago Musters alejados del ámbito del lago en una masiva concentración y con excelente grado de conservación al oeste del bajo del Avestruz; en la Bahía Costa al noroeste del lago Musters; en la costa oriental del lago Colhué Huapí, y lejos del ámbito lacustre, al sur del cerro Puricelli. También paleoacantilados en posiciones más elevadas son relevantes en el extremo austral de la península Baya. Se estima que la extensión del paleolago Sarmiento, en la depresión del bajo de Sarmiento, alcanzó los 4300 km². La concentración de las paleogeoformas sobre las costas orientales es relacionada con la dinámica del oleaje, inducido localmente por intensos y dominantes paleovientos de dirección oeste.

  2. Diagnóstico del tratamiento del género en los documentos de centro-, diseño y aplicación de la escala observacional Val-Gen

    Directory of Open Access Journals (Sweden)

    María Teresa PADILLA

    2009-11-01

    Full Text Available RESUMEN: Este artículo presenta el proceso de diseño y aplicación de la escala observacional Val-Gen, a través de la cual se pretende valorar en qué grado los diferentes documentos escolares (proyecto educativo, proyecto curricular, plan de orientación y acción tutorial, ROF, plan anual y memorias anuales recogen los valores de género e integran la educación para la igualdad de oportunidades. Se describe, por tanto, el marco conceptual a partir del cual se elaboró dicha escala, la estructura de ésta y el proceso a través del cual se confeccionó. Se discuten, asimismo, los resultados de una primera aplicación a los documentos escolares de dos centros de enseñanza en la que participaron 12 observadores/as.ABSTRACT: In this article, the process of design and application of the observational scale named Val-Gen is presented and described. This scale pretends to assess the extent which gender values and igual opportunities are integrated in several school papers (such as educational project, curriculum project, guidance programs, etc.. The scale conceptual framework, structure and process by means of which it has been designed, are described. Also, results from the scale application through two schools and by 12 observers are presented and discussed.RÉSUMÉ: Cet article présente le procès de dessin et application de l'escale Val- Gen, avec laquelle on prétende évaluer le degré avec lequel les différents documents écoliers (projet éducatif, projet du curriculum, plan d'orientation et action du tuteur, ROF, plan annuel et mémoires annuels recueillent les valeurs du genre, et composent l'éducation pour l'égalité des opportunités. On décri ainsi le marc conceptuelle, restructure et le procès de confection de l'escale, et en même temps les résultats d'une première aplication en deux centres d'enseignement avec la participation de 12 observateurs.

  3. Orígen del deterioro del medio ambiente en Taiwan: Desajuste entre el modelo de desarrollo y la dotación de recursos naturales

    OpenAIRE

    Antonio Rodríguez Carmona

    1994-01-01

    De igual modo que el análisis de los llamados nuevos países industriales asiáticos (NPIAs) abre interesantes matices en el campo de las teorías del desarrollo, poniendo en duda la capacidad explicativa de los enfoques tanto dependentista como neoclásico, el estudio del medio ambiente en esos países aporta visiones nuevas y enriquecidas en lo referente a sus modelos de desarrollo. En este trabajo se aborda el caso de Taiwan, cuya crisis ambiental se ha acelerado espectacularmente durante el de...

  4. Estudio del rol funcional del gen RHBDD2 en líneas celulares de cáncer de mama

    OpenAIRE

    Canzoneri, Romina

    2016-01-01

    La superfamilia Romboide reúne un conjunto de genes que codifican para proteínas de transmembrana multipaso que se encuentran conservadas evolutivamente en todas las ramas del árbol filogenético. Estas proteínas se agrupan según su función en: serina-proteasas y pseudoproteasas. En los seres humanos se reconocen 14 genes romboides, los cuales se encuentran involucrados en diversos procesos biológicos tales como: respuesta al estrés del retículo endoplasmático, apoptosis, proliferación y migra...

  5. Influència dels efectes genètics i ambientals en el perfil sensorial de dues poblacions de la varietat de mongeta de Castellfolit del Boix

    OpenAIRE

    Garrober Calaf, Montserrat

    2014-01-01

    This study deals of with the influence of genetic and environmental effects on the beans named "Castellfollit del Boix" in order to approach to the bean idiotip and to get a geographic frame. The aims are: to study and characterize the variability sensory of four bean genotypes, which two of them are from Castellfollit del Boix (El Bages), all grown in three different locations; to make an estimate of the environmental influence on the sensory value; to define the sensory profile of the beans...

  6. Expresión transitoria del gen GUS en caña de azúcar usando Agrobacterium tumefaciens Transient gene expression in sugarcane using Agrobacterium tumefaciens

    Directory of Open Access Journals (Sweden)

    Martha Liliana Bonilla Betancourt

    2008-10-01

    Full Text Available En el estudio se desarrolló una metodología de transformación genética mediante Agrobacterium tumefaciens en cultivares colombianos de caña de azúcar. La transformación se evaluó mediante la expresión del gen GUS. Callos embriogénicos y explantes meristemáticos de los genotipos CC85-92, CC84-75 y CC87-505 se transformaron usando tres cepas (AGL-1, LBA4404 y EHA105 con el plásmido pCambia 1305.2 y dos (EHA105 y LBA4404 con pCambia 2301. Se usó el medio de infiltración (IM con acetosiringona y se evaluó el tiempo de cocultivo y la densidad óptica de la bacteria al momento de la inducción. Los genotipos mostraron respuesta diferencial con las combinaciones cepa-plásmido: obtuvieron mayor expresión del gen GUS cuando el genotipo CC85-92 se transformó con la cepa AGL-1-pCambia 1305.2. CC84-75 y CC87-505 mostraron mayor expresión cuando se transformaron con la cepa EHA105-pCambia 1305.2. Mayor eficiencia en la expresión se obtuvo cuando la bacteria se indujo en IM después de siete días de cocultivo y cuando la densidad óptica de la bacteria fue de 0.2(600nm al momento de la inducción. Se demostró superioridad de los explantes en la eficiencia de transformación.The aim of the present study was to develop a transformation method mediated by Agrobacterium in Colombian cultivars of sugarcane. Transformation was evaluated in each step through transient GUS expression. Embryogenic calli and meristematic explants of CC85-92, CC84-75 y CC87-505 cultivars, were transformed using Agrobacterium tumefaciens AGL-1, LBA 4404 and EHA 105 strains, harboring pCambia 1305.2 plasmid. Furthermore, strains LBA 4404 and EHA 105 harboring pCambia 2301 were also tested. Bacterian activator medium, named infiltration media (IM with acetosyringone was used. Co-cultivation time and bacteria optical density before induction were tested. Sugarcane cultivars evaluated showed differential response to different strain-plasmid combinations, obtaining

  7. Estructura genética e historia demográfica del Jaguar ( Panthera onca en Colombia: Contraste entre marcadores moleculares y datos craneométricos

    Directory of Open Access Journals (Sweden)

    Payán-Esteban C.

    2001-06-01

    Full Text Available Se estudio la estructura genética de los jaguares en Colombia (n=49, e igualmente, se com-pararon los resultados moleculares obtenidos con otros 16 jaguares procedentes de Guatemala,Perú, Bolivia y zona central de la Amazonía brasileña. Para ello se emplearon 18 marcadores microsatélites (STRPs diseñados para gato doméstico. Estos marcadores fueron Fca 01, 08, 24,43, 45, 70, 94, 96, 126, 136, 176, 200, 225, 251, 290, 294, 391 y 506, localizados en losdiferentes cromosomas felinos. Mediante tests exactos utilizando cadenas de Markov y elmétodo de Fisher se determinó un fuerte exceso de homocigotos en todos los niveles jerárquicosanalizados, lo cual pone en evidencia la posible importancia del efecto Wahlund en esta especiey la no existencia de correspondencia con las subespecies morfológicamente propuestas en elpasado. Se calculó también el asignamiento poblacional de los jaguares analizados, a las dossubespecies de jaguares presentes en Colombia mediante el método de verosimilitud y con elmétodo basado en distancias con los procedimientos “as is” y “leave one out”.

  8. Asociación del polimorfismo TaqI del gen del receptor de la vitamina D con la densidad mineral ósea en mujeres mexicanas jóvenes Association of polymorphism TaqI of vitamin de receptor with bone mineral density in young mexican women

    Directory of Open Access Journals (Sweden)

    Z. Jiménez-Salas

    2012-10-01

    Full Text Available Introducción: La osteoporosis es una enfermedad multifactorial que se caracteriza por una baja densidad mineral ósea (DMO. Se ha asociado a la osteoporosis y la presencia de fracturas en mujeres postmenopáusicas con el polimorfismo TaqI del gen del receptor de la vitamina D (VDR. Objetivo: Analizar la asociación de los diversos genotipos del polimorfismo TaqI del gen VDR con la DMO en mujeres mexicanas jóvenes. Métodos: A 150 mujeres de 19 a 29 años de edad se les realizó una absorciometría dual de rayos X para determinar su densidad mineral ósea total (DMOt y dual de fémur (DMOdf. A partir de sangre periférica se extrajo DNA para determinar el genotipo del polimorfismo TaqI del gen VDR. Los datos obtenidos se analizaron mediante regresión lineal simple y ANOVA. Resultados: El promedio de la DMOt fue de 1,096 ± 0,064 g/cm², la DMOdf promedio fue de 0,960 ± 0,107 g/cm². La frecuencia de los genotipos del polimorfismo TaqI fue de 57% (TT, 37% (Tt y 6% (tt, la frecuencia por alelos fue de 75% (T y 25% (t. El análisis estadístico demostró que no existe asociación entre la DMO y los genotipos del polimorfismo TaqI del gen VDR. Discusión y Conclusiones: Los resultados sugieren que pueden existir otros factores diferentes del polimorfismo TaqI del gen VDR que contribuyan a la DMO en mujeres jóvenes del norte de México.Introduction: Osteoporosis is a multifactorial disease characterized by a low bone mineral density (BMD. Osteoporosis and the occurrence of fractures in postmenopausal women have been associated to the TaqI polymorphism in the vitamin D receptor (VDR gene. Objective: To analyze the association of the different genotypes of TaqI polymorphism of the VDR gene with BMD in young Mexican women. Methods: Dual X-ray absorptiometry was carried out in 150 women aged 19 to 29 years in order to determine their total bone mineral density (tBMD and dual BMD of the femur (dfBMD. DNA was extracted from peripheral blood to

  9. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano

    Directory of Open Access Journals (Sweden)

    A. P. Galeano

    2010-06-01

    Full Text Available Con el objetivo de estimar los componentes de varianza, las heredabilidades, repetibilidadesy correlaciones genéticas y fenotípicas para la producción de leche por lactancia(PL, el peso al destete (PD, el intervalo entre partos (IEP y el Índice de Vaca (IV,de las hembras bovinas manejadas en los sistemas de producción de doble propósitodel trópico bajo colombiano, se analizaron los registros productivos y reproductivosde 1.687 vacas registradas en la Asociación Colombiana de Criadores de Ganado enDoble Propósito (Asodoble, durante el periodo comprendido entre 1998 y 2007. Seempleó un modelo animal mixto que incluyó los efectos fijos del grupo contemporáneo(finca-sexo-época-año, la composición racial, y la duración de la lactancia comocovariable; así como los efectos genéticos aleatorios del animal, el medio ambientepermanente y el residual. Las heredabilidades estimadas para IEP (0,04 y PD (0,11fueron bajas, y moderadas para PL (0,35 e IV (0,24, respectivamente. La repetibilidadestimada para IEP fue baja (0,08, y para PL (0,41 e IV (0,31 moderada; en el casode PD este valor fue igual a la heredabilidad (0,11. Las correlaciones genéticas y fenotípicasobtenidas entre PL y PD con respecto a IEP fueron positivas, y se determinóuna asociación genética negativa entre PL y PD. Los resultados demostraron que el IVes un buen indicador, desde el punto de vista genético, de la eficiencia productiva yreproductiva de los animales manejados en estos sistemas productivos.

  10. Mejoramiento genético del frijol rojo y negro mesoamericano para Centroamérica y El Caribe

    Directory of Open Access Journals (Sweden)

    Juan C. Rosas

    2000-01-01

    Full Text Available La producción de frijol en Centroamérica es llevada a cabo mayormente en laderas de suelos marginales, limitada por diversos factores bióticos y abióticos. Más de 350,000 t de este grano se producen en cerca de 0,5 millones de hectáreas, con rendimientos promedios de 678 kg/ha. La mayoría de los productores de frijol utilizan bajos insumos y muy pocas fincas están mecanizadas. El autoconsumo es alto; sin embargo, una alta proporción de este grano es comprado por intermediarios. En Honduras, el frijol es el sétimo cultivo en valor económico y es el de mayor rentabilidad entre el maíz, arroz y sorgo. Las dos clases comerciales más importantes en Centroamérica son el frijol rojo y negro pequeños (raza Mesoamérica. El mejoramiento de estos tipos de frijol se ha enfocado en el desarrollo de resistencia a enfermedades (mosaico común, mosaico dorado, antracnosis, mancha angular, roya, mustia hilachosa y bacteriosis común e insectos (principalmente picudo de la vaina; y tolerancia a baja fertilidad, sequía y calor. Programas adecuados de hibridación, evaluación y selección son usados para el desarrollo de cultivares con resistencia múltiple, alto rendimiento, buena adaptación y aceptación comercial. La ampliación de la base genética se obtiene usando fuentes de germoplasma Andino y Mesoamericano en la etapa de hibridación. La selección simultánea por varios caracteres y pruebas multilocalidades son utilizadas. Los viveros y ensayos de adaptación y rendimiento de líneas avanzadas son distribuídos a países de Centroamérica, México, y El Caribe. Las pruebas y validaciones en fincas y la liberación de variedades, son efectuadas por los programas nacionales de frijol de los países miembros de PROFRIJOL, en colaboración con el Zamorano, CIAT y el Bean/Cowpea CRSP

  11. Evaluación de la presencia del gen mer A implicado en la detoxificación de mercurio a partir de actinomicetos nativos del humedal de La Conejera

    Directory of Open Access Journals (Sweden)

    Rueda Carolina

    2009-12-01

    Full Text Available Se aislaron diez cepas de actinomicetos nativos del humedal La Conejera a partir de muestras de sedimento y agua, con el fin de determinar la capacidad de resistencia y detoxificación de mercurio, evaluando la presencia del gen mer A involucrado en el proceso. La prueba de resistencia fue realizada mediante un test de sensibilidad tomando concentraciones desde 3,68x10-3 mM hasta 10 mM de HgCl2. Se realizaron curvas de crecimiento de 192 h para las cepas resistentes al mercurio, en un medio suplementado con 0,01 mM y 0,05 mM de HgCl2, realizando una fermentación discontinua y midiendo el crecimiento por la técnica de peso seco. A partir de estos resultados se determinó un tiempo de adaptación de 24 h y una producción máxima de biomasa de 2,72 g·L-1 a la hora 72. Paralelamente, se realizó la secuenciación de los genes de resistencia al mercurio de Streptomyces lividans 1326, por medio del diseño de los oligonucleótidos capaces de amplificar el extremos 3’ del gen mer A, codificador de la enzima mercurio reductasa. Se optimizaron las condiciones de amplificación por PCR para obtener un producto amplificado de 686 pb aproximadamente. Finalmente, se realizó una electroforesis en campo pulsado comprobando la presencia de plásmidos en la cepa KH7 con tamaños aproximados de 50, 90 y 300 Kb, no integrados al cromosoma y posiblemente asociados a la resistencia presentada frente al metal. Palabras clave: Streptomyces; mercurio-resistencia; gen mer A; plásmidos; humedales. Abstract Ten native actinomycete strains were isolated from water and sediment samples collected in La Conejera wet-lands to assess mercury resistance and detoxification ability for evaluating the presence of the mer A gene involved in that process. Sensitivity assays were performed using 3.68 x 10-3 mM to 10 mM HgCl2 concentrations. Growth curves were generated for each resistant strain after 192 h in discontinuous fermentation in medium supplemented with 0.01 mM and 0

  12. Mutación de novo en el gen BTK en agammaglobulinemia ligada a X. Reporte de un caso del estado Mérida, Venezuela

    Directory of Open Access Journals (Sweden)

    Liliana Aboultaif Aboultaif

    2013-09-01

    Full Text Available Las inmunodeficiencias primarias (IDPs son un conjunto de enfermedades caracterizadas por defectos en el desarrollo y/o función del sistema inmune debido a anomalías genéticas en cualquiera de sus componentes. Las deficiencias de anticuerpos son las IDPs más comunes y dentro de estas la agammaglobulinemia congénita representa el 10%, siendo un 85% ligada al cromosoma X, existiendo también formas autosómicas recesivas. La agammaglobulinemia ligada a X (ALX consiste en la ausencia casi absoluta de linfocitos B, ocasionando incapacidad de sintetizar anticuerpos y una alta susceptibilidad a la adquisición de infecciones, con respuesta a vacunas disminuida o ausente. Se presenta el caso de un escolar masculino de 8 años de edad quien desde los 5 meses presentó infecciones a repetición principalmente por bacterias extracelulares encapsuladas. Estudios paraclínicos revelaron hipogammglobulinemia persistente con subpoblación de linfocitos B muy disminuida y conservación de linfocitos T en sangre periférica. El estudio molecular reportó la mutación R525X en el exón 16 del gen TirosinKinasa de Bruton (BTK en el paciente y su madre, más no en la abuela, lo que confirmó el diagnóstico de ALX y permitió concluir que se trataba de una mutación de novo en la madre. Actualmente recibe tratamiento con Inmunoglobulina por vía endovenosa, disminuyendo la frecuencia y severidad de episodios infecciosos. El diagnóstico precoz a través del reconocimiento de las señales de alarma de las IDPs, junto al tratamiento adecuado y vigilancia constante constituyen la mejor herramienta para el adecuado manejo de los pacientes con IDPs, logrando una disminución de los procesos infecciosos e inflamatorios y sus secuelas, así como también mejorar la calidad de vida y supervivencia. De novo mutation in BTK gene in X-linked agammaglobulinaemia. A case report in Mérida, Venezuela Abstract The Primary Immunodeficiencies (PIDs are a group of diseases

  13. Evaluación de la diversidad genética del género Capsicum sp. presente en los Departamentos de Vaupés, Guainía y Putumayo por medio de Isoenzimas

    Directory of Open Access Journals (Sweden)

    Andrade Pérez Luis Eugenio

    2000-06-01

    Full Text Available El género Capsicumcomprende 25 especies de las cuales cinco han sido domesticadas y dadoorigen a numerosos cultivares. Sin embargo, la alta selección a la que está siendo sometido elgénero podría llevarla a su erosión genética, por ello se requiere la introducción de nuevogermoplasma que suministre una fuente de diversidad genética, para el mejoramiento de loscultivares comerciales. Dicha fuente se debe encontrar en aquellas zonas donde las especiessilvestres, cercanas y/o relacionadas se distribuyen, ya que estas áreas funcionan como reser-vorio de genes y es allí donde se encuentran variedades con acervos genéticos amplios; fuentesgenéticas para resistencia a enfermedades, alta productividad y calidad nutricional. Teniendoen cuenta lo anterior la región amazónica colombiana tiene un valor potencial en la exploraciónde germoplasma importante para el género Capsicum, por ser considerada como el lugar deorigen del complejo silvestre annuum-chinense-frutescens. Así mismo se requiere de unaevaluación urgente de la diversidad genética de la región amazónica, antes de que se agotela disponibilidad de material vivo debido al proceso de deforestación. Con el propósito devalorar la diversidad genética presente del género Capsicum, en la Amazonía colombiana seutilizó la técnica de electroforésis de isoenzimas para los materiales de Ají colectados enhuertos y chagras indígenas de los departamentos de Vaupés, Guainía y Putumayo. Para laevaluación se utilizaron cinco isoenzimas polimórficas: alfabetaEST (alfabeta esterasa, GOT(glutamato oxaloacetato transaminasa, PRX (peroxidasa, 6PGDH (6-fosfoglucona-todehidrogenasa y ME (enzima málica. Con los resultados de presencia-ausencia de bandasse construyeron fenogramas con el índice de similaridad de Dice o Nei (1945 por mediodel programa estadístico NTSYS (Numerical Taxonomy and Multivariate Analisys System. Deacuerdo a los resultados se pudo establecer la alta variabilidad

  14. Caracterización genómica del microalga Trebouxia sp. TR9 aislada del liquen Ramalina farinacea (L.) Ach. mediante secuenciación masiva

    OpenAIRE

    Martínez Alberola, Fernando

    2015-01-01

    Los líquenes son complejas entidades simbióticas originadas por asociaciones cíclicas e interacciones positivas de organismos muy diferentes, un hongo heterotrófico y uno o varios “fotobiontes” autótrofos fotosintéticos, tanto algas verdes unicelulares, como cianobaterias o ambos. Además, comunidades específicas de bacterias aparecen como simbiontes obligados de líquenes. En todos los talos del liquen Ramalina farinacea (L.) Ach., coexisten las dos mismas especies de algas Trebouxia (T. james...

  15. Genómica funcional del transporte y asimilación del nitrógeno en plantas de interés forestal

    OpenAIRE

    Castro Rodríguez, Vanessa Viviana

    2014-01-01

    El N es un componente esencial de aminoácidos, ácidos nucleicos, fitohormonas y clorofilas, entre otras biomoléculas, y por lo tanto un elemento clave para el crecimiento y desarrollo de las plantas. Para la asimilación primaria, las plantas necesitan sistemas de captación del N, que en la mayoría de los casos se lleva a cabo mediante proteínas transmembrana llamadas transportadores. Una vez que el N es incorporado se asimila mayoritariamente mediante el ciclo de la glutamina sintetasa (GS; E...

  16. Relación de la transición A G en la posición –21 del intrón 10 del gen NCF-2 con la expresión de la proteína p67-phox

    Directory of Open Access Journals (Sweden)

    Pablo Patiño

    2001-04-01

    Full Text Available

    El sistema NADPH oxidasa de las células fagocíticas es esencial
    para la producción de metabolitos reactivos de oxígeno que tienen
    acción microbicida importante. La proteína p67-phox, codificada por
    el gen NCF-2, tiene un papel importante en este sistema (1. Previamente nuestro grupo reportó algunos cambios nucleotídicos en regiones no codificadoras del gen NCF-2. Uno de estos corresponde a la
    transición de una adenina (A por una guanina (G en el intrón 10, 21
    nucleótidos antes del inicio del exón 11, sitio importante para la eliminación de este intrón y unión de los exones 10 y 11 durante el procesamiento del ARNm.
    En este proyecto se pretende determinar si existe alguna modificación
    en la expresión de p67-phox inducida por la transición A -►G en la posición -21 del intrón 10 en el gen NCF-2.

     

     

  17. Genética de las poblaciones virales y transmisión del dengue Population genetics of dengue virus and transmission of dengue fever

    Directory of Open Access Journals (Sweden)

    Jorge Falcón-Lezama

    2009-01-01

    Full Text Available El comportamiento endémico de la fiebre por dengue en México durante los últimos cinco años ha generado gran preocupación en todos los sectores relacionados con la salud. Los esfuerzos para interrumpir la transmisión se han concentrado en el control vectorial; sin embargo, al margen de la efectividad de las intervenciones, resulta importante establecer con claridad cuáles son los elementos determinantes de la transmisión del dengue para establecer medidas de control y vigilancia eficaces. En cuanto a los determinantes moleculares de la transmisión, mucho se ha avanzado con el desarrollo de la genómica y la bioinformática. Esta revisión pretende ofrecer un panorama de los desarrollos más recientes en ese aspecto con un énfasis en la situación de México.The endemic behavior of dengue fever in Mexico during the past five years is of major concern to every sector related with public health and the effort to control the transmission has been focused on vector control. However, regardless of the effectiveness of the intervention measures it is important to know which elements determine dengue transmission. With regard to the molecular basis for dengue transmission, a great deal of progress has been made due to the introduction of genomic and bioinformatic approaches. The goal of this review is to describe the most recent developments in this area with emphasis on the Mexican situation.

  18. Clinical and ethical implications of genetic counselling in familial adenomatous polyposis Implicaciones clínicas y éticas del consejo genético en la poliposis adenomatosa familiar

    Directory of Open Access Journals (Sweden)

    A. Fernández-Suárez

    2005-09-01

    écnicas de secuenciación que detectan mutaciones en la línea germinal del gen APC (adenomatous poliposis coli. El abordaje del diagnóstico genético en familias con PAF seguidas previamente en la consulta de digestivo, ha permitido poner de manifiesto tanto las ventajas como los inconvenientes de esta forma de acercarnos a la enfermedad y a los pacientes. La revelación de los resultados de la prueba genética comporta importantes problemas en la práctica clínica, que afectan tanto al ámbito sanitario, como al ético y legal, además de las implicaciones familiares, laborales y sociales que el conocimiento del status genético puede tener para el paciente. El análisis genético es poco frecuente en la práctica clínica habitual, lo que conlleva errores tanto en la interpretación de los resultados obtenidos como durante el proceso del consejo genético. Son necesarias unidades multidisciplinares especializadas en el manejo de pacientes con PAF, en las cuales se realice un análisis y un consejo genético adecuado, permitiendo así una atención personalizada. La creación de registros de PAF y la protocolización de este proceso sanitario debería optimizar el manejo de estos pacientes y sus familias.

  19. GEN 105 Courses/sanptutorial

    OpenAIRE

    ncbdf

    2015-01-01

    GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion Questions GEN 105 Assignment: University Library Article Search GEN 105 Chec...

  20. Parámetros y valores genéticos para características de composición corporal, área de ojo del lomo y grasa dorsal medidos mediante ultrasonido en la raza Brahman

    Directory of Open Access Journals (Sweden)

    A. Jiménez

    2010-12-01

    Full Text Available El ganado Brahman en Colombia es el de mayor participación como raza pura paraproducción de carne, y tiene gran influencia en el ganado comercial. Hasta el momento,Asocebu ha realizado evaluaciones genéticas para características de crecimiento,pero aún no se han realizado para características de la canal. El objetivo de este trabajofue determinar parámetros genéticos (heredabilidades y correlaciones, y valores genéticos(DEP para área de ojo del lomo (AOL, grasa dorsal (GD, profundidad delmúsculo glúteo medio (PMGM y grasa del anca (GA. Fueron medidos por medio deultrasonido un total de 934 animales puros, hijos de 164 toros que se encontraban enun rango de edad de 15 a 18 meses. Para los análisis se crearon grupos contemporáneosteniendo en cuenta la época, el sexo y el manejo alimenticio. Se realizó un análisis univariadousando un modelo reproductor, teniendo en cuenta el grupo contemporáneo(animales del mismo sexo, de la misma época y en el mismo manejo alimenticio, laedad fue tomada como covariable y la finca fue incluida en el modelo. Las heredabilidadesfueron 0,37 ± 0,11; 0,29 ± 0,10; 0,26 ± 0,10 y 0,11 ± 0,09 para AOL, GD,PMGM y GA respectivamente. Las DEP para AOL variaron de -2,84 a 3,43; para GDde -0,372 a 0,235; para PMGM de -0,187 a 0,235, y para GD de -0,176 a 0,298. Lascorrelaciones genéticas fueron positivas y altas indicando que la selección por musculaturano afecta el grado de acabado. Este trabajo mostró que en ganado Brahman puroexiste variación genética para las características medidas por ultrasonido relacionadascon la canal, lo cual permitirá tenerlas en cuenta en el programa de mejoramientogenético de la raza Brahman en Colombia.

  1. Algoritmos genéticos

    OpenAIRE

    Martínez Páez, José Jesús

    2004-01-01

    Esta técnica se basa en el concepto de evolución a través de selección de los mejores individuos, y de los operadores genéticos de selección, reproducción y mutación. Se trata entonces, de definir un espacio de soluciones para el problema que se quiere solucionar, en una cadena de bits. A esto se le conoce como la codificación del cromosoma, donde cada bit, denominado gen  tiene cierto significado especial. Inicialmente el algoritmo genera al azar muchas de estas cadenas o seres, es decir, un...

  2. Relación del polimorfismo TaqI del gen del receptor de la vitamina D con la lepra lepromatosa en población mexicana Association between the TaqI polymorphism of Vitamin D Receptor gene and lepromatous leprosy in a Mexican population sample

    Directory of Open Access Journals (Sweden)

    Jesús Salvador Velarde Félix

    2009-02-01

    Full Text Available OBJETIVO: Determinar la relación del polimorfismo TaqI del gen del receptor de la vitamina D (RVD con la lepra lepromatosa (LL en individuos originarios de Sinaloa, México. MATERIAL Y MÉTODOS: Se amplificó un fragmento de 740 pb del gen RVD en muestras de ADN de 71 pacientes con LL y 144 controles en el Hospital General de Culiacán durante el periodo 2004-2007. El polimorfismo se identificó mediante la endonucleasa TaqI. RESULTADOS: Se observó un aumento de relevancia estadística del genotipo TT en pacientes con LL en comparación con los controles (p= 0.040; RM= 1.82. CONCLUSIÓN: Se demuestra un nexo entre el genotipo TT y la susceptibilidad a la LL.OBJETIVE: To establish the association of the vitamin D receptor gene TaqI polymorphism with lepromatous leprosy (LL in individuals from Sinaloa, Mexico. MATERIAL AND METHODS: A 740 bp fragment was amplified from the VDR gene in DNA samples of 71 patients with LL and 144 controls in the Hospital General de Culiacán during 2004-2007. Polymorphism was identified through TaqI endonuclease. RESULTS: A significant increase in the genotype TT of the VDR gene was observed in patients when compared to controls (p = 0.040; OR = 1.82. CONCLUSIONS: Our data support the association between the TT genotype and susceptibility to LL in this Mexican population.

  3. Anticanon de la identidad : Subjetividades "identitarias" sexo-genéricas y sus sentidos como heurística de la construcción hegemónica de la cultura argentina del siglo XX

    OpenAIRE

    Rapisardi, Flavio

    2015-01-01

    La tesis aborda de manera histórica la construcción de las subjetividades genérico-sexuales, étnicas y de clase como pivotes en la circulación de la hegemonía. A partir del análisis de distintos materiales (ficción, documentos políticos, reportajes y volantes) se configura la complejidad de la construcción hegemónica en nuestro país.

  4. Identificación de biotipos de Spodoptera frugiperda (Lepidoptera: Noctuidae) en los departamentos de Córdoba, Meta, Tolima y Valle del Cauca mediante el gen mitocondrial Citocromo Oxidasa I (COI) y la región nuclear FR

    OpenAIRE

    Cano Calle, Daniela

    2015-01-01

    Resumen: Spodoptera frugiperda (J. E. Smith, 1797) es un insecto plaga del maíz, arroz, algodón, sorgo y pastizales. Presenta dos formas biológicas (biotipos o razas) (maíz y arroz) que son idénticas morfológicamente, pero que difieren en varios aspectos tales como su composición genética, su aislamiento reproductivo y su tolerancia a insecticidas y controladores biológicos. En este trabajo se realizó la identificación molecular de estos biotipos a partir de larvas recolectadas en cultivos de...

  5. Estudio genético de la estructura poblacional y conectividad de dos corales endémicos del Mediterráneo: Astroides calycularis (Pallas, 1766) y Cladocora caespitosa (Linnaeus, 1767)

    OpenAIRE

    Casado-Amezúa, P.

    2012-01-01

    [ES] El objetivo general de la presente tesis es determinar la estructura genética y el alcance de la conectividad de las poblaciones de dos corales escleractinios del Mediterráneo, Astroides calycularis (Pallas, 1766) y Cladocora caespitosa (Linnaeus, 1767). Estos procesos están generalmente ligados a diferentes características biológicas de las especies, tales como la densidad y distribución de las poblaciones, la fecundidad, el éxito reproductor, el tipo de desarrollo larvario, la capacida...

  6. Exploración de la variabilidad genética del maracuyá (Passiflora edulis f. flavicarpa Degener como base para un programa de fitomejoramiento en Colombia

    Directory of Open Access Journals (Sweden)

    John Ocampo

    2013-12-01

    Full Text Available El maracuyá es uno de los principales frutales del Neotrópico y en Colombia existen cerca de 6000 ha cultivadas con esta fruta, con una producción de 90,000 t/año. No obstante este potencial, los cultivos presentan graves problemas fitosanitarios y degeneración genética, lo que se manifiesta por una reducción de la vida útil de la plantación. El objetivo de esta investigación fue evaluar el grado de variabilidad genética del maracuyá cultivado en Colombia como base para un programa de fitomejoramiento. Las recolecciones se realizaron en los departamentos de Antioquia, Caldas, Cauca, Huila, Tolima y Valle del Cauca mediante una selección masal participativa con los productores. En cada cultivo, se seleccionaron diez frutos al azar (calidad extra de las plantas más sobresalientes por productividad y sanidad, en las cuales se registró la incidencia de insectos plaga y enfermedades. Los frutos fueron caracterizados con 11 variables fisicoquímicas y analizados mediante la descomposición de la varianza (univariado y el análisis de clasificación (neighbour joining. Los resultados mostraron que los trips (Neohydatothrips spp. y la virosis (SMV son los problemas fitosanitarios que más afectan el cultivo en los sitios del estudio. El análisis univariado del fruto mostró un porcentaje de variabilidad promedio total de 14.31% (CV, destacándose los pesos de la cáscara (20.53% y de la semilla (20.47%. Tomando en cuenta los parámetros de calidad (°Brix y %pulpa + semilla se identificaron ocho accesiones élite provenientes de Caldas, Valle del Cauca y Antioquia. El análisis de clasificación mostró una alta variabilidad, con poca estructuración por origen geográfico. Estos resultados permitirán iniciar un proceso de mejoramiento genético a partir de genotipos superiores de las accesiones élite identificadas.

  7. GEN 105 Course tutorial/ indigohelp

    OpenAIRE

    SCD

    2015-01-01

    For more classes visit www.indigohelp.com   GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion Questions GEN 105 A...

  8. Identificación de mutaciones en el gen del receptor de proteínas morfogéneticas óseas tipo II (BMPRII) en pacientes pediátricos con hipertensión arterial pulmonar familiar e idiopática de la ciudad de BOGOTÁ

    OpenAIRE

    Moreno Pinzón, Christian Camilo

    2014-01-01

    La Hipertensión Arterial Pulmonar (HAP) es una enfermedad poco frecuente y de causa desconocida. La HAP comprende varios subgrupos y dentro de ellos se encuentra la Hipertensión Arterial Pulmonar Idiopática (HAPI) y la Hipertensión Arterial Pulmonar Familiar (HAPF). Se postula la existencia de una predisposición genética porque mutaciones en el gen BMPRII (gen de receptor de proteínas morfogenéticas óseas tipo II) responsable del mantenimiento de la fisiología vascular pulmonar, están implica...

  9. Informe del proyecto 'Armonización de la metodología de caracterización, evaluación de la diversidad genética y definición de la colección nuclear del germoplasma de manzano conservado en los bancos de germoplasma españoles' (RF2011-00017-C05-03)

    OpenAIRE

    Errea Abad, María Pilar; Centro de Investigación y Tecnología Agroalimentaria de Aragón - CITA

    2015-01-01

    La necesidad de evitar la pérdida de genotipos de manzano autóctono llevó a diferentes Grupos de Investigación del país a acometer programas de prospección, conservación y caracterización de recursos genéticos de esta especie. A pesar del considerable trabajo de caracterización morfológica, agronómica y molecular de estas colecciones, el estado de la información disponible actualmente no ha permitido realizar una evaluación conjunta apropiada de la riqueza genética conservada en las coleccion...

  10. Sequence analysis of the capsid and polimerase genes of different raspberry bushy dwarf virus (rbdv samples Análisis de la secuencia de nucleótidos del gen de la capside y la polimerasa entre diferentes aislamientos del virus motoso del enanismo de la frambuesa

    Directory of Open Access Journals (Sweden)

    Mayo M.

    1998-12-01

    Full Text Available This work was aimed to find sequence variability between capsid and polymerase gene sequences of five RBDV samples. Capsid and polymerase cDNAs were obtained by reverse transcription and PCR (RT-PCR of RNA extracted from plants inoculated with each of the respective isolated samples. The amplified products were cloned in pGEM-T and sequenced. The results showed that the capsid and polymerase sequences varied less than 1% among the isolated samples. These data suggested that capsid and polymerase transgenic sequences that protect against a particular RBDV sample might protect against the others.Este proyecto tuvo como objetivo determinar el grado de variabilidad existente al interior de las secuencias correspondientes al gen de la cápside y de la polimerasa entre cinco aislamientos de RBDV. Para este propósito, el DNA complementario (cDNA, correspondiente al gen de la cápside y de la polimerasa, fueron obtenidos por transcriptasa reversa y reacción en cadena de la polimerasa (RT-PCR, a partir de RNA de plantas inoculadas con cada uno de los respectivos aislamientos. El cDNA correspondiente al gen de la cápside y de la polimerasa, obtenido de cada aislamiento de RBDV, mediante esta metodología se clonó en el plásmido pGEM-T para ser secuenciado posteriormente. Los resultados mostraron que tanto el gen de la cápside, como el de la polimerasa, variaron menos del 1% entre estos aislamientos. Por lo tanto, se puede esperar que una secuencia transgénica de RBDV (de la cápside o de la polimerasa que proteja contra un aislamiento de RBDV, podría también proteger contra otras cepas de RBDV.

  11. Polimorfismo del promotor del gen TNF-α (p-TNF-α bovino y su asociación con la resistencia del huesped a la diseminación del virus de la leucosis - Polymorphism of the TNF-α (p-TNF-α bovine gene promoter region and its association with host resistance to bovine leukemia virus infectio

    Directory of Open Access Journals (Sweden)

    LENDEZ, Pamela Anahí

    2010-11-01

    Full Text Available ResumenEl virus de la leucemia bovina (BLV es el agente causal de la leucosis bovina enzoótica, enfermedad neoplásica que provoca enormes pérdidas económicas en la producción ganadera y en la exportación.Luego de la infección por BLV, la expresión del mensajero del TNF-α se ve aumentada en aquellos animales capaces de eliminar el virus en la fase aguda de la infección. Esto sugiere que esta citoquina tendría un rol importante en la eliminación del virus. Se ha demostrado que la homocigosis G/G en la posición -824 de la región promotora del TNF-α estaría asociada con el desarrollo de linfosarcoma. Por otro lado, el alelo *902 del gen BoLA DRB3.2 del complejo mayor de histocompatibilidad de clase II está asociado con la resistencia a la diseminación viral y a la baja carga proviral. El objetivo de este trabajo fue estudiar la relación entre el olimorfismo en la región promotora del TNF-α y la presencia del alelo de resistencia BoLA DRB3.2*902 en animales infectados con BLV.Se seleccionaron 60 animales portadores o no del alelo *902, y se dentificó por la técnica de PCR-RFLP la presencia de la mutación en la región descripta. Los datos preliminares obtenidos sugieren que los genotipos A/A y A/G estarían asociado a la presencia del alelo de resistencia *902. No se encontró ningún animal homocigota G/G en ese grupo de animales, lo que sugiere una asociación negativa entre este polimorfismo y la presencia del alelo de resistencia frente al BLV. Se requiere estudiar un mayor número de animales.SummaryBovine leukemia virus (BLV is the causative agent of enzootic bovineleukosis, a neoplasic disease that causes important economic losses in cattle production and trading. After BLV infection, TNF-α mRNA expression is increased in those a nimals hich are capable of eliminating the virus in the acute phase of infection.This finding suggests that this cytokine could have an important role in virus elimination. It has been

  12. Genetic diversity and conservation of the Resplendent Quetzal Pharomachrus mocinno in Mesoamerica Diversidad genética y conservación del quetzal Pharomachrus mocinno en Mesoamérica

    Directory of Open Access Journals (Sweden)

    Sofía Solórzano

    2009-04-01

    Full Text Available In this study, we analyzed the genetic variation of quetzals (Pharomachrus mocinno throughout their geographic distribution to determine conservation targets. This species is found in patchy isolated cloud forests from Mexico to Panama. A multidimensional scaling and UPGMA analysis of a 286 RAPD fragment set resolved 3 genetic groups: cluster 1 (Mexican localities, cluster 2 (Guatemala, Nicaragua and El Salvador and cluster 3 (Panama. The mean genetic diversity estimated by the Shannon index was 0.38, 0.22 and 0.32, for clusters 1, 2, and 3, respectively. The genetic differentiation among clusters was statistically significant. The highest percentage of genetic variation (70.86% was found within populations using an AMOVA analysis. Our results suggest that within the quetzal species, there are 3 genetic groups that should be considered as independent conservation targets and included in a global Mesoamerican conservation program.En este estudio, analizamos la variación genética del quetzal (Pharomachrus mocinno a lo largo de su distribución geográfica con la finalidad de determinar prioridades de conservación. Esta especie se encuentra desde México hasta Panamá en bosques de niebla fragmentados y aislados. Un análisis escalar multidimensional y un UPGMA de un conjunto de 286 fragmentos de RAPD resolvieron 3 grupos genéticos: grupo 1, localidades mexicanas; grupo 2, Guatemala, Nicaragua y El Salvador, y grupo 3, Panamá. La media de la diversidad genética estimada con el índice de Shannon fue de 0.38, 0.22 y 0.32, para los grupos 1, 2 y 3, respectivamente. La diferenciación genética entre grupos fue estadísticamente significativa. El análisis de AMOVA detectó que el porcentaje más alto de variación genética (70.86% está dentro de las poblaciones. Nuestros resultados sugieren que dentro de la especie de quetzal, existen 3 grupos genéticos que deben ser considerados como prioridades de conservación independientes y ser

  13. Medición del daño genético inducido por el basuco en linfocitos humanos empleando la prueba de micronúcleos con Citocalasina B

    Directory of Open Access Journals (Sweden)

    Ocampo AP.

    2001-06-01

    Full Text Available El bazuco es una mezcla compleja que se deriva del proceso de extracción de la cocaína. El frecuente consumo de bazuco constituye un problema de salud pública. La prueba de micronúcleos en linfocitos humanos de sangre periférica por bloqueo de la citocinesis con Citocalasina B, es más sensible y precisa para evaluar daño  cromosómico porque permite registrar micronúcleos originados de fragmentos de cromosomas o cromosomas enteros en células que se han dividido una sola vez. El objetivo del presente estudio fue evaluar el daño genético, inducido por el bazuco en linfocitos humanos in vitro empleando la prueba de micronúcleos con Citocalasina B.

  14. Estudios lipídico-nutricionales y genéticos para la prevención de deficiencias neurosensoriales del niño y degenerativas del adulto. Premio Reina Sofía 2002 de Prevención de Deficiencias

    OpenAIRE

    Sanjurjo Crespo, Pablo

    2003-01-01

    Se describen tres líneas de investigación: lipídico-perinatal, nutricional-metabólica y metabólico-genética desarrolladas como Investigador Principal a lo largo de los últimos 25 años en la Unidad de Metabolismo del Departamento de Pediatría del Hospital de Cruces, de Bilbao. Las tres líneas convergen en un objetivo común, la prevención de deficiencias. Estas deficiencias pueden ser tanto neurosensoriales inmediatas en el propio niño, como futuras en la época adulta: enfermedad cardiovascular...

  15. HIGH GENETIC VARIATION IN Y CHROMOSOME PATTERNS OF THE MOCOVÍ POPULATION / Alta variación genética en los patrones del cromosoma Y de la población Mocoví

    Directory of Open Access Journals (Sweden)

    Laura Angela Glesmann

    2011-12-01

    Full Text Available In numerically small ethnic groups, the loss of genetic variability in the Y chromosome is frequent, because this genomic compartment is often subjected to selective sweeps. Despite its small size, the Mocoví population retains a significant amount of genetic variation in relation to other native communities, but their Y chromosome diversity is not known in depth. The aim of this study was to analyze the genetic variability of the Y chromosome in a sample of Mocoví males from Santa Fe province (Argentina. We genotyped 11 short tandem repeats (STRs and two single nucleotide polymorphisms (SNPs: M3 and M346. The diversity observed was high, and the 25 haplotypes obtained were compared to the YHRD database, with 13 of them absent of that database. A comparison with previous data reported from other Gran Chaco native groups showed significant differences between the Mocoví and other populations of different ethnic origin. This result and other studies on molecular markers of the Mocoví prove that this ethnic group retains a high genetic diversity that clearly differentiate them from other Amerindian populations.   Keywords: Haplotypes; genetic diversity; STRs; M3; Amerindians.   Resumen La pérdida de variabilidad genética en el cromosoma Y es frecuente en grupos étnicos reducidos numéricamente, debido a que este cromosoma suele estar sometido a barridos selectivos. A pesar de ser pequeña, la población Mocoví conserva una cantidad significativa de variación genética en relación con otras comunidades nativas, pero su diversidad a nivel del cromosoma Y no se conoce en profundidad. El objetivo de este trabajo fue analizar la variabilidad genética del cromosoma Y en una muestra de varones Mocoví de la provincia de Santa Fe (Argentina. Se tipificaron 11 microsatélites (STRs y dos marcadores bialélicos (SNPs: M3 y M346. La diversidad observada fue elevada, y los 25 haplotipos obtenidos se compararon con la base de datos YHRD, donde 13

  16. Estrategia de verificación de calidad de las cepas de Escherichia coli conservadas en la Colección del Centro de Ingeniería Genética y Biotecnología

    Directory of Open Access Journals (Sweden)

    Iveldris Domínguez-Vázquez

    2010-04-01

    Full Text Available La colección de microorganismos de interés biotecnológico del Centro de Ingeniería Genética y Biotecnología incluye diferentes cepas de bacterias y levaduras utilizables en la manipulación de genes mediante el empleo de la ingeniería genética y para la producción de proteínas recombinantes por métodos biotecnológicos. La colección de hospederos de Escherichia coli centraliza todas las cepas que se utilizan en los proyectos de investigación-desarrollo de la institución. Este microorganismo constituye una de las herramientas biológicas imprescindibles para el trabajo en ingeniería genética y la investigación molecular. La fidelidad de los resultados experimentales depende en parte de la calidad de los bancos de estas cepas, que está determinada por las condiciones de almacenamiento y las estrategias de evaluación de los mismos. La complejidad del manejo de esta colección está influida en gran medida por el hecho de que en los medios de propagación pueden crecer un gran número de contaminantes ambientales de difícil identificación. Mientras más similar es el contaminante a la cepa de interés, más difícil es lograr bancos puros con una estabilidad confiable para la conservación. En este trabajo se describe cómo se garantiza el control de calidad de los bancos de Escherichia coli. Los métodos y estrategias de verificación que se describen han sido desarrollados en nuestro laboratorio.

  17. El género Elaphocera Gené, 1836 (Coleoptera, Melolonthidae, Pachydeminae: revisión de las series tipo de las colecciones del Museo Nacional de Ciencias Naturales (Madrid, España

    Directory of Open Access Journals (Sweden)

    Alonso-Zarazaga, M. A.

    1998-12-01

    Full Text Available Melolontha emarginata Gyllenhal, 1817 is designated as the type species of Elaphocerida Reitter, 1902. The type specimens of the species of genus Elaphocera Gené, 1836, from the entomological collections of Museo Nacional de Ciencias Naturales (Madrid, Spain, are studied. Lectotypes are designated for species Elaphocera (Elaphocerida ampla Báguena, 1955, Elaphocerida segurensis Escalera, 1923, Elaphocerida pygmaea Escalera, 1923 and Elaphocera (Elaphocerida torressalai Báguena, 1955. The type material of the following species is also revised: Elaphocera pardoi Escalera, 1931, Elaphocera (Elaphocerida ibicensis Escalera, 1926, Elaphocerida abdelkrimi Escalera, 1934 and Elaphocera baguenae Mancini, 1926.En este trabajo se designa Melolontha emarginata Gyllenhal, 1817 como la especie tipo de Elaphocerida Reitter, 1902. Se revisan las series típicas de las especies del género Elaphocera Gené, 1836 conservadas en las colecciones de Entomología del Museo Nacional de Ciencias Naturales (Madrid, España. Se designan los lectotipos de Elaphocera (Elaphocerida ampla Báguena, 1955, Elaphocerida segurensis Escalera, 1923, Elaphocerida pygmaea Escalera, 1923 y Elaphocera (Elaphocerida torressalai Báguena, 1955. Además, se proporcionan nuevos datos sobre el material típico de las especies Elaphocera pardoi Escalera, 1931, Elaphocera (Elaphocerida ibicensis Escalera, 1926, Elaphocerida abdelkrimi Escalera, 1934 y Elaphocera baguenae Mancini, 1926, conservado en estas colecciones.

  18. Estudios de la región 5'UTRTR del gen FMR-1 en pacientes con falla ovárica prematura Studies of the 5' - UTRTR region in the FMR-1 gene in patients withe Premature Ovarian Failure

    Directory of Open Access Journals (Sweden)

    V.A. Chiauzzi

    2010-12-01

    Full Text Available La falla ovárica prematura (FOP es un síndrome de patogénesis multicausal que afecta aproximadamente al 1% de las mujeres en edad reproductiva. Numerosos estudios asocian el estado de premutación (amplificación del número de tripletes CGG entre 50/55 y 200 repeticiones en el gen FMR-1 y FOP. Alrededor de un 4% de las pacientes FOP presentan alelos con premutación. La amplificación del número de tripletes por encima de 200 repeticiones causa el Síndrome de Fragilidad del X (SFX. El objetivo del presente trabajo fue estudiar la región 5´ no codificante del gen en un grupo de pacientes FOP de Argentina. La región de interés se amplificó por PCR a partir de muestras de ADN de 100 pacientes FOP y 145 mujeres controles. Los alelos de las pacientes y controles fueron agrupados en 7 categorías de acuerdo al número de tripletes obtenidos. Se observó que el número de repeticiones más frecuente se encuentra en el rango de 26 a 30 tripletes, tanto en pacientes como en controles. En el grupo de pacientes FOP, 5/197 (2.6% alelos no relacionados estudiados presentaron un número de tripletes CGG mayor a 50, mientras que sólo 1 de 290 (0.34% para el grupo control. Todas las pacientes FOP con valores de tripletes CGG mayor a 50 presentaron amenorrea secundaria. Estos resultados están en concordancia con lo comunicado para otras poblaciones acerca de la existencia de una asociación entre la premutación del gen FMR-1 y el desarrollo de FOP. Asimismo, los resultados obtenidos refuerzan la importancia de la genotipificación del gen FMR-1 en las pacientes FOP, a los efectos de estimar el riesgo de su descendencia para el SFX.Premature ovarian failure (POF is a syndrome of multicausal pathogenesis that affects 1% of women before the age of 40. Several studies associate the premutation state (CGG repeats increased in number between 50/55 and 200 in the FMR-1 gene and POF. About 4% of POF women have alleles in the FMR-1 gene in the permutation

  19. El diagnóstico genético del sexo mediante el test de la amelogenina: Métodos y posibles fuentes de error Sex typing through the Amelogenin test: Methods and possible pitfalls

    Directory of Open Access Journals (Sweden)

    F. Francès

    2008-04-01

    Full Text Available El diagnóstico del sexo a partir de indicios biológicos es crucial en la ciencia forense en general y en la investigación criminal, en particular. La amelogenina -proteina codificada en los cromosomas sexuales- se viene utilizando con ese fin desde la última década del siglo pasado. Existen divergencias en secuencia y tamaño entre los alelos codificados en el cromosoma X y el cromosoma Y (AMELX y AMELY, respectivamente. Esta es la base que ha permitido su amplia utilización en ciencias forenses para el diagnóstico genético del sexo. No obstante, recientemente se han publicado casos en los cuales el resultado del test de la amelogenina no corresponde con el sexo legal (oficial del individuo. El presente trabajo presenta una revisión de los protocolos publicados, localizando las áreas más comúnmente amplificadas del gen de la amelogenina, así como de las técnicas utilizadas para la detección de los fragmentos amplificados de AMELX y AMELY. Por último se analizan las condiciones en las cuales el test de la amelogenina, puede mostrarse discrepante con el sexo fenotípico del individuo y que han de ser tenidas en cuenta para evitar errores potencialmente graves en el curso de la investigación con fines forenses.Sex typing of biological evidences is crucial in forensics in general, and in criminal investigation, in particular. The amelogenin -a protein codified in the sexual chromosomes- has been used with these purposes since the last decade of the past century. There are sequence and size divergences between the X and Y-codified alleles of this gene (AMELX and AMELY. This fact is in the base of its using as a genetic sex typing test. However some cases in which the amelogenin test outcome does not correspond with the legal (official sex have been published. The present work offers a revision of the published protocols of the amelogenin sex typing test, locating the most common amplified areas of this gene, and the different

  20. Diversidad genética, patogénica y morfológica del hongo Colletotrichum gloeosporioides (Penz. de Michoacán, México Genetic, pathogenic and morphological diversity of fungi Colletotrichum gloeosporioides (Penz. from Michoacan, Mexico

    Directory of Open Access Journals (Sweden)

    Víctor Montero Tavera

    Full Text Available El hongo Colletotrichum gloeosporioides, es el agente causal de antracnosis y representa la principal limitante para la cosecha de frutos con calidad comercial de aguacate Hass (Persea americana. La diversidad genética poblacional de este hongo se ha estudiado en diversas partes del mundo, pero en México se desconoce su estructura poblacional y particularmente los componentes de su diversidad. Se determinó la diversidad genética, patogénica y morfológica de 21 cepas monoconidiales de Colletotrichum gloeosporioides de Michoacán, México. La diversidad genética se estimó por medio del polimorfismo de ADN amplificado al azar y por la determinación de los perfiles de isoenzimas de cada cepa monoconidiales. La diversidad patogénica se midió mediante la capacidad invasiva de pulpa de aguacate y por la tasa de crecimiento in vitro. La diversidad morfológica in vitro se determinó por la comparación de caracteres del micelio de cada cepa monoconidiales. Los resultados mostraron alta diversidad de Colletotrichum gloeosporioides con un índice de variabilidad genética de 0.3031 y los estimadores más precisos fue el polimorfismo de ADN amplificado al azar (índice de variabilidad genética igual a 0.344 y perfiles de isoenzimas (índice de variabilidad genética igual a 0.35. Las características típicas fueron micelio blanco, consistencia algodonosa, colonia blanca, crecimiento de micelio al azar e hifas cortas en el borde de crecimiento. No se encontró relación entre la patogenicidad medida como capacidad invasiva de pulpa y la velocidad de crecimiento in vitro. Los análisis de agrupamiento establecieron que las relaciones entre cepas se dan principalmente con base en la localidad de origen y de manera secundaria, en el síntoma producido en el fruto.The fungi Colletotrichum gloeosporioides, is the agent that causes anthracnose and the main limitation to the harvest of commercial quality Hass avocado (Persea americana. The genetic

  1. Genética poblacional del caracol rosado Strombus gigas en la Península de Yucatán: Implicaciones para su manejo y pesquería

    Directory of Open Access Journals (Sweden)

    2005-01-01

    Full Text Available Se determinó la estructura genética poblacional del caracol rosado Strombus gigas en la Península de Yucatán, México, mediante la expresión de isoenzimas en geles de poliacrilamida. Se utilizaron muestras de músculo de 50 organismos, capturados en cada uno de los cuatro sitios de la Península de Yucatán seleccionados, para caracterizar la expresión genotípica revelada por la expresión de 55 loci en 30 sistemas enzimáticos. Se utilizó el programa TFPGA versión 1.3 para procesar los datos de frecuencias génicas de aloenzimas de las poblaciones en estudio. Los parámetros determinados fueron: estadística descriptiva, estadística F, distancias genéticas, equilibrio de Hardy-Weinberg, UPGMA y el número de migrantes como indicador del flujo de genes. Los valores de heterocigosis, en un rango de 0.3240 para OCTDH 2 hasta 0.0440 para FUM y promedio de 0.0366, los de Fis, con un rango de 0.0835 para OCTDH 2 hasta 0.3600 para la FUM y promedio de –0.0492, y los de Fst, con un rango de 0.0082 para LAP 2 hasta 0.1967 para MDH 2 y promedio de 0.1039, indican una deficiencia de heterocigotos. El número de migrantes derivado de la ecuación de Slatkin resultó de 2.156 por generación, lo que en forma global indica un cierto grado de variabilidad entre las poblaciones y es consistente con los bajos valores de distancia genética de Nei encontrados, particularmente en el nodo que sugiere la separación de la población de Alacranes de las otras poblaciones estudiadas, con un valor obtenido de 0.0053. Por los resultados, se concluye que las poblaciones de S. gigas en el Caribe mexicano presentan niveles de variabilidad genética que no reflejan fragilidad para su subsistencia.

  2. Variabilidad genética y estructura poblacional del tunicado Pyura chilensis Molina, 1782, en la costa de Chile Genetic variability and population structure in tunicate Pyura chilensis Molina, 1782, in the coast of Chile

    Directory of Open Access Journals (Sweden)

    MARCELA P ASTORGA

    2006-12-01

    Full Text Available El tunicado Pyura chilensis se ha considerado una especie de importancia ecológica, por concentrar una gran diversidad biológica en sus agregaciones y de importancia económica por ser un recurso de extracción por pescadores artesanales. Sin embargo, se han detectado cambios en la distribución y abundancia de sus poblaciones adjudicados a su sobreexplotación. Para llegar a establecer medidas de conservación de un recurso, es necesario entre otras cosas, conocer su variabilidad genética y su estructura poblacional, estimando los patrones y sus causas. Por lo tanto, en el presente trabajo se determinó el grado de variabilidad genética aloenzimática del piure P. chilensis y su estructura poblacional en base a tres localidades (Antofagasta, Talcahuano y Puerto Montt en la costa chilena. Los loci polimórficos obtenidos fueron Mdh-1 y Pgi-1. Los valores de Fst mostraron leve estructuración poblacional entre localidades (Fst 0,019 al igual que la prueba exacta de diferenciación genética (P = 0,031. Se observó diferenciación para la localidad de Puerto Montt en relación a las otras dos localidades en algunos de los dos loci. Los niveles de variabilidad observados en esta especie corresponden a lo esperados para otras ascidias. La estructuración genética poblacional puede ser explicada por una combinación de diferentes factores, entre los que destacan: (i el tiempo del periodo larval de 12 a 24 h, lo cual no facilitaría una amplia dispersión a lo largo de 2.500 km de costa y (ii las condiciones oceanográficas diferenciales entre localidades, junto a patrones de circulación cerrados que podrían llegar a restringir el flujo génico. Por último, proponemos que un conocimiento adecuado del grado de variabilidad, estructura y dinámica genética de las poblaciones son aspectos esenciales para tomar medidas de conservación de recursos explotados, tanto en ambientes abiertos como en áreas de manejoThe ascidian Pyura chilensis is an

  3. Gen quimérico que utiliza el gen o cDNA de la insulina, en especial para terapia génica de la diabetes

    OpenAIRE

    Bosch i Tubert, Fàtima; Valera Abril, Alfons

    2001-01-01

    Gen quimérico que utiliza el gen o CDNA de la insulina, en especial para terapia génica de la diabetes. El gen quimérico está dirigido por un promotor o fusión de promotores, los cuales preferentemente son regulables y están activados por el proceso diabético. Preferentemente, se obtiene por fusión del gen de la insulina humana al promotor de la PEPCK (p-enolpiruvato carboxiquinasa). Dicho promotor (fragmento - 460 pb a + 73 pb) está fusionado a la zona 5'' franqueante del gen de la insulina ...

  4. Dolor miofascial en el territorio craneocervical: una revisión de la patología y su relación con polimorfismos genéticos del sistema GABAérgico

    Directory of Open Access Journals (Sweden)

    V. Iturriaga

    2015-08-01

    Full Text Available El dolor miofascial es una patología muscular regional no inflamatoria caracterizada por la presencia de una zona hiperirritable de tejido muscular que se encuentra en una banda tensa, denominado punto gatillo. En la región orofacial pertenece a un conglomerado de patologías denominadas trastornos temporomandibulares, correspondiendo al de mayor prevalencia. Las manifestaciones clínicas van desde dolor local, tensión muscular y disfunción estructural hasta dolor referido, fenómenos autonómicos e hiperexcitabilidad en el sistema nervioso central. Durante las últimas décadas se han asociado variantes genéticas con diferentes expresiones en patologías dolorosas, algunas de las cuales se encuentran en el sistema GABAérgico. En el presente artículo se realiza una revisión del dolor miofascial como patología y su relación con estos polimorfismos genéticos.

  5. Intronic SNP rs3811647 of the human transferrin gene modulates its expression in hepatoma cells El SNP intrónico rs3811647 del gen de la transferrina humano, modula su expresión en células hepáticas

    Directory of Open Access Journals (Sweden)

    R. Blanco-Rojo

    2012-12-01

    Full Text Available Introduction: Transferrin (Tf exerts a crucial function in the maintenance of systemic iron homeostasis. The expression of the Tf gene is controlled by transcriptional mechanism, although little is known about genetic factors influence. Objective: To study the role of rs3811647 in Tf expression using an in-vitro assay on hepatoma cells. Design and Methods: Hep3B cells were co-transfected with constructs containing A (VarA-Tf-luc and G (VarG-Tf-luc variants of rs3811647, using luciferase as a surrogate reporter of Tf expression. Results: Luciferase assays showed a higher intrinsic enhancer activity (p Introducción: La transferrina (Tf ejerce una función crucial en el mantenimiento de la homeostasis sistémica del hierro. La expresión del gen de la transferrina es controlada a nivel transcripcional, aunque la posible influencia de factores genéticos todavía se desconoce. Objetivo: Estudiar el papel del rs3811647 en la expresión de la transferrina mediante un ensayo in-vitro en células de hepatoma. Diseño y métodos: Células Hep3B fueron co-transfectadas con vectores que contenían las variantes A (VarA-Tf-luc y G (VarG-Tf-luc del rs3811647, utilizándose la luciferasa como marcador de la expresión del gen Tf. Resultados: Los ensayos con la luciferasa mostraron un mayor aumento de la expresión del gen Tf en presencia de la variante A comparada con la G (p < 0,05. El análisis in silico del SNP rs3811647 mostró que la presencia del alelo A puede constituir un sitio de unión del receptor de glucocorticoides (GR. Conclusión: El alelo A del SNP rs3811647 incrementa la expresión del gen Tf de modo que podría modular la variación interindividual en los niveles de transferrina sérica observados en diferentes poblaciones.

  6. Análisis de los polimorfismos de longitud de los fragmentos de restricción (RFLP del gen ribosómico 18S RNA de nutria gigante de río Pteronura brasiliensis

    Directory of Open Access Journals (Sweden)

    Grupo de Investigación en Genética Molecular

    2001-06-01

    Full Text Available La nutria gigante de río Pteronura brasiliensises un mamífero carnívoro de la familia Mustelidae, ala cual pertenecen también las tairas, las martas y los hurones. La nutria es considerada por elCITES como una especie vulnerable y por la IUCN como especie en peligro de extinción. Por estarazón, el Centro de Biología Molecular del Gimnasio Campestre inicio un proyecto de genética conservacionista que pretende proveer información utilizable para el análisis, tanto de la especieP. brasiliensiscomo de sus familiares mas cercanos, y de esta forma, proponer planes de manejo dela especie y su hábitat previniendo su extinción.

  7. Genetic composition of Mytilus species in mussel populations from southern Chile Composición genética de especies de Mytilus en poblaciones de mejillón del sur de Chile

    Directory of Open Access Journals (Sweden)

    María Angélica Larraín

    2012-11-01

    Full Text Available Mussels are one of the most cultivated and commercialized bivalves worldwide and in southern Chile its culture represent an important economic activity. The species identification within the Mytilus genera, by morphological features, is unreliable, so we used a polymorphism RFLP in the gene encoding the polyphenolic adhesive protein as a species-specific genetic marker to describe Mytilus species diversity in southern Chile, and evaluate possible applications in traceability, food quality and safety. Using Me 15-16 marker most mussels were M. chilensis, finding no other pure individuals; however, putative hybrids of M. chilensis x M. trossulus and M. chilensis x M. galloprovincialis were detected. There was no evidence of M. edulis. The presence of the M. trossulus allele, faraway from its distribution area, demands further analysis with different genetic markers to allow a better understanding of its origin. In addition, the correspondence between markers that distinguishes northern from southern hemisphere M. galloprovincialis, with those who discriminates between M. chilensis and M. galloprovincialis would contribute to the taxonomic status of Chilean blue mussels. In Chile, the genetic composition of Mytilus indicates that geographical origin of mussels and its traceability cannot be established merely from the identification of the species. The use of other markers would be required.Los mejillones son una de las especies de bivalvos más cultivadas y comercializadas, en el sur de Chile donde su cultivo representa una actividad económica importante. La identificación de la especie dentro del género Mytilus, basada en las características morfológicas no es confiable por lo que se utilizó un polimorfismo RFLP en el gen que codifica la proteína adhesiva polifenólica como marcador genético específico de la especie para describir la diversidad de especies Mytilus en el sur de Chile, y evaluar posibles aplicaciones en trazabilidad

  8. Estudio del síndrome de QT largo en nuestro medio : genética, características clínicas y herramientas de diagnóstico electrocardiográfico

    OpenAIRE

    Muñoz Esparza, Carmen

    2014-01-01

    RESUMEN Introducción El síndrome de QT largo (SQTL) es una canalopatía hereditaria que se asocia a síncope y muerte súbita (MS). Hasta la fecha, más de 700 se han identificado mutaciones en 13 genes asociados a SQTL, siendo los subtipos de SQTL 1-3 (QTL1-3) los genotipos más frecuentes (1;2). El QTL2 se produce por mutaciones en el gen KCNH2 que causan un a pérdida de función del canal Kv11.1, que conlleva un efecto negativo en la corriente de K+ de rectificación tardía rápida (3). ...

  9. Ética y genética

    OpenAIRE

    2002-01-01

    Este documento contiene una transcripción de las ponencias presentadas en la Mesa Redonda sobre Ética y Genética celebrada en Oviedo, el día 10 de octubre de 2001, y organizada por el Real Patronato sobre Discapacidad en el marco del XXI Congreso Nacional de Genética Humana.

  10. GenBank

    Data.gov (United States)

    U.S. Department of Health & Human Services — GenBank is the NIH genetic sequence database, an annotated collection of all publicly available DNA sequences. GenBank is designed to provide and encourage access...

  11. Perfiles genéticos (RFLP-IS6110 y resistencia a drogas en aislamientos de M. tuberculosis de pacientes internados en un hospital referencial del Callao, Perú

    Directory of Open Access Journals (Sweden)

    Christian Baldeviano V

    2003-04-01

    Full Text Available Objetivo: evaluar la frecuencia y el agrupamiento de los perfiles genéticos (RFLP-IS6110 y los niveles de resistencia a drogas en aislamientos de M. tuberculosis de pacientes hospitalizados con tuberculosis pulmonar frotis positivo (TBP-FP en un hospital general de la provincia del Callao, Lima, Perú. Materiales y métodos: se incluyeron pacientes con TBP-FP hospitalizados en el Hospital Nacional Daniel A. Carrión entre agosto de 2000 y febrero de 2001. Se realizó la prueba de sensibilidad a las cuatro drogas de primera linea (INH, RIF, SM, EMB por el método de las proporciones y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó la información de los pacientes de los registros de laboratorio e historias clínicas. Resultados: en 74 aislamientos, el número de bandas en los perfiles genéticos variaron entre 2 y 16, 4 perfiles (5,5% mostraron menos de 5 bandas. En total 50 perfiles genéticos fueron obtenidos de 70 pacientes. 34 aislamientos (48,6 % se agruparon en 14 "clusters" y 36 tuvieron ocurrencia única. La resistencia a drogas en pacientes nunca y antes tratados fue 45,2% y 71,1%, respectivamente. La multidrogorresistencia fue 16,1% y 36,8%, respectivamente. 10 de los 14 "clusters" incluyeron por lo menos un aislamiento resistente y un cluster agrupó 6 aislamientos resistentes. Conclusiones: No se encontró evidencia de algún genotipo predominante en la población estudiada. Sin embargo, se observaron «clusters» agrupando pacientes con TB sensible y resistente. Nuestros resultados sugieren que existen genotipos asociados a resistencia lo cual indicaría transmisión activa de cepas resistentes en la provincia del Callao. Es necesario llevar a cabo un estudio poblacional para confirmar nuestros resultados.

  12. Estructura genética de las poblaciones de Stegastes partitus (Perciformes: Pomacentridae) en cinco localidades del archipiélago cubano y Bocas del Toro, Panamá.

    OpenAIRE

    Castellanos Gell, J.

    2008-01-01

    La mayoría de los peces de arrecifes poseen un estadio larval pelágico durante el cual pueden ser transportados largas distancias. La inferencia de estos patrones de conectividad a partir de estudios genético-poblacionales, ha cobrado gran auge debido a su utilidad en el diseño de áreas marinas protegidas. Este trabajo se propone analizar la influencia de las posibles barreras físicas, la biología de la especie y sus potenciales de dispersión, en la estructura genética de S...

  13. Mutaciones del gen de la Hemocromatosis en donantes de sangre voluntarios y en pacientes con Porfiria cutánea tarda en Chile Mutations of hemochromatosis gene in volunteer blood donors and Chilean porphyria cutanea tarda patients

    Directory of Open Access Journals (Sweden)

    Carlos Wolff F

    2006-10-01

    Full Text Available La acumulación de hierro hepático asociada a mutaciones en el gen HFE de la hemocromatosis hereditaria (HH en los pacientes con porfiria cutánea tarda (PCT podría tener un papel en la etiología y en la expresión clínica de esta enfermedad. Se estudió la frecuencia de las mutaciones H63D y C282Y en un grupo de pacientes con PCT y se la comparó con la observada en un grupo de donantes voluntarios de sangre. Los pacientes con PCT fueron catalogados como portadores de la forma hereditaria o adquirida de la enfermedad, según presentaran o no mutaciones en el gen uroporfirinógeno decarboxilasa (UROD. El 50% de los pacientes con PCT eran portadores de la forma genética de la enfermedad, porcentaje significativamente mayor que lo informado en otras series. El 23% de los donantes voluntarios de sangre eran portadores de la mutación H63D y 2.4% lo era de la mutación C282Y. Frecuencias similares a lo encontrado por otros autores en población chilena de etnia blanca, en población argentina y española, pero significativamente más alta que lo encontrado en estudios en población aborigen araucana. Esto tiene, probablemente, relación con el predominio de ascendencia española en la población blanca chilena. La frecuencia de mutación en el gen HFE en pacientes con PCT no fue significativamente diferente que la observada en donantes voluntarios de sangre. Tampoco hubo diferencias significativas en la frecuencia de estas mutaciones entre los casos con PCT adquirida respecto de aquellos en que ésta era de origen genético. Los resultados obtenidos no permiten afirmar que exista asociación entre la PCT y la condición de portador de mutaciones del gen HFE de la hemocromatosis hereditaria.In patients with porphyria cutanea tarda (PCT, hepatic iron accumulation associated to hereditary hemochromatosis (HH could play a role in the etiology and in the clinical expression of the disease. The H63D and C282Y mutations of the HFE gene frequency were

  14. Resolución mediante algoritmos genéticos del problema de flow shop sin pulmones. Aplicación a una empresa de autobastidores para autobuses

    OpenAIRE

    Cánovas Tarrés, Inés; Crespo Navarro, Victoria

    2001-01-01

    El proyecto que planteamos está íntimamente relacionado con la materia impartida en la intensificación de gestión. Proponemos la resolución de un problema de Flow-Shop sin pulmones mediante una técnica vanguardista como son los algoritmos genéticos. El proyecto viene motivado por la problemática originada en Irisbus S.L, fabricante de autobastidores para autobuses. Debido a las dimensiones de estos elementos, resulta costoso habilitar zonas para almacenar el producto en curso. La e...

  15. Aspectos jurídico internacionales del acceso a los recursos genéticos que componen la diversidad biológica

    OpenAIRE

    Rodrigues Bertoldi, Márcia

    2003-01-01

    Actualmente nos encontramos en un momento de profunda transformación en la historia de la humanidad y de las leyes de la naturaleza caracterizada, entre otras cosas, por un desarrollo expansivo de la industria biotecnológica. La biotecnología tiene como materia prima los recursos genéticos y, también, los extractos bioquímicos de las especies vegetales, animales y microbianas que componen la diversidad biológica, la cual permite un sin fin de posibilidades alimenticias, medicinales, energétic...

  16. Parámetros genéticos del crecimiento y la reproducción en ganado cebú

    OpenAIRE

    Mario Pino Pérez de Utrera; Danilo Guerra Iglesias; Dianelys González-Peña

    2009-01-01

    Con el propósito de conocer las correlaciones genéticas entre los rasgos de crecimiento en toros y las características reproductivas en vacas cebú de Cuba, se utilizaron 9490 registros de toros que terminaron la prueba de comportamiento en pastoreo, a los cuales se les registró el peso final (PF) a los 18 meses de edad; así mismo se emplearon 13.575 registros de sus medio hermanas, a las que se les registró la edad a la primera inseminación (EPI), la edad al primer parto (EPP) y los servicios...

  17. Asociación de polimorfismos SNPs del gen DGKH y caracterización neuropsicológica en escolares con TDAH con trastorno de ansiedad

    OpenAIRE

    Polanco Barreto, Ángela María

    2013-01-01

    El Trastorno por Déficit de Atención e Hiperactividad (TDAH) es uno de los desórdenes psiquiátricos que con más frecuencia se observan en la infancia. Su principal sintomatología es la alteración en el proceso de atención y con cierta frecuencia se acompaña de impulsividad e hiperactividad. Es de etiología multifactorial, pudiendo ser causado por factores genéticos, ambientales, pre y perinatales y psicosociales. Igualmente, se ha reconocido que el 60% de los casos tienen comorbilidad con otr...

  18. Polymorphisms in the interleukin-10 gene and relation to phenotype in patients with ulcerative colitis Polimorfismos del gen de la IL-10 y su relación con los diferentes fenotipos de la colitis ulcerosa

    Directory of Open Access Journals (Sweden)

    J. L. Mendoza

    2006-02-01

    Full Text Available Background and objectives: interleukin-10 (IL-10 has a key role in regulating mucosal inflammation in inflammatory bowel disease. In our population of Spanish ulcerative colitis (UC patients, we have previously demostrated that two polymorphisms (IL-10.G14 microsatellite allele and homozygous for the -1082G alelle (guanine at position -1082 in the IL-10 gene were susceptibility markers for disease. No data exist regarding the relationship of these IL-10 polymorphims with phenotypic subpopulations in UC. Therefore, this study sought to examine the contribution of IL-10 polymorphims to phenotypical variability in UC. Material and methods: a cohort of 215 Spanish unrelated patients with UC recruited in a single center was studied. All patients were rigorously phenotyped and followed for at least 3 years (mean time: 11.8 years. The clinical phenotype was established before genotyping. Genotyping was performed using polymerase chain reaction (PCR assays. Results: patiens with UC included 129 (60% men and 89 (40% women. Mean age at diagnosis was 38 years, with a range of 8-83. Disease extent included 127 (59.1% left-side patients and 88 (40.9% extensive patients. Neither UC phenotype variable was associated with the presence of susceptibility polymorphims (10G14 microsatellite and -1082G alelle. Conclusions: in Madrid's Spanish population of UC patients, the carrying of the ILG14 microsatellite or -1082G polymorphism in the IL-10 gene was not associated with phenotype of disease.Introducción y objetivo: el gen de la interleuquina 10 (IL-10 tiene un papel clave en la regulación de la inflamación intestinal en la enfermedad inflamatoria intestinal. Recientemente hemos descubierto que dos polimorfismos del gen de la IL-10, el microsatélite IL-10.G14 y ser homocigoto -1082G (guanina en la posición 1082 del gen promotor de la IL-10 son marcadores de susceptibilidad para padecer colitis ulcerosa (CU. No existen datos que demuestren si estos

  19. Variantes moleculares en el gen L1 del virus del papiloma humano tipo 16, y regiones de la proteína L1 probablemente involucradas en la interacción virus-célula epitelial

    Directory of Open Access Journals (Sweden)

    María Mercedes Bravo

    2004-03-01

    Full Text Available

    La infección con virus del papiloma humano de alto riesgo es considerada como el principal factor de riesgo en el desarrollo del cáncer de cuello uterino. Entre los HPV de alto riesgo, el tipo 16 es el más frecuente tanto en mujeres con citología normal, como en mujeres con lesiones premalignas y en cáncer invasivo. Se ha demostrado la existencia de variaciones en la secuencia del genoma de HPV16, estos polimorfismos se han agrupado en cinco ramas filogenéticas denominadas según su distribución geográfica: Europeas (E, Asiaticas-Americanas (AA, Asiáticas (As, Africanas (Af y Norteamericanas (NA; determinadas por sustituciones nucleotídicas en los genes E6, L1 y L2 y la región larga de control.

    Varios estudios han sugerido que las variantes no Europeas son más agresivas que las Europeas, esto puede ser el reflejo de una interacción diferente con el huésped y por tanto implicar diferencias en el resultado final de la infección (mayor persistencia o mayor oncogenicidad.

    Particularmente se ha demostrado que las variaciones en la secuencia de aminoácidos de la proteína L1, la proteína principal de la cápside viral, pueden modificar las epítopes neutralizantes del virus afectando la efectividad de la respuesta inmune, también estas variaciones pueden afectar la capacidad de ensamble de las cápsides y la afinidad por receptores a nivel epitelial.

    El propósito de este estudio fue identificar las variaciones moleculares del gen L1 de HPV16 en aislamientos provenientes de cepillados cervicales de mujeres colombianas con citología normal y con cáncer de cuello uterino, con el fin de analizar si existen variaciones que alteren las regiones

  20. Estimación del Valor Genético para Producción de Leche a Través de un Modelo Lineal Mixto con Repetibilidad (Modelo Animal

    Directory of Open Access Journals (Sweden)

    Montoya Serna Camilo

    1998-06-01

    Full Text Available Se estimó el valor genético aditivo para producción por Lactancia a través de un modelo lineal mixto con repetibilidad (Modelo Animal, en vacas Holstein de un hato "élite" localizado en zona ecológica de bosque muy húmedo montano bajo (bmhMB y situado a 2600 m.s.n.m. con una temperatura promedio de 12,5°C, en el Departamento de Antioquia Colombia. Para la aplicación del modelo animal, la heredabilidad utilizada fue de 0,21 ± 0,07 la cual fue estimada en un trabajo previo. La repelibilidad fue es limada a través de un modelo lineal mixto usando el programa de mínimos cuadrados de Harvey (1988. Los registros utilizados fueron un total de 276 lactancias correspondientes a 43 vacas con cuatro más lactancias consecutivas en el hato. Además del efecto aleatorio vaca, se tuvieron en cuenta los efectos fijos: año, edad, época, regresión de la producción real sobre la duración de lactancia y procedencia. EL coeficiente de determinación del modelo fue (J = 0,82. Los efectos de vaca, año, edad y regresión de la producción sobre la duración de la lactancia fueron significativos (P ~ 0,05 a excepción de la época de parto y procedencia. La repetibilidad obtenida fue de 0,45 ± 0,07. Para la estimación de los valores de cría se escogieron 24 individuos, 22 hembras y 2 machos, los cuales fueron escogidos teniendo en cuenta el parentesco entre ellos (matriz de parentesco, además de contar con suficiente información sobre producción. Para un período de nueve años, 1986-1994, se tomó para las hembras la producción por lactancia previamente ajustada por los efectos duración a 305, número de partos, edad, y época. El año fue tomado como efecto fijo dentro del modelo animal y coma aleatorios los valores de cría para producción de leche. Los individuos se clasificaron de mayor a menor de acuerdo con sus valores de cría, incluyendo dos machos y una hembra que no contaban con información propia. Los valores de cría se

  1. Evaluación de los niveles séricos de la proteína de unión de alta afinidad de la hormona de crecimiento humana (GHBP y del polimorfismo del exón 3 del gen del receptor de GH en niños con talla baja idiopática

    Directory of Open Access Journals (Sweden)

    María G Ballerini

    2010-04-01

    Full Text Available La talla baja idiopática (TBI incluye a un grupo heterogéneo de pacientes con fallas en su crecimiento. Una causa probable de TBI puede ser la insensibilidad a la GH (IGH. La proteína de unión de GH de alta afinidad (GHBP se genera por el clivaje proteolítico de la porción extracelular del receptor de GH (GHR y su determinación se propone como un marcador periférico del nivel de GHR en los tejidos. El objetivo de este trabajo fue evaluar los niveles de GHBP circulantes y su asociación con factores de crecimiento y el polimorfismo del exón 3 del gen GHR en niños con TBI. Los niños con TBI presentaron talla, IMC, IGF-I, IGFBP-3, ALS y niveles de GHBP significativamente más bajos que un grupo de niños de edad comparable (pIdiopathic Short Stature (ISS includes a heterogeneous group of children with growth failure. One possible explanation for the growth failure is a reduced responsiveness to growth hormone (GH. Human circulating GH is partially bound to a highaffinity binding protein (GHBP which is derived from proteolytical cleavage of the extracellular domain of the GH receptor. Many reports have demonstrated a close relationship between GHBP and liver GH receptor status in physiological conditions and diseases. Moreover, serum GHBP measurement has been proposed as an useful peripheral index of GH receptor abundance. Our objective was the evaluation of serum GHBP levels and its probable association with serum growth factors (IGF-I, IGFBP-3 and ALS and the exon 3 polymorphism of the extracellular domain of the GHR gene in ISS children. Children with ISS presented significantly lower height SDS, BMI SDS, serum components of the IGFs system and GHBP concentration as compared to an age-matched control group of normal children (p<0.001. Interestingly, exon 3 genotype did not influence the differences observed in these parameters. The maximal GH response obtained after two GH provocative tests inversely and significantly correlated to

  2. Diseño e implementación de una unidad didáctica interactiva apoyada en tic, para la enseñanza-aprendizaje significativo del tema genética, de ciencias naturales en estudiantes del grado octavo, Institución Educativa José María Vélaz, Medellín

    OpenAIRE

    Jimenez Cortes, Monica Isabel

    2015-01-01

    Resumen: El documento presentado a continuación, titulado: diseño e implementación de una unidad didáctica interactiva apoyada en tic, para la enseñanza-aprendizaje significativo del tema genética, de ciencias naturales en estudiantes del grado octavo, institución educativa José María Vélaz, Medellín, constituye el trabajo final de la maestría en enseñanza de las ciencias exactas y naturales. En este trabajo se muestra la importancia que tienen las TIC en la educación, específicamente en e...

  3. Determination of human cytomegalovirus genetic diversity in different patient populations in Costa Rica Determinación de la diversidad genética del citomegalovirus humano en diferentes poblaciones de pacientes en Costa Rica

    Directory of Open Access Journals (Sweden)

    Sara Ahumada-Ruiz

    2004-04-01

    Full Text Available Seroprevalence of HCMV in Costa Rica is greater than 95% in adults; primary infections occur early in life and is the most frequent congenital infection in newborns. The objectives of this study were to determine the genetic variability and genotypes of HCMV gB gene in Costa Rica. Samples were collected from alcoholics, pregnant women, blood donors, AIDS patients, hematology-oncology (HO children and HCMV isolates from neonates with cytomegalic inclusion disease. A semi-nested PCR system was used to obtain a product of 293-296 bp of the gB gene to be analyzed by Single Stranded Conformational Polymorphism (SSCP and sequencing to determine the genetic polymorphic pattern and genotypes, respectively. AIDS patients showed the highest polymorphic diversity with 14 different patterns while fifty-six percent of HO children samples showed the same polymorphic pattern, suggesting in this group a possible nosocomial infection. In neonates three genotypes (gB1, gB2 and gB3, were determined while AIDS patients and blood donors only showed one (gB2. Of all samples analyzed only genotypes gB1, 2 and 3 were determined, genotype gB2 was the most frequent (73% and mixed infections were not detected. The results of the study indicate that SSCP could be an important tool to detect HCMV intra-hospital infections and suggests a need to include additional study populations to better determine the genotype diversity and prevalence.La seroprevalencia de citomegalovirus es mayor del 95% en la población adulta de Costa Rica; la infección primaria ocurre muy temprano en la vida y es la infección congénita más frecuente en recién nacidos. El objetivo de este trabajo fue determinar la variabilidad genética y los genotipos del gene gB del citomegalovirus humano. Se recolectaron muestras de sangre de mujeres embarazadas, alcohólicos, pacientes con SIDA, niños con trastornos hemato-oncológicos, donadores de sangre y se incluyeron aislamientos de citomegalovirus de

  4. La cuestión genérica del “drama histórico” con la temática colonial en las dramaturgias mexicana y española del siglo XX

    OpenAIRE

    Krpan, Ivana

    2015-01-01

    El artículo problematiza las singularidades discursivas del drama histórico en las obras post(modernas) de los autores españoles mexicanos del siglo XX. Se analizan los paralelismos temáticos y estructurales en los textos que tratan el tema del descubrimiento y la conquista del Nuevo Mundo. Mediante una dramatización paródica de la historia oficial y el alejamiento extradiegético de los personajes, los autores problematizan la estructura del relato histórico, vinculándola con las técnicas dis...

  5. Aplicación de algoritmos genéticos en la optimización del sistema de abastecimiento de agua de barquisimeto­-cabudare

    OpenAIRE

    RINCÓN O., JEAN CARLOS

    2009-01-01

    Se propone una metodología de optimización de sistemas de abastecimiento de agua a nivel de proyectos de expansión, basada en los principios fundamentales de los Algoritmos Genéticos; para luego ser aplicada al sistema que abastece a Barquisimeto–Cabudare (Venezuela). Para ello, se estructuró el modelo partiendo de la teoría básica, y para proceder a su aplicación se recopiló toda la información requerida, se formularon las alternativas, se definió la función objetivo así como las restric...

  6. Las prácticas externas y el Espacio Europeo de Educación superior: análisis del desarrollo de competencias genéricas

    OpenAIRE

    Pérez López, María del Carmen

    2014-01-01

    Tesis inédita presentada en la Universidad Europea de Madrid. Facultad de Ciencias Sociales. Programa de Doctorado en Educación La armonización del Espacio Europeo de Educación Superior, tanto a nivel legislativo como pedagógico, es ya una realidad. El EEES ha supuesto, entre otras muchas cosas, una reformulación de las nuevas metodologías de enseñanza-aprendizaje centradas fundamentalmente en el papel protagonista, activo y dinamizador del estudiante, y con un claro enfoque profesionaliza...

  7. Receptor de estrógenos: variantes genéticas del ESR1 y parámetros bioquímicos de riesgo cardiovascular Estrogen Receptor: Polymorphisms of ESR1 and Biochemical Markers of Cardiovascular Risk

    Directory of Open Access Journals (Sweden)

    MB Rauschemberger

    2012-06-01

    Full Text Available El estudio de la asociación entre marcadores genéticos y signos clínicos y/o bioquímicos de determinadas patologías, se ha propuesto para evaluar la posible utilidad clínica de emplear las determinaciones genéticas como predictores de riesgo. La enfermedad cardiovascular es una de las principales causas de muerte en mujeres posmenopáusicas en el mundo occidental, hecho atribuido al descenso de los niveles de estrógenos circulantes. El objetivo de este trabajo fue investigar la existencia de asociaciones entre los polimorfismos del gen del receptor de estrógenos ESR1 (PvuII y XbaI y los marcadores bioquímicos de riesgo cardiovascular en una población local de mujeres sanas fértiles y posmenopáusicas. Se clasificó a ambas poblaciones en subgrupos según el marcador genético 1(P/p, 2(p/p, 3(P/P, A(X/x, B(x/x, C(X/X, donde P/X indica ausencia de corte y p/x indica presencia de corte para PvuII y XbaI respectivamente. En una muestra de sangre periférica, se determinaron parámetros bioquímicos de perfil lipídico, hemostasia e inflamación y se compararon fértiles vs. posmenopáusicas agrupadas según el genotipo. Las mujeres posmenopáusicas con genotipo A presentaron un aumento significativo en los niveles de colesterol total; C-LDL y triglicéridos respecto a las fértiles. En el subgrupo 1 se detectaron cambios solo en CT y C-LDL. En el haplotipo 1A de posmenopáusicas solo se evidenció aumento en colesterol total. Los parámetros de la hemostasia y de inflamación no mostraron cambios significativos entre fértiles y posmenopáusicas en función del marcador genético presente. Los resultados sugieren que, el genotipo A identifica a la población de mujeres posmenopáusicas con un perfil lipídico más desfavorable respecto a las fértiles del mismo subtipo. Los autores declaran no poseer conflictos de interés.In the last few years, the study of the association between genetic markers and clinical or biochemical signs of

  8. Diseño y aplicación de una estrategia para la enseñanza de la genética con el fin de propiciar aprendizajes significativos en el grado octavo mediante el uso de las TIC: Estudio de caso en la Institución Educativa Dinamarca del municipio de Medellín

    OpenAIRE

    Arango Castrillón, Julián Andrés

    2013-01-01

    Resumen: Este trabajo final de maestría presenta el diseño y aplicación de una estrategia para la enseñanza de la genética mediada por el uso de las Tecnologías de la Información y la comunicación (TIC), con el fin de propiciar aprendizajes significativos en los estudiantes del grado octavo de la Institución Educativa Dinamarca del municipio de Medellín. Para esto se creó un curso virtual, con una duración de 4 semanas y en el que se enseñan los aspectos principales de la genética como sus co...

  9. Is tumor necrosis factor - 376a promoter polymorphism associated with susceptibility to multiple sclerosis? ¿El polimorfismo-376A del promotor del gen del factor de necrosis tumoral se asocia con una mayor susceptibilidad a padecer esclerosis múltiple?

    Directory of Open Access Journals (Sweden)

    Marcelo A. Kauffman

    2007-10-01

    Full Text Available A single nucleotide polymorphism (SNP at position -376 of the tumor necrosis factor á gene (TNFA has been associated with susceptibility to multiple sclerosis (MS in Spain. However, no association was found in populations from the USA and The Netherlands. Here we investigate the association between the TNFA - 376A SNP and MS susceptibility in Argentinean patients with MS. The A/G genotype was found in 4.4% of patients (n=90 and in 4.8% of healthy individuals (n=84; p=0.92; odds ratio=0.93; confidence interval: 0.23- 3.84. Thus, no significant differences in genotype and allele frequencies were found between healthy individuals and patients with MS in Argentina.Un polimorfismo de nucleótido único (SNP, por sus iniciales en inglés en la posición -376 del gen codificante del factor de necrosis tumoral á (TNFA ha sido asociado en España con un mayor riesgo a padecer esclerosis múltiple (EM. Sin embargo, esta asociación no fue encontrada en estudios hechos en poblaciones provenientes de los EE.UU. y Holanda. Aquí investigamos la asociación entre el SNP TNFA -376A y el desarrollo de EM en una población de pacientes argentinos con EM. El genotipo A/G fue encontrado en 4.4% de los pacientes (n=90 y en 4.8% de los controles sanos (n=84; p=0.92; odds ratio=0.93; intervalo de confianza: 0.23-3.84. En consecuencia, no encontramos diferencias en las frecuencias alélicas y genotípicas entre los sujetos enfermos y los controles sanos en Argentina.

  10. Análisis genético del sistema de captación de hemo en "Vibrio anguillarum" : caracterización estructural y funcional

    OpenAIRE

    Mouriño López, Susana

    2006-01-01

    Vibrio anguillarum está considerado como uno de los patógenos bacterianos más importantes dentro de la acuicultura marina, siendo responsable de numerosos brotes de vibriosis en especies de gran valor comercial. Uno de sus principales factores de virulencia reside en la capacidad para obtener hierro del hospedador, pudiendo utilizar distintos compuestos de hemo como fuentes de hierro. Debido a su abundancia en el organismo hospedador, la existencia de mecanismos específicos para l...

  11. Variabilidad y estructura genética en dos poblaciones de Vicugna vicugna (Camelidae del norte de Chile Genetic variability and structure in two populations of Vicugna vicugna (Camelidae from northern Chile

    Directory of Open Access Journals (Sweden)

    M. CECILIA NORAMBUENA

    2003-03-01

    Full Text Available RESUMEN Se estudiaron dos poblaciones de Vicugna vicugna pertenecientes a la Primera y Segunda regiones del país, en base a la determinación electroforética de 28 loci presumtivos. Las diferencias fenotípicas existentes entre las vicuñas de estas poblaciones hace necesario este trabajo con el fin de re-estudiar su posición taxonómica y obtener antecedentes de variabilidad genética y estructura poblacional que podrían resultar útiles en su manejo de conservación. En la población de vicuñas de la Primera Región se detectó un polimorfismo de 17,8 % y un nivel de heterocigosidad de 0,078. En aquellas de la Segunda Región, el polimorfismo y la heterocigosidad se estimaron en 14,3 % y 0,045, respectivamente. Ambos parámetros revelan un alto grado de variabilidad genética poblacional. Se encontró un nivel de subestructuración démica alto (F ST = 0,344 y un grado de diferenciación génico y genotípico significativo entre las poblaciones. Se infiere que la deriva genética y el sistema social poligámico tendrían un rol importante como promotores de las diferencias genéticas observadas. El valor de distancia génica (D = 0,097 no confirmó el estatus subespecífico atribuido en base a sus diferencias morfológicas.Two populations of Vicugna vicugna from regions First and Second of Chile were studied on the basis of the electrophoretic determination of 28 presumptive loci. Due to the phenotypic differences between the populations mentioned above, this kind of study is required to determine some parameters like taxonomic status, genetic variability and population structure in order to help in conservation management of the specie. The percentage of polymorphism and the level of heterozigosity of vicuñas from the First region were 17.8 % and 0.078, respectively. The corresponding figures of vicuñas from the Second were 14.3 % and 0.045, respectively. These two parameters show that the two populations have a high degree of genetic

  12. Utilización de la reacción en cadena de la polimerasa para amplificar dos secuencias del gen glicina decarboxilasa que codifica para la proteína P del sistema de clivaje de la glicina, relacionado con hiperglicinemia no cetósica

    Directory of Open Access Journals (Sweden)

    Sarmiento C.

    2001-06-01

    Full Text Available Los Errores Congénitos del Metabolismo son trastornos bioquímicos de origen genético, que causan un defecto específico en la estructura o función de las moléculas proteicas involucradas en una vía metabólica.Dentro de los errores innatos del metabolismo se encuentra la hiperglicinemia no cetósica (HNC, la cual es un desorden autosómico recesivo, que se caracteriza por un defecto en el sistema de clivaje de la glicina, (SCG ocasionando la acumulación de este aminoácido en los diferentes fluidos corporales, causando alteraciones neurológicas y desórdenes somáticos que llegan a ser letales. El SCG es un sistema multienzimático de carácter mitocondrial y está compuesto por cuatro proteínas individuales reconocidas como proteína P (piridoxal fosfato, H (ácido lipóico, T (tetrahidrofolato y L (deshidrogenasa lipoamida (1. La proteína P es codificada por el gen glicina decarboxilasa (GLDC (2; se han reportado varias mutaciones
    en este gen, siendo la mutación S564I, la más común (3. La actividad de esta proteína se encuentra disminuida o ausente en 80% de los pacientes con HNC (4. Los estudios de esta entidad en Colombia, se iniciaron con Barrera y col (5, pero no se disponía de un diagnóstico enzimático ni molecular para la HNC; por lo tanto, la Universidad Colegio Mayor de Cundinamarca, en asociación con la unidad de biología procreativa del Instituto Materno Infantil y la Universidad Nacional de Colombia, inició el estudio bioquímico y molecular
    de esta enfermedad.

  13. Estudio de la prevalencia de mutaciones en línea germinal (síndrome de Birt-Hogg-Dubé) y somáticas del gen FLCN en pacientes con fibrofoliculomas o tricodiscomas cutáneos y/o neumotórax recidivantes y/o bilaterales.

    OpenAIRE

    López Castillo, Verónica

    2016-01-01

    Antecedentes y objetivos: En 1977, tres doctores canadienses, Birt y cols., describieron en una serie de pacientes la presencia de múltiples lesiones papulosas, del color de la piel, de aspecto cupuliforme, localizadas en la cara, cuello y tronco, en asociación con lesiones pediculadas en axilas y párpados superiores que correspondían histológicamente a fibrofoliculomas, tricodiscomas y fibromas blandos. Esta asociación se definió como síndrome Birt-Hogg-Dubé. La alteración del gen FLCN produ...

  14. Análisis de asociación de nuevos polimorfismos en el promotor del gen MMP- 1 y osteoartritis secundaria a displasia de cadera en perros. Association analyses of novel polymorphisms in the MMP-1 promoter gene with osteoarthritis secondary to hip dysplasia in dogs

    OpenAIRE

    V.B. Fassa; G. Oertlin; J.G. Waldhorn; A.O. Álvarez; E.G. Maubecin; D.A. Pazos; Flores, M; G.B. Pinto; M.J. Huguet; Conte, A.; G. Marrube

    2010-01-01

    La displasia de cadera (DC) es una enfermedad poligénica caracterizada por laxitud articular y pérdida de congruencia que conduce a la osteoartritis (OA). En muchas condiciones patológicas, incluyendo a la artritis puede observarse un aumento de la síntesis de MMP-1. El promotor del gen MMP-1 contiene elementos de respuesta a citoquinas, los factores de trascripción AP-1 y SAF-1 que se hallan aumentados en OA. El objetivo del presente estudio fue la identificación y análisis de polimorfismos ...

  15. Roles of G1359A polymorphism of the cannabinoid receptor gene (CNR1 on weight loss and adipocytokines after a hypocaloric diet Papel del polimorfismo G1359A del gen del receptor endocanabinoide tipo 1 (CNR1 en la perdida de peso y adipocitoquinas tras una dieta hipocalórica

    Directory of Open Access Journals (Sweden)

    D. A. De Luis

    2011-04-01

    Full Text Available Background: A intragenic biallelic polymorphism (1359 G/A of the CB1 gene resulting in the substitution of the G to A at nucleotide position 1359 in codon 435 (Thr, was reported as a common polymorphism in Caucasian populations. Intervention studies with this polymorphism have not been realized. Objective: We decided to investigate the role of the polymorphism (G1359A of CB1 receptor gene on adipocytokines response and weight loss secondary to a lifestyle modification (Mediterranean hypocaloric diet and exercise in obese patients. Design: A population of 94 patients with obesity was analyzed. Before and after 3 months on a hypocaloric diet, an anthropometric evaluation, an assessment of nutritional intake and a biochemical analysis were performed. The statistical analysis was performed for the combined G1359A and A1359A as a group and wild type G1359G as second group, with a dominant model. Results: Forty seven patients (50% had the genotype G1359G (wild type group and 47 (50% patients G1359A (41 patients, 43.6% or A1359A (6 patients, 6.4% (mutant type group had the genotype. In wild and mutant type groups, weight, body mass index, fat mass, waist circumference and systolic blood pressure decreased. In mutant type group, resistin (4.15 ± 1.7 ng/ml vs. 3.90 ± 2.1 ng/ml: P Antecedentes: Un polimorfismo intragénico (1359 G / A del gen del receptor CB1 que produce la sustitución en la posición 1359 en el codón 435 (Thr, se ha descrito como un polimorfismo común en poblaciones caucásicas. No se han realizado estudios de intervención dietética teniendo en cuenta este polimorfismo. Objetivo: Se decidió investigar el papel del polimorfismo (G1359A del gen del receptor CB1 en la respuesta a las adipocitoquinas y la pérdida de peso secundaria a una modificación de estilo de vida (dieta mediterránea hipocalórica y ejercicio en pacientes obesos. Diseño: Se analizó una población de 94 pacientes con obesidad. Antes y tras 3 meses con una

  16. Estudio de la influencia de la nutrición y genética maternas sobre la programación del desarrollo del tejido adiposo fetal: Estudio PREOBE Study of maternal nutrition and genetic on the foetal adiposity programming: The PREOBE study

    OpenAIRE

    Campoy, C.; Martín-Bautista, E.; L. García-Valdés; Florido, J; A. Agil; J. A. Lorente; Marcos, A; López-Sabater, M. C.; T. Miranda-León; Sanz, Y.; Molina-Font, J A

    2008-01-01

    Introducción: La genética y la alimentación de la madre antes y durante el embarazo, las distintas patologías metabólicas maternas, así como la ingesta de nutrientes en los primeros meses de vida del recién nacido parecen estar implicados en la etiología de la obesidad y sus consecuencias a largo plazo. La posible contribución de estos y otros factores, los mecanismos y sus efectos en el metabolismo y desarrollo de la enfermedad están aún en fase de investigación. Objetivo: Obtener un mayor c...

  17. Estudio genómico de la influencia vírica en el desarrollo del cáncer de colon

    OpenAIRE

    Acebrón Garcia de Eulate, Marta

    2013-01-01

    El cáncer de colon presenta una distribución geográfica inusual lo que sugiere que haya una nueva causa ambiental, como una infección viral. En este Trabajo Fin de Máster se propone que dicha diferencia en la distribución del cáncer de colon puede deberse al consumo de ternera poco cocinada, y que en ella esté presente algún virus que cause parte de los cánceres de colon. Para ello se plantea comparar las muestras de cáncer de colon de pacientes omnívoros frente a las de pacientes vegetariano...

  18. GEN 105 UOP course tutorial/tutorialoutlet

    OpenAIRE

    NARESH 1

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com     GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion...

  19. Regulación del flujo sanguíneo uterino. II. Funciones de estrógeno y receptores estrogénicos α/β en acciones genómicas y no-genómicas del endotelio uterino *

    Science.gov (United States)

    Mayra, Pastore R.; Rosalina, Villalón L.; López, Gladys; Iruretagoyena, Jesús; Magness, Ronald

    2015-01-01

    Resumen El embarazo está marcado por cambios y adaptaciones cardiovasculares que son importantes para el crecimiento y mantenimiento de la placenta y el feto. Durante este periodo, las adaptaciones vasculares uterinas manifiestan cambios clasificados como de corto o largo plazo los cuales están relacionados con adaptaciones vasodilatadoras, angiogénicas o de remodelación. El estrógeno y los receptores estrogénicos clásicos (REs), RE-α y RE-β, han demostrado ser parcialmente responsables por facilitar el incremento dramático en el fluido sanguíneo uterino necesario durante el embarazo. En ésta revisión bibliográfica se discuten la base estructural para la diversidad y selectividad funcional de los REs por el estrógeno, el papel de los REs sobre los efectos genómicos y no-genómicos en células endoteliales de arterias uterinas (CEAU). Estos temas integran el conocimiento científico sobre la regulación molecular de CEAU para mantener el incremento fisiológico en la perfusión útero-placentaria observada durante un embarazo normal. PMID:26113751

  20. Capítulo VIII: heredabilidad del rendimiento y sus componentes en tomate, Lycopersicon esculentum, Mill.; correlaciones genéticas y ambientales

    Directory of Open Access Journals (Sweden)

    Lobo Arias Mario

    1994-12-01

    Full Text Available

    El presente estudio se desarrolló con el fin de determinar la heredabilidad, en sentido amplio, del rendimiento y sus componentes en tomate y a la vez describir las relaciones genotípicas y ambientales para dichos componentes en una población constituida por tres líneas endocriadas (Ponderosa Red, Chonto y Red Cherry como progenitores y las F1 provenientes de los cruzamientos entre los progenitores en una sola dirección. La heredabilidad se estimó en base a los cuadrados medios esperados del análisis de varianza y las correlaciones genotípicas y ambientales en base a los cuadrados medios esperados del análisis de varianza y productos cruzados medios del análisis de covarianza. Para el rendimiento se estimó una heredabilidad de 79.3%, para el número total de frutos de 93.107%, para peso promedio de de fruto de 4.25%. Los coeficientes de correlación genotípicos estimados fueron: para número de frutos por planta y peso promedio de frutos de -0.985; para número de inflorescencias por planta y número de frutos por inflorescencia de 0,541; para número de lóculos por fruto y peso promedio de lóculos de 0.826. Los coeficientes de correlación ambiental estimados fueron: para número de frutos por planta y peso promedio de frutos de -0.512; para rendimiento y número de frutos por planta de -0.065; para rendimiento y peso promedio de frutos de 0.613; para número de inflorescencias y número de frutos por inflorescencias de -0.878; para número de lóculos por fruto y peso promedio de lóculos de -0.779. Lo anterior indica que el método de mejoramiento para rendimiento, dentro de la población estudiada, seria la selección, tomando como índice de selección apropiado el peso promedio de frutos pero sin descuidar el número de frutos. Se debe maximizar las condiciones favorables de suelo y manejo de cultivo para permitir una adecuada manifestación de los dos componentes primarios del rendimiento.

    This study

  1. Clonación del cDNA del gen de la insulina humana en raíces aéreas de Brassica oleracea var italica (brócoli)

    OpenAIRE

    Berenice García Reyes; María del Carmen Montes Horcasitas; Emma Gloria Ramos Ramírez; Armando Ariza Castolo; Josefina Pérez Vargas; Octavio Gómez Guzmán; Graciano Calva Calva

    2010-01-01

    La insulina humana es una proteína de actividad hormonal que regula los niveles de glucosa en sangre. Cuando la insulina falla se desarrolla el padecimiento conocido como diabetes. La insulina se ha expresado en bacterias, levaduras, hongos, células animales y sistemas vegetales por biotecnología vegetal. En este trabajo presentamos los resultados del uso de raíces transformadas de Brassica oleracea var italica (Brocoli) para producir insulina humana. Materiales y Métodos: El cDNA del corresp...

  2. Genetic Characterization of Old Grapevines collected in Oases of the Atacama Desert Caracterización Genética de Vides Antiguas colectadas en Oasis del Desierto de Atacama

    Directory of Open Access Journals (Sweden)

    Ingrid Poblete

    2011-09-01

    variantes génicas que pueden ser rescatadas para su uso directo o su incorporación en programas de fitomejoramiento. La primera etapa de este rescate es la colecta y caracterización del germoplasma propio de una región particular. Este estudio describe la caracterización genética de 21 accesiones de vid colectadas en el desierto de Atacama, en el Norte de Chile. La caracterización se basó en 12 marcadores de microsatélites (SSR, complementado con marcadores de tipo fragmentos amplificados de largo variable (AFLP. La mayoría de las accesiones colectadas con bayas negras corresponden al genotipo ‘País’, un cultivar antiguo que se encuentra distribuido en toda América. Sin embargo, entre las accesiones de baya negra, una de ellas mostró un fenotipo abortivo severo (22S7, y otro (6S4 difirió en un alelo con respecto a ‘País’. Ambos podrían ser ejemplos de mutaciones somáticas, aun cuando no fue posible detectar variaciones en sus patrones de AFLP. Por otra parte, la única accesión con bayas negras que exhibió características genéticas diferentes a ‘País’ correspondió a ‘Gros Colman’ (5CN, un genotipo supuestamente proveniente de Georgia, Rusia, introducido en esta región a mediados del siglo XX. Una mayor diversidad genética fue detectada entre las accesiones de bayas blancas y rosadas, que se clasificaron en cinco clados en base a sus alelos de microsatélites. De estos genotipos, 11Si se identificó como ‘Emperatriz’ o ‘Red Seedless’, una variedad de origen argentino, mientras que las accesiones 16H1 y 17H2 correspondieron a un cruzamiento de ‘Moscatel de Alejandría’ × ‘País’. Por último, la accesión 20S5 se identificó como ‘Ahmeur bou Ahmeur’, un genotipo argelino de bayas de color rosado. Dos genotipos semillados de bayas blancas, pequeñas o grandes, no se asimilaron con alguna variedad conocida. Se discute también la posibilidad de utilizar algunas de estas accesiones en fitomejoramiento, para aumentar

  3. Evaluación genética de los componentes del rendimiento en progenitores de la caña de azúcar (Saccharum oficinarum hib.

    Directory of Open Access Journals (Sweden)

    Lorenzo Cabrera Miranda

    2010-10-01

    Full Text Available En este trabajo se emplearon los progenitores femeninos la CP 52-43; C 1566-75; C 177-76 y la CP 772-2086 y los masculinos Ja 64-19; B 45181; C 227-59; y la C 323-68 en diseño factorial 4 X 4. Todos elegidos sobre la base del comportamiento agrícola y azucarero. Se estudiaron los caracteres longitud de los tallos (LT, diámetro de los tallos (DT en cm; número de tallos por cepas (NT y el brix refractométrico (BR. Se encontró que los coeficientes de heredabilidad (H estimado lograron valores muy bajo. La habilidad combinatoria general (HCG tuvo mejor comportamiento que la habilidad combinatoria específica (HCE para el DT para el BR, no así para la LT y el NT por cepas que resultó ser la HCE. Se evalúan los progenitores femeninos y masculinos atendiendo a las habilidades combinatorias las cuales se recomiendan para la evaluación de progenitores en el mejoramiento de la caña de azúcar.

  4. Valoración ambiental preliminar del riesgo-beneficio de la liberación de una semilla de arroz genéticamente modificada

    Directory of Open Access Journals (Sweden)

    Sergio Bermúdez Muñoz

    2010-10-01

    Full Text Available La Evaluación de Impacto Ambiental (EIA es una herramienta de gestión que permite, de forma holística, determinar las potenciales alteraciones que una puede tener sobre el ambiente, pues considera los impactos positivos y negativos que podrían presentarse. La aplicación de esta herramienta cuando se libera un OGM, con la ayuda de información de campo y secundaria, se convierte en un esfuerzo pionero, pues permite a quienes toman decisiones y a la opinión pública analizar los pro y contra que la actividad podría tener. Mediante el empleo de un software para valorar impactos como RIAM, se logra una visión integral del riesgo y el beneficio gracias a la información obtenida, y se elabora un pronóstico de lo que podría ocurrir a partir de los supuestos planteados. Aunque el flujo de genes (-B es un riesgo, también se observan beneficios como la recuperación de campos infestados de arroz rojo y una menor persistencia de herbicidas en el ambiente (E.

  5. Evaluación del efecto de tres polimorfismos en el gen del receptor adrenérgico beta-2 en el trabajo de parto pretérmino

    Directory of Open Access Journals (Sweden)

    Fanny Cuesta González

    2004-02-01

    Full Text Available

    El trabajo de parto pretérmino (TPP, es una causa importante
    de morbilidad y mortalidad perinatal. Debido a la inmadurez y a
    su baja capacidad de adaptación al ambiente extrauterino, la
    supervivencia neonatal y las complicaciones de un recién nacido
    pretérmino generan un problema de salud pública de importancia
    mundial.
    Los receptores adrenérgicos ? 2 (? 2AR son el principal mecanismo de comunicación intercelular para inducir relajación
    de las fibras musculares miometriales y tanto estos receptores como sus vías de señalización intracelular sufren alteraciones
    importantes en relación con el inicio del trabajo de parto normal.
    Recientemente se ha encontrado que la homocigozidad para el polimorfismo Arg16, que está asociado in vitro con la tenuación del proceso de disminución del número de los ? 2AR 1, protege del parto pretérmino (2, y que el alelo Glu27, sociado con resistencia a la desensibilización in vitro, contradictoriamente podría ser un factor de riesgo para el parto antes de las 37 semanas de gestación (3.

  6. Evaluación de regiones polimórficas del gen de la miostatina en ganado Beefmaster Evaluation of polymorphic regions of myostatin gene in Beefmaster cattle breed

    Directory of Open Access Journals (Sweden)

    VR Moreno

    2008-01-01

    Full Text Available En el presente trabajo se analizaron regiones potencialmente portadoras de mutaciones del gen miostatina, en la raza Beefmaster con la técnica de escaneo de secuencias por escisión de la base timina (BESS-T y un método fluorescente basado en las temperaturas de disociación (Tm's. Se encontraron cinco cambios nucleotídicos, cuatro en las regiones flanqueantes de los intrones 1 y 2, y uno en el exón II, éstos se agruparon en 11 haplotipos. Se optimizó un método fluorescente basado en la Tm's, para analizar una mayor cantidad de animales en la región con mayor número de mutaciones previamente detectada por BESS-T. La validación de la técnica de Tm's fue realizada utilizando los resultados de las muestras genotipificadas previamente mediante la técnica de BESS-T y se encontró un 93,5% de concordancia entre ambas técnicas. Las mutaciones encontradas mediante la técnica de BESS-T no sugieren un efecto directo sobre la función del gen, sin embargo, su alta frecuencia en la población bajo estudio abre la posibilidad de evaluar su asociación con características productivas, como ganancia de peso o conformación de los individuos portadores. Se propone a la técnica de medición de temperaturas de disociación (Tm's como un método de tamizaje de moderado rendimiento, para la detección de genotipos mutadosHere we analyze GDF8 gene regions which are potential carriers of polymorphisms using both base excision sequence scanning thymine-base (BESS-T and a fluorescent technique based on temperatures of dissociation (Tm's technique. The first one permitted us to detect five nucleotide changes located four in the flanking regions of introns 1 and 2 and one in exon II. All the sequence variations were grouped in 11 haplotypes, which were distributed in the population tested. In order to evaluate a highest number of animals, a Tm's technique was optimized to analyze the region harboring most of mutations previously detected with BESS

  7. Using GenBank.

    Science.gov (United States)

    Sayers, Eric W; Karsch-Mizrachi, Ilene

    2016-01-01

    GenBank(®) is a comprehensive database of publicly available DNA sequences for 300,000 named organisms, more than 110,000 within the embryophyta, obtained through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Daily data exchange with the European Nucleotide Archive (ENA) in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system that integrates data from the major DNA and protein sequence databases with taxonomy, genome, mapping, protein structure and domain information, as well as the biomedical journal literature in PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. GenBank usage scenarios ranging from local analyses of the data available via FTP to online analyses supported by the NCBI web-based tools are discussed. To access GenBank and its related retrieval and analysis services, go to the NCBI home page at www.ncbi.nlm.nih.gov . PMID:26519398

  8. Laminación y bioturbación en carbonatos lagunares: interpretación genética (Cuenca del Guadiana, Badajoz

    Directory of Open Access Journals (Sweden)

    Armenteros, I.

    1986-10-01

    Full Text Available The sedimentological study of both polished and thin sections of samples taken from the 1-2 m thick unit of laminated carbonates overlying the Miocene succession infilling the Neogene Guadiana Basin (western Spain reveals the existence of prominent features that are discussed in the paper.
    The lamination visible in hand specimens is due to the alternance of massive and laminated layers. In thin sections, the massive layers are made or intraclastic, ooidal pelletoidal particles, whereas the laminated ones show gently undulating, alternating light and dark-coloured layers. Inside the laminated and, to a lesser extent, the massive leyers it is possible to recognize; (a abundant vestiges of algal filaments, (b abundant remains of charophites, (c small, usually grouped-up, cavities (mean diameter about 250 microns and bigger, pellet-filled cavities, both types related to burrowing; (d sparse prisms of calcite resembling those of Microcodium, and (e cclusters of trapezohedral crystals of calcite with rhomboidal and. lenticular sections,these being more abundant in the massive layers.
    The sedimentological interpretation assumes that sedimentation took place in swamps with periodic oscillations of the water level. The laminated layers, el stromatoIithic nature, correspond to quiet realms under constant water level during dry stages. The massive layers record higher environmental energy during flood stages, that is able to remobilize the cracked sediments of the former dry stages.
    The vital activity of Chironomid insects lead to the two described types of burrowing: the small grape-like cavities correspond to eclosing eggs whereas the bigger pellet-filled cavities resulted from mining by larvae

    El estudio sedimentológico al microscopio y en secciones pulidas de las muestras de la unidad de carbonatos laminados (1 a 2 m de espesor, situada a techo de la sucesión miocena, que rellena la cuenca neógena del Guadiana

  9. Evaluación del potencial de mejoramiento genético en el crecimiento en altura de Acacia mangium Willd. Evaluation of the breeding potential in height growth for Acacia mangium Willd.

    Directory of Open Access Journals (Sweden)

    Iván Javier Pastrana-Vargas

    2012-04-01

    Full Text Available En el periodo 2009-2010, en Ayapel, Planeta Rica y Tierralta, departamento de Córdoba (Colombia se evaluó el desempeño en crecimiento en altura total de 90 familias de polinización abierta de Acacia mangium. En estos municipios el clima se clasifica, de acuerdo con Holdridge, como bosque seco tropical (Bs-T, excepto Tierralta que es bosque húmedo tropical (Bh-T. Durante el primer año de crecimiento, las plantas en cada familia fueron evaluadas en ensayos de progenie mediante un diseño experimental de bloques completos al azar, con seis bloques en cada una de las tres localidades. La parcela o unidad experimental consistió en seis plantas de polinización abierta por familia, distribuidas aleatoriamente en tres parejas espacialmente separadas dentro de cada bloque. La predicción de parámetros genéticos individuales y de familias se efectuó por medio del procedimiento BLUP y los componentes de varianza por medio del procedimiento REML utilizando el software SELEGEN. Las estimaciones de heredabilidad variaron entre In 2009-10, in Ayapel, Planeta Rica and Tierralta, Córdoba department (Colombia the growth performance in overall height of 90 open-pollinated families of Acacia mangium was evaluated. In these municipalities the climate is classified, according to Holdridge, like tropical dry forest (TDF, except Tierralta that it is tropical moist forest (TMF. During the first year of growth, plants in each family were evaluated in progeny tests using a randomized experimental complete block design, with six blocks in each of the three locations. The experimental unit consisted of six open-pollinated plants per family, randomly distributed in three spatially separated pairs within each block. The prediction of genetic parameters individual and of families was conducted by the method BLUP (best linear unbiased prediction and the variance components by REML (restricted maximum likelihood procedure using the software SELEGEN. Heritability

  10. Relación del polimorfismo rs9939609 del gen FTO con factores de riesgo cardiovascular y niveles de adipocitoquinas en pacientes con obesidad mórbida Relation of the rs9939609 gene variant in FTO with cardiovascular risk factor and serum adipokine levels in morbid obese patients

    Directory of Open Access Journals (Sweden)

    D. A. de Luis

    2012-08-01

    Full Text Available Introducción: Algunos polimorfismos del gen asociado con la masa grasa y la obesidad (FTO se han relacionado con la obesidad y parámetros bioquímicos. Nuestro objetivo fue analizar la relación del polimorfismo rs9939609 del gen FTO con el peso corporal, factores de riesgo cardiovascular y los niveles séricos de adipocitoquinas en una muestra de pacientes con obesidad mórbida. Material y métodos: Una muestra de 129 pacientes con obesidad mórbida (IMC > 40 se analizó en un diseño de corte transversal. A todos los pacientes se les determinó el peso, presión arterial, glucemia basal, proteína C reactiva (PCR, insulina, resistencia a la insulina (HOMA-R, colesterol total, LDL-colesterol, HDL-colesterol, triglicéridos y adipocitoquinas (adiponectina leptina, resistina, TNF-alfa, y los niveles de interleucina-6. Se evaluó la masa grasa mediante bioimpedancia tetrapolar y registró prospectivamente la ingesta de nutrientes durante tres días. En todos ellos se genotipo el polimorfismo del gen FTO (rs9939609. Resultados: Cuarenta y un pacientes (31,8% tenían el genotipo TT (grupo genotipo salvaje, 55 pacientes (42,6% el genotipo TA y 33 pacientes (25,6% el genotipo AA. El índice de masa corporal (43,6 (2,6 kg/m² vs. 44,1 (2,9 kg/m²; p Background: Common polymorphisms of the fat mass and obesity associated gene (FTO have been linked to obesity in some populations. The aim of our study was to analyze the relationship of the rs9939609 FTO gene polymorphism on body weight, cardiovascular risk factors and serum adipokine levels in morbid obese patients. Material and methods: A sample of 129 patients with obesity was analyzed in a cross sectional design. Weight, blood pressure, basal glucose, creactive protein (CRP, insulin, insulin resistance (HOMA, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides blood and adipocytokines (leptin, adiponectin, resistin, TNF alpha, and interleukin 6 levels were measured. A tetrapolar

  11. Valoración del medio natural por "unidades valle" en Puebla de Lillo (León para actividades genéricas y específicas

    Directory of Open Access Journals (Sweden)

    Alonso Herrero, E.

    1993-12-01

    Full Text Available The capability of different land units for supporting different activities in the Southern Cantabrian mountains has been assessed through the quantification of various areal parameters of the natural environment.
    The analysis has been carried out by means of activities/parameters relational matrixes. Twenty one "types" corresponding to five environmental parameters were considered. A two-step system of capability assessment was used, evaluating first seven generic activities and then five specific ones.

    [es] La cuantificación territorial (planimetría de diferentes parámetros del medio natural del término municipal de Puebla de Lillo, en la vertiente sur de la Cordillera Cantábrica, ha permitido la valoración de la capacidad de este medio natural frente a la posible implantación de diferentes actividades.
    Esta valoración se basa en la utilización de matrices de relación entre los elementos y tipos del medio natural frente a las actividades, eligiéndose diferentes tipos de parámetros pertenecientes a 5 elementos del medio natural.
    En primer lugar se ha realizado una valoración para seis actividades genéricas, consideradas éstas como el conjunto de varias actividades específicas relacionadas estrechamente entre sí. De este modo se establece una doble jerarquización en la capacidad de uso para las distintas "unidades valle". Posteriormente se muestra como ejemplo la valoración de cinco actividades específicas y se establece la capacidad de acogida para éstas.
    [fr] La capacité d'accueil pour de différentes activités de la Cordillère Cantabrique (versant méridional a été évaluée par la quantification des divers paramètres du moyen naturel.
    Le rapport entre les éléments et les types du moyen naturel et les activités, a été étudié sur l'analyse matriciel, dans lequel sont considérés différentes types de paramètres qui appartiennent à 5 éléments de l'environnement naturel

  12. Crucigrama de conceptos generales de Genética. Nivel semi-avanzado.

    OpenAIRE

    Cross, Ismael; Rebordinos, Laureana

    2012-01-01

    El archivo es un ejercicio desarrollado con JCross en Hotpotatoes para que los alumnos prueben e identifiquen su nivel con respecto a cuestiones de Genética, conceptos, técnicas, características del ADN, etc. El ejercicio permite obtener pistas para completar el crucigrama y de esta manera finalizar el mismo habiendo asimilado o aprendido conceptos ya sabidos o nuevos de Genética. El crucigrama contiene cerca de 40 definiciones de Genética.

  13. DETERMINACIÓN DEL GEN aac(6´-aph(2´´ ASOCIADO CON RESISTENCIA A AMINOGLUCÓSIDOS EN CEPAS DE STAPHYLOCOCCUS COAGULASA NEGATIVA EN UNA UNIDAD NEONATAL EN BOGOTÁ Detection of gene aac(6´-aph(2´´ in associated with aminoglucosides resistance in Staphylococcus coagulase-negative strains isolates from one neonatal unit in Bogota

    Directory of Open Access Journals (Sweden)

    Liliana Muñoz M

    2009-01-01

    Full Text Available Antecedentes. La causa más común de resistencia a antibióticos aminoglucósidos en bacterias Gram positivas, especialmente en S. epidermidis, es la enzima modificante AAC(6’-APH(2", capaz de acetilar y fosforilar un amplio rango de antibióticos. Objetivo. Determinar la presencia del gen aac(6’-aph(2" en cepas de Staphylococcus coagulasa negativa aisladas en infecciones neonatales, e investigar la concordancia con las pruebas de sensibilidad in-vitro. Material y métodos. Se determinó la presencia del gen aac(6’-aph(2" en 63 cepas de estafilococos coagulasa negativa provenientes de hemocultivos y puntas de catéter, de la Unidad de Neonatología del Instituto Materno Infantil, en Bogotá. Resultados. Staphylococcus epidermidis fue el germen más frecuente y el gen aac(6’-aph(2" estaba presente en 55 (87,3% cepas; de éstas, 42 (73,4% cepas provenían de hemocultivos y 13 (23,6% cepas de punta de catéter. La susceptibilidad a gentamicina se determinó mediante concentración inhibitoria mínima y para amikacina por difusión en disco. No se encontró asociación estadísticamente significativa entre la presencia del gen aac(6’-aph(2" y la resistencia a gentamicina y amikacina. Conclusión. La presencia del gen aac(6’-aph(2" de resistencia a aminoglucósidos es muy alta en cepas de Staphylococcus epidermidis. Diferencias en la expresión del gen pueden explicar parcialmente la falta de consistencia con las pruebas de susceptibilidad utilizadas en la clínica.Background. The most common cause of resistance to aminoglucosides is the acetilation and phosphorilation of the antibiotic by the enzyme AAC(6’APH(2". Objetive. To determine the presence of the gene aac(6’-aph(2" in strains of coagulase-negative Staphylococci isolated from infected neonates and to investigate the concordance with the susceptibility tests in-vitro. Materials and methods. the aac(6’-aph(2" gene was determined in 63 coagulase-negative Staphylococci strains

  14. Herencia no genética, competencia lingüística, experiencia prenatal y manipulación de la conducta: aportes recientes de la Neurobiología conductual y la Neuropsicología a la explicación del comportamiento

    Directory of Open Access Journals (Sweden)

    Andres Felipe Reyes

    2013-01-01

    Full Text Available En el artículo se revisan algunos supuestos y explicaciones que algunos subtipos de la Psicología conductual –como el radical– y de las ciencias cognoscitivas nativistas –en particular la Psicología cognitiva y la Psicolingüística– proponen para comprender eventos psicológicos importantes como la ansiedad, el estrés, el miedo, los estados de ánimo y el lenguaje. A la discusión entre las posturas que suponen que la causa principal de la conducta se encuentra en el ambiente o en la interacción con él, o en la genética que a su vez que da origen a lo mental, se suman aportes recientes de la Neurobiología del comportamiento y la Neuropsicología. Se muestra evidencia de rasgos que pueden ser heredados y que no se relacionan con la genética, que tienen un impacto a lo largo de la vida de los organismos y en su forma de interactuar con el medio durante varias generaciones; de comportamientos que pueden ser alterados por agentes y eventos ambientales hasta hace poco insospechados, y del rol subestimado de las experiencias prenatales en la explicación del comportamiento. Esto permite cuestionar algunos supuestos que las áreas mencionadas han realizado al tratar de explicar el comportamiento y pensar en reinterpretaciones importantes.

  15. Patrones geográficos de diferenciación craneofacial entre poblaciones de la región central del país y otras de Argentina: aportes desde la genética del paisaje

    Directory of Open Access Journals (Sweden)

    Mariana Fabra

    2009-04-01

    Full Text Available ResumenEn este trabajo se analizan los patrones de variación espacial de los grupos humanos que habitaron la regióncentral del país (actualmente, parte de los territorios de las provincias de Córdoba y San Luis conocida en laarqueología como «Sierras Centrales», y otras regiones ecológicas de la Argentina, buscando identificar barrerasde diferenciación morfológica craneofacial en un amplio espacio geográfico. El estudio se basa en el análisis de10 variables morfométricas lineales en 14 muestras representativas de poblaciones que habitaron diversas regionesdel país, y se aplica análisis de componentes principales –PCA- para el estudio de las relaciones biológicas entrepoblaciones, y el algoritmo de máxima diferenciación de Monmonier –AM- para la identificación de barrerasgenéticas. Los resultados obtenidos a partir de PCA y AM son coincidentes, y permiten señalar que las poblacionesasentadas en la región central del país presentan mayores similitudes morfológicas con poblaciones de la Patagoniay del Noreste de la región pampeana, más que con grupos asentados en el Noroeste, Noreste y Centro-Oeste delpaís. Estos resultados apoyan nuestra hipótesis acerca de un poblamiento de esta región procedente del Norestedel país, que luego habría continuado hacia Patagonia y Tierra del Fuego.AbstractIn this study we analyze the patterns of spatial variation of a population sample from the pre-Hispanicinhabitants of the central territory of Argentina (Córdoba and San Luis provinces archaeologically known as«Sierras Centrales», and 13 other samples from different ecological and geographical regions from Argentina.Additionally, we searched for the existence of genetic barriers in the geographic landscape. The study is based on10 craniometric measurements. Results from principal component analysis reveal that the pre-Hispanic inhabitantsof the Central Mountains of Argentina were biologically more related to the Patagonian

  16. La mutacion H63D del gen HFE se asocia con un riesgo aumentado de carcinoma hepatocelular The H63D mutation of the HFE gene is related to the risk of hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    P. Ropero

    2007-07-01

    Full Text Available Objetivo: comprobar si las mutaciones del gen HFE, que pueden inducir sobrecarga hepática de hierro, guardan relación con el riesgo de desarrollar carcinoma hepatocelular (CHC en sujetos predispuestos a sufrir este tumor. Material y métodos: se han incluido 196 pacientes (161 varones diagnosticados de CHC. Ninguno estaba diagnosticado de hemocromatosis. El grupo control estaba constituido por 181 sujetos sanos. Todos los sujetos eran españoles de raza blanca.Las mutaciones C282Y y H63D del gen HFE se identificaron mediante reacción en cadena de polimerasa (PCR sobre ADN genómico leucocitario utilizando enzimas de restricción específicas. Resultados (casos/controles: 1. Distribución genotípica: a mutación C282Y: 1/0 homocigotos, 12/23 heterocigotos, 183/158 normales (p = 0,07, n.s.; y b mutación H63D: 9/5 homocigotos, 85/52 heterocigotos, 102/124 normales (odds ratio 2,00, IC95% 1,29-3,12, p = 0,002. Cuatro casos y seis controles eran heterocigotos compuestos. 2. Frecuencias alélicas: a mutación C282Y: normales 378/339, mutados 14/23 (p = 0,11, n.s.; b mutación H63D: normales 289/300; mutados 103/62 (odds ratio 1,72, IC95% 1,19-2,50, p = 0,004. No se observaron diferencias en relación con el sexo, la edad o la etiología (VHC, VHB, etílica o mixta de la hepatopatía previa. Conclusiones: la mutación C282Y no guarda relación con el riesgo de desarrollar CHC en sujetos sin hemocromatosis conocida. La posesión de la mutación H63D se asocia con un riesgo aumentado de desarrollar CHC independientemente de la etiología de la hepatopatía crónica subyacente.Aim: to disclose whether mutations in the HFE gene inducing liver iron overload are related to the risk of hepatocellular carcinoma (HCC in otherwise predisposed patients. Patients and methods: one hundred and ninety-six patients (161 males diagnosed with HCC and 181 healthy controls were included in the study. All subjects were white Spaniards. C282Y and H63D mutations in the

  17. Influencia del polimorfismo -3826 A → G en el gen de la UCP1 sobre los componentes del síndrome metabólico Influence of the polymorphism 03826 A → G in the UCP1 gene on the components of metabolic syndrome

    Directory of Open Access Journals (Sweden)

    Ll. Forga

    2003-08-01

    Full Text Available Fundamento. La proteína desacoplante UCP1 se ha relacionado con el desarrollo y/o mantenimiento de la obesidad a través de su implicación en la regulación del balance energético. El papel de esta proteína mitocondrial en humanos es incierto por la escasa presencia del tejido adiposo pardo en el individuo adulto. El polimorfismo -3826 A/G de la UCP1 solo o conjuntamente con la mutación Trp64Arg del receptor adrenérgico β3 se ha asociado con obesidad, diabetes mellitus y enfermedades relacionadas aunque con resultados contradictorios. Con objeto de conocer la influencia del polimorfismo -3826 A/G de la UCP1 sobre los componentes clásicos del síndrome metabólico en nuestra población, se han estudiado 159 individuos obesos y 154 en normopeso, con un diseño de casos y controles. A todos ellos se les ha determinado IMC, índice cintura/cadera, % de grasa corporal, TA, perfil lipídico, leptina, glucemia e insulinemia basales. Asimismo se les ha analizado la presencia de la mencionada mutación en el gen de la UCP1. Resultados. Se obtuvieron diferencias significativas en todas las variables estudiadas entre obesos (casos y normopeso (controles Dentro del grupo de obesos, el polimorfismo -3826 A/G del gen de la UCP1 (n=53 se asoció con un mayor IMC (p=0,03, mayor % de grasa corporal (p=0,04 y TA más elevada tanto sistólica (p=0,009 como diastólica (p=0,02 No hubo diferencias estadísticamente significativas en ninguno de los demás índices evaluados. Conclusión. El factor fundamental que influye sobre los componentes del síndrome metabólico es la obesidad. No obstante, el polimorfismo -3826 A/G del gen de la UCP1 se asocia con un mayor grado de obesidad y unas cifras más elevadas de TA.Background. The uncoupling protein UCP1 has been related to the development and/or maintenance of obesity through its involvement in regulating energy balance. The role of this mitochondrial protein in humans is uncertain due to the scarce presence

  18. Influence of G1359A polimorphysm of the cannabinoid receptor gene (CNR1 on insulin resistance and adipokines in patients with non alcoholic fatty liver disease Influencia del polimorfismo G1359a del gen del receptor cannabinoide (CNR1 sobre la resistencia a la insulina y adipocinas en pacientes con enfermedad hepática no alcohólica

    Directory of Open Access Journals (Sweden)

    R. Aller

    2012-10-01

    la resistencia a la insulina, cambios en la histología hepática, parámetros antropométricos y adipocitoquinas en pacientes con hígado graso no alcohólico. Material y métodos: Una población de 71 pacientes con hígado graso no alcohólico fue reclutado en un estudio de corte transversal. Se realizó un análisis bioquímico de suero. El genotipo del polimorfismo G1359A del gen del receptor CB1 se ha estudiado en todos los pacientes. Cuarenta y un pacientes (36,9% tenían el genotipo G1359G (grupo de tipo salvaje y veintinueve (26,1% de los pacientes o G1359A A1359A (grupo mutante. Resultados: Veinticuatro 24 pacientes (32,3% tenían un grado de Brunt > 4 y 12 pacientes (17% tenían una fibrosis significativa (F > = 2. Los valores de HOMA fueron mayores en el grupo con genotipo salvaje que el grupo mutante. Los niveles de adiponectina y visfatina fueron mayores en el grupo con genotipo mutante. Por otra parte, el TNF-alfa y los niveles de resistina fueron más altos en el grupo con genotipo salvaje que el grupo mutante. Los pacientes con genotipo mutante mostraron niveles elevados de menor frecuencia de AST. AST > 40 UI/L se detectó en el 28,5% de los pacientes con el genotipo mutante frente a 53% de los pacientes con genotipo salvaje, p = 4 con menos frecuencia que los pacientes con genotipo salvaje (28,5%vs 7,1%. Conclusión: Una variante del polimorfismo G1359A CBR1 se asocia con menores niveles de HOMA, TNF-alfa, resistina y mayores niveles de adiponectina que los pacientes con la variante salvaje de este polimorfismo. Además, los pacientes con una variante del alelo muestra menor grado de Brunt en la biopsia hepática.

  19. Genética de comunidades

    Directory of Open Access Journals (Sweden)

    M. Verdú

    2009-01-01

    Full Text Available Los estudios sobre los procesos responsables del ensamblaje de las especies en comunidades ecológicas tradicionalmente han considerado a las especies como unidades de estudio. Sin embargo, dentro de las especies existe gran cantidad de variación genotípica y fenotípica que puede finalmente ser decisiva en el resultado de las interacciones con el resto de especies en la comunidad (competencia, mutualismo, etc. Recientemente se ha propuesto una nueva regla de ensamblaje de las comunidades que sugiere que la composición genética de una población afecta a la estructura y composición de la comunidad (es decir alfenotipo de la comunidad. Apoyando esta regla, varios estudios han demostrado que los cambios en la diversidad genética de poblaciones de plantas conllevan cambios predecibles en sus comunidades asociadas de herbívoros y predadores. Más allá de la visión poblacional, la nueva genética de comunidades pretende demostrar 1 que el genotipo particular de ciertos individuos es responsable del fenotipo de la comunidad, 2 que el fenotipo de la comunidad es heredable, y por lo tanto 3 que las comunidades evolucionan. Tras explicar estos tres conceptos, se discute el valor que esta aproximación puede tener desde el punto de vista de la biología de la conservación.

  20. Recursos genéticos de los hongos del maguey (pleurotus sp.) de la región central de México: caracterización y selección de genotipos con potencial para la producción rural.

    OpenAIRE

    Ramírez Carrasco, Angelina Patricia

    2011-01-01

    México cuenta con una gran diversidad biológica, sin embargo, poco se han aprovechado los recursos genéticos nativos para la producción comercial de hongos comestibles. En esta investigación se recolectaron y caracterizaron diversos genotipos de Pleurotus que crecían silvestres sobre plantas de Agave en el altiplano de la región central de México. Estos hongos comestibles son consumidos por las comunidades locales durante la época de lluvias, a los cuales denominan como “Hongos del Maguey”. ...

  1. Detección de secuencias homologas al Gen Env del virus del tumor mamario murino (MMTV en Cáncer de mama de pacientes argentinas Detection of murine mammary tumor virus (MMTV env gene-like sequences in breast cancer from Argentine patients

    Directory of Open Access Journals (Sweden)

    Stella M. Melana

    2002-08-01

    Full Text Available En los últimos años se ha renovado el interés en la investigación sobre la posible etiología viral del cáncer de mama humano. En publicaciones previas se ha demostrado la presencia de secuencias homólogas al gen env del virus del Tumor Mamario Murino (MMTV en alrededor del 38% de cánceres de mama de mujeres procedentes de Estados Unidos e Italia; estas secuencias están generalmente ausentes en otros tumores y en tejido mamario normal. En el presente trabajo se analizó la presencia de una secuencia de 250 pb similar a la del gen env de MMTV en biopsias de pacientes argentinas con cáncer de mama. Se detectó este fragmento retroviral en el 31% (23/74 de los tumores analizados, mientras que sólo se obtuvo un caso positivo en tejido de mama normal y ninguno en fibroadenomas. En 46 pacientes con cáncer se analizaron células mononucleares de sangre periférica, detectando la secuencia en el 17% (2/12 de las pacientes portadoras de tumores env positivos y en el 3% (1/34 de aquéllas cuyos tumores eran env negativos. Los datos de Argentina son similares a los obtenidos en Estados Unidos e Italia donde la incidencia de cáncer de mama es también semejante. Estos resultados apoyarían la hipótesis de un probable agente viral implicado en la génesis de esta neoplasia y alientan los estudios en marcha.In the last years research on the possible viral etiology of human breast cancer has been revised. Previous studies have demonstrated the presence of a Mouse Mammary Tumor Virus (MMTV env gene-like sequence in about 38% of breast cancers from American and Italian women; these sequences are generally absent in other tumors and in normal mammary tissue. In the present study we have analyzed the presence of a 250-bp sequence of the MMTV env gene in breast cancer biopsies from Argentine patients. The retroviral fragment was present in 31% (23/74 of the tumors, only in one normal mammary tissue and in none of the fibroadenomas analized. Peripheral

  2. La identidad y el comportamiento del maíz BT. El debate sobre la predicción de las posibles consecuencias adversas de la ingeniería genética

    Directory of Open Access Journals (Sweden)

    Larrión Cartujo, Jósean

    2010-04-01

    Full Text Available This article analyses the main causes and consequences related to the powerful scientific and technological network of the contemporary occidental societies. Specifically, it is examined the particular controversy about the creation, growing and commercialization of a transgenic corn variety which it is property of a multinational enterprise called Syngenta. In opposition to the more idealistic and metaphysical perspectives of the research practice, in this work it is proposed that the development of the research may not completely guarantee the future closure of some problems related with the present scientific and technological system. bearing in mind a more critical and reflexive point of view about the new technoscience, it is explored the dissimilar collective translations activated and mobilized here and it is investigated which particular social groups are benefited and which others are harmed by the conflict of the free global propagation of these genetically modified organisms.

    Este trabajo analiza las principales causas y consecuencias relacionadas con el poderoso entramado científico y tecnológico propio de las sociedades occidentales contemporáneas. Más concretamente, se examina la polémica singular sobre la creación, el cultivo y el comercio de un tipo de maíz transgénico propiedad de la empresa multinacional Syngenta. en contra de las concepciones del quehacer investigador más idealistas y metafísicas, se sostiene que el desarrollo de las investigaciones puede no garantizar necesariamente la clausura futura de determinadas discusiones asociadas al actual complejo científico y tecnológico. con arreglo a una perspectiva analítica de la nueva tecnociencia más crítica y reflexiva, por tanto, se exploran las heterogéneas traducciones colectivas aquí activadas y movilizadas y se investiga qué grupos sociales específicos salen más o menos beneficiados o perjudicados de la libre proliferación mundial de estos

  3. Caracterización de la diversidad genética en naranja y comparación del polimorfismo de microsatélites amplificados al azar (RAMs usando electroforesis de poliacrilamida y azarosa Characterization of the genetic diversity in orange, and comparison of polymorphism in randomly-amplifed microsatellites (RAMs, using polyacrylamide and agarose electrophoresis

    Directory of Open Access Journals (Sweden)

    Ana Cruz Morillo Coronado

    2009-10-01

    Full Text Available Se compararon las eficiencias de tres métodos de electroforesis en agarosa y poliacrilamida, usando la cámara pequeña de DNA Sequencing System y cámara grande OWL Sequi-Gen Sequencing Cell, en la detección del polimorfismo en 21 accesiones de naranja (Citrus sinensis con empleo del cebador CGA. El gel de poliacrilamida dio mejor resolución de los productos amplificados vía PCR producidos por RAMs. Este permitió una mejor detección de bandas de ADN polimórficas, lo que facilitó la identificación de la variabilidad genética. La electroforesis en agarosa puede ser más conveniente en otras aplicaciones, debido al bajo costo y fácil aplicación. El estudio de diversidad genética en naranja usando microsatélites RAMs diferenció 51 accesiones en siete grupos con 0.75 de similaridad y 0.25 de heterocigosidad, lo que revela bajo polimorfismo genético. La técnica RAMs permitió agrupar las accesiones en Comunes o Blancas, Navel y Pigmentadas o Sanguinas.We compared the efficiency of three methods of agarose and polyacrylamide electrophoresis (using the small tank of the DNA Sequencing System and the large OWL Sequi-Gen Sequencing Cell, for the detection of polymorphism in 21 accessions of orange (Citrus sinensis, using the primer CGA. The polyacrylamide gel gave better resolution of the PCR-amplified RAM products. This method allowed better detection of polymorphic DNA bands, facilitating the identification of genetic variability. The agarose electrophoresis may be more convenient in other applications, due to its low cost and easy implementation. The study of genetic diversity in orange using RAMs separated 51 accessions into seven groups with 0.75 similarity, and 0.25 heterozygosity, revealing low genetic polymorphism. The RAMs technique grouped the accessions into “Common or White”, “Navel” and “Pigmented or “Sanguine”.

  4. Caracterización genética del puma andino boliviano (Puma concolor en el Parque Nacional Sajama (PNS y relaciones con otras poblaciones de pumas del noroccidente de Sudamérica Genetic characterization of the Bolivian Andean puma (Puma concolor at the Sajama National Park (SNP and relationships with other north-western South American puma populations

    Directory of Open Access Journals (Sweden)

    MANUEL RUIZ-GARCÍA

    2009-03-01

    Full Text Available Se analizaron originalmente 25 muestras fecales de puma andino boliviano para proceder a su extracción de ADN. De esas 25 muestras, se detectaron cinco pumas diferentes que, junto, a tres de pieles de animales cazados, completaron un total de ocho pumas andinos bolivianos analizados. Igualmente se analizaron 45 muestras de ADN procedentes de pumas silvestres de Colombia, Perú, Ecuador, Venezuela y Amazonia occidental brasileña obtenidas a partir de mechones de pelos con bulbo, trocitos de pieles, músculo y dientes. Todas ellas se genotipificaron para siete marcadores microsatélites (Fea 08, 24, 43, 45, 96, 126 y 391. Los niveles de diversidad genética resultaron muy elevados en ambas muestras (H = 0,942 y 0,845; respectivamente, con valores muy superiores a los reportados para pumas norteamericanos. Diversos análisis de asignación poblacional mostraron que los pumas andinos bolivianos no formaron un grupo consistentemente diferente del otro grupo de pumas analizado. Únicamente un marcador, Fea 96, mostró heterogeneidad genética significativa entre ambos grupos. Sin embargo, globalmente, esa heterogeneidad fue extremadamente pequeña (F ST, G ST, R ST. Por el contrario, las estimas de flujo génico entre ambas agrupaciones fueron elevadas para toaos los procedimientos empleados. La estimación del parámetro θ (= 4Neμ mediante el método de máxima verosimilitud de Nielsen (1997 mostró que la muestra boliviana es una extensión indiferenciable de la otra agrupación de pumas de otros países latinoamericanos. Por lo tanto, este estudio aporta resultados concluyentes en favor de un único acervo genético de pumas en el nor-occidente de Sudamérica, en contraste con las tradicionales clasificaciones morfológicas y morfométricas que habían identificado un número considerable de subespecies de puma en esta región de Latinoamérica.Twenty-five Andean Bolivian fecal samples were obtained for extracting DNA. Five different Andean

  5. Germline TP53 mutations and single nucleotide polymorphisms in children Mutaciones y polimorfismos de un único nucleótido del gen TP53 en línea germinal en niños

    Directory of Open Access Journals (Sweden)

    Pamela Valva

    2009-02-01

    Full Text Available Mutations in the gene TP53, which codifies the tumor suppressor protein p53, are found in about 50% of tumors. These mutations can occur not only at somatic level, but also in germline. Pediatric cancer patients, mostly with additional family history of malignancy, should be considered as potential TP53 germline mutation carriers. Germline TP53 mutations and polymorphisms have been widely studied to determine their relation with different tumors' pathogenesis. Our aim was to analyze the occurrence frequency of germline TP53 mutations and polymorphisms and to relate these to tumor development in a pediatric series. Peripheral blood mononuclear cell samples from 26 children with solid tumors [PST] and 21 pediatric healthy donors [HD] were analyzed for germline mutations and polymorphisms in TP53 gene spanning from exon 5 to 8 including introns 5 and 7. These PCR amplified fragments were sequenced to determine variations. A heterozygous mutation at codon 245 was found in 1/26 PST and 0/21 HD. Comparative polymorphisms distribution, at position 14181 and 14201(intron 7, between HD and PST revealed a trend of association (p= 0.07 with cancer risk. HD group disclosed a similar polymorphism distribution as published data for Caucasian and Central/South American populations. This is the first study about TP53 variant frequency and distribution in healthy individuals and cancer patients in Argentina.El gen que codifica para la proteína supresora de tumor p53 (TP53 se encuentra mutado en aproximadamente el 50% de los tumores. Estas mutaciones pueden presentarse como somáticas o en línea germinal. Los niños con tumores, sobre todo aquellos con historia familiar de enfermedad oncológica, deben considerarse potenciales portadores de mutaciones en línea germinal. Las mutaciones de TP53 y los polimorfismos son estudiados para determinar su relación con la patogénesis de diferentes tumores. El objetivo del trabajo fue analizar la frecuencia de

  6. Generación de una línea de macrófagos con expresión del represor de tetraciclina para su implementación en un modelo de silenciamiento genético inducible / Generation of a macrophage cell line expressing tetracycline repressor for the establishment of an inducible gene silencing model

    OpenAIRE

    Salazar Terreros, Myriam Janeth

    2010-01-01

    La línea promonocítica U937 ha sido utilizada como modelo in vitro para estudios de infección de patógenos intracelulares, fisiopatología del cáncer y procesos de diferenciación celular. En este proyecto se generó una línea celular derivada de la línea U937, con expresión estable del represor de tetraciclina (U937-TR+) para utilizarla eventualmente en un sistema de silenciamiento genético inducible mediado por miRNA. La generación de la línea U937-TR+ se logró mediante transfección por lipofe...

  7. Patrones geográficos de diferenciación craneofacial entre poblaciones de la región central del país y otras de Argentina: aportes desde la genética del paisaje

    Directory of Open Access Journals (Sweden)

    Mariana Fabra

    2008-09-01

    Full Text Available In this study we analyze the patterns of spatial variation of a population sample from the pre-Hispanicinhabitants of the central territory of Argentina (Córdoba and San Luis provinces archaeologically known as«Sierras Centrales», and 13 other samples from different ecological and geographical regions from Argentina.Additionally, we searched for the existence of genetic barriers in the geographic landscape. The study is based on10 craniometric measurements. Results from principal component analysis reveal that the pre-Hispanic inhabitantsof the Central Mountains of Argentina were biologically more related to the Patagonian groups than to thenortheast, central western and northwestern populations. Monmonier`s algorithm reveals that the pre-Hispanicinhabitants of the Central Mountains of Argentina were biologically more related to the Patagonian groups thanto the central and northern populations. These results support our hypothesis that the peopling of the centralregion of Argentina most likely took place as a migratory wave proceeding from the northeast, and continuedsouthward to Patagonia and Tierra del Fuego.

  8. La genómica de las plantas

    OpenAIRE

    Cánovas, Francisco M.

    2009-01-01

    La mejora vegetal es una actividad tan antigua como la propia agricultura. El estudio de las variedades genéticas de la vegetación permite conocer en profundidad sus funciones y mecanismos para localizar los beneficios alimenticios, textiles, cosméticos o combustibles que la naturaleza ha puesto al servicio del ser humano.

  9. Genética de la enfermedad de Charcot-Marie-Tooth autosómica recesiva

    OpenAIRE

    Claramunt Alonso, Reyes

    2008-01-01

    RESUMEN El objetivo de esta tesis doctoral es profundizar en el conocimiento de las bases genéticas y moleculares de la enfermedad de Charcot-Marie-Tooth, especialmente de las formas con herencia autosómica recesiva. En este sentido, se incluyen los resultados obtenidos del análisis genético y molecular del gen GDAP1 en una serie de 118 familias de origen español, cuyas mutaciones son las causantes de la forma autosómica recesiva axonal tipo 4A (CMT4A), así como también, el estudio genétic...

  10. Gen quimérico que utiliza el gen o cDNA de la 3-hidroxi-3-metilglutaril-CoA sintasa mitocondrial y animal transgénico no humano que expresa dicho gen quimérico para su utilización en el desarrollo de aproximaciones terapéuticas para diabetes mellitus.

    OpenAIRE

    Bosch i Tubert, Fàtima; Valera Abril, Alfons

    2001-01-01

    Gen quimérico que utiliza el gen o cDNA de la 3-hidroxi-3- metilglutaril-CoA sintasa mitocondrial y animal transgénico no humano que expresa dicho gen quimérico para su utilización en el desarrollo de aproximaciones terapéuticas para diabetes mellitus. El gen quimérico está dirigido por un promotor o fusión de promotores, los cuales preferentemente son regulables y activados por el proceso diabético. Preferentemente se obtiene por la fusión del gen de la 3-hidroxi-3-metilglutaril-CoA sintasa ...

  11. Análisis de asociación de nuevos polimorfismos en el promotor del gen MMP- 1 y osteoartritis secundaria a displasia de cadera en perros. Association analyses of novel polymorphisms in the MMP-1 promoter gene with osteoarthritis secondary to hip dysplasia in dogs

    Directory of Open Access Journals (Sweden)

    V.B. Fassa

    2010-12-01

    Full Text Available La displasia de cadera (DC es una enfermedad poligénica caracterizada por laxitud articular y pérdida de congruencia que conduce a la osteoartritis (OA. En muchas condiciones patológicas, incluyendo a la artritis puede observarse un aumento de la síntesis de MMP-1. El promotor del gen MMP-1 contiene elementos de respuesta a citoquinas, los factores de trascripción AP-1 y SAF-1 que se hallan aumentados en OA. El objetivo del presente estudio fue la identificación y análisis de polimorfismos en el promotor del gen MMP-1 canino y su asociación a la OA secundaria a DC. Basados en la secuencia de referencia NCBI_006587, se detectaron dos nuevos polimorfismos, Indel CTGCCCT (bp31986794 y una sustitución C>T (bp31986815 que fueron seleccionadas para su análisis debido a su posición en la secuencia de consenso perteneciente al elemento de respuesta SAF-1. Los polimorfismos detectados se ingresaron a la base del GenBank (números de acceso GQ475524 y GQ475525. Se tomaron muestras de 125 perros de diferentes razas y se evaluó el estado de la cadera por medio de radiografías en posición ventro-dorsal. Se realizó un análisis estadístico por medio de un chi cuadrado para probar la asociación entre las variables raza, sexo y genotipo con el estado para OA (sanos y afectados. No se hallo asociación (p>0.05 entre ninguna variable y la condición de OA secundaria a DC. El estudio no excluye al gen MMP-1 como candidato responsable de OA secundaria a DC en las razas estudiadas ya que sólo se ha evaluado la región promotora del mismo.Hip dysplasia (HD is a polygenic disease characterized by joint laxity and lack of congruence leading to osteoarthritis (OA. Under many pathogenic conditions including arthritis, MMP-1 synthesis is augmented. The MMP-1 gene promoter contains cytokine response elements, transcription factors AP-1 and SAF-1 that are increased in OA. The objective of the present study was to identify and characterize new polymorphisms

  12. Estudio de la influencia de la nutrición y genética maternas sobre la programación del desarrollo del tejido adiposo fetal: Estudio PREOBE Study of maternal nutrition and genetic on the foetal adiposity programming: The PREOBE study

    Directory of Open Access Journals (Sweden)

    C. Campoy

    2008-12-01

    Full Text Available Introducción: La genética y la alimentación de la madre antes y durante el embarazo, las distintas patologías metabólicas maternas, así como la ingesta de nutrientes en los primeros meses de vida del recién nacido parecen estar implicados en la etiología de la obesidad y sus consecuencias a largo plazo. La posible contribución de estos y otros factores, los mecanismos y sus efectos en el metabolismo y desarrollo de la enfermedad están aún en fase de investigación. Objetivo: Obtener un mayor conocimiento del desarrollo del tejido adiposo fetal y la influencia de factores genéticos, dietéticos y ambientales sobre el riesgo a largo plazo de padecer obesidad. Metodología: Se han establecido cuatro grupos de estudio de 30 madres gestantes cada uno: 1 grupo control; 2 madres con intolerancia a la glucosa/diabetes gestacional; 3 madres con escasa ganancia ponderal durante el embarazo, y 4 madres con sobrepeso/obesidad al inicio del embarazo. Se realizará un análisis de los siguientes parámetros: 1 ingesta dietética; 2 hábitos y estilo de vida; 3 actividad física; 4 antropometría y composición corporal; 5 estudio hematológico; 6 estudio bioquímico (biomarcadores lipídicos y metabólicos; 7 perfil inmunológico; 8 perfil psicológico; 9 marcadores genéticos, y 10 marcadores microbiológicos; todos ellos relacionados con la formación del tejido adiposo fetal en las primeras etapas de la vida y el riesgo de padecer obesidad en el futuro. Conclusión: En este proyecto, coordinado por el Departamento de Pediatría de la Facultad de Medicina de la Universidad de Granada y que cuenta con la participación de otros grupos de investigación de larga y acreditada experiencia, se pretende obtener un mayor conocimiento de los orígenes de la obesidad en la infancia y posterior desarrollo de esta enfermedad en etapas posteriores de la vida.Background: Maternal genetics and feeding before and during pregnancy, different maternal metabolic

  13. Introduction to the Post-Human Genome Project era, a target for interactions between polygenic and/or multiphenotypical components in cancer control in South America Introducción a la post era del Proyeto Genoma Humano: la interrelación entre componentes multi-genéticos y multi-fenotípicos en el control del cáncer en América Latina como una meta

    Directory of Open Access Journals (Sweden)

    José Iscovich

    1998-01-01

    Full Text Available Epidemiological studies have suggested that the propensity to develop malignancy involves a complex mix of genetic and environmental determinants, however both older and innovative techniques display unresolved questions regarding etiology. Current barriers to achieving the potential benefit from this understanding are: 1 incomplete background on the various environmental and genetic factors involved in the carcinogenesis mechanism; 2 difficulties in accurately differentiating specific molecular subtypes and measuring the effective cellular exposure dose; and 3 difficulties in determining the multifactorial interaction between genetic and environmental factors. To extrapolate Human Genome Project research findings to the Post-Human Genome Project era, South America provides a large population and large-pedigree families, thus including genetically heterogeneous and less heterogeneous groups. An initial strategy might be to trace high risk populations and the respective exposures to which they are susceptible, such as: 1 migration, identifying rural migrant populations; 2 inherent susceptibility, studying "long term homogeneous populations" or large families living in similar rural environments; and 3 dissection of gene-environmental interaction.Estudios epidemiológicos han demonstrado que la susceptibilidad de la población a las enfermedades malignas está basada en interrelaciones genéticas hereditarias y no hereditarias. Las técnicas epidemiológicas tradicionales no han resuelto los problemas básicos de los mecanismos etiológicos. Las barreras existentes son: 1 el conocimiento incompleto de las etapas del mecanismo de la carcinogénesis accionada por factores genéticos y ambientales; 2 la dificultad en delimitar subtipos específicos de neoplasmas basados en mecanismos moleculares definidos, y las dosis efectivas de exposición celular; y 3 la capacidad en determinar la interrelación en el mecanismo genético-ambiental. Anticipandose

  14. A critical view to explanations for the maximal value of 50 % of genetic recombination Críticas a las explicaciones del máximo de 50 % de recombinación genética

    Directory of Open Access Journals (Sweden)

    CARLOS Y VALENZUELA

    2001-03-01

    Full Text Available The maximal value of 50 % of genetic recombination (RF = recombination fraction between two linked gene loci has been explained by two models: (i the restriction of crossovers to only two of the four chromatids of a tetrad (tetrad model; (ii the limit of the occurrence of an odd number of crossovers between two loci, when the expected number of crossovers tends to infinite (odd-even model. This article shows that (i is wrong. If tetrads were responsible for the maximal 50 % RF, sister chromatid exchanges (SCE should display a maximal 100 % RF. In mammalian CHO cells we found that SCE yield a maximal 50 % recombination. Also, we demonstrated that the maximal 50 % RF for tetrads occurs because the sum of odd order coefficients in the binomial distribution is equal to the sum of even order coefficients. At the end of meiosis the two chromatids of a chromosome that receives K crossovers are separated. Then K breaks should distribute into two chromatids. Thus, the expected number of breaks per chromatid distributes, when K is large, in 50 % of chromatids having an even number of breaks (RF = 0 and 50 % having an odd number (RF = 1, irrespective of tetrads, hexads, octads or more complex meiotic chromosome configurationsEl máximo de 50 % de recombinación genética (RF entre dos loci ligados ha sido explicado por dos modelos. (i la restricción de los entrecruzamientos a dos de las cuatro cromátidas de una tétrada (modelo de tétrada; (ii el límite de la ocurrencia de un número impar de entrecruzamientos entre los dos loci, cuando el número esperado de entrecruzamientos tiende a infinito (modelo par-impar. Este artículo muestra que (i es erróneo, ya que, si la tétrada fuera responsable del máximo de 50 % de RF, el intercambio de cromátidas hermanas (SCE debería alcazar el 100 % de recombinación y esto no se da en células CHO, en las que encontramos un máximo de 50 %. Además, demostramos que el máximo de 50 % RF para las t

  15. Assimetria cerebral e lateralização da linguagem: déficits nucleares na esquizofrenia como indicadores da predisposição genética Asimetría cerebral y lateralización del lenguaje: déficits nucleares en la esquizofrenia como indicadores de predisposición genética Cerebral asymmetry and the lateralization of language: core deficits in schizophrenia as pointers to the genetic predisposition

    Directory of Open Access Journals (Sweden)

    Timothy J. Crow

    2004-08-01

    Full Text Available OBJETIVO: Assimetria cerebral (o torque do frontal direito em relação ao occipital esquerdo é a característica definidora do cérebro humano e, conforme proposto por Broca, o correlato neural putativo da linguagem. Se, conforme sugerido, a esquizofrenia é o preço que Homo sapiens precisa pagar pela linguagem, o torque, juntamente com seus correlatos funcionais, é de fundamental importância. São revisadas recentes evidências obtidas a partir de estudos anatômicos, funcionais e genéticos. ACHADOS RECENTES: Estudos de imagem, post mortem e anatômicos demonstram evidências de uma redução ou reversão de aspectos de assimetria, particularmente no córtex de associação occipitotemporoparietal. Em alguns estudos, há interação com o sexo. Há evidências de que uma alteração no lobo temporal esquerdo é, às vezes, progressiva. Estudos funcionais acrescentam credibilidade ao conceito de que a lateralização da linguagem é reduzida e, em alguns casos, revertida. RESUMO: A dimensão da assimetria se destaca como a variável que pode dar significância às observações entre campos de investigação e que proporciona uma solução para a base genética da psicose. Estudos de gêmeos monozigóticos discordantes têm apresentado fortes indicações de que a variação relevante é epigenética; isso é consistente com a possibilidade de que a variação seja relacionada a alterações estruturais recentes (a transposição duplicativa Xq21.3/Yp dos cromossomos sexuais.OBJETIVO: Asimetría cerebral (el torque del frontal derecho al occipital izquierdo es la característica definidora del cerebro humano y, conforme al propuesto por Broca, el correlato neuronal putativo del lenguaje. Si, conforme a lo sugerido, la esquizofrenia es el precio que el Homo sapiens debe pagar por el lenguaje, el torque, juntamente con sus correlatos funcionales, es de importancia fundamental. Se revisan recientes evidencias obtenidas a partir de estudios

  16. Anomalías y displasias dentarias de origen genético-hereditario Inherited dental abnormalities and dysplasias

    OpenAIRE

    J. Martín-González; B. Sánchez-Domínguez; M.L. Tarilonte-Delgado; L. Castellanos-Cosano; J.M. Llamas-Carreras; F.J. López-Frías; J.J. Segura-Egea

    2012-01-01

    Las alteraciones del desarrollo embriológico de la dentición provocan anomalías y displasias dentarias. Los factores etiopatogénicos implicados en las alteraciones del desarrollo dentario son básicamente dos: genéticos y ambientales. Según la fase del desarrollo en que afecten al órgano del esmalte y a los tejidos dentarios, aparecerán diferentes anomalías y/o displasias dentales. El control genético del desarrollo dentario se lleva a cabo mediante dos procesos: a) control de la histogénesis ...

  17. XIAO Pei-gen

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    <正>Academician of Chinese Academy of Engineering Editor-in-chief of Chinese Herbal Medicines(CHM)Honorary director of Institute of Medicinal Plant Development,Chinese Academy of Medical Sciences,Beijing100193,China Tel/Fax:+86-10-62894462 E-mail:xiaopg@public.bta.net.cn Professor XIAO Pei-gen is the founder of the Institute of Medicinal Plant Development(IMPLAD),Chinese Academy of Medical Sciences(CAMS).He is also one of the founders and leading

  18. Caracteres clínico-patológicos y perfil genético en el carcinoma colorrectal

    Directory of Open Access Journals (Sweden)

    Florencia Perazzo

    2013-10-01

    Full Text Available El cáncer colorrectal es el tercer cáncer más frecuente en hombres y el segundo más frecuente en mujeres, con una incidencia mundial aproximada de 1.2 millones de casos nuevos por año. Nuestro objetivo primario fue estudiar la relación existente entre las características clínico-histológicas en individuos con cáncer colorrectal y el estado mutacional de los codones 12 y 13 del gen KRAS (7 mutaciones validadas, con el fin de hallar un marcador histopatológico para los tumores mutados. El objetivo secundario fue determinar cuántos pacientes tenían mutaciones adicionales en los codones 15 y 61 del gen KRAS y 600 del gen BRAF que podrían modificar el fenotipo tumoral. Fueron seleccionados 60 individuos con cáncer colorrectal (30 wild-type y 30 con mutaciones validadas en los codones 12 y 13 del gen KRAS. Se amplificaron y secuenciaron del gen KRAS los exones 2 y 3, y del gen BRAF el exón 15. La información recolectada se examinó mediante un análisis descriptivo, análisis univariado y/o análisis multivariado, según correspondiese. En conclusión, no se encontró relación entre las características clínico-histológicas de los tumores de individuos con diagnóstico de cáncer colorrectal y el estado mutacional de los codones 12 y 13 del gen KRAS. No hallamos un marcador histopatológico para los tumores mutados. En pacientes con adenocarcinomas colorrectales avanzados y KRAS wild-type resulta de interés considerar el estudio del codón 600 del gen BRAF.

  19. Construcción de una librería genómica parcial del pez Xiphophorus maculatus (Teleostei: Poeciliidae para la búsqueda de microsatélites (AC/GTn por medio de la reacción en cadena de la polimerasa (PCR

    Directory of Open Access Journals (Sweden)

    Acosta DF.

    2001-06-01

    Full Text Available El objetivo general de la presente investigación fue probar una metodología económica quepermitiera encontrar, y eventualmente identificar y aislar microsatélites (AC/GTn en el genomadel pez Xiphophorus maculatus . Los objetivos específicos de la misma fueron revisar el estadoactual del modelo genómico de Xiphophorus maculatuspara el estudio de melanoma, elaboraruna librería genómica parcial de este organismo para buscar microsatélites (AC/GTn, utilizardirectamente los fragmentos de restricción clonados como material de partida para la reacciónen cadena de la polimerasa (PCR, explorar la utilidad de la PCR para la búsqueda de insertosportadores de loci microsatélites utilizando iniciadores específicos, y por ultimo, evaluar lautilidad de la metodología propuesta en los protocolos de Cooper et al. (1997 y Grist et al.(1993 para el aislamiento de microsatélites.

  20. Representaciones indirectas en algoritmos genéticos aplicados a un problema scheduling

    OpenAIRE

    Ordoñez, Guillermo; Leguizamón, Guillermo

    2001-01-01

    Este artículo presenta un estudio comparativo de los resultados obtenidos a partir de la aplicación de Algoritmos Genéticos (AGs) a un caso particular del problema Job-Shop Scheduling (JSS). El objetivo del estudio está centrado en mostrar las posibles mejoras en la performance de un Algoritmo Genético (AG) a medida que la representación de las soluciones incorpora conocimiento específico del problema. En nuestro caso, dicho conocimiento está representado por las prioridades de los jobs a pla...

  1. Aïllament, identificació i caracterització de nematodes entomopatògens en sòls de cultius del Baix Llobregat i les muntanyes de Prades i possible utilització per al control de plagues

    OpenAIRE

    Suárez Cano, Pedro

    2015-01-01

    Durant els últims anys s'estan realitzant nombrosos estudis sobre l'ús de nematodes com a mètode de control biològic. Mitjançant el present treball s'ha pretès realitzar un aïllament de nematodes entomopatògens en les zones de Prades i del Baix Llobregat i un cop aïllats i identificats realitzar diferents proves d'eficàcia d'aquests aïllats com mètodes de control de diferents plagues. Per dur a terme aquests assajos s'han realitzat diferents sistemes pel manteniment i producció de les pob...

  2. GEN 499 ASH course tutorial/tutorialoutlet

    OpenAIRE

    NARESH 34

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com       GEN 499 Week 1 DQ 1 Final Research Paper Topic and Plan (Ash) GEN 499 Week 1 DQ 2 Social Media (Ash) GEN 499 Week 2 DQ 1 Professional Resume and Cover Letter (Ash) GEN 499 Week 2 Assignment Critiquing Internet Sources (Ash) GEN 499 Week 3 DQ 1 Social Capital (Ash) GEN 499 Week 3 DQ 2 Federal Policy (Ash) GEN 499 Week 3 Assignment Annotated Bibliography (Ash) GEN 499 Week 4 DQ 1...

  3. Atlas del Genoma del Cáncer: Antecedentes

    Science.gov (United States)

    El Atlas del Genoma del Cáncer es una iniciativa de los Institutos Nacionales de la Salud (NIH) para crear mapas multidimensionales completos de los cambios genómicos clave en los tipos y subtipos principales de cáncer.

  4. Genetic Variability of the Tomato Leaf Miner (Tuta absoluta Meirick; Lepidoptera: Gelechiidae, in Tunisia, Inferred from RAPD-PCR Variabilidad Genética del Minador de Hojas de Tomate (Tuta absoluta Meyrick; Lepidoptera: Gelechiidae en Túnez desde RAPD-PCR

    Directory of Open Access Journals (Sweden)

    Asma Bettaibi

    2012-06-01

    Full Text Available The tomato leaf miner Tuta absoluta Meyrick has invaded tomato (Solanum lycopersicum L. crop in Tunisia since 2008 and is representing today a major threat to the production of this crop. In this study, we used the Randomly Amplified Polymorphic DNA-Polymerase Chain Reaction (RAPD-PCR technology to assess the genetic variability within and among seven populations of T. absoluta, collected on tomato from different regions in Tunisia. Using five RAPD-PCR primers and 108 individuals, 140 polymorphic fragments were recorded. From 335 different RAPD phenotypes generated, 71 were redundant and 264 unique to a specific population. The genetic structure of T. absoluta was investigated using analysis of molecular variance (AMOVA, genetic distances (Fst and multidimensional scaling (MDS. We detected a high genetic diversity within and among populations in conjunction with a significant differentiation between populations, suggesting that different founder genotypes would have been responsible of the introduction of T. absoluta in Tunisia. The presence of overlapping phenotypes probably indicates migration events between populations, mainly through infested plant material carried by humans.El minador de hojas de tomate Tuta absoluta Meyrick ha invadido el cultivo del tomate (Solanum lycopersicum L. en Túnez desde 2008 y actualmente representa una importante amenaza para su producción. En este estudio usamos la tecnología de ADN polimórfico amplificado al azar-reacción de cadena polimerasa (RAPD-PCR para evaluar la variabilidad genética dentro y entre siete poblaciones de T. absoluta, colectadas desde tomate en diferentes regiones de Túnez. Usando cinco primers RAPD-PCR y 108 individuos, se registraron 140 fragmentos polimórficos. Se generaron 335 fenotipos RAPD diferentes, entre los cuales 71 fueron redundantes y 264 únicos para una población específica. La estructura genética de T. absoluta se investigó usando análisis de varianza molecular

  5. La adaptabilidad fenotípica de genotipos de camote provenientes de semillas botánicas en el sur del Estado de Tocantins Adaptabilidade fenotípica de genótipos de batata-doce oriundos de sementes botânicas na região Sul do Estado do Tocantins

    Directory of Open Access Journals (Sweden)

    Tiago Alves Ferreira

    2012-06-01

    Full Text Available

    Objetivou-se com este trabalho estimar a adaptabilidade de genótipos de batata-doce com aptidão para a produção de etanol em duas épocas de cultivo na região Sul do Tocantins. Foram avaliados 22 genótipos de batata-doce, sendo 20 genótipos provenientes de sementes botânicas de um campo de policruzamento e duas cultivares selecionados para a produção de etanol (Marcela e Ana Clara durante os anos agrícolas 2008/09 e 09/10. A colheita foi realizada 150 dias após o plantio e as características avaliadas foram: produtividade total de raízes; massa média e incidência de danos por insetos do solo. Constatou-se diferença significativa em todas as características. Com relação à produtividade e a massa média das raízes, os genótipos BDGU#36; BDGU#78 e BDGU#89 são indicados a ambientes desfavoráveis. A maior parte dos genótipos com produtividade média de raízes significativa são adaptados em ambientes com utilização de baixa tecnologia. Apenas o genótipo BDGU#93 pode ser indicado como de adaptabilidade geral para ambientes em relação à massa média de raízes.

    El objetivo de este trabajo ha sido de estimar la capacidad de adaptación de los genotipos de camote (patata dulce con aptitud para producir etanol en dos temporadas de crecimiento en el sur de Tocantins. Un total de 22 genotipos de camote, 20 genotipos de semilla botánica de un campo policruces y dos cultivares seleccionados para la producción de etanol (Marcela y Ana Clara durante los años 2008/09 y 09/10. Las plantas se cosecharon 150 días después de la siembra y las características evaluadas fueron: rendimiento total de las raíces, peso y incidencia de los daños derivados de insectos del suelo. Se encontraron diferencias significativas en todas las características evaluadas. Con respecto a la productividad y la masa media de raíces, los genotipos BDGU # 36; BDGU # 78 y # BDGU 89 se indican a ambientes

  6. Morphological and genetic comparative analyses of populations of Zoogoneticus quitzeoensis (Cyprinodontiformes: Goodeidae from Central Mexico, with description of a new species Análisis comparativo morfológico y genético de diferentes poblaciones de Zoogoneticus quitzeoensis (Cyprinodontiformes:Goodeidae del Centro de México, con la descripción de una especie nueva

    Directory of Open Access Journals (Sweden)

    Omar Domínguez-Domínguez

    2008-12-01

    lago de Chapala, mientras que el otro incluye las poblaciones de los lagos de Zacapu y Cuitzeo. Se emplearon 4 poblaciones para los análisis morfométricos identificándose 2 morfotipos, 1 de la localidad del manantial La Luz en la cuenca del bajo Lerma y el otro a los lagos de Zacapu y Cuitzeo. Con estas 2 fuentes de evidencia, la población de La Luz es considerada como una nueva especie Zoogoneticus purhepechus n. sp. La especie nueva difiere de su especie hermana, Z. quitzeoensis por tener una distancia preorbital más corta (PrOL/SL o = 0.05 -0.06, la base de la aleta dorsal más larga (DFL/SL o = 0.17-0.20 y presentar entre 13 y 14 radios en la aleta dorsal. La especie nueva difiere de las 2 especies descritas en el género (Zoogoneticus tequila y Z. quitzeoensis en 10 posiciones nucleotídicas fijadas para el gen citocromo b. Zoogoneticus purhepechus se distribuye por las cuencas de los ríos Ameca, Armería, Santiago y bajo Lerma, así como en el lago de Chapala. Z. purhepechus debe ser considerada en peligro de extinción de acuerdo a los criterios del MER (Aii,Bi,Ci,Di y de la UICN (A-1,b,c,e.

  7. La determinación del género en música popular: hacia un modelo jerárquico de caracterización genérica

    OpenAIRE

    Rodríguez, Edgardo José

    2011-01-01

    En este trabajo nos proponemos estudiar el problema del género en música popular dentro del marco de la teoría musical y la musicología tradicional. En los estudios de música popular hemos notado cierta desaprensión por la caracterización del objeto musical y, paralelamente, la concentración de esfuerzos en los factores contextuales a partir de la aplicación de modelos semióticos, antropológicos y sociológicos. A la crítica furibunda al estructuralismo musical parece sucederle el simple olvid...

  8. Crucigrama de conceptos generales de Genética. Nivel básico.

    OpenAIRE

    Cross, Ismael; Rebordinos, Laureana

    2012-01-01

    El archivo es un ejercicio desarrollado con JCross en Hotpotatoes para que los alumnos prueben e identifiquen su nivel de base con respecto a cuestiones básicas de Genética, conceptos, técnicas, características del ADN, etc. El ejercicio permite obtener pistas para completar el crucigrama y de esta manera finalizar el mismo habiendo asimilado o aprendido conceptos ya sabidos o nuevos de Genética.

  9. Organismos modificados genéticamente en la alimentación humana

    OpenAIRE

    Barros Fernández, Paula

    2014-01-01

    El presente trabajo trata la controversia del tema de los organismos modificados genéticamente (OMG). Se mencionan los beneficios que aporta la ingeniería genética y también los principales riesgos y preocupaciones existentes en torno al consumo de los alimentos modificados genéticamente, reportando casos de estudios que así lo constatan.Se tratan temas como seguridad alimentaria, legislación y normativas de etiquetado de estos nuevos alimentos, señalando su relación con la salud. Además, se ...

  10. Salud pública, genética y ética

    Directory of Open Access Journals (Sweden)

    Kottow Miguel H

    2002-01-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.

  11. Salud pública, genética y ética

    Directory of Open Access Journals (Sweden)

    Miguel H Kottow

    2002-10-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.

  12. Selección y caracterización de mutantes en Clementina. Cambios del transcriptoma asociados a la maduración del fruto de los cítricos y análisis de la expresión del gen fosfoenolpiruvato carboxiquinasa

    OpenAIRE

    IBÁÑEZ GONZÁLEZ, VICTORIA

    2012-01-01

    La tesis tiene como objetivo central el estudio de la maduración del fruto, proceso fisiológico escasamente conocido a nivel molecular. Para ello se han aislado y caracterizado varias mutaciones de clementino, los cuales han sido empleados para la identificación de rutas bioquímicas y genes importantes en el proceso de maduración. Además, se ha estudiado el proceso de degradación del ácido cítrico en los frutos, centrándose en la función de la fosfoenolpiruvato carboxiquinasa. OBJETIVOS ...

  13. Análisis genético molecular del Oso Andino ( Tremarctos ornatus en el norte de los andes (Venezuela, Colombia, Ecuador: Una visión global

    Directory of Open Access Journals (Sweden)

    Ruiz-García M.

    2001-06-01

    Full Text Available Se analizaron 82 muestras de oso andino (Tremarctos ornatus procedentes de 3 países latinoamericanos, Venezuela, Colombia y Ecuador, mediante 5 microsatélites hipervariables (G1A, G1D,
    G10B, G10C y G10X. Un exhaustivo análisis genético poblacional permitió determinar los siguientes aspectos fundamentales: (1 No existencia de equilibrio Hardy-Weinberg ni en el conjunto global de muestras ni en el conjunto particular de muestras para cada uno de esos países, al utilizar los tests exactos con cadenas de Markov y con el método de Fisher.

  14. La genética de las poblaciones centroamericanas

    Directory of Open Access Journals (Sweden)

    Barrantes, Ramiro

    2005-01-01

    Full Text Available Las poblaciones centroamericanas no han sido objeto de muchos estudios genéticos con la excepción de análisis esporádicos de la variación entre y dentro de los grupos amerindios y de origen africano ubicados en el área. No obstante, en los últimos 15 años se efectuaron investigaciones sistemáticas en este sentido incluyendo poblaciones mestizas, particularmente las de Costa Rica y Panamá. En los amerindios se efectuaron estudios detallados de su estructura genética y las relaciones filogenéticas entre poblaciones en un contexto regional y continental. De manera general estos grupos mantienen una baja diversidad genética. Por otra parte, estimativas de la mezcla génica en la población mestiza muestran diferencias dentro y entre los distintos países del área. Al Valle Central de Costa Rica se le atribuye la condición de aislado con una supuesta constitución genética homogénea favorable para los estudios de desequilibrio de ligamiento y asociaciones con algunas enfermedades hereditarias; sin embargo, los resultados obtenidos con relación el flujo génico direccional, la amalgama de etnias y otros componentes de su estructura como la variación temporal y espacial de la consanguinidad y la migración indican una mayor heterogeneidad. Se muestran los resultados y conclusiones obtenidas y se plantean las perspectivas y tendencias al mediano plazo que vinculan los enfoques y métodos de la epidemiología y la antropología genética y el estudio genético de poblaciones.

  15. Mutations in CFTR gene and clinical correlation in Argentine patients with congenital bilateral absence of the vas deferens Correlación de las características clínicas con mutaciones del gen CFTR en pacientes argentinos con ausencia bilateral congénita de vasos deferentes

    Directory of Open Access Journals (Sweden)

    Estrella M Levy

    2004-06-01

    Full Text Available Congenital bilateral absence of the vas deferens (CBAVD is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR gene have been identified. Here we identify different mutations of CFTR and the poly-T variant of intron 8 (IVS8 in Argentine patients and analyze sweat test values and clinical characteristic related to Cystic Fibrosis (CF. For counseling purposes the two most frequent mutations in Argentine CF population: DF508 and G542X were screened in wives. In all cases, it was possible to reduce the risk of CF/CBAVD descendants in these couples because none of the mutation were found in the 36 samples. Eight patients (23% showed abnormal chloride values (> 60 mmol/l. A second group of 6 patients (18% had borderline values of sweat chloride (40-59 mmol/l. We defined another group with 6 patients (18%, with normal sweat chloride levels (30-39 mmo/l and a fourth group of 14 (41% patients with sweat chloride below 30 mmol/l. DF508, the most frequent CF mutation in the Argentine population, was found on 15 of the 72 chromosomes (21%, R117H mutation was detected on 2 of 62 chromosomes (3%. Only one R347P allele was found on 28 chromosomes analyzed (2%. On a sample of 27 patients, IVS8 analysis showed a frequency of 6/56 chromosomes (11% of 5T allele. Even though these findings present an improvement in the detection of mutations related to clinical correlations in Argentine CBAVD population, the search for other common and uncommon mutations should be continued.La ausencia bilateral congénita de vasos deferentes (CBAVD es una forma de infertilidad masculina en la que se han identificado mutaciones en el gen de la conductancia transmembrana de la fibrosis quística (CFTR. Hemos estudiado en pacientes argentinos diferentes mutaciones en el CFTR y la variante poli T del intron 8 (IVS8 y analizado los valores de test del sudor y las características clínicas relacionadas a la Fibrosis Qu

  16. Enfermedades de base genética Genetically based diseases

    Directory of Open Access Journals (Sweden)

    D. González-Lamuño

    2008-01-01

    Full Text Available La genética constituye uno de los mayores avances científicos del siglo XX, que comienza con el redescubrimiento de las leyes de Mendel y termina con la elaboración del primer "borrador" de la secuencia completa del genoma humano. La genética utiliza diferentes estrategias de investigación, como los estudios de gemelos y de adopción, que investigan la influencia de los factores genéticos y ambientales, y las estrategias para identificar genes específicos (genética molecular. Además del importante grado de discapacidad que generan, el impacto social de las enfermedades hereditarias es enorme, por su carácter potencialmente recurrente en una misma familia y por el elevado coste socio-sanitario derivado de la enorme carga de cuidados que requiere. El diagnóstico de las enfermedades hereditarias presenta características diferenciadoras muy significativas ya que el resultado de un diagnóstico genético tiene no sólo efectos sobre el paciente sino también sobre todos los individuos emparentados. Por tanto, la unidad de estudio en el diagnóstico genético es la familia y todo proceso de diagnóstico implica una investigación familiar. También conviene tener en cuenta que los protocolos de diagnóstico se desarrollan de forma paralela a la investigación básica y generalmente están poco estandarizados. Los resultados obtenidos en los estudios genéticos y el tipo de información que se facilita al paciente y a su familia deben ser matizados dentro del proceso del "consejo genético".Genetics is one of the greatest scientific advances of the XX century, which begins with the rediscovery of Mendel’s laws and culminates in the elaboration of the first "draft" of the complete sequence of the human genome. Genetics employs different research strategies, such as the study of twins and adoption, investigating the influence of genetic and environmental factors, and strategies for identifying specific genes (molecular genetics. Besides the

  17. Valor pronóstico del gen de fusión TMPRSS2-ERG, metilación de PITX2 y marcadores inmunohistoquímicos en el cáncer de próstata.

    OpenAIRE

    Ferrandis Cortes, Cristina

    2015-01-01

    El cáncer de próstata es una de las causas de morbimortalidad más importantes en los países desarrollados. Actualmente las herramientas tanto diagnósticas como pronósticas con las que contamos son limitadas. A pesar de que el PSA ha supuesto un avance importante en el diagnóstico y pronóstico del cáncer de próstata no es un buen marcador cáncer-específico. Además, en las últimas décadas, el uso indiscriminado del PSA para la búsqueda del cáncer de próstata ha llevado a un sobrediagnóstico y s...

  18. Impacto de la normativa contable del Banco de España en el resultado de las entidades de crédito españolas. El efecto de la provisión genérica.

    OpenAIRE

    Cervera Millán, Mª Natividad

    2015-01-01

    RESUMEN DE LA TESIS A INCLUIR EN TESEO Las entidades de crédito españolas utilizan en su contabilidad del deterioro de inversiones crediticias el denominado modelo de provisión dinámica del Banco de España desde el año 2000, de carácter prudencial anticíclico. Este modelo es único en el ámbito de la Unión Europea, donde desde 2005 se siguen las Normas Internacionales de Información Financiera (NIIF) en la elaboración de las cuentas anuales de los grupos cotizados. El modelo del Banco de Es...

  19. Transhumanistas y Bioconservadores en torno al dopaje genético

    Directory of Open Access Journals (Sweden)

    Raúl Francisco Sebastián Solanes

    2013-04-01

    Full Text Available En el presente texto proponemos una reflexión sobre uso de tecnologías genéticas que  aumentan el rendimiento deportivo como futuro campo de investigación de una Neuroética social. Este problema, que se ha dado en llamar “dopaje genético”, congrega a su alrededor un debate entre los partidarios del Bioconservadurismo y del Transhumanismo. Expondremos la concepción de dos importantes representantes del Transhumanismo (J. Savulescu y C. Tamburrini y de dos conocidos partidarios del Bioconservadurismo (M. Sandel y R. L. Simon, a fin de subrayar la importancia de este debate y las futuras implicaciones en la mejora del rendimiento físico, cognitivo y educacional a las que se deberá hacer frente desde el nivel socio-cultural de la Neuroética.

  20. Evaluación genética de cruzamientos de ganado Brahman para características de crecimiento y medidas de ultrasonido en la microrregión del Sur del Cesar / Genetic evaluation of Brahman cattle crossbreds for growth and ultrasound-measured traits in the microregion of Southern Cesar

    OpenAIRE

    Martínez Niño, Carlos Alberto

    2011-01-01

    En el presente estudio se obtuvieron estimadores de efectos de raza, heterosis, componentes de (co)varianza, parámetros genéticos y predicciones de valores genéticos para pesajes y medidas ultrasónicas de canal (repetidas en el tiempo) en una población multirracial bovina. La población se obtuvo mediante el apareamiento aleatorio de 37 toros de 9 razas (Brahman Gris, Brahman Rojo, Guzerat, Blanco Orejinegro, Romosinuano, Simmental, Braunvieh, Normando y Limousin) con hembras Br...

  1. Medición del daño genético inducido por el basuco en linfocitos humanos empleando la prueba de micronúcleos con citocalasina b

    OpenAIRE

    Ocampo AP.; Carvajal SM.; Hoyos LS.

    2011-01-01

    El bazuco es una mezcla compleja que se deriva del proceso de extracción de la cocaína. El frecuente consumo de bazuco constituye un problema de salud pública. La prueba de micronúcleos en linfocitos humanos de sangre periférica por bloqueo de la citocinesis con Citocalasina B, es más sensible y precisa para evaluar daño  cromosómico porque permite registrar micronúcleos originados de fragmentos de cromosomas o cromosomas enteros en células que se han dividido una sola vez. El objetivo del pr...

  2. Justicia en salud y genética

    Directory of Open Access Journals (Sweden)

    Maria Graciela De Ortuzar

    2014-06-01

    Full Text Available Las expectativas puestas en el conocimiento genético exceden el ámbito de la medicina tradiciona, debido a que la intervención directa en la lotería natural demandaría el replanteamiento de conceptos centrales de justicia en salud: necesidades médicas, enfermedad, normalidad, e igualdad de oportunidades en el acceso a la salud. El punto en debate es sí el replanteo de dichos conceptos conlleva un cambio radical en las teorías de justicia (libertariana y/o liberal, mostrando su obsolescencia, o sí simplemente se requiere ampliar dichos conceptos claves por fallas estructurales en las mismas teorías. Como hipótesis general considero que los supuestos cuestionamientos, lejos de socavar las bases de las teorías de justicia, sólo ponen en evidencia sus viejos problemas estructurales. Por razones expositivas, dividiré la presentación tres partes. En la Primera parte, analizo la teoría libertariana, estudiando las contradicciones del modelo a través del impacto de la información genética en el seguro privado de salud. En la Segunda Parte, desarrollo la propuesta alternativa liberal rawlsianadanielsiana del modelo de seguro público, evaluando las implicaciones de la genética a partir de la crítica de su concepto biológico de enfermedad y su restricción al acceso a la salud por necesidades naturales. En la Tercera parte presento un modelo integral de necesidades y capacidades básicas, comprendiendo la prevención, el tratamiento y el mejoramiento moralmente permisible (genético y no genético.Mi aporte principal consiste en la elaboración de este modelo normativo integral de necesidades y capacidades para la regulación conjunta de la información y terapia genética con los restantes problemas de salud.

  3. Reubicación del parque de transformadores de los sistemas de distribución de Bogotá D.C. mediante algoritmos genéticos Relocation of electric transformers lot in Bogotá distribution systems using genetic algorithms

    Directory of Open Access Journals (Sweden)

    Johnn Alejandro Quintero Salazar

    2012-08-01

    Full Text Available Este documento presenta una metodología basada en algoritmos genéticos que permite adelantar el reordenamiento del parque de transformadores existente en el nivel de tensión I de los sistemas de distribución de Bogotá D.C., Colombia, con el fin de maximizar el reconocimiento de activos que el ente regulador CREG (Comisión Reguladora de Energía y Gas realiza a los distintos operadores de red, según lo establecido en la resolución 097 de 2008. Para la aplicación del algoritmo se obtuvieron mediciones de potencia activa máxima para cada hora del año 2009 en un conjunto de 94 transformadores de diferentes capacidades, escogidos de forma aleatoria, instalados en el sistema de distribución de CODENSA S.A. ESP, empresa encargada de prestar el servicio de energía eléctrica en la ciudad de Bogotá D.C. Con esta información se construyeron curvas de carga diarias representativas y se elaboró una base de datos que contiene los costos operativos del movimiento de los equipos y de las tarifas, a partir de los cuales fue posible modelar la función objetivo y las restricciones del problema, obteniéndose un elevado número de combinaciones posibles (alrededor de 1*10(134 debido al gran número de nodos y de transformadores presentes en el sistema de distribución. La búsqueda convencional de una solución en la anterior situación implicaría el empleo de tiempos prohibitivos, por lo cual se implementó un algoritmo genético clásico, obteniéndose de esta manera una solución óptima que ofrece una ganancia económica en el primer año, asociada al incremento en el cargo por uso, de $ 253.446.362,47 (COP, ganancias que podrían verse incrementadas considerablemente al ejecutar el algoritmo en parques de transformadores más grandes.This paper presents a methodology based on genetic algorithms that allows the reordering of the existing park transformers voltage level I of the distribution systems of Bogotá city, Colombia, in order to

  4. Parámetros Genéticos para Algunas Características Productivas y Reproductivas en un Hato Holstein del Oriente Antioqueño, Colombia Genetic Parameters for Some Productive and Reproductive Traits in a Dairy Herd in Eastern Antioquia, Colombia

    Directory of Open Access Journals (Sweden)

    Katerinne Quiroz Osorio

    2011-12-01

    Full Text Available La edad y el peso al primer parto y otros caracteres productivos y reproductivos son importantes porque determinan el desempeño futuro de las vacas lecheras, su análisis permite definir metas relacionadas con el inicio de la vida productiva de las mismas, influyendo directamente en el costo del periodo de crecimiento y desarrollo. En esta investigación se estimaron las heredabilidades (h2 y algunas correlaciones genéticas y fenotípicas para edad y peso al primer servicio, edad y peso al servicio fértil, producción en primera y segunda lactancia y algunas otras características relacionadas con el desempeño general de las vacas durante su vida. Fueron analizadas 928 lactancias de 184 vacas de la raza Holstein nacidas entre 1985 y 2006 en un hato lechero del departamento de Antioquia. Los componentes de varianza fueron estimados mediante análisis univariados con la metodología de máxima verosimilitud restricta libre de derivadas y las correlaciones se estimaron directamente con la información fenotípica y los valores genéticos estimados. Se utilizó el programa SAS 9,0 para la edición de los datos y los análisis estadísticos y el software MTDFREML para el análisis genético. No se encontró efecto significativo (P>0,05 de la edad y peso al primer servicio con producción de leche en primera y segunda lactancia, ni con caracteres reproductivos, la edad y el peso al primer servicio fértil tuvieron efecto altamente significativo (PThe age and weight at first calving and other productive and reproductive traits are decisive because are important for the future performance of dairy cows, their analysis allows to define some goals related to the start of productive life of those, influencing direct economic cost of the period of growth and development. In this research, were estimated the heritability (h2 and some genetic and phenotypic correlations of age and weight at first service, age and weight at fertile service, milk yield at

  5. Cabells blancs, un destí també escrit als gens

    OpenAIRE

    Bueno i Torrens, David, 1965-

    2016-01-01

    Un dels aspectes més evidents del pas del temps és l'emblanquiment dels cabells. Tanmateix, aquest procés únicament es produeix en les persones d'ascendència europea. En les d'origen asiàtic, africà i amerindi, és un fet rar i excepcional. Andrés Ruiz-Linares i els seus col·laboradors, de diverses universitats i centres de recerca europeus, sud-americans i australians, han aïllat el gen que el provoca, i també han identificat disset gens més que contribueixen a definir les característiques ge...

  6. Comparación de un algoritmo genético y la técnica Nube de partículas en la solución del Flow Shop Scheduling

    Directory of Open Access Journals (Sweden)

    José Eduardo Márquez Delgado

    2012-12-01

    Full Text Available El problema de secuenciamiento de tareas o Flow Shop Scheduling Problems (FSSP es un problema clásico de la programación de trabajos. Este problema es típico de la optimización combinatoria y se presenta en talleres con tecnología de maquinado donde existen máquinas-herramientas convencionales y se fabrican diferentes tipos de piezas que tienen en común una misma ruta. La solución de este problema consiste en encontrar una secuencia de tareas que emplee un tiempo mínimo de procesamiento (makespan. El mismo está incluido dentro de la gran variedad de problemas de planificación de recursos, el  cual, como  muchos  otros  en este campo, es  de difícil solución y está clasificado técnicamente como de solución en un tiempo no polinomial. En la presente investigación se implementa un algoritmo genético simple  y la técnica nube de partículas para dar solución a dicho problema y se compara la calidad de dichas soluciones lográndose resultados satisfactorios y de gran interés.  Para validar los resultados arrojados por ambas técnicas computacionales se usan como  casos de prueba, instancias de problemas de planificación de la literatura especializada de diferentes tamaños y complejidad.

  7. Diversity of Genetic Resources and Genetic Association Analyses of Green and Dry Chillies of Eastern India Diversidad de Recursos Genéticos y Análisis de Asociación Genética de Ajíes Verdes y Secos del Este de India

    Directory of Open Access Journals (Sweden)

    Arup Chattopadhyay

    2011-09-01

    , para estudiar la variabilidad genética para diferentes rasgos y evaluar la asociación de diferentes rasgos productivos con el rendimiento de ají verde y seco. Treinta y cuatro genotipos se caracterizaron durante un período de 2 años. La mayoría de los genotipos poseía constelación de caracteres de C. annuum. Dos genotipos, ‘Chaitali Pointed’ y ‘BC CH Sel-4’ fueron los más promisorios para rendimiento de fruto verde (272,79 g, 221,10 g por planta y de fruto seco (54,56 g, 44,44 g por planta. Los valores de coeficiente de variación fenotípica y genotípica se consideraron altos para peso de fruto verde (119,95%, 111,26%, circunferencia fruto verde (89,76%, 48,93%, peso de fruto maduro rojo (112,02%, 111,93%, peso de fruto seco (111,63%, 110,97% y número de frutos por planta (86,05%, 85,02%. Rendimiento de fruto verde, contenido de ácido ascórbico, y número de frutos por planta también mostraron heredabilidad en sentido amplio y avance genético altos. Para el estudio de correlación y análisis de coeficientes, los índices de selección más importantes fueron número de frutos por planta y longitud de fruto verde para ají verde, y peso de fruto seco y número de frutos por planta para ají seco.

  8. Construcción y caracterización in vitro e in vivo de un sistema bivectorial bidireccional regulable Tet-Off para el gen sintético del péptido tímico timulina y el gen reportero de la GFP

    OpenAIRE

    Poch, Brenda; Costa, M.; Omar J Rimoldi; Rodolfo G Goya; Reggiani, Paula Cecilia

    2010-01-01

    La timulina es una hormona tímica involucrada en diversos aspectos de la diferenciación intra- y extratímica de las células T. Esta hormona, que consiste en un nonapéptido (FTS) coordinado al ión Zn+2 (FTS-Zn) en una relación equimolecular, posee una acción inmunomodulatoria, actividad hipofisotrófica y actividad antiinflamatoria y analgésica en el sistema nervioso central. Además, se ha demostrado que es clave en la acción del timo sobre el eje hipotálamo-hipófiso-ovárico. En estudios previo...

  9. Estudio de la evolución de un fitopatógeno: Genómica comparada del hongo patógeno de maíz Colletotrichum graminicola

    OpenAIRE

    Rech, Gabriel Eduardo

    2014-01-01

    [ES] Uno de los mayores problemas para el desarrollo de estrategias efectivas frente a hongos fitopatógenos es que, al igual que la mayoría de los microorganismos, presentan una gran plasticidad fenotípica y una extraordinaria capacidad de adaptarse a nuevos ambientes y/o de infectar nuevos huéspedes. En este contexto, resulta imprescindible determinar qué genes (u otras regiones del genoma) muestran evidencias de evolución adaptativa con el objetivo de identificar secuencias involucradas en ...

  10. Estudio de la transición nucleohistona-nucleoprotamina "in vivo" e "in vitro". Clonación, secuenciación y expresión del gen de la protamina galina.

    OpenAIRE

    Oliva Virgili, Rafael

    1986-01-01

    [spa] Para investigar los cambios de composición y estructura de la cromativa en las distintas fases de la espermatogénesis, se han puesto a punto para el testículo de gallo las técnicas de obtención de suspensiones celulares por disociación tríptica del tejido y separación de las células a gravedad unidad. Los resultados obtenidos indican que a medida que progresa la espermiogénesis se detectan cantidades crecientes de protamina y decrecientes de histonas. Coincidiendo con esta transición nu...

  11. Estatus de parámetros oxidativos y del gen p53 en sangre de niños en edad escolar de zonas afectadas por el accidente nuclear de Chernobyl.

    OpenAIRE

    García Mora, Mª Carmen

    2004-01-01

    RESUMEN Tras el accidente nuclear de Chernobyl producido el 26 de abril de 1986 se liberaron muchos radioisótopos, produciendo la contaminación del medio ambiente, con la consiguiente implicación sobre la salud de las personas afectadas. La irradiación produce su efecto sobre el material biológico de manera directa, como consecuencia inmediata de la ionización inducida por la irradiación y de manera indirecta, que al interaccionar sobre cualquier estructura celular, esencialmente el agua t...

  12. FutureGen Project Report

    Energy Technology Data Exchange (ETDEWEB)

    Cabe, Jim; Elliott, Mike

    2010-09-30

    This report summarizes the comprehensive siting, permitting, engineering, design, and costing activities completed by the FutureGen Industrial Alliance, the Department of Energy, and associated supporting subcontractors to develop a first of a kind near zero emissions integrated gasification combined cycle power plant and carbon capture and storage project (IGCC-CCS). With the goal to design, build, and reliably operate the first IGCC-CCS facility, FutureGen would have been the lowest emitting pulverized coal power plant in the world, while providing a timely and relevant basis for coal combustion power plants deploying carbon capture in the future. The content of this report summarizes key findings and results of applicable project evaluations; modeling, design, and engineering assessments; cost estimate reports; and schedule and risk mitigation from initiation of the FutureGen project through final flow sheet analyses including capital and operating reports completed under DOE award DE-FE0000587. This project report necessarily builds upon previously completed siting, design, and development work executed under DOE award DE-FC26- 06NT4207 which included the siting process; environmental permitting, compliance, and mitigation under the National Environmental Policy Act; and development of conceptual and design basis documentation for the FutureGen plant. For completeness, the report includes as attachments the siting and design basis documents, as well as the source documentation for the following: • Site evaluation and selection process and environmental characterization • Underground Injection Control (UIC) Permit Application including well design and subsurface modeling • FutureGen IGCC-CCS Design Basis Document • Process evaluations and technology selection via Illinois Clean Coal Review Board Technical Report • Process flow diagrams and heat/material balance for slurry-fed gasifier configuration • Process flow diagrams and heat/material balance

  13. Algoritmos genéticos locales

    OpenAIRE

    García-Martínez, Carlos; Lozano, Manuel

    2007-01-01

    Los Algoritmos Genéticos Locales son procedimientos que iterativamente re nan soluciones dadas. Su diferencia con procedimientos de mejora iterativa clásicos reside en el uso de operadores genéticos para realizar el re namiento. En este estudio presentamos un nuevo Algoritmo Genético Local Binario basado en un Algoritmo Genético Estacionario. Hemos comparado el Algoritmo Genético Local Binario con otros procedimientos de mejora iterativa de la literatura. Los res...

  14. Estudi pragmaestilístic de la premsa escrita diària trets i usos estilístics en les distintes modalitats genèriques dels diaris d'informació general /

    OpenAIRE

    Palau Sampio, Dolors

    2009-01-01

    Consultable des del TDX Títol obtingut de la portada digitalitzada La presència inflacionista de l'etiqueta estil periodístic en llibres de redacció professionals, manuals i altres obres de producció acadèmica no ha anat acompanyada, en general, d'una reflexió sòlida sobre les seues arrels o l'abast en els textos periodístics. La referència a aquesta noció ha esdevingut una salmòdia repetida i acrítica, assimilada sense prendre una distància adequada i reproduïda amb vocació de dogma de...

  15. GenLab, Laboratorio Virtual de Genética

    Directory of Open Access Journals (Sweden)

    García Sergio

    2000-12-01

    Full Text Available

    GenLab es el nombre que tiene el software diseñado por nosotros, en el cual se modela el proceso meiótico y la fecundación en organismos diploides. El objetivo de esta aplicación es ilustrar el resultado de un cruce determinado, tratando de ser lo más ajustados a la realidad. La modelación de la reproducción sexual se realiza internamente y el GenLab se limita a presentar los resultados según el número de descendencia seleccionado para un cruce específico, esto significa que se puede escoger una gran cantidad de características para los parentales y se puede estudiar la frecuencia de estos en la descendencia. El modelo cuenta con base de datos donde están almacenados algunos de los locus de Drosophila melanogaster junto con su ubicación en centimorgans 1. EI propósito de este modelo es servir como herramienta pedagógica  y didáctica tanto en universidades como en colegios, facilitando el aprendizaje de algunos principios básicos de la genética, por lo cual puede ser usado si se cuenta con una conexión a Internet y un navegador visitando http://biologia.unal.edu.co/fidel.

  16. Mineralogía y aspectos genéticos del depósito volcanogénico submarino de Manganeso "La Casualidad", Cerro atraves, Neuquén

    Directory of Open Access Journals (Sweden)

    Eduardo O Zappettini

    2012-12-01

    Full Text Available El depósito La Casualidad está constituido por capas manganesíferas intercaladas en calizas y tobas de la Formación Chachil (Pliensbachiano. La mineralización identificada comprende carbonatos (rodocrosita, calcita, sulfatos (baritina, jarosita, silicatos (tefroíta, granate manganesífero, pennantita, serpentina -caryopilita-, nontronita, bementita, óxidos (pirolusita, espinelos de la serie jacobsita-franklinita, pirofanita, hetaerolita, akhtenskita, nsutita, criptomelano, coronadita, hematita, magnetita, jaspe, sulfuros (gersdorffita, esfalerita, galena, pirita, calcopirita, greigita y posible alabandita y sulfosales (de la serie tennantita-tetraedrita, algunos de ellos reconocidos por primera vez en Argentina. La mineralogía y geoquímica del depósito sugieren que éste se formó en condiciones hidrotermales submarinas en un paleomargen extensional a través de fallas sinsedimentarias en un ambiente hemipelágico con desarrollo de plataforma calcárea. Su génesis se vincula con la etapa de rift tardío del depocentro Chachil, definido como un pequeño hemigraben extensional activo durante el rifting inicial de la Cuenca Neuquina. La presencia de sulfuros y de niveles de granates manganesíferos, así como la asociación de los niveles de Mn con calizas, sugiere la posibilidad de hallazgo de cuerpos de sulfuros masivos en las proximidades.La Casualidad ore deposit is characterized by manganiferous layers interbedded with limestones and tuffs of the Chachil formation (Pliensbachian. The identified mineralogy comprises carbonates (rhodochrosite, calcite, sulfates (barite, jarosite, silicates (tefroite, manganoan garnet, pennatite, serpentine -caryopillite-, nontronite, bementite, oxides (pyrolusite, spinels from the jacobsite-franklinite series, pyrophanite, hetaerolite, akhtenskite, nsutite, cryptomelane, coronadite, hematite, magnetite, jasper, sulfides (gersdorffite, sphalerite, galena, pyrite, chalcopyrite, greigite y possible

  17. Validación y resultados preliminares del kit de AmpFlSTR® MinifilerTM en el Laboratorio de Genética Forense de la DIJIN, Policía Nacional de Colombia Validation and preliminary results of kit AmpFlSTR® MinifilerTM in the Laboratory of Forensic Genetics of DIJIN, National Police Colombia

    Directory of Open Access Journals (Sweden)

    M.L. Acevedo

    2011-06-01

    Full Text Available El laboratorio de la Dirección de Investigación Criminal e Interpol (DIJIN de la Policía Nacional implementó la utilización del kit AmpF l STR® MinifilerTM PCR Amplification de AppliedBiosystems con el fin de ayudar en la resolución de casos donde se sospechara una gran fragmentación del ADN. Metodología: Se evaluaron las alturas de los picos de los controles utilizando dos termocicladores diferentes, dos analizadores genéticos ABI Prism310® y empleando dos volúmenes finales de reacción de PCR. Se evaluó la sensibilidad utilizando muestras de concentraciones entre 0,1 ng/µL hasta 0,006 ng/µL y los datos fueron analizados con el software Genemapper ID v3.2. Se valoró la precisión y la reproducibilidad comparando 10 muestras donde se incluía sangre a diferentes concentraciones, saliva, prendas, evidencias traza, pelo, hueso y diente. Una vez realizada la validación se hicieron pruebas con muestras de 5 casos que habían presentado concentraciones bajas de ADN y amplificaciones parciales utilizando el kit AmpF l STR® Identifiler®. Resultados y discusión: Se pudo verificar que la concentración ideal para el uso del kit AmpF l STR® MinifilerTM está en un rango entre 0,05 y 0,075 ng/µl de ADN. Se encontró que es posible obtener resultados en muestras con concentraciones de 0,02 ng/µl; cuando la concentración es inferior, los resultados no son reproducibles. En 4 muestras previamente genotipificadas con el kit AmpF l STR® Identifiler®, se amplió el número de marcadores obtenidos en más del 48% con la utilización del kit AmpF l STR® MinifilerTM y se pudo llegar a la probabilidad exigida por la ley colombiana.The laboratory of the Bureau of Criminal Investigation and Interpol (DIJIN of the National Police implemented the use of the kit AMPF l STR®MinifilerTM PCR Amplification of AppliedBiosystems to assist in the resolution of cases where suspected large DNA fragmentation. Methods: We evaluated the peak heights of

  18. Microevolution of human archaic groups of Arica, northern Chile, and its genetic contribution to populations from the Formative Period Microevolución de grupos humanos arcaicos de Arica, norte de Chile, y su contribución genética a las poblaciones del Período Formativo

    Directory of Open Access Journals (Sweden)

    HÉCTOR HUGO VARELA

    2006-06-01

    Mahalanobis (MDS. La estructura de población se analizó utilizando un método basado en teoría genética cuantitativa que predice una relación lineal entre la varianza promedio intragrupal y su distancia hacia el centroide poblacional. Las cuatro muestras analizadas demostraron ser morfológicamente diferentes. La mayor diferencia fue observada entre Plm-7 (Formativo costero y Alto Ramírez (Formativo valluno, la menor entre Morro-Uhle y Morro 1-1/6, teniendo las otras distancias valores intermedios. El grupo más divergente fue Alto Ramírez y el menos divergente Morro 1-1/6. Un cambio gradual morfológico se observó entre el arcaico (Morro Uhle y Morro 1-1/6 y el Formativo costero (Plm-7 indicando una contribución morfológica (genética de los pescadores arcaicos a las poblaciones formativas en la costa del norte de Chile, sin excluir, por cierto, flujo génico de otros grupos de la región centro-sur andina

  19. Desarrollo de un nuevo método para el análisis del estado de metilación del gen hTERT y su asociación con la infección por el virus de papiloma humano en tejidos de pacientes con cáncer cervical invasivo

    OpenAIRE

    Morales Cárdenas, Mauro Nicolás

    2013-01-01

    El cáncer de cuello uterino es un problema de salud pública en Colombia, con una incidencia de 21.5 X 100000 mujeres al año. Se ha demostrado una fuerte relación entre la infección con el virus del papiloma humano (VPH) de alto riesgo y el desarrollo de cáncer cervical y de sus lesiones precursoras. La presencia de VPH es así, una causa necesaria pero no suficiente para el desarrollo de cáncer cervical y otros factores del virus, del huésped y del ambiente pueden estar involucrados en la onco...

  20. Relación del polimorfismo -55CT del gen UCP3 con la pérdida de peso y los cambios metabólicos tras una dieta hipocalórica rica en ácidos grasos poliinsaturados en pacientes obesos Relation of -55CT polymorphism of UCP3 gene with weight loss and metabolic changes after a high polyunsaturated fat diet in obese patients

    Directory of Open Access Journals (Sweden)

    D. A. de Luis

    2012-08-01

    Full Text Available Antecedentes y objetivos: La alteración en la expresión de las proteinas UCP3 podrían reducir el gasto energético y aumentar el almacenamiento de energía en forma de grasa. El objetivo de nuestro estudio fue investigar la influencia del polimorfismo -55CT del gen UCP3 en la respuesta metabólica, pérdida de peso y los niveles séricos de adipocitoquinas tras una dieta hipocalórica rica en grasas poliinsaturadas en pacientes obesos. Diseño: Se estudió una muestra de 133 pacientes obesos de forma prospectiva durante 3 meses. La dieta hipocalórica tenía 1.459 kcal, un 45,7% de hidratos de carbono, un 34,4% de los lípidos y un 19,9% de las proteínas. La distribución de las grasas era; un 21,8% de grasas saturadas, un 55,5% de grasas monoinsaturadas y un 22,7% de las grasas poliinsaturadas (7 g por día de ácidos graso w6, 2 g por díia de w-3 y una ratio w6/w3 de 3,5. Resultados: Un total de 100 pacientes (28 varones/72 mujeres (75,2% tenían el genotipo -55CC (grupo con genotipo salvaje y 33 pacientes (8 varones/25 mujeres (24,8% el genotipo -55CT (grupo con genotipo mutante. En el grupo con genotipo salvaje disminuyeron el índice de masa corporal (-2,5 ± 5,3 kg/m², peso (-4,2 ± 3,7 kg, masa grasa (-3,7 ± 3,3 kg, circunferencia de la cintura (-4,1 ± 2,9 cm, tensión arterial sistólica (-4,9 ± 10,1 mmHg, niveles de colesterol total (-16,1 ± 23,6 mg/dl, colesterol LDL (-11,1 ± 26,8 mg/dl, triglicéridos (-12,0 ± 46,8 mg/dl, insulina (-1,8 ± 4,5 UI/L, HOMA-R (-0,6 ± 1,5 y leptina (-6,2 ± 8,4 ng/ml. En el grupo con genotipo mutante disminuyeron significativamente los parámetros antropométricos sin modificaciones significativas de parámetros bioquímicos. Conclusión: Los pacientes portadores del alelo T del polimorfismo -55CT del gen UCP3, presentan una ausencia respuesta metabólica ante la perdida de peso inducida por una dieta hipocalórica rica en ácidos grasos poliinsaturados.Background and objectives: The

  1. Algoritmos genéticos distribuidos: heterogeneidad y migración

    OpenAIRE

    Dupuy, Germán; Stark, Natalia; Sanz Troiani, Fernando; Alfonso, Hugo; Bermúdez, Carlos; Salto, Carolina; Minetti, Gabriela F.

    2016-01-01

    Esta línea de investigación se enfoca en las metaheurísticas distribuidas, en especial los algoritmos genéticos distribuidos, dado que permiten reducir significativemente la complejidad temporal de la resolución y mejorar la calidad de las soluciones obtenidas. Dos características sumamente importantes a la hora de resolver problmas NP-duros y NP-completos. Por un lado, esta línea de investigación se dedica a la configuración y evaluación del desempeño de los algoritmos genéticos distribui...

  2. Heterosis en maíz del Altiplano de México con diferente grado de divergencia genética Heterosis in maize from the Mexican Highlands with different degree of genetic divergence

    Directory of Open Access Journals (Sweden)

    Gilberto Esquivel Esquivel

    2011-06-01

    Full Text Available Con el objetivo de valorar la variación de la heterosis, y de identificar posibles patrones heteróticos en maíz (Zea mays L, se evaluaron 15 poblaciones progenitoras originarias del área de distribución geográfica de la raza Chalqueño y sus 105 cruzamientos, más otros grupos de genotipos adicionales, todos provenientes de Valles Altos de México. La evaluación se hizo en el ciclo agrícola primavera-verano 2006 en Zotoluca, Apan y Mixquiahuala en el estado de Hidalgo y Texcoco en el Estado de México, bajo un diseño látice 12* 12 con tres repeticiones. Se registró el rendimiento de grano, índice de grano, mazorcas por planta, diámetro de mazorca, longitud de grano, número de hileras por mazorca, días a floración masculina y altura de planta. Hubo diferencias significativas (pWith the aim of assess the variation of heterosis, and to identify potential heterotic patterns in maize (Zea mays L., 15 progenitor populations originating from the geographical area of distribution of the Chalqueño race, along with their 105 crosses and other additional groups of genotypes all of them from the Mexican Highlands were evaluated. The evaluation was carried out during the 2006 Spring-Summer agricultural cycle in Zotoluca, Apan, Hidalgo, Mixquiahuala, Hidalgo and Texcoco, State of Mexico, under a 12* 12 lattice design with three replications. Grain yield, grain index, corncobs per plant, corncob diameter, kernel length, number of kernel rows per corncobs; days to anthesis and plant height were registered. Significant differences (p< 0.01 among locations, among groups and among populations within groups were detected for the eight traits. Significant correlation was found between yield and its components and between yield and plant height. Populations Col-03-64, Col-6784 and F HC H-129Fn of the Chalqueño race showed high per se performance, as did their crosses as an average, while Gto-142, Zac-66, Tlaxcala-151 and VS-22, variants of the same

  3. Diagnóstico precoz del cáncer primario de hígado: imagen versus genética Early diagnosis of primary liver cancer: imaging versus genetics

    Directory of Open Access Journals (Sweden)

    A. Forner

    2008-07-01

    Full Text Available El diagnóstico precoz del carcinoma hepatocelular (CHC es fundamental, especialmente si se consigue cuando los nódulos son menores de 2 cm, dado que en esta fase la mayoría aún no han presentado invasión vascular y la aplicación de tratamientos radicales se acompaña de una alta tasa de supervivencia a largo plazo. Los avances en las técnicas de imagen en los últimos años han permitido llegar a un diagnóstico concluyente de CHC en algunos de estos nódulos de pequeño tamaño sin necesidad de realizar procedimientos invasivos. Sin embargo, el número de CHC que pueden ser diagnosticados mediante pruebas de imagen es bajo y en más de la mitad de los casos sigue siendo necesaria la realización de una biopsia. Por otro lado, la confirmación histológica de CHC en este tipo de nódulos es compleja y en muchas ocasiones imposible, dado el posible error de muestreo y la dificultad para diferenciar CHC bien diferenciado de nódulos displásicos en una muestra habitualmente con escaso material. Además, los marcadores tumorales séricos disponibles en la actualidad presentan un bajo rendimiento y carecen de utilidad en el diagnóstico precoz de CHC. Los progresos en el conocimiento de los mecanismos moleculares responsables de la transformación maligna permitirán aplicar una serie de técnicas de biología molecular para facilitar el diagnóstico de CHC de forma precoz, con resultados iniciales prometedores.Early diagnosis of hepatocellular carcinoma (HCC in nodules smaller than 2 cm detected by screening ultrasounds becomes essential given that, at that stage, no vascular invasion is usually detected and treatment is associated with a high rate of long-term survival. Improvements in imaging techniques in the last few years have allowed a conclusive diagnosis of HCC in these small nodules without invasive procedures. However, a conclusive diagnosis of HCC by imaging is not always possible and, in more than half of cases, biopsy is needed

  4. Diversidad genética de poblaciones de ajo (Allium sativum L. cultivadas en Guatemala, definida por marcadores de ADN

    Directory of Open Access Journals (Sweden)

    Fredy Uber Rosales-Longo

    2007-01-01

    Full Text Available Diversidad genética de las poblaciones de ajo (Allium sativum L. cultivadas en Gua temala, definida por mar cado res de ADN. En Guatemala es escasa la in for ma ción sobre la diversidad genética de ajo. Los objetivos del estudio fueron: incidir en el mejoramiento de Allium sativum, so bre la base del conocimiento de su variabilidad genética, así mismo, establecer una colección in vi tro de la co lec ción de las poblaciones cultivadas en Guatemala. Los experimentos fueron realizados entre octubre de 2005 y marzo de 2006. La determinación de las variaciones de ADN se realizaron me dian te la téc ni ca de AFLP™. La información se analiza por medio de análisis de componentes principales, análisis de coordenadas principales y análisis de conglomerados. Mediante la inspección de los pro duc tos de AFLP™ y análi sis estadísticos, se detectó una alta variabilidad genética entre los materiales vegetales colectados. Las muestras clasificadas co mo del ti po “Chi leno”, correspondieron a los tipos “Criollo”. Nueve bien diferenciados grupos genéticos se conformaron en un dendrograma y se con fir mó que la diversidad genética descubierta es una función del lugar don de se cul ti van las po bla cio nes de ajo. Se identificó una mayor diversidad genética entre las mues tras de ajo del ti po “Crio llo” que las que se tienen en tre los ma te ria les del ti po “Chileno”, como producto de la mayor dispersión espacial de los primeros. Los materiales genéticos de ajo se encuentran actualmente preservados en un Banco de Germoplasma in vi tro en la Uni dad de Bio tec no lo gía del IC TA.

  5. Implicación del estrés oxidativo, alimentación, estilo de vida y variantes polimórficas del gen de apolipoproteína D en pacientes con pólipos intestinales y con adenocarcinoma esporádico de colon

    OpenAIRE

    Crespo Sanjuán, Jesús

    2012-01-01

    El estrés oxidativo (EO) constituye un mecanismo fundamental en la génesis de cáncer colorectal (CRC) dando lugar a las mutaciones que convierten las células en cancerosas. Comprobamos cómo existe un incremento del EO en sangre y en tejido de pacientes con pólipos y con CRC conforme avanza la enfermedad. Se trata del primer estudio que analiza en plasma de estos pacientes los valores de Mieloperoxidasa, encontrándose incrementados a medida que avanza el estadío. Los pacientes que consu...

  6. Implicaciones del estudio de inestabilidad del ciclo celular en la biología del cáncer.

    OpenAIRE

    Luis Tume-Farfán

    2014-01-01

    Todas las células poseen mecanismos para mantener la integridad genómica que es vital para la supervivencia celular y la proliferación. Las células se dividen a tasas normale s durante su tiempo de vida, cuando esta tasa sobrepasa los límites normales ocurren alteraciones a nivel genético que afectan el control del ciclo celular por lo tanto estas células crecen y se dividen sin control y ya no responden a señalización extrace lular que indica la detención del ciclo y la apoptosis, estos meca...

  7. Salud pública, genética y ética

    OpenAIRE

    Kottow Miguel H

    2002-01-01

    La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del princ...

  8. fundamentales del hombre

    Directory of Open Access Journals (Sweden)

    Edmundo Hernández Vela Salgado

    2005-01-01

    Full Text Available En este artículo, el autor analiza los vínculos que deben existir entre la ciencia, la ética, la moral y los derechos humanos. En su trabajo, el autor expone el trascendente papel que desempeña la bioética como guardiana de los derechos y libertades fundamentales del hombre, papel basado en una relación dinámica entre los desarrollos científico-tecnológicos aplicados —en la biología, la biotecnología, la genética y, particularmente en sus modernas expresiones, la genómica y la proteómica— y los valores y opciones éticas humanos. Asimismo, se aborda esta temática desde el punto de vista de la creciente cooperación internacional.

  9. Análisis molecular del gen TPSAB1, un gen polimórfico

    OpenAIRE

    Hernández Hernández, Laura

    2013-01-01

    [ES]Introducción: La triptasa es una serin-proteasa relacionada con la tripsina. El término triptasa comprende al menos cuatro proteasas diferentes: α, ß, γ y δ, que presentan diferencias en cuanto a sus propiedades enzimáticas. Las funciones de esta proteína no han sido completamente dilucidadas, aunque se ha implicado en fenómenos inflamatorios, protección contra la infección y otros fenómenos inmunológicos. La estructura de esta proteína es tetramérica y los genes que las codifican se encu...

  10. Variabilidad genética y gestión forestal

    Directory of Open Access Journals (Sweden)

    R. Alía

    2003-01-01

    Full Text Available La diversidad biológica, su conservación e incremento, es uno de los principios básicos de la gestión forestal sostenible. La alta variabilidad genética de las especies forestales es responsable de los procesos de adaptación ante factores bióticos y abióticos extremos que, a su vez, aseguran la persistencia frente a los riesgos a los que están sometidas las masas forestales. En este trabajo se analizan distintos aspectos relacionados con la variabilidad genética de las especies forestales, y como la gestión forestal influye sobre ella. Se analiza la variabilidad entre poblaciones (que es una de las bases de la comercialización de material forestal de reproducción, la influencia del sistema de reproducción en la variabilidad genética de las masas y los efectos en ellas de los tratamientos selvícolas, así como la variación individual y clonal aprovechada en los programas de selección. Por último, se analiza el papel de la variabilidad genética en los programas de mejora y conservación de recursos genéticos forestales

  11. Genève Reconnaissante

    CERN Multimedia

    2001-01-01

    Robert Cailliau (centre), with Geneva's Mayor Alain Vaissade (left) and Jean Erhardt, Secretary General of the Administrative Council of Geneva (right). Geneva recognised the contribution of two CERN people to the reputation of the city last Tuesday when Mayor Alain Vaissade presented the Genève Reconaissante Medal to Tim Berners-Lee and Robert Cailliau. Berners-Lee, who was not able to be present in person, invented the World Wide Web at CERN just over a decade ago, while Cailliau was his first collaborator. Quoting Cailliau, Vaissade said that whilst there is no doubt that something like the Web would have appeared sooner or later, the fact that it happened at CERN, in Geneva, was no accident. Both the Laboratory and the city are places where people from around the world meet and work in harmony.

  12. Daño genético y exposición a plaguicidas en trabajadores agrícolas del Valle de San Quintín, Baja California, México Genetic damage and exposure to pesticides among agricultural workers from Valle de San Quintín, Baja California, México Danos genéticos e exposição a pesticidas em trabalhadores agrícolas do Vale San Quintin, Baixa California, México

    Directory of Open Access Journals (Sweden)

    J. Claudia Leyva Aguilera

    2012-12-01

    Full Text Available Diferentes estudios muestran la capacidad de los plaguicidas para inducir daño genético (DG con diversos efectos en la salud. En el presente trabajo se estudia la genotoxicidad en residentes del valle agrícola de San Quintín, Baja California, México (VSQ. El objetivo fue determinar si la exposición laboral y ambiental a plaguicidas en la región del VSQ es un factor de DG y explorar si las mujeres son más vulnerables a dicho efecto. Se aplicó un cuestionario a 88 residentes del VSQ para determinar los factores de inclusión y exclusión del estudio, 40 aceptaron participar, 25 expuestos ocupacionalmente a plaguicidas y 15 ambientalmente expuestos, con similar número de hombres y mujeres. Todos los participantes firmaron un consentimiento informado. Se utilizó la técnica de micronúcleos (MN por bloqueo de la citocinesis en sangre periférica para evaluar el DG con la frecuencia de MN y Puentes de Cromatina en 1000 células binucleadas (CBN; se exploró la correlación del DG con el tiempo de exposición ocupacional a plaguicidas. Los hombres ambientalmente expuestos tuvieron menos DG que las mujeres con medias de MN de 8,1 (±1,83 y 13,1 (±1,7 respectivamente; en cambio, la exposición laboral afectó a los dos sexos: los hombres tuvieron una media de MN igual a 15,9 (±2,9 y en las mujeres fue 18,1 (±1,7. Se concluye que la exposición laboral a plaguicidas es un factor de DG, las mujeres mostraron mayor vulnerabilidad al DG. El tiempo de exposición laboral se relaciona directamente con el aumento del número de MN.Various studies have shown the ability of pesticides to induce genetic damage (GD that can cause health effects. In the present work, a genotoxicological study was conducted monitoring residents from the agricultural region of the San Quintin Valley (SQV, Baja California, Mexico. The objective was to determine if occupational and environmental exposure to pesticides in the region of the SQV is a factor in GD, and to

  13. La protección jurídica de los datos genéticos en México

    OpenAIRE

    Ochoa Villicaña, Ana María

    2012-01-01

    Es indudable que los datos genéticos humanos revisten una importancia capital para el desarrollo de la ciencia y la medicina. Son esenciales para: la investigación fundamental (mejor conocimiento del genoma humano y de las interacciones de éste con el medio ambiente).

  14. Análisis comparativo de la aplicación de distintos operadores genéticos al problema de job shop scheduling

    OpenAIRE

    Alfonso, Hugo; Salto, Carolina; Gallard, Raúl Hector

    2000-01-01

    Este trabajo describe un estudio de distintas soluciones al problema del job shop scheduling basado en algoritmos genéticos. La característica fundamental es la utilización de decodificadores incorporada a la representación del cromosuma. El objetivo del trabajo es comparar la performance de los distintos tipos de operadores de crossovers que se pueden usar con esta representación.

  15. Animal transgénico no humano que sobreexpresa el gen de la P-enolpiruvato carboxiquinasa para su utilizacion en el estudio de la diabetes mellitus y en el desarrollo de aproximaciones terapéuticas a la enfermedad.

    OpenAIRE

    Bosch i Tubert, Fàtima; Valera Abril, Alfons

    2001-01-01

    Animal transgénico no humano que sobreexpresa el gen de la p- enolpiruvato carboxiquinasa para su utilización en el estudio de la diabetes mellitus y en el desarrollo de aproximaciones terapéuticas a la enfermedad. Se refiere a un minigen que utiliza una parte del gen y del cDNA (ADN complementario) de la PEPCK (P- enolpiruvato carboxiquinasa) o gen de la PEPCK modificado por una etiqueta dirigidos por un promotor o fusión de promotores. También se refiere a un vector de expresión que permite...

  16. Fongs patògens i mortalitat forestal induïda per sequera

    OpenAIRE

    Oliva, Jonàs; Departament de Biologia Animal, de Biologia Vegetal i d'Ecologia

    2014-01-01

    Si bé encara es desconeixen amb precisió els mecanismes pels quals les plantes es moren quan els manca l'aigua, se sap que quan hi ha sequera, els seus sistemes de transport i emmagatzematge d'aigua i carboni es veuen afectats. D'aquesta manera, els arbres queden debilitats, situació que aprofiten plagues i patògens forestals, com és el cas d'alguns fongs, el paper dels quals és poc conegut. Aquest estudi ha descrit els efectes que els fongs tenen sobre els arbres en funció del tipus d'intera...

  17. Clonación artificial de un controlador on-line, basado en lógica difusa y algoritmos genéticos

    Directory of Open Access Journals (Sweden)

    Javier Ballesteros

    2006-10-01

    Full Text Available Los Algoritmos Genéticos son procedimientos adaptativos para la búsqueda de soluciones en espacios complejos, inspirados en la evolución biológica, con patrones de operaciones basados en el principio darwiniano de reproducción y supervivencia de los individuos que mejor se adaptan al entorno en que viven. En este artículo se presenta un estudio sobre los Algoritmos Genéticos y la Lógica Difusa, para desarrollar una metodología propuesta y replicar la caja negra de un controlador, utilizando procedimientos de obtención del conjunto de reglas de inferencia, agrupamiento difuso y después aplicar el desarrollo del algoritmo genético simple con algunas alteraciones, buscando el objetivo del trabajo propuesto.

  18. Gen SRY y ausencia de tejido testicular en una mujer 47XYY con disgenesia gonadal.

    Directory of Open Access Journals (Sweden)

    William Jubiz

    2009-11-01

    Full Text Available Este artículo revisa conceptos actuales sobre determinación y diferenciación sexual con base en el estudio genético de una niña de 13 años que consultó por talla baja y aumento de peso. El examen físico mostró Tanner I en mamas y en vello púbico, sin signos de androgenización. Mientras el nivel de la hormona de crecimiento (GH era normal, las hormonas folículoestimulante (FSH y luteinizante (LH estaban aumentadas. Mediante laparoscopia y posterior estudio patológico se demostró la presencia de gonadas rudimentarias con ausencia de tejido testicular. Aunque el cariotipo obtenido fue 47XYY y el análisis molecular identificó la presencia del gen SRY, su funcionalidad es incierta, lo que hace necesaria su secuenciación, con la finalidad de determinar posibles mutaciones. En respuesta a la terapia con estrógenos y progesterona se desarrollaron tanto los caracteres sexuales secundarios como una menstruación normal. Aunque es posible que en la paciente haya una doble alteración genética donde concurran la mutación de novo de un gen y una no disyunción en la meiosis paterna, el caso descrito es ilustrativo de la importancia del estudio genético en la evaluación de la disgenesia gonadal.

  19. Variabilidad genética de Plasmodium falciparum en pacientes con malaria grave y malaria no complicada en Iquitos - Perú

    Directory of Open Access Journals (Sweden)

    Gisely Hijar G

    2002-07-01

    Full Text Available Objetivo: Determinar la diversidad genética del gen que codifica la proteína rica en glutamato (GLURP de Plasmodium falciparum en pacientes con malaria complicada y no complicada circulante en un área del departamento de Loreto, distrito de Maynas. Materiales y métodos: La diversidad genética fue analizada usando reacción en cadena de la polimerasa (PCR en 30 muestras sanguíneas de pacientes con malaria no complicada (MNC y 46 con malaria grave complicada (MGC. Resultados: Ocho genotipos fueron detectados en pacientes con MNC (Genotipo I,II,III, IV,V, VI,VII y VIII y cuatro genotipos en los pacientes con MGC (Genotipo V,VI,VII,VIII. Asimismo, en 50% de las muestras con MNC fueron detectadas infecciones múltiples, a diferencia de las muestras de MGC en donde no se detectó infecciones múltiples. Conclusión: Existe una diversidad genética en esta región del gen GLURP de P. falciparum, para esa época (marzo 1998 - abril 1999 y esa área del país. En tal sentido, nuestros resultados podrían servir de base para llevar a cabo estudios epidemiológicos posteriores, ya que permitiría conocer la distribución de las cepas circulantes en nuestro país.

  20. Estudio comparativo entre estatinas genéricas y no genéricas, en relación a su uso terapéutico, efectos farmacológicos y reacciones adversas

    OpenAIRE

    Agón Banzo, Pedro Jesús; Ejea Arquillué, María Victoria

    2013-01-01

    La prescripción de medicamentos genéricos contribuye a mejorar la eficiencia del Sistema Nacional de Salud, generando un ahorro que repercute de forma positiva en el propio Sistema. No obstante, en España la prescripción de EFG es todavía baja, y su ritmo de crecimiento lento. Un porcentaje considerable de médicos no confía en que los medicamentos genéricos tengan la misma bioequivalencia, efectos clínicos y garantías de calidad que los medicamentos originales de referencia, a pesar de que la...

  1. Detección de alteraciones numéricas en el gen dys y su asociación con rasgos clínicos

    Directory of Open Access Journals (Sweden)

    Alejandra Mampel

    2011-04-01

    Full Text Available La distrofia muscular de Duchenne/Becker (DMD/B es una miopatía hereditaria grave y progresiva. Se relaciona con alteraciones en el gen DYS, ubicado en el cromosoma X, que codifica para la proteína distrofina. Distintas manifestaciones pueden observarse según el impacto de la alteración genética sobre la proteína. Los registros internacionales de mutaciones refieren una elevada frecuencia (65-70% de deleciones/duplicaciones de uno o más exones del gen DYS. En este trabajo presentamos el estudio de alteraciones numéricas en los 79 exones del gen DYS. El estudio fue realizado en 59 individuos pertenecientes a 31 familias no relacionadas. La metodología utilizada fue Multiplex Ligation Dependent Probe Amplification (MLPA. En los 31 casos independientes se estableció además el score clínico, se realizó el test de Raven y se determinaron los valores de creatininfosfoquinasa (CPK en sangre. Nuestros datos revelan una frecuencia de alteraciones numéricas en el gen DYS del 61.3%, provocando un corrimiento del marco de lectura en el 100% de los casos. Se observó una región con mayor tendencia a presentar alteraciones que involucran un solo exón. La tasa de mutación de novo identificada fue del 35.2%. Se halló, a su vez, una asociación significativa entre afectados con alteraciones numéricas y valores del test de Raven de bajo rendimiento. Estos resultados aportan datos a los conocimientos regionales sobre las alteraciones genéticas y su impacto fenotípico en la enfermedad de Duchenne/Becker.

  2. Generación de líneas celulares humanas KNOCKOUT mediante el uso del sistema CRISPR/Cas9

    OpenAIRE

    Lebrero Fernández, Patricia

    2014-01-01

    La terapia génica consiste en la introducción de material genético en la célula con el fin de sustituir o reparar un gen defectuoso. Existen tres formas de emplear dicha terapia: sustitución génica (que consiste en la sustitución del gen defectuoso por el gen normal mediante recombinación homóloga), inserción génica (es decir, introducción de una copia del gen funcional para compensar el defectivo, sin modificar dicho gen endógeno), o modificación génica (donde el gen defectuoso e...

  3. Eventos moleculares, genéticos e inmunológicos durante la interacción VIH-Hombre

    Directory of Open Access Journals (Sweden)

    Carlos Yábar V

    2003-04-01

    Full Text Available En el presente trabajo se hace una revisión de los principales estudios realizados en el aspecto genético, molecular e inmunológico de la interacción VIH-Hombre. Del mismo modo, se citan algunos alcances actuales sobre los progresos en el tratamiento contra el SIDA. Finalmente, se plantean estrategias experimentales que podrían ser aplicadas a la realidad peruana y que permitirían responder algunos vacíos sobre los factores genéticos humanos y virales que influyen sobre la transmisión y progresión de la enfermedad.

  4. Array CGH com a primera opció per al diagnòstic genètic postnatal

    OpenAIRE

    Castells Sarret, Neus

    2015-01-01

    La citogenètica convencional detecta un 3-5% dels pacients amb retard global del desenvolupament / discapacitat intel·lectual (RGD / DI) i / o malformacions congènites (MC). L'amplificació de sondes múltiples dependents de lligació (MLPA) permet incrementar la taxa diagnòstica entre 2,4-5,8%. Actualment els arrays d'hibridació genòmica comparada (aCGH) constitueixen l'eina diagnòstica amb major rendiment en pacients amb RGD / DI, MC i trastorns de l'espectre autista (TEA). L'objectiu del p...

  5. Uso de algoritmos genéticos para detección de objetos en tiempo real

    OpenAIRE

    Martínez Gómez, Jesús; Gómez Martín, José Antonio; García Varea, Ismael; Matellán Olivera, Vicente

    2009-01-01

    El artículo presenta un sistema de Visión para la detección de objetos mediante el uso de algoritmos genéticos. La principal aportación del mismo consiste en la adaptación al tiempo real de algoritmos generalmente utilizados offline. Para conseguir esto se necesita una ejecución eficiente que reduzca al máximo la complejidad del algoritmo. El ámbito de aplicación del sistema es el campeonato de fútbol robótico RoboCup, en concreto la categoría Standard Platform, y debe permi...

  6. Predicción de ingresos de causas penales utilizando programación genética lineal

    OpenAIRE

    Garcete Rodríguez, Alberto David; Barán, Benjamín

    2015-01-01

    Este trabajo propone una metodología de predicción de ingresos de causas penales utilizando Programación Genética Lineal (Linear Genetic Programming - LGP). El estudio se realizó en base a datos mensuales recogidos durante siete años (2007 a 2013), en los siete Juzgados Penales de Garantías de Ciudad del Este - Paraguay. La verificación del método propuesto se hizo mediante la comparación del método LGP implementado con modelos estadísticos conocidos como la regresión lineal, promedio móvil, ...

  7. Unleashing Gen Y: Marketing Mars to Millennials

    Science.gov (United States)

    Leahy, Bart D.; Hidalgo, Loretta; Kloberdanz, Cassie

    2007-01-01

    Space advocates need to engage Generation Y (born 1977-1999).This outreach is necessary to recruit the next generation of scientists and engineers to explore Mars. Space advocates in the non-profit, private, and government sectors need to use a combination of technical communication, marketing, and politics, to develop messages that resonate with Gen Y. Until now, space messages have been generated by and for college-educated white males; Gen Y is much more diverse, including as much as one third minorities. Young women, too, need to be reached. My research has shown that messages emphasizing technology, fun, humor, and opportunity are the best means of reaching the Gen Y audience of 60 million (US population is 300 million). The important things space advocates must avoid are talking down to this generation, making false promises, or expecting them to "wait their turn" before they can participate. This is the MTV generation! We need to find ways of engaging Gen Y now to build a future where human beings can live and work on the planet Mars. In addition to the messages themselves, advocates need to keep up with Gen Y' s social networking and use of iPods, cell phones, and the Internet. NASA and space advocacy groups can use these tools for "viral marketing," where young people share targeted space-related information via cell phones or the Internet because they like it. Overall, Gen Y is a socially dynamic and media-savvy group; advocates' space messages need to be sincere, creative, and placed in locations where Gen Y lives. Mars messages must be memorable!

  8. Manipulación genética «sensu lato» y Derecho penal: Reflexiones sobre algunos presupuestos dogmáticos

    OpenAIRE

    Peña Guillén, Sandra Catalina

    2009-01-01

    Esta tesis parte de los avances científicos y tecnológicos que proceden del desarrollo de ciencias como la Genética y la Biotecnología, y de las consideraciones que realiza la Bioética, con el fin de analizar la intervención del Derecho penal en estos temas. El estudio se sustenta en los delitos relativos a la manipulación genética tipificados en el Código penal de España de 1995, (la legislación de la autora -ecuatoriana- no tipifica estos delitos). Dentro de este trabajo se considera el con...

  9. Afinidades en la flora genérica de piñonares del norte y centro de México: un análisis fenético Floristic affinities of the generic flora of pinyon pines of northern and central Mexico: a phenetic analysis

    Directory of Open Access Journals (Sweden)

    Mario Luna-Cavazos

    2008-12-01

    Full Text Available Mediante un análisis de clasificación fenética, se discuten las afinidades en la flora genérica de los piñonares mexicanos. El estudio se sustentó en el registro de 438 géneros de plantas vasculares de 32 piñonares mexicanos caracterizados por distintas especies como Pinus cembroides, P. johannis, P. maximartinezii, P. monophylla, P. quadrifolia, P. nelsonii, P. culminicola y P. lagunae. Se elaboró una matriz de datos presencia/ausencia de los géneros en los 32 piñonares, cada uno de los cuales se consideró como una Unidad Geográfica Operativa. Se estimaron 2 índices de semejanza entre las comunidades piñoneras, y después se agruparon mediante el procedimiento UPGMA; los grupos formados se representaron en un dendrograma. Los piñonares se relacionaron, en general, por cercanía geográfica y por su localización en una misma provincia fisiográfica. Los piñonares de Baja California caracterizados por P. quadrifolia formaron un grupo compacto, lo mismo que aquellos de P. cembroides de Chihuahua y de P. maximartinezii de Zacatecas. En el grupo de San Luis Potosí se conjuntaron comunidades de P. cembroides y de P. johannis; mientras que las propias de P. nelsonii no formaron un grupo coherente; los piñonares del suroeste de Coahuila están muy relacionados, pero tienen diferencias con los de más al norte de este estado. El piñonar de P. culminicola de Nuevo León es el más diferente de las otras comunidades de piñoneros.Using phenetic classification, we analyze the similarity of the generic flora of Mexican pinyon pine forests. Methods included records of 438 genera of vascular plants from 32 communities of pinyon pines such as Pinus cembroides, P. johannis, P. maximartinezii, P. monophylla, P. quadrifolia, P. nelsonii, P. culminicola, and P. lagunae. A matrix of presence/absence of genera in 32 communities was performed, and 2 indices of similarity between communities were estimated; we then applied UPGMA to classify the

  10. Marcadores moleculares y ecología del movimiento

    OpenAIRE

    Robledo Arnuncio, Juan José; González Martínez, Santiago César

    2009-01-01

    El estudio del movimiento es parte esencial del análisis ecológico a nivel de gen, individuo, población, comunidad y ecosistema. Los marcadores de ADN son herramientas muy útiles para el estudio del movimiento a todos estos niveles, permitiendo, por ejemplo, establecer relaciones de parentesco entre individuos, determinar el origen poblacional de individuos migrantes, estudiar sistemas de apareamiento, cuantificar la escala de interacciones interespecíficas, o caracterizar el patrón espacial ...

  11. Caracterización molecular con marcadores aflp’s de los biotipos de spodoptera frugiperda (lepidoptera: noctuidae) pertenecientes a los departamentos de Córdoba, Meta y Valle del Cauca, Colombia

    OpenAIRE

    Lobo Hernández, Mariela Isabel

    2012-01-01

    Spodoptera frugiperda (Lepidoptera, Noctuidae) (J. E. Smith) es una polilla que se ha diferenciado genéticamente en dos biotipos denominados “maíz” y “arroz” en todo el Hemisferio Occidental. En Colombia, particularmente en el departamento del Tolima, una investigación anterior se basó en la identificación de los biotipos de este insecto con el uso de una PCR-RFLP del gen COI y una PCR del gen FR como marcadores diagnóstico de la especie, sin embargo, dada la baja variabilidad genética de est...

  12. Genómica de poblaciones: nada en evolución va a tener sentido si no es a la luz de la genómica, y nada en genómica tendrá sentido si no es a la luz de la evolución

    OpenAIRE

    Luis E. Eguiarte; Jonás A. Aguirre-Liguori; Lev Jardón-Barbolla; Erika Aguirre-Planter; Valeria Souza

    2013-01-01

    La teoría de la genética de poblaciones surgió hace más de 80 años y nos permite explicar los patrones de variación genética dentro y entre las poblaciones que forman a las especies en términos de las fuerzas evolutivas. Este programa de investigación generó las preguntas que se han abordado empíricamente mediante marcadores moleculares desde hace medio siglo. Una pregunta fundamental ha sido hasta dónde un conjunto reducido de loci es o no representativo del efecto de las fuerzas evolutivas,...

  13. Salud pública, genética y ética Public health, genetics and ethics

    Directory of Open Access Journals (Sweden)

    Miguel H Kottow

    2002-10-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.Genetics research has shown enormous developments in recent decades, although as yet with only limited clinical application. Bioethical analysis has been unable to deal with the vast problems of genetics because emphasis has been put on the principlism applied to both clinical and research bioethics. Genetics nevertheless poses its most complex moral dilemmas at the public level, where a social brand of ethics ought to supersede the essentially interpersonal perspective of principlism. A more social understanding of ethics in genetics is required to unravel issues such as research and clinical explorations, ownership and patents, genetic manipulation, and allocation of resources. All these issues require reflection based on the

  14. Microsatélites, distancias genéticas y estructura de poblaciones nativas sudamericanas

    Directory of Open Access Journals (Sweden)

    Demarchi, Darío Alfredo

    2009-01-01

    Full Text Available En este trabajo se investigaron las relaciones genéticas entre 17 poblaciones nativas sudamericanas en relación a 15 microsatélites (STRs autosómicos, utilizando 3 distancias genéticas- DST, DAy (δu2-que se ajustan a diferentes postulados teóricos. A través de diferentes técnicas de análisis (escalamiento multidimensional, correlación y correlación parcial de matrices se puso a prueba si las distancias genéticas reflejaban las relaciones interpoblacionales esperadas a partir de la distribución geográfica o de relaciones lingüísticas entre las poblaciones. Además, se estimó en que grado las distintas medidas de distancias genéticas eran influenciadas por la diversidad (He de cada población. Los mapas genéticos muestran, principalmente para DST y DA, que las poblaciones aisladas y con bajo tamaño efectivo (Ne aparecen como outliers, mientras que las poblaciones con alto Ne y mayor flujo génico ocupan una posición central a bajos valores de distancia unas de otras y sin un patrón definido de agrupamiento. La falta de asociación entre distancias genéticas y lingüísticas o geográficas y por otra parte, la alta correlación negativa entre He y distancias génicas promedio por población confiman ese patrón, demostrando que la mayor parte de la variación interpoblacional puede ser explicada en función del grado de diversidad intrapoblacional. Es decir, las distancias genéticas no reflejan relaciones filogenéticas, lingüísticas o geográficas, sino más bien eventos demográficos recientes tales como cuellos de botella genético, efecto fundador o migración externa masiva. Este hecho puede ser comprobado por medio de otra metodología analítica, el modelo de Harpending y Ward.

  15. Salud pública, genética y ética Public health, genetics and ethics

    OpenAIRE

    Miguel H. Kottow

    2002-01-01

    La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del princ...

  16. Zum gotischen gen. pl. auf-ë

    Directory of Open Access Journals (Sweden)

    M. Grošelj

    1964-12-01

    Full Text Available Bekanntlich ist die got. Endung -ē eine Besonderheit, der in den übrigen germ. Sprachen nichts Vergleichbares gegenübersteht. Man nimmt wohl -allgemein an, dass es sich um eine innergot. Neuschöpfung handelt; auch ist eine idg. Endung des Gen. Pl. -ēm; linbelegt. Folgender Erklärungsversuch geht von der Annahme aus, dass die Triebkraft für dfese Neuschöpfupg in der Neigung zur Differenzierung des Maskulinums vom Femininum auf -ō (gibō : dagē zu suchen ist. Diese Neigung ist besonders im Nom. und Gen. bemerkbar.

  17. Polimorfismo genético relacionado con la probabilidad de desarrollar asma ocupacional en trabajadores expuestos a isocianatos

    Directory of Open Access Journals (Sweden)

    Gaetano Pepe Betancourt

    2014-03-01

    Full Text Available Introducción: El desarrollo tecnológico ha traído como consecuencia el uso de sustancias químicas potencialmente perjudiciales para la salud de los trabajadores. Particularmente el uso de isocianatos ha resultado en una mayor morbilidad de patología respiratoria, especialmente el asma. Considerando que no todos los trabajadores expuestos desarrollan la enfermedad se ha propuesto un modelo de interacción gen-medioambiental, el cual trata de explicar la predisposición genética que tienen algunos individuos a desarrollar asma ocupacional y otros no. Objetivo: Conocer la evidencia científica relacionada con el polimorfismo genético y la susceptibilidad que tienen los trabajadores expuestos a isocianatos a desarrollar asma ocupacional. Metodología: Se realizó una revisión sistemática mediante una búsqueda bibliográfica utilizando las bases de datos PubMedline, así como en los repositorios Dialnet y ELSEVIER. Se extrajeron los artículos relacionados al objetivo de esta revisión, no se aplicaron filtros de temporalidad, utilizándose los siguientes descriptores: MeSH Major Topic, MeSH Terms. El periodo de búsqueda fue desde el 20 de noviembre de 2013 y finalizó el 15 de diciembre de 2013. El nivel de evidencia se estableció de acuerdo a los criterios GRADE. Resultados: Se analizaron a texto completo 42 artículos, la evidencia científica se sustentó en 11 estudios de casos-controles. Dada la complejidad del polimorfismo genético asociado con la expresión fenotípica de la enfermedad, como limitación de los estudios, los autores coinciden que el tamaño muestral no es suficientemente grande, sin embargo después de ajustar los factores de confusión los artículos encontrados tuvieron un nivel de evidencia B de GRADE. Conclusión: La genética tiene una influencia significativa en el asma ocupacional inducida por isocianatos. El peso de la susceptibilidad genética y de la interacción gen-medioambiente aún no se han

  18. Aspectos biodemográficos de grupos étnicos Macro-Pano de Bolivia y caracterización genética de las poblaciones Aymará, Quechua, Chimane y Mosetén

    OpenAIRE

    Bert i Fibla, Francesc

    2011-01-01

    La tesis trata de definir algunos aspectos de la situación demográfica y describir la genética poblacional a partir del estudio de haplogrupos del ADN mitocondrial (ADNmt), secuenciación de la región de control d-loop del ADNmt (HVRI), de microsatélites autosómicos, short tandem repeats (STR´s) y microsatélites del cromosoma Y de un grupo de etnias asentadas en el Piedemonte del Departamento del Beni de Bolivia. Las poblaciones Mosetén y Chimane son autóctonas de la zona mientras que las pobl...

  19. Introducción a los algoritmos genéticos y sus aplicaciones

    OpenAIRE

    Piedad Tolmos Rodríguez-Piñero

    2002-01-01

    Los algoritmos genéticos son un logro más de la Inteligencia Artificial en su intento de replicar comportamientos biológicos, con los avances científicos que ello implica, mediante la computación. Se trata de algoritmos de búsqueda basados en la mecánica de la selección natural y de la genética. Utilizan la información histórica para encontrar nuevos puntos de búsqueda de una solución óptima del problema planteado, con esperanzas de mejorar los resultados. En el presente artículo se real...

  20. Lamotheoxyuris ackerti n. gen., n. comb. (Nematoda: Heteroxynematidae parasite of Neotoma spp. (Rodentia: Muridae Lamotheoxyuris ackerti n. gen., n. comb. (Nematoda: Heteroxynematidae parásito de Neotoma spp. (Rodentia: Muridae

    Directory of Open Access Journals (Sweden)

    JORGE FALCÓN-ORDAZ

    2010-06-01

    Full Text Available On the basis of the revision of the type material of Aspiculuris ackerti Kruidenier & Mehra, 1959, and new specimens collected from Neotoma nelsoni Goldman, 1905 (Rodentia: Cricetidae, in Veracruz, Mexico, we herein to which A. ackerti is transferred as Lamotheoxyuris ackerti This new genus differs from all other genera included in 1 mouth surrounded by six lips; 2 extension of lateral alae describe a new genus (Lamotheoxyuris n. gen., (Kruidener & Mehra, 1959 n. gen., n. comb. Heteroxynematinae by the following main traits: reduced; and 3 lack of caudal alae.Con base en la revisión del material tipo de Aspiculuris ackerti Kruidenier y Mehra, 1959 y de nuevos ejemplares recolectados en Neotoma nelsoni Goldman, 1905 (Rodentia: Cricetidae, en Veracruz, México, se describe un nuevo género (Lamotheoxyuris n. gen., al que A. ackerti es transferido como Lamotheoxyuris ackerti (Kruidener y Mehra, 1959 n. gen., n. comb. Este nuevo género se distingue de todos los demás géneros incluidos en Heteroxynematinae por las siguientes características: 1 presencia de seis labios rodeando la boca; 2 extensión reducida del ala lateral; y 3 carencia de ala caudal.

  1. Diversidad genética, entre y dentro de los mayores grupos humanos

    Directory of Open Access Journals (Sweden)

    Barbujani, G.

    2003-01-01

    Full Text Available Varios estudios están de acuerdo cuando reportan que cerca del 85% de la diversidad del ADN autosomal y de los loci de las proteínas se debe a diferencias entre individuos dentro de la misma población, mientras que las diferencias entre los grupos de diferentes continentes son responsables de solamente 10% de la variación genética total. Estos resultados están en conflicto con nociones populares de razas humanas claramente distintas y relativamente homogéneas, y nos hacen cuestionar la utilidad de clasificaciones étnicas en diagnósticos médicos, en el campo forense y en genética farmacológica. Nuevos datos obtenidos de inserciones polimórficas de Alu y del cromosoma Y confirman los resultados previos, aunque indican una diversidad mayor en algunos (pero no todos los loci del cromosoma Y. Estos datos nos permiten investigar dos preguntas: (1 si las diferencias continentales, aunque pequeñas, son suficientemente grandes como para asignar a individuos a sus continentes basados en sus genotipos; (2 si los genotipos observados se agrupan en grupos de población o continentales cuando el origen de la muestra se ignora. Usando varios métodos estadísticos, veremos que los errores de clasificación son por lo menos de un 30% para los polimorfismos autosomales bi-alélicos, y de un 27% para el cromosoma Y. Cuatro series de datos genéticos de todo el mundo sugieren la existencia de grupos de genotipos diferentes, pero que éstos cuatro grupos no coinciden el uno con el otro. Adicionalmente, estudios de bloques de ADN del genoma humano indican que la mayor parte de dichos bloques es compartida entre los continentes, con solamente un pequeño porcentaje siendo específico a ciertos continentes. Estos resultados no indican que haya una base clara para subdividir a los humanos en grupos biológicamente definidos. Este puede no ser un problema en áreas aplicadas de genéticas, dado que los métodos rápidos para obtener genotipos individuales

  2. Preserving Accuracy in GenBank

    DEFF Research Database (Denmark)

    Bidartondo, M.I.; Bruns, T. D.; Blackwell, M.;

    2008-01-01

    GenBank, the public repository for nucleotide and protein sequences, is a critical resource for molecular biology, evolutionary biology, and ecology. While some attention has been drawn to sequence errors (1), common annotation errors also reduce the value of this database. In fact, for organisms...

  3. El NCI inicia un estudio para evaluar la utilidad de la secuenciación genética para mejorar los resu

    Science.gov (United States)

    El Instituto Nacional del Cáncer (NCI) lanzará este mes un estudio clínico piloto denominado M-PACT con la finalidad de evaluar si el tratamiento asignado según mutaciones genéticas específicas puede brindar beneficios a pacientes con tumores sólidos meta

  4. Thaumetopoea pityocampa i nematodes entomopatògens : un mètode alternatiu de control biològic de la plaga

    OpenAIRE

    Franquet Barrera, Laura; García del Pino, Fernando

    2009-01-01

    L'objectiu principal d'aquesta investigació és determinar la viabilitat dels nematodes entomopatògens per controlar les plagues de Thaumetopoea pityocampa, tenint en compte que presenten tot un seguit de característiques que els fan adequats per al control de diferents plagues d'insectes.

  5. Mutation c.255delA in the PARK2 gene as cause of juvenile Parkinson´s disease in a large Colombian family Una mutación en el gen PARK2 causa enfermedad de Parkinson juvenil en una extensa familia colombiana

    Directory of Open Access Journals (Sweden)

    Nicolas Pineda Trujillo

    2009-05-01

    ; line-height: 150%;">STRs, as reported in this study, or SNPs.

    La enfermedad de Parkinson (EP es común y se   debe   a degeneración de las neuronas dopaminérgicas en la sustancia nigra y en otras áreas del cerebro. Varios genes y mutaciones han sido implicados en ella y la mayoría de estas últimas han sido identificadas en el gen PARK2. Reportamos la evaluación de este gen PARK2 y de su región flanqueante en una gran familia de origen caucano, al suroccidente de Colombia. Los padres son primos hermanos y cuatro de sus diez hijos resultaron afectados en edad juvenil.

     

    La evaluación molecular incluyó tipificación de microsatélites (STR y la secuencia directa de los exones del gen. Nuestros hallazgos evidenciaron la presencia en condición homocigota de la mutación c.255delA, en el exón 2 de PARK2. Además, se pudo identificar un haplotipo portado por ambos padres y presente en condición homocigota en los hijos afectados. Del mismo modo se observó una alta tasa de recombinantes en la extensión de la región cromosómica analizada. La mutación c.255delA en PARK2 ya había sido reportada previamente en familias tanto de Francia como de

  6. Gen IV Materials Handbook Implementation Plan

    Energy Technology Data Exchange (ETDEWEB)

    Rittenhouse, P.; Ren, W.

    2005-03-29

    A Gen IV Materials Handbook is being developed to provide an authoritative single source of highly qualified structural materials information and materials properties data for use in design and analyses of all Generation IV Reactor Systems. The Handbook will be responsive to the needs expressed by all of the principal government, national laboratory, and private company stakeholders of Gen IV Reactor Systems. The Gen IV Materials Handbook Implementation Plan provided here addresses the purpose, rationale, attributes, and benefits of the Handbook and will detail its content, format, quality assurance, applicability, and access. Structural materials, both metallic and ceramic, for all Gen IV reactor types currently supported by the Department of Energy (DOE) will be included in the Gen IV Materials Handbook. However, initial emphasis will be on materials for the Very High Temperature Reactor (VHTR). Descriptive information (e.g., chemical composition and applicable technical specifications and codes) will be provided for each material along with an extensive presentation of mechanical and physical property data including consideration of temperature, irradiation, environment, etc. effects on properties. Access to the Gen IV Materials Handbook will be internet-based with appropriate levels of control. Information and data in the Handbook will be configured to allow search by material classes, specific materials, specific information or property class, specific property, data parameters, and individual data points identified with materials parameters, test conditions, and data source. Details on all of these as well as proposed applicability and consideration of data quality classes are provided in the Implementation Plan. Website development for the Handbook is divided into six phases including (1) detailed product analysis and specification, (2) simulation and design, (3) implementation and testing, (4) product release, (5) project/product evaluation, and (6) product

  7. Modelado y simulación de la distribución de energía eléctrica en sistemas genéricos consistentes en diversas fuentes y múltiples modos de transmisión. Optimización del uso de las fuentes con criterios de sostenibilidad

    OpenAIRE

    Valdivieso Sarabia, Rafael Jesús

    2013-01-01

    Esta investigación aborda el problema de la distribución eléctrica en sistemas genéricos compuestos por varias fuentes de energía (hidroeléctrica, eólica, solar, etc.), múltiples medios de transmisión (líneas de transmisión, medios de almacenamiento, convertidores, etc.) y varios centros de consumo (edificios, viviendas, electrodomésticos, portátiles, teléfonos móviles, etc.), concretamente, haciendo uso de criterios sostenibles que aprovechen las bondades de las fuentes de energía renovables...

  8. Intención de compra de medicamentos genéricos por parte de los usuarios de Asturias

    Directory of Open Access Journals (Sweden)

    Santiago González Hernando

    2003-01-01

    Full Text Available Fundamento: Conocer las percepciones de los consumidores acerca del riesgo asociado al uso de medicamentos genéricos y los factores que más influyen en la intención de solicitar un genérico al médico (prescriptor y/o al farmacéutico, a fin de determinar posibles barreras o frenos a la aceptación de los mismos y obtener información que apoye la toma de decisiones de los gestores sanitarios. Métodos: Estudio sobre utilización de medicamentos centrado en la disposición de los pacientes a solicitar una EFG. En esta investigación transversal cuantitativa se entrevistó personalmente a 542 individuos, a la salida de un centro de salud o de un establecimiento de farmacia en Asturias. En el cuestionario se incluía una escala de medición del riesgo percibido en la compra de un medicamento con 15 atributos agrupados en cinco dimensiones. Asimismo se recogió información sobre la intención de consumir medicamentos genéricos y sobre las características demográficas y socioeconómicas de los entrevistados. Para el análisis de los resultados se aplicaron un análisis factorial confirmatorio, regresión múltiple y análisis univariable. El tratamiento de los datos se efectuó con los programas estadísticos EQS y SPSS. Resultados:Percepción media del riesgo (escalas de 1 a 7: funcional: 2,75; físico: 2,68; financiero: 2,19; psicológico: 1,99; social: 1,42. Factores influyentes sobre la intención de solicitar genéricos al médico: riesgo psicológico (p=0,000. Sobre la solicitud al farmacéutico: riesgo psicológico (p=0,000 y riesgo social (p=0,020. Conclusiones: Los agentes interesados en el desarrollo en el mercado de las EFG deben mantener sus esfuerzos de comunicación hacia la equiparación de los aspectos funcionales y financieros entre especialidades del fabricante y especialidades genéricas, pero no deben dejar de lado aspectos psicológicos y sociales del comportamiento de compra del consumidor.

  9. Intención de compra de medicamentos genéricos por parte de los usuarios de Asturias

    Directory of Open Access Journals (Sweden)

    González Hernando Santiago

    2003-01-01

    Full Text Available Fundamento: Conocer las percepciones de los consumidores acerca del riesgo asociado al uso de medicamentos genéricos y los factores que más influyen en la intención de solicitar un genérico al médico (prescriptor y/o al farmacéutico, a fin de determinar posibles barreras o frenos a la aceptación de los mismos y obtener información que apoye la toma de decisiones de los gestores sanitarios. Métodos: Estudio sobre utilización de medicamentos centrado en la disposición de los pacientes a solicitar una EFG. En esta investigación transversal cuantitativa se entrevistó personalmente a 542 individuos, a la salida de un centro de salud o de un establecimiento de farmacia en Asturias. En el cuestionario se incluía una escala de medición del riesgo percibido en la compra de un medicamento con 15 atributos agrupados en cinco dimensiones. Asimismo se recogió información sobre la intención de consumir medicamentos genéricos y sobre las características demográficas y socioeconómicas de los entrevistados. Para el análisis de los resultados se aplicaron un análisis factorial confirmatorio, regresión múltiple y análisis univariable. El tratamiento de los datos se efectuó con los programas estadísticos EQS y SPSS. Resultados: Percepción media del riesgo (escalas de 1 a 7: funcional: 2,75; físico: 2,68; financiero: 2,19; psicológico: 1,99; social: 1,42. Factores influyentes sobre la intención de solicitar genéricos al médico: riesgo psicológico (p=0,000. Sobre la solicitud al farmacéutico: riesgo psicológico (p=0,000 y riesgo social (p=0,020. Conclusiones: Los agentes interesados en el desarrollo en el mercado de las EFG deben mantener sus esfuerzos de comunicación hacia la equiparación de los aspectos funcionales y financieros entre especialidades del fabricante y especialidades genéricas, pero no deben dejar de lado aspectos psicológicos y sociales del comportamiento de compra del consumidor.

  10. Determinantes genéticos de la calidad de maíz

    OpenAIRE

    Eyherabide, Guillermo

    2013-01-01

    La literatura científica es abundante en documentación respecto de los efectos genéticos sobre las propiedades del grano de maíz. Una de las evidencias más notables son los experimentos de selección recurrente a largo plazo iniciados en Illinois en 1896 sobre la población Burr´s White y que se prolonga hasta nuestros días. Se trata de un programa de selección divergente para porcentajes de proteína y de aceite en el grano. Las respuestas observadas para ambos caracteres excedieron veinte desv...

  11. Introducción a los algoritmos genéticos

    OpenAIRE

    Niño, Jairo Amador

    2013-01-01

    Este documento presenta una introducción a los algoritmos genéticos AGs, como resultado de la revisión bibliografía por parte del grupo de investigación de inteligencia artificial de la universidad Santo Tomas, haciendo énfasis en los siguientes aspectos: los AGs, la robustez en la optimización tradicional y en los métodos de búsqueda, sus metas, algunos campos de aplicación, y cómo funcionan.

  12. Manipulación genética: el nuevo monstruo de Frankenstein en el cine

    OpenAIRE

    Prada Pérez, Francisco Javier de

    2007-01-01

    [ES] El cine se ha ocupado en multitud de ocasiones de lanzar los interrogantes que abren los avances científicos y su repercusión en la vida del ser humano. No en vano la ciencia ficción es un género consagrado a esa tarea, la de intentar predecir hacia dónde camina la humanidad gracias a la aplicación de nuevos descubrimientos. La manipulación genética, por su extraordinario abanico de posibilidades, no podía escapar a guiones que intentaran vislumbrar las aplicaciones que la sociedad pudie...

  13. Factores genéticos de pacientes con ictus asociados al pronóstico

    OpenAIRE

    Giralt Casellas, Dolors

    2016-01-01

    El objetivo de este trabajo es, utilizando una base de datos de pacientes que han padecido un ictus, encontrar tendencias entre pronóstico al alta y medicamentos que toman los pacientes previamente al ictus. Seguidamente, cruzar los factores genéticos asociados anteriormente con bases de datos del genoma humano para ver los genes asociados a las tendencias encontradas y ver la drogabilidad de los genes. L'objectiu d'aquest treball és, utilitzant una base de dades de pacients que han patit ...

  14. Biomarcadores de daño genético en poblaciones humanas expuestas a plaguicidas

    OpenAIRE

    AIASSA, DELIA; Mañas, Fernando; Bosch, Beatriz

    2012-01-01

    El efecto de los plaguicidas sobre la salud humana, animal y ambiental es preocupación de la comunidad científica desde hace mucho tiempo. Numerosos estudios reportan que los plaguicidas no son inofensivos y que su uso puede conducir a efectos biológicos dañinos a mediano y a largo plazo, en los grupos humanos y animales expuestos, en el presente o en los descendientes. La importancia en la detección precoz del daño genético radica en que permite tomar las medidas necesarias para disminuir o ...

  15. Desarrollo de recursos docentes para la evaluación de competencias genéricas

    OpenAIRE

    García García, María José; Terrón López, María José; Blanco Archilla, María Yolanda

    2010-01-01

    En este artículo se presentará parte del trabajo desarrollado dentro de un proyecto interdepartamental sobre innovación docente en competencias. Se realizó un análisis de términos que refieren a competencias genéricas, generándose un listado de competencias a estudiar, y de sus denominaciones alternativas conforme a la bibliografía utilizada. A partir de este listado se diseñaron fichas que reúnen las principales características a tener en cuenta en el desarrollo y evaluación en el alumnado u...

  16. GA-Ensemble : optimización de conjuntos de clasificadores mediante algoritmos genéticos

    OpenAIRE

    Ordóñez Morales, Francisco Javier

    2007-01-01

    El objetivo general de este Proyecto Fin de Carrera es desarrollar un algoritmo optimizado de generación de conjuntos de clasificadores heterogéneos basándose en el algoritmo GA-Stacking. Los objetivos específicos son: - Determinar los métodos de generación de clasificadores más adecuados al proceso de creación del conjunto de clasificadores. - Definir los parámetros adecuados de los algoritmos genéticos a utilizar para la generación del conjunto de clasificadores, haciendo ...

  17. Genética molecular y biogerontología en la era postgenómica

    OpenAIRE

    Michán Aguirre Shaday

    2011-01-01

    RESUMEN La forma de estudiar la genética ha progresado notablemente en las últimas decadas. Sus orígenes se remontan al estudio de los caracteres hereditarios, seguido por el descubrimiento de los genes y los cromosomas hasta conocer la estructura del ADN. Este último evento impulsó el desarrollo de la tecnología del ADN recombinante y de la secuenciación masiva y automatizada, los cuales permitieron posteriormente determinar la anatomía de los genomas. Todos estos descubrimientos ...

  18. Safety Assurance in NextGen

    Science.gov (United States)

    HarrisonFleming, Cody; Spencer, Melissa; Leveson, Nancy; Wilkinson, Chris

    2012-01-01

    The generation of minimum operational, safety, performance, and interoperability requirements is an important aspect of safely integrating new NextGen components into the Communication Navigation Surveillance and Air Traffic Management (CNS/ATM) system. These requirements are used as part of the implementation and approval processes. In addition, they provide guidance to determine the levels of design assurance and performance that are needed for each element of the new NextGen procedures, including aircraft, operator, and Air Navigation and Service Provider. Using the enhanced Airborne Traffic Situational Awareness for InTrail Procedure (ATSA-ITP) as an example, this report describes some limitations of the current process used for generating safety requirements and levels of required design assurance. An alternative process is described, as well as the argument for why the alternative can generate more comprehensive requirements and greater safety assurance than the current approach.

  19. Gen. Keen discusses Americas with JFSSPP

    OpenAIRE

    2011-01-01

    Army Lt. Gen. P. K. Keen, he Militay Deputy Commander for USSOUTHCOM, met with Foreign Area Officers (FAOs) attending a Latin American in-residence course at NPS for the School of International Graduate Studies (SIGS) Joint Foreign Area OFficer Skill Sustainment Pilot Program (JFSSPP). Keen spoke for nearly an hour to more than 35 participants in the course, which ran from February 21 though March 4. JFSSPP students are non-matriculated students who come to NPS for topical short courses rela...

  20. Planificación radioterápica de intensidad modulada basada en un modelo de simulación explícita del transporte de partículas mediante optimización por imágen médica

    OpenAIRE

    Ureba Sánchez, Ana María

    2015-01-01

    Falta resumen y palabras clave Introducción: La planificación radioterápica más precisa es la basada en un cálculo del transporte explícito del haz de partículas, desde su generación en la cabeza del acelerador lineal, y en su interacción con los modificadores y colimadores, hasta la deposición de su energía en los tejidos del paciente con densidades heterogéneas. No obstante, este cálculo exige un tiempo de computación inviable para la práctica clínica diaria. En este trabajo se presenta ...

  1. TDAH en adultos: Factores genéticos, evaluación y tratamiento farmacológico

    OpenAIRE

    Ramos-Quiroga, Josep Antoni

    2009-01-01

    El trabajo de tesis doctoral está centrado en el estudio del trastorno por déficit de atención (TDAH) en adultos. Se presentan un total de cuatro artículos publicados en revistas con factor de impacto. Los dos primeros sobre factores genéticos, el tercero sobre la validación en español del cuestionario ASRS 1.1 de la OMS para el cribaje del TDAH en adultos y el útlimo sobre el tratamiento farmacológico del TDAH en esta población. Las conclusiones más relevantes son:1. Los resultados de los es...

  2. Correlaciones fenotípicas, ambientales y genéticas en berenjena

    Directory of Open Access Journals (Sweden)

    Hermes Araméndiz Tatis

    2009-10-01

    Full Text Available En el Centro de Investigaciones Turipaná de la Corporación Colombiana de Investigaciones (Corpoica (Cereté, Córdoba, Colombia -8° 31' N y 75° 58' O, a 13 m.s.n.m se estudiaron las correlaciones, ambientales y genéticas entre seis caracteres de 24 cultivares de berenjena (Solanum melongena. Para el efecto se utilizó un diseño de bloques completamente al azar con tres repeticiones y unidades experimentales de 10 m². Los resultados mostraron que las correlaciones fueron de mayor o igual magnitud que las fenotípicas, mientras que las ambientales fueron de escaso valor. El número de frutos y el rendimiento estuvieron genéticamente correlacionados (r = 0.56, P < 0.01, la longitud y la resistencia del fruto mostraron correlación genética negativa (r = -0.68, P < 0.01 y entre el rendimiento y peso de fruto la correlación fue muy baja (r = 0.04. El número de frutos y su peso de frutos se correlacionaron de manera negativa (r =-0.63, P < 0.01. El número de frutos por planta puede ser utilizado como criterio de selección para la obtención de cultivares de berenjena de altos rendimientos.

  3. Avances genéticos y moleculares en el estudio de trastornos mentales

    Directory of Open Access Journals (Sweden)

    Daisy Natalia Salamanca-Ortíz

    2014-04-01

    Full Text Available Actualmente, con el aumento de la disponibilidad de técnicas para la realización de estudios genéticos, han aparecido nuevas áreas del conocimiento como la epigenética y la farmacogenética. Estas nuevas áreas han permitido esclarecer las bases genéticas implicadas en la aparición de las enfermedades que afectan al ser humano. Dada su aplicación global, la psiquiatría no ha sido ajena al alcance de estas nuevas disciplinas, lo cual se refleja en el gran número de estudios realizados a nivel mundial que han relacionado la presencia de variantes genéticas en los individuos con la aparición de trastornos mentales específicos. De la misma forma, otros estudios han evidenciado que la efectividad de los tratamientos farmacológicos empleados en psiquiatría se correlaciona con polimorfismos en las enzimas encargadas de metabolizar dichos medicamentos. Por lo tanto, es importante que los psiquiatras conozcan los aspectos básicos de estas relaciones para obtener mejores resultados en el diagnóstico y tratamiento de los principales trastornos mentales.

  4. Generic classification of the Archiborborinae (Diptera: Sphaeroceridae), with a revision of Antrops Enderlein, Coloantrops gen. nov., Maculantrops gen. nov., Photoantrops gen. nov., and Poecilantrops gen. nov.

    Science.gov (United States)

    Kits, Joel H; Marshall, Stephen A

    2013-01-01

    The Archiborborinae comprise a diverse clade of flies in the family Sphaeroceridae. We here revise the generic classification, redefining the genus Antrops Enderlein and naming 5 new genera: Boreantrops gen. nov., Coloantrops gen. nov., Maculantrops gen. nov., Photoantrops gen. nov., and Poecilantrops gen. nov. The genus Archiborborus, until recently a paraphyletic assemblage including most of the described species in the subfamily, is treated as a junior synonym of Antrops (syn. nov.) We revise the genera Antrops (53 species, including 40 sp. nov.: Antrops anovariegatus, Antrops aurantifemur, Antrops baeza, Antrops bellavista, Antrops biflavus, Antrops bucki, Antrops carpishensis, Antrops cochabamba, Antrops cochinoca, Antrops coniobaptos, Antrops coroico, Antrops cotopaxi, Antrops didactylos, Antrops diversipennis, Antrops eurus, Antrops fulgiceps, Antrops fuliginosus, Antrops guandera, Antrops guaramacalensis, Antrops inca, Antrops juninensis, Antrops mucarensis, Antrops niger, Antrops papallacta, Antrops pecki, Antrops podocarpus, Antrops quadrilobus, Antrops siberia, Antrops sierrazulensis, Antrops tachira, Antrops tequendama, Antrops tetrastichus, Antrops tumbrensis, Antrops unduavi, Antrops variegatus, Antrops versabilis, Antrops vittatus, Antrops yungas, and Antrops zongo and the following comb. nov.: Antrops annulatus (Richards), Antrops chaetosus (Richards), Antrops femoralis (Blanchard), Antrops hirtus (Bigot), Antrops maculipennis (Duda), Antrops maximus (Richards), Antrops microphthalmus (Richards), Antrops quadrinotus (Bigot), Antrops setosus (Duda), Antrops simplicimanus (Richards), Antrops nitidicollis (Becker), and Antrops orbitalis (Duda)), Coloantrops (1 species: Coloantrops daedalus, sp. nov.), Maculantrops (2 species, Maculantrops hirtipes (Macquart) comb. nov. and Maculantrops altiplanus, sp. nov.), Photoantrops (1 species: Pho-toantrops echinus sp. nov.), and Poecilantrops (10 species: Poecilantrops baorucensis, Poecilantrops boraceiensis

  5. Market share scenarios for Gen-DIII and gen-IV reactors in Europe

    International Nuclear Information System (INIS)

    Nuclear energy is back on the agenda worldwide in order to meet growing energy demand and especially the growth in electricity demand. Many objectives direct to an increased use of nuclear energy, i.e. minimising energy costs, reducing climate change effects and others. In the light of the potential renewed growth of nuclear energy, the public demands a clear view on what nuclear energy may contribute towards meeting these objectives and especially how nuclear energy may address some socio-political obstructions with respect to economics, radioactive waste, safety and proliferation of fissile materials. To address these questions, the future nuclear reactor park mix in Europe has been analysed applying an integrated dynamic process modelling technique. Various market share scenarios for nuclear energy are derived including sub-variants with regard to the intra-nuclear options. In the analyses, it is assumed that different types of new reactors may be built, taking into account the introduction date of considered Gen-Ill (i.e. EPR) and Gen-IV (i.e. SCWR, HTR, FR) reactors, and the economic evaluation of the complete fuel cycle. The assessment was undertaken using the DANESS code (Dynamic Analysis of Nuclear Energy System Strategies). The analyses show that given the considered realistic nuclear energy demand and given a limited number of available Gen-III and Gen-IV reactor types, the future European nuclear park will exist of combinations of Gen-III and Gen-IV reactors. This mix will always consist of a set of reactor types each having its specific strengths. The analyses also highlight the triggers influencing the choice between different nuclear energy deployment scenarios. (authors)

  6. Importância da análise cromossômica dos fibroblastos em casos suspeitos de mosaicismo: experiência de um serviço de Genética Clínica Importancia del análisis cromosómico de los fibroblastos en casos sospechosos de mosaicismo: experiencia de un servicio de Genética Clínica Importance of the fibroblast chromosomal analysis in suspected cases of mosaicism: experience of a clinical Genetics service

    Directory of Open Access Journals (Sweden)

    Giorgio Adriano Paskulin

    2011-03-01

    de mosaicismo sometidos a la evaluación cromosómica mediante cariotipo por bandas GTG de linfocitos y fibroblastos. MÉTODOS: se realizó un análisis retrospectivo de los pacientes evaluados en el Servicio de Genética Clíncia de UFCSPA/CHSCPA, en el periodo de enero de 1975 a junio de 2008, mediante la recolección de datos clínicos y resultados de la evaluación citogenética. RESULTADOS: La muestra estuvo compuesta por 15 pacientes, 6 de ellos (40% del sexo masculino y edades variando entre 10 días y 14 años. En el análisis cromosómico de la sangre, se observaron alteraciones en 4 (26,7% y se incluyó 1 caso de translocación balanceada [t(2;9pat] y 3 de mosaicismo [1 caso, respectivamente, de mos 45,X/46,X,+mar; mos 45,XY,-12/46,XY,r(12/47,XY,r(12,+r(12 y mos 47,XY,+9/46,XY]. Con el objetivo de confirmar, o incluso identificar un mosaicismo cromosómico, los pacientes fueron sometidos posteriormente al cariotipo de piel. Los principales motivos por los que los pacientes con cariotipo de la sangre sin mosaicismo presentaron tal sospecha fueron la presencia de hemihipertrofia (n=5 y de manchas hipocrómicas siguiendo las líneas de Blaschko (n=4. Se confirmó el mosaicismo en 2 casos y se identificó en otros 2 (2 casos de mos 47,XX,+22/46,XX. El mos 47,XY,+9/46,XY no fue verificado en el estudio de los fibroblastos. CONCLUSIONES: Los resultados demuestran la variabilidad tejidual característica de los casos de mosaicismo cromosómico, así como confirman la importancia de la evaluación de un según tejido para la determinación diagnóstica. Hallazgos clínicos, como asimetría de miembros y anomalías pigmentares siguiendo las líneas de Blaschko son fuertemente indicativos de la presencia de mosaicismo.OBJECTIVE: To verify clinical characteristics and cytogenetic findings of patients suspects of having mosaicism and submitted to chromosomal analysis of lymphocytes and fibroblasts through GTG-Banding karyotype. METHODS: This is a retrospective analysis

  7. Disseny i implementació d'un robot 3R genèric

    OpenAIRE

    Ballbè Chaler, Marc

    2015-01-01

    Aquest projecte s'ha realitzat al laboratori del Institut de Robòtica i Informàtica Industrial ubicat en la Facultat de Matemàtiques i Estadística de la Universitat Politècnica de Catalunya. Els objectius d'aquest projecte han sigut diversos, encara que tots s'engloben en l'anàlisi genèrica d'un robot amb tres graus de llibertat de rotació i la implementació d'un prototip. Un dels objectius principals ha sigut la resolució de la cinemàtica directa i inversa d'un robot amb...

  8. Aplicación de algoritmos genéticos para la programación de tareas en una celda de manufactura

    OpenAIRE

    Delgado, Efredy; Cortés Rodríguez, Carlos Julio; Duarte Velasco, Óscar Germán

    2010-01-01

    El propósito del trabajo fue plantear una metodología para la programación de tareas de una celda de manufactura, basada principalmente en algoritmos genéticos. La celda de manufactura fue modelada como una línea de flujo, y se desarrollaron cálculos que permiten saber el makespan usando una heurística adaptada de una librería realizada para algoritmos genéticos, esto implantado en un ambiente de programación C++ builder. Se resolvieron problemas diversos, considerando distintos tamaños de li...

  9. Asignación de tareas a procesadores en un sistema distribuido de tiempo real duro utilizando algoritmos genéticos y lógica difusa

    OpenAIRE

    Cayssials, Ricardo; Orozco, Javier D.; Ferro, Edgardo

    1997-01-01

    Se presenta un método basado en algoritmos genéticos para atacar el problema de asignación de un conjunto de tareas apropiativas, sobre un conjunto de procesadores distribuidos que deben trabajar en un entorno de tiempo real duro. Las tareas son cooperativas y utilizan como vía de comunicación una red local. Los coeficientes que ponderan la función de costo del algoritmo genético son calculados utilizando operadores difusos. Sobre el sistema existe un conjunto de restricciones que debe ser sa...

  10. Ausencia de equivalencia terapéutica de 7 productos genéricos de lincomicina comparados con el compuesto original

    Directory of Open Access Journals (Sweden)

    Omar Vesga

    2004-02-01

    Full Text Available

    La equivalencia farmacéutica (EF como prueba de equivalencia terapéutica (ET para productos genéricos parenterales (PG es un dogma ampliamente difundido y aceptado, pero nunca se ha retado experimentalmente [1]. Comparamos la magnitud de los parámetros farmacodinámicos (PD de los genéricos de lincomicina (LIN con los del compuesto original (CO, mediante determinación de su eficacia bactericida in vitro e in vivo.

     

     

  11. Diversidad y estructura genética de accesiones de palma de aceite (Elaeis guineesis Jacq.) provenientes de Camerún

    OpenAIRE

    Jose Estiben Pacheco Diaz; Diana Marcela Arias Moreno; Zaida Zarely Ojeda Perez; Hernán Mauricio Romero Angulo

    2014-01-01

    Título en español: Diversidad y estructura genética de accesiones de palma de aceite (Elaeis guineesis Jacq.) provenientes de CamerúnTítulo en ingles: Diversity and genetic structure of oil palm accession (Elaeis guineesis Jacq.)  from CameroonTítulo corto: Diversidad genética de accesiones de palma de aceiteResumen: La palma de aceite Elaeis guineesis Jacq. posee gran importancia debido al aceite que se extrae de sus frutos, del cual se obtienen derivados refinados de gran valor comercial co...

  12. Diversidad genética de la población colombiana de ganado Cebú Brahman Americano Bos Indicus (Bovidae)

    OpenAIRE

    Novoa Bravo Miguel Adriano; Usaquén Martínez William

    2006-01-01

    La raza Cebú Brahman Americano se encuentra en Colombia alrededor de 100 años. Todo ese tiempo, esta raza ha estado bajo un proceso continuo de selección artificial dirigida, reproducción endogámica, efectos de deriva genética causados por eventos fundadores, migraciones de ejemplares entre las fincas del país y animales importados desde otros países. Estos hechos hacen a esta raza interesante y particular desde el punto de vista de la genética de poblaciones. El objetivo de este trabajo es e...

  13. Identificación genética de Pediococcus acidilactici de fluido ruminal y efecto de dos ionóforos en su actividad fermentativa

    OpenAIRE

    Ley de Coss, Alejandro

    2012-01-01

    Se aisló una bacteria de ovinos con acidosis ruminal usando medios selectivos para el crecimiento de bacterias productoras de ácido láctico. La bacteria fue identificada genéticamente usando una secuencia parcial de 800 nucleótidos del gen ARNr 16S obtenida por el método de la reacción en cadena de la polimerasa (PCR). Para evaluar in vitro el efecto de los ionóforos monensina y lasalocida en la actividad metabólica de la bacteria se usó una dosis de 30 y 40 g ton-1 de...

  14. Estudios de transformación genética en arveja voluble cultivar Santa Isabel

    Directory of Open Access Journals (Sweden)

    María Isabel Peñaranda

    2013-12-01

    Full Text Available Título corto: Estudios de transformación genética en arveja.Resumen: Se probaron diferentes alternativas de transformación genética en arveja cultivar “Santa Isabel” con el fin de estudiar los factores que afectan el proceso. Se emplearon los métodos de infiltración mediante vacío, infección directa de explantes, transformación de polen, y microinyección de ovarios. La prueba histoquímica de expresión gus fue escogida como método de análisis en la determinación de transformantes positivos. Con las metodologías empleadas se detectaron puntos azules en el tejido vegetal, lo cual indica la expresión transitoria del transgen en los explantes utilizados. Los resultados obtenidos sugieren que la transformación genética en arveja cultivada en Colombia puede ser utilizada para la introducción de genes de interés como apoyo a los procesos de mejoramiento genético.Palabras clave: genotipos, expresión gus, fitomejoramiento.Abstract: Different genetic transformation alternatives were tested in “Santa Isabel” cultivar pea, in order to study the factors that affect the process. The methods used were infiltration with vacuum, direct infection of the explants, pollen transformation and ovary microinjection. The hystochemical test of  gus expression was chosen as analysis method in the determination of positive transformants. Blue spots in the plant tissue were detected, with the used methodologies, which indicates transient expression of the transgene in the explants utilized. The obtained results suggest that the genetic transformation in pea genotypes planted in Colombia can be used for the introduction of genes of interest as support to genetic improvement.Key words: genotypes, gus expressions, plant breeding.

  15. Genètica en embriologia humana

    OpenAIRE

    Megías Vericat, Javier

    2015-01-01

    Aquests materials han rebut un incentiu del Servei de Política Lingüística. Diapositives de les classes de l'assignatura d'Embriologia del grau de Medicina. Grup de valencià. Curs 2014-15. Slides from the subject of Embriology. Degree of Medicine. 2014-2015.

  16. Protección de los derechos y las nuevas tecnologías. El caso de la genética en el ámbito de los derechos de la era tecnológica

    OpenAIRE

    Carla Faralli

    2015-01-01

    Particular relieve asumen los derechos vinculados a la genética. Se examina la evolución del derecho a la privacy, desde su significado de intimidad a aquella del control sobre los datos personales. Se analiza también un nuevo derecho, es decir, el derecho a heredar un patrimonio genético no modificado. Tal derecho nace con la terapia génica, que puede ser “germinal” o de la “línea somática”. La primera es inaceptable desde la moral y la segunda asimilable a una terapia sustitutiva o traspl...

  17. Evaluación del perfil genómico de la plataforma de investigación basada en PAM50 y miRNAs en el cáncer de mama en mujeres jóvenes (< 35 años): Correlación con parámetros clínicos

    OpenAIRE

    Martínez Martínez, María Teresa

    2015-01-01

    El cáncer de mama de mujeres jóvenes (≤ 35 años) se ha evidenciado más agresivo que el de mujeres mayores, y con peor pronóstico a corto/largo plazo. Sin embargo, si el cáncer de mama en jóvenes es una entidad biológica distinta o simplemente un reflejo de un mayor porcentaje de casos con fenotipos agresivos es actualmente un motivo de controversia. El propósito de este estudio fue determinar si esta mayor agresividad se debe a la activación de vías genéticas diferentes en los tumores de muje...

  18. Gobernabilidad en la sociedad del conocimiento

    Directory of Open Access Journals (Sweden)

    José A. López Cerezo

    2007-01-01

    Full Text Available En esta presentación planteo una reflexión sobre un importante condicionante para la gobernabilidad en la actual sociedad del conocimiento: la participación ciudadana en las políticas públicas sobre ciencia y tecnología. Comenzaré con un bosquejo de lo que entiendo genéricamente como “sociedad del conocimiento”. Defenderé los conceptos de sociedad del riesgo y de ciencia reguladora como necesarios para una compresión adecuada del carácter de esa “sociedad” y ese “conocimiento”. En función de este análisis, es posible detectar varios modelos de proyección futura para la sociedad del conocimiento con distintas condiciones de gobernabilidad. Sobre esta base, argumentaré que el nuevo papel del conocimiento en la transformación de la naturaleza y en la dinámica social, así como el creciente protagonismo de la sociedad civil en la vida pública, hace del involucramiento de los agentes sociales en la gestión del cambio científico-tecnológico una condición clave de gobernabilidad en la sociedad del conocimiento.

  19. Marcadores ancestrales culturales y genéticos: investigación de apellidos mapuche

    Directory of Open Access Journals (Sweden)

    Corach, Daniel

    2007-01-01

    Full Text Available Las comunidades aborígenes que habitan las regiones andinas se caracterizan por haber conservado elementos lingüísticos originarios en sus apellidos. Estos han sufrido procesos de “occidentalización”, manteniendo, no obstante, rasgos etnia-específicos. Tal situación permite disponer de un criterio simple para identificar con cierto grado de certeza la ancestralidad de un individuo. Con el objeto de evaluar el grado de correlación entre este marcador cultural y marcadores genéticos hemos llevado a cabo una investigación con individuos varones no relacionados provenientes de las provincias de Río Negro y Chubut (N=136. Los donantes se seleccionaron de acuerdo a la presencia de elementos lingüísticos Mapuche en sus apellidos e individuos con apellidos europeos. Se emplearon tres criterios de clasificación: apellidos, presencia del haplogrupo Q-M3 y presencia de Haplogrupos mitocondriales amerindios (ABCD. Los grupos clasificados de acuerdo con estos criterios fueron analizados mediante 15 STRs autosómicos y 9 Y-STRs. En ambas provincias más del 95% de los individuos portadores de apellidos Mapuche exhibían hgs matri y/o patrilineales amerindios. Por otro lado, en Río Negro y Chubut sólo 18 y 17%, respectivamente, no exhibieron ni apellidos ni marcadores genéticos asociables con ancestros amerindios; en éstos los hgmt más representados fueron H (6.5%, U5 (4.3% y K (2.8%, seguidos por T (1.4%, V (0.7%, X (0.7% y M (0.7%. También fue detectado el hg Africano en baja frecuencia (1.4%. Nuestros resultados confirman una correlación estrecha entre apellidos Mapuche y polimorfismos genéticos étnia-específicos.

  20. Desarrollo de un sistema de transformación genética en Paracoccidioides brasiliensis

    Directory of Open Access Journals (Sweden)

    Mauricio Corredor

    2001-04-01

    Full Text Available

    La transformación genética es una alternativa para el conocimiento de genes involucrados en la patogenicidad de los hongos. A la fecha se han transformado algunos hongos utilizando técnicas como luz ultravioleta para obtener mutantes auxotróficas. Así mismo, se ha empleado la transformación basada en la introducción de plásmidos que confieren resistencia a antibióticos bien sea por medio de electroporación o imitando un evento que se presenta naturalmente entre plantas y el bacilo gram negativo Agrobacterium tumefaciens y que consiste en la transferencia del T-DNA del plásmido Ti bacteriano a la célula vegetal, con la consecuente aparición de un tumor en el tallo de
    la planta. Este mecanismo se ha reproducido con éxito en hongos
    filamentosos y en levaduras. En el caso de Paraco ccidioides brasiliensis aún no se dispone de un modelo de transformación. Considerando esta carencia y la necesidad de conocer los genes involucrados en la patogenicidad de este microorganismo, pretendemos desarrollar un sistema de transformación genética para P. brasiliensis utilizando A. tumefaciens.

     

     

  1. Aconselhamento genético Genetic counseling

    Directory of Open Access Journals (Sweden)

    João Monteiro de Pina-Neto

    2008-08-01

    Full Text Available OBJETIVO: Esta revisão sobre aconselhamento genético (AG teve o objetivo de mostrar os conceitos atuais e os princípios filosóficos e éticos aceitos na grande maioria dos países e recomendados pela Organização Mundial da Saúde, as fases do processo, seus resultados e o impacto psicológico de uma doença genética em uma família. FONTES DOS DADOS: Os conceitos apresentados são baseados em uma síntese histórica da literatura sobre AG desde a década de 1930 até o momento atual, sendo que os artigos citados representam os principais trabalhos publicados e que hoje fundamentam a teoria e a prática do AG. SÍNTESE DOS DADOS: O AG modernamente é definido como um processo de comunicação que trata dos problemas humanos relacionados à ocorrência de uma doença genética em uma família. É fundamental que os profissionais da saúde conheçam os aspectos psicológicos desencadeados pela doença genética e como estes aspectos podem ser manejados. Vivemos ainda na genética humana e médica uma fase de predomínio dos aspectos técnicos e científicos e de pouca ênfase no estudo das reações emocionais e dos processos de adaptação das pessoas a estas doenças, o que leva ao baixo entendimento dos clientes sobre os fatos ocorridos, com conseqüências negativas sobre a vida familiar e para a sociedade. CONCLUSÕES: Conclui-se pela necessidade de que as famílias com doenças genéticas sejam encaminhadas para AG e que os profissionais desta área invistam mais na humanização do atendimento, desenvolvendo mais as técnicas do AG psicológico não-diretivo.OBJECTIVE: The objective of this review of genetic counseling (GC is to describe the current concepts and philosophical and ethical principles accepted by the great majority of countries and recommended by the World Health Organization, the stages of the process, its results and the psychological impact that a genetic disease has on a family. SOURCES: The concepts presented are

  2. TidGen Power System Commercialization Project

    Energy Technology Data Exchange (ETDEWEB)

    Sauer, Christopher R. [President & CEO; McEntee, Jarlath [VP Engineering & CTO

    2013-12-30

    ORPC Maine, LLC, a wholly-owned subsidiary of Ocean Renewable Power Company, LLC (collectively ORPC), submits this Final Technical Report for the TidGen® Power System Commercialization Project (Project), partially funded by the U.S. Department of Energy (DE-EE0003647). The Project was built and operated in compliance with the Federal Energy Regulatory Commission (FERC) pilot project license (P-12711) and other permits and approvals needed for the Project. This report documents the methodologies, activities and results of the various phases of the Project, including design, engineering, procurement, assembly, installation, operation, licensing, environmental monitoring, retrieval, maintenance and repair. The Project represents a significant achievement for the renewable energy portfolio of the U.S. in general, and for the U.S. marine hydrokinetic (MHK) industry in particular. The stated Project goal was to advance, demonstrate and accelerate deployment and commercialization of ORPC’s tidal-current based hydrokinetic power generation system, including the energy extraction and conversion technology, associated power electronics, and interconnection equipment capable of reliably delivering electricity to the domestic power grid. ORPC achieved this goal by designing, building and operating the TidGen® Power System in 2012 and becoming the first federally licensed hydrokinetic tidal energy project to deliver electricity to a power grid under a power purchase agreement in North America. Located in Cobscook Bay between Eastport and Lubec, Maine, the TidGen® Power System was connected to the Bangor Hydro Electric utility grid at an on-shore station in North Lubec on September 13, 2012. ORPC obtained a FERC pilot project license for the Project on February 12, 2012 and the first Maine Department of Environmental Protection General Permit issued for a tidal energy project on January 31, 2012. In addition, ORPC entered into a 20-year agreement with Bangor Hydro Electric

  3. Gen IV Materials Handbook Functionalities and Operation

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Weiju [ORNL

    2009-12-01

    This document is prepared for navigation and operation of the Gen IV Materials Handbook, with architecture description and new user access initiation instructions. Development rationale and history of the Handbook is summarized. The major development aspects, architecture, and design principles of the Handbook are briefly introduced to provide an overview of its past evolution and future prospects. Detailed instructions are given with examples for navigating the constructed Handbook components and using the main functionalities. Procedures are provided in a step-by-step fashion for Data Upload Managers to upload reports and data files, as well as for new users to initiate Handbook access.

  4. Autismo: genética Autism: genetics

    Directory of Open Access Journals (Sweden)

    Abha R Gupta

    2006-05-01

    Full Text Available O autismo é um transtorno fortemente genético, com uma herdabilidade estimada de mais de 90%. Uma combinação de heterogeneidade fenotípica e o provável envolvimento de múltiplos loci que interagem entre si dificultam os esforços de descobertas de genes. Conseqüentemente, a etiologia genética dos transtornos relacionados ao autismo permanece, em grande parte, desconhecida. Nos últimos anos, a convergência entre tecnologias genômicas em rápido avanço, a finalização do projeto genoma humano e os crescentes e exitosos esforços em colaboração para aumentar o número de pacientes disponíveis para estudo conduziram às primeiras pistas sólidas sobre as origens biológicas desses transtornos. Este artigo revisará a literatura até nossos dias, resumindo os resultados de estudos de ligação genética, citogenéticos e de genes candidatos com um foco no progresso recente. Além disso, são consideradas as vias promissoras para pesquisas futuras.Autism is a strongly genetic disorder, with an estimated heritability of greater than 90%. A combination of phenotypic heterogeneity and the likely involvement of multiple interacting loci have hampered efforts at gene discovery. As a consequence, the genetic etiology of the spectrum of autism related disorders remains largely unknown. Over the past several years, the convergence of rapidly advancing genomic technologies, the completion of the human genome project, and increasingly successful collaborative efforts to increase the number of patients available for study have led to the first solid clues to the biological origins of these disorders. This paper will review the literature to date summarizing the results of linkage, cytogenetic, and candidate gene studies with a focus on recent progress. In addition, promising avenues for future research are considered.

  5. Parámetros genéticos de caracteres biométricos en caballos Mangalarga

    Directory of Open Access Journals (Sweden)

    Raul Sampaio de Almeida Prado and Marcilio Dias Silveira da Mota

    2008-12-01

    Full Text Available El objetivo del presente estudio fue estimar los parámetros genéticos de caracteres biométricos en caballos de la raza Mangalarga. Los datos fueron proporcionados por el Studbook de la Asociación Brasileña de Criadores de Caballos Mangalarga (ABCCRM y compuesto por 36.036 registros de alzada a la cruz, 6.906 de la circunferencia del tórax y 6.916 de la circunferencia del hueso frontal de la caña, realizado en caballos nacidos entre enero de1980 y diciembre de 2003, y comprende 169.228 caballos en la matriz de parentesco. El modelo utilizado para estimar los componentes de lacovarianza necesarios para obtener la heredabilidades y las correlaciones incluyen: el efecto aleatorio de los caballos y los efectos fijos de edad, creador y el grupo de contemporáneos, utilizando el programa MTGSAM para las análisis. La media de heredabilidad encontradas oscilaron entre 0,41 (circunferencia del hueso de la caña a 0,7 (circunferencia torácica y elcorrelaciones genéticas y fenotípicas, fueron todos positivos, desde 0,28 a 0,47 y de 0,19 a 0,35, respectivamente.

  6. Apratylenchus vietnamensis gen. n., sp. n. and A. binhi gen. n., sp. n., sedentary Pratylenchidae (Nematoda:Tylenchida) from coffee in Vietnam, with proposal of Apratylenchinae subfam. n.

    NARCIS (Netherlands)

    Trinh, P.Q.; Waeyenberge, L.; Nguyen, C.N.; Baldwin, J.G.; Karssen, G.; Moens, M.

    2009-01-01

    Apratylenchinae subfam. n. is proposed within the Pratylenchidae to include Apratylenchus gen. n. and two new species, A. vietnamensis gen. n., sp. n. and A. binhi gen. n., sp. n., from coffee plantations in Vietnam. Apratylenchus gen. n. is distinguished by the presence of transverse rows of cuticu

  7. Texturas de los minerales del grupo de la sílice de la manifestación epitermal El Rifle-Hato Viejo, región de Moa: clasificación, descripción e implicaciones genéticas

    Directory of Open Access Journals (Sweden)

    Leduar Ramayo-Cortés

    2001-03-01

    Full Text Available En el marco de la región de Moa, Cuba oriental, se localizan varias manifestaciones hidrotermales. Se trata de sistemas vetiformes y brechas hidrotermales con contenidos significativos de metales nobles. La manifestación hidrotermal El Rifle-Hato Viejo se destaca por su extensión, y está formada por brechas y vetas de cuarzo mineralizadas, vinculadas preferentemente a fracturas correspondientes al sistema de fallas NW-SE y se hospeda en rocas sedimentarias del Campaniense Tardío-Daniense. El estudio textural de los minerales del grupo de la sílice permitió el reconocimiento de varias texturas, las cuales fueron clasificadas en tres grupos: 1 texturas de crecimiento primario (calcedonia maciza, costriforme, en peine, cristales zonados, y maciza, 2 texturas de recristalización (mosaico, plumosa y llameante, y 3 texturas de reemplazo (en enrejado, paralelo y radiado. Sobre la base de este análisis se estableció la secuencia deposicional de los diferentes minerales del grupo de la sílice y se reveló la presencia de la paragénesis de alteración adularia-sericita, lo cual indicaría el desarrollo de un sistema epitermal de baja sulfuración. Estas texturas también se usaron para indicar el nivel de emplazamiento dentro del sistema epitermal; en este caso, el emplazamiento de la manifestación El Rifle-Hato Viejo se corresponde con el nivel intermedio o coloiforme-costriforme, el cual se encuentra por encima de la zona propicia para la deposición del oro, por lo que podría esperarse la presencia de contenidos más elevados en profundidad.

  8. El desarrollo de la investigación en genética en Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Isaza

    2008-06-01

    Full Text Available Durante la última década la genética y la biología molecular en Colombia han dado un gran salto en su desarrollo. Al revisar las convocatorias nacionales de salud que realiza anualmente el Ministerio de Protección Social a través de Colciencias es posible visualizarlo. Al dar una breve mirada a las cifras estadísticas desde el año 2000, encontramos que el país muestra un claro aumento de la capacidad científica y el recurso humano para investigación en salud, reflejado en el incremento del número de proyectos presentados en cada convocatoria y el aumento considerable en la inversión del país para financiar investigación en salud, llegando en el año 2008 a la cifra de 28,000 millones de pesos.En el año 2000 se presentaron para evaluación a Colciencias 133 proyectos y se aprobaron para ejecución solamente 43 por un monto de 1,585 millones de pesos, mientras que en el 2007 se presentaron 690 y aprobados 103 por un monto de 21,223 millones de pesos. Este año se han presentado 711 proyectos que se encuentran actualmente en evaluación y se dispone de 28,000 millones para financiación. Estas cifras muestran un incremento de siete veces en el número de propuestas y un crecimiento de cerca de 27 veces en el presupuesto durante los últimos 7 años. Es muy claro que los proyectos seleccionados son cada vez de mayor impacto para la salud de los colombianos y ahora entre 20% y 30% de las propuestas presentadas en la modalidad nacional, incluyen temas relacionados con genética o utilizan herramientas de biología molecular. Sin embargo, este porcentaje es mucho menor en la convocatoria regional, lo que muestra una concentración de científicos con preparación en genética y biología molecular en las principales ciuda-des del Colombia, que es lo que se ha denominado el triángulo de oro de la ciencia en Colombia (Medellín, Bogotá y Cali. Es interesante ver los desarrollos de la genética molecular para el estudio de las

  9. El desarrollo de la investigación en genética en Colombia.

    Directory of Open Access Journals (Sweden)

    Carolina Isaza

    2009-11-01

    Full Text Available Durante la última década la genética y la biología molecular en Colombia han dado un gran salto en su desarrollo. Al revisar las convocatorias nacionales de salud que realiza anualmente el Ministerio de Protección Social a través de Colciencias es posible visualizarlo. Al dar una breve mirada a las cifras estadísticas desde el año 2000, encontramos que el país muestra un claro aumento de la capacidad científica y el recurso humano para investigación en salud, reflejado en el incremento del número de proyectos presentados en cada convocatoria y el aumento considerable en la inversión del país para financiar investigación en salud, llegando en el año 2008 a la cifra de 28,000 millones de pesos. En el año 2000 se presentaron para evaluación a Colciencias 133 proyectos y se aprobaron para ejecución solamente 43 por un monto de 1,585 millones de pesos, mientras que en el 2007 se presentaron 690 y aprobados 103 por un monto de 21,223 millones de pesos. Este año se han presentado 711 proyectos que se encuentran actualmente en evaluación y se dispone de 28,000 millones para financiación. Estas cifras muestran un incremento de siete veces en el número de propuestas y un crecimiento de cerca de 27 veces en el presupuesto durante los últimos 7 años. Es muy claro que los proyectos seleccionados son cada vez de mayor impacto para la salud de los colombianos y ahora entre 20% y 30% de las propuestas presentadas en la modalidad nacional, incluyen temas relacionados con genética o utilizan herramientas de biología molecular. Sin embargo, este porcentaje es mucho menor en la convocatoria regional, lo que muestra una concentración de científicos con preparación en genética y biología molecular en las principales ciudades del Colombia, que es lo que se ha denominado el triángulo de oro de la ciencia en Colombia (Medellín, Bogotá y Cali. Es interesante ver los desarrollos de la genética molecular para el estudio de las

  10. Deleciones en el gen de la distrofina en 62 familias colombianas: correlación genotipo-fenotipo para la distrofia muscular de Duchenne y Becker.

    Directory of Open Access Journals (Sweden)

    Claudia T. Silva

    2009-11-01

    Full Text Available INTRODUCCIÓN: La correlación genotipo-fenotipo se estableció mediante el análisis de deleciones del gen de la distrofina en pacientes con distrofia muscular de Duchenne y Becker (DMD/DMB. OBJETIVOS: Establecer la correlación entre el genotipo molecular y el fenotipo clínico de los pacientes. MATERIALES Y MÉTODOS: Se analizaron 62 afectados mediante amplificaciones por PCR múltiplex de 18 exones ubicados en los dos puntos proclives dentro del gen. RESULTADOS: En la población analizada, 19 pacientes mostraron deleción en el gen de la distrofina con los 18 exones estudiados, esto corresponde a 31% de hombres afectados con deleción. CONCLUSIONES: Teniendo en cuenta la hipótesis del corrimiento del marco de lectura traduccional (CMLT y la mutación observada en los afectados, se pudo determinar que las mutaciones out frame, resultan en pacientes con el fenotipo severo o distrofia muscular de Duchenne y las mutaciones in frame, resultan en pacientes con el fenotipo leve o distrofia muscular de Becker. Se pudo predecir un cuadro clínico de DMD o DMB en 79% de los casos, lo cual permite utilizar este sistema diagnóstico como una herramienta importante para ayudarle a los neurólogos en la valoración clínica de los pacientes en los cuales se encuentra deleciones.

  11. Towards an International Culture: Gen Y Students and SNS?

    Science.gov (United States)

    Lichy, Jessica

    2012-01-01

    This article reports the findings of a small-scale investigation into the Internet user behaviour of generation Y (Gen Y) students, with particular reference to social networking sites. The study adds to the literature on cross-cultural Internet user behaviour with specific reference to Gen Y and social networking. It compares how a cohort of…

  12. Engenharia Genética: busca da mercadoria perfeita?

    OpenAIRE

    José Neivaldo de Souza

    2014-01-01

    Resenha:Engenharia Genética: busca da mercadoria perfeita? -SANDEL, Michael J. Contra a Perfeição: ética na era da engenharia genética. 1ª.ed. Tradução por Ana Carolina Mesquita. Rio de janeiro: Civilização Brasileira, 2013. 160p. 

  13. Hoja informativa de pruebas genéticas

    Science.gov (United States)

    Trata de pruebas genéticas para riesgos heredados de cáncer; incluye tipos de pruebas, para quién son, explicación y confidencialidad de los resultados. Ofrece información de pruebas genéticas a domicilio o pruebas para el consumidor.

  14. Anomalías y displasias dentarias de origen genético-hereditario Inherited dental abnormalities and dysplasias

    Directory of Open Access Journals (Sweden)

    J. Martín-González

    2012-12-01

    Full Text Available Las alteraciones del desarrollo embriológico de la dentición provocan anomalías y displasias dentarias. Los factores etiopatogénicos implicados en las alteraciones del desarrollo dentario son básicamente dos: genéticos y ambientales. Según la fase del desarrollo en que afecten al órgano del esmalte y a los tejidos dentarios, aparecerán diferentes anomalías y/o displasias dentales. El control genético del desarrollo dentario se lleva a cabo mediante dos procesos: a control de la histogénesis del esmalte y la dentina, y b la especificación del tipo, tamaño y posición de cada diente. La mutación de los genes implicados en la amelogénesis (AMELX, ENAM, MMP20 y KLK4 o en la dentinogénesis (DSPP produce alteraciones del desarrollo dentario aisladas o no sindrómicas. Por el contrario, las mutaciones de los genes reguladores morfogenéticos involucrados en la determinación de la posición y el desarrollo precoz de los órganos dentarios (genes homeobox, además de alterar la morfodiferenciación dentaria, tienen efectos pleiotrópicos y afectan a otros órganos, provocando síndromes hereditarios en los que uno de sus rasgos es la alteración dentaria. En este artículo se revisan las principales anomalías y displasias dentarias de causa genético-hereditaria.Alterations of the embryologic development of the dentition cause dental anomalies and dysplasias. The causing factors involved in the disturbances of tooth development are basically two: genetic and environmental factors. Depending on the phase of tooth development when the factors act, they will appear different dental anomalies and dysplasias. Genetic control of tooth development is carried out through two processes: a control of amelogenesis and dentinogenesis,and b the specification of the type, size and position of each tooth. Mutation of genes involved in amelogenesis (AMELX, ENAM, MMP20 and KLK4 and dentinogenesis (DSPP produces non-syndromic alterations of tooth

  15. Interacciones genéticas y epigenéticas relacionadas con fisuras de labio y paladar no sindrómicas

    Directory of Open Access Journals (Sweden)

    L.R. Tirado Amador

    2016-02-01

    Full Text Available En la actualidad, las fisuras de labio y fisuras de paladar no sindrómicas constituyen una de las alteraciones del crecimiento y desarrollo facial con alta prevalencia que ocasiona preocupación a nivel mundial porque generan efectos a nivel fisiológico al repercutir en la deglución, fonación, así como en la autopercepción y aceptación del individuo en lo relacionado con la socialización, ocasionando que el tratamiento de dicha alteración requiera de la utilización de un equipo interdisciplinario con el fin de lograr mejoría satisfaciendo las necesidades del individuo afectado. Con respecto a la etiología de este defecto del desarrollo, en la literatura se ha atribuido a diversos factores genéticos así como a factores ambientales, convergiendo hacia el modelo de interacción multifactorial en el que los genes emiten respuesta ante los estímulos que provienen del ambiente, lo que repercute en la expresión a nivel fenotípico. Aunque existen reportes de los cambios genéticos que pueden estar asociados con las alteraciones en el desarrollo labial y cierre palatino, existe gran tendencia a considerar la presencia de mutaciones; sin embargo en ocasiones se omite o resta cierta importancia a los efectos que derivan de las alteraciones en la expresión de la información genética como resultado de la exposición a ciertos factores ambientales. Por lo cual, en la presente revisión, los autores pretenden describir algunos factores genéticos y epigenéticos que intervienen en la aparición de las fisuras labiales y palatinas no sindrómicas.

  16. Susceptibilidad genética a desarrollar Cáncer de pulmón asociada con el gen polimórfico hidrolasa epoxida

    Directory of Open Access Journals (Sweden)

    Sierra CH.

    2001-06-01

    Full Text Available La enzima metabólica hidrolasa epóxida microsomal (mHE está involucrada en biotransforma-ción de carcinógenos del cigarrillo (ej., benzo-a-pireno. Este estudio investigó la susceptibilidad genética a desarrollar cáncer de pulmón asociada con los polimorfismos en los exones 3 y 4 delgen mHE, los cuales confieren reducida e incrementada actividad enzimática respectivamente. Además, se determinó su efecto en la frecuencia de aberraciones cromosómicas (AC como unamedida adicional de riesgo. La población de estudio incluyó 110 pacientes con cáncer de pulmóny 119 fumadores saludables.

  17. Bases ambientales y genéticas de las fisuras orofaciales: Revisión

    Directory of Open Access Journals (Sweden)

    Cesar A Rivera

    2013-04-01

    Full Text Available RESUMEN El desarrollo embriológico de las estructuras orofaciales es un proceso complejo guiado por programas genéticos. Alteraciones en esos procesos dan lugar a anomalías estructurales. Un ejemplo de ellas son las fisuras de labio y paladar. Las principales vías involucradas en las fisuras tienen como participantes a las familias del factor de crecimiento fibroblástico (FGF, Hedgehog (HH, Wingless (WNT y la familia del factor de crecimiento transformante beta (TGFβ, que incluye las proteínas morfogenéticas del hueso (BMPs y activinas. En esta revisión narrativa se presentan algunos de los procesos celulares, moleculares y factores ambientales implicados en el desarrollo del complejo orofacial, finalizando con posibilidades terapéuticas para la evidencia acumulada. ABSTRACT Complex genetic process guides the embryonic head development. Alterations in these processes result in structural abnormalities. An example of these are the cleft lip and palate. The major pathways involved in the fissures are families: the Fibroblast Growth Factor (FGF family, the Hedgehog (HH family, the Wingless (WNT family and the Transforming Growth Factor beta (TGF-β family, which includes the Bone Morphogenetic Proteins (BMPs and Activins. In this review, we discuss some of the celular/molecular processes and environmental factors involved in the development of the orofacial complex, ending with therapeutic possibilities and potential clinical relevance to the accumulated evidence.

  18. Del Piero

    OpenAIRE

    Umbaca, Enzo

    2015-01-01

    Rifacendosi al “Pinturicchio”, epiteto con cui Gianni Agnelli consacrava il calciatore Alessandro Del Piero un “artista del calcio”, Enzo Umbaca scrisse al popolare personaggio invitandolo a collaborare ad una performance durante la quale Pinturicchio-Del Piero avrebbe affrescato il muro di una galleria torinese calciando un pallone macchiato di grafite contro un muro sul quale è appesa la copia di un opera del Pinturicchio.

  19. Marcadores moleculares y ecología del movimiento

    Directory of Open Access Journals (Sweden)

    J.J. Robledo-Arnuncio

    2009-01-01

    Full Text Available El estudio del movimiento es parte esencial del análisis ecológico a nivel de gen, individuo, población, comunidad y ecosistema. Los marcadores de ADN son herramientas muy útiles para el estudio del movimiento a todos estos niveles, permitiendo, por ejemplo, establecer relaciones de parentesco entre individuos, determinar el origen poblacional de individuos migrantes, estudiar sistemas de apareamiento, cuantificar la escala de interacciones interespecíficas, o caracterizar el patrón espacial de la dispersión y la competencia. A nivel de gen, los marcadores de ADN son imprescindibles para estudiar la estructura y el flujo genético dentro y entre poblaciones, así como su efecto combinado con otras fuerzas evolutivas y los factores bióticos y abióticos del medio sobre la adaptación local. En este artículo se revisan algunos métodos basados en marcadores de ADN que pueden resultar de utilidad en ecología del movimiento, identificándose áreas de estudio en las que se espera estos marcadores sean de especial utilidad en los próximos años.

  20. Variabilidad genética en cepas de Plasmodium falciparum circulantes en regiones colombianas con riesgo diferente para malaria

    Directory of Open Access Journals (Sweden)

    Mauricio Arcos Burgos

    2000-02-01

    Full Text Available

    La presencia de malaria en una zona es el resultado de una interacción dinámica entre los hospederos humanos, los plasmodios, el vector y el medio ambiente ecológico, físico, socioeconómico y cultural. Plasmodium falciparum, es la especie que produce la enfermedad más grave. La diversidad genética de las cepas de P. falciparum se expresa en el gran polimorfismo antigénico, en la susceptibilidad de este plasmodio a las diferentes drogas utilizadas para su tratamiento y en la patogenicidad de las cepas. El secuenciamiento de genes de P. falciparum ha demostrado diferencias tanto en tamaño como en la secuencia de regiones repetitivas que codifican para la parte inmunodominante de antígenos altamente polimórficos.

    Algunos estudios asocian el grado de variabilidad genética con la endemicidad de malaria en la zona. Estos hallazgos han permitido formular la hipótesis de que a mayor endemicidad mayor variabilidad genética del P. falciparum (2, 3, sin embargo la mayoría de estudios se han realizado en zonas altamente endémicas y poco se conoce sobre la complejidad genética de P. falciparum en zonas de baja y moderada endemicidad. La variabilidad genética de cepas de P. falciparum circulantes en Colombia según el riesgo por regiones es desconocido, en Colombia, según el Índice Parasitario Anual (IPA, hay zonas de alto riesgo (IPA >10, mediano riesgo (IPA entre 2-10 y de bajo riesgo (IPA entre 0-2 para malaria, pensamos que a mayor endemicidad de la malaria en una zona mayor será la variabilidad genética de las cepas de P. falciparum circulantes en ella, por eso queremos conocer el grado de variabilidad genética de las cepas de P. falciparum circulantes en zonas colombianas con diferente riesgo para malaria y la presencia de infección multiclonal en dichas áreas. Para determinar el

  1. Las buenas semillas. Plantas, capital genético y Revolución Verde en Costa Rica

    Directory of Open Access Journals (Sweden)

    Wilson Picado Umaña

    2013-03-01

    Full Text Available Este artículo analiza el desarrollo de la Revolución Verde en la producción de arroz de Costa Rica. Muestra el papel fundamental que jugaron los cambios en el capital biológico (semillas en la transformación de la agricultura del arroz a partir de la década de 1940. Se parte de la hipótesis que la selección del material genético nuevo fue determinante para la consolidación del paquete técnico asociado con la Revolución Verde, así como para el fortalecimiento de las formas capitalistas de producción. La investigación se fundamenta en la revisión de documentos agronómicos, entrevistas, series estadísticas y revistas agrícolas.

  2. Sobreexpresión, purificación y reconstitución del citocromo b559

    OpenAIRE

    Luján Serrano, María Ángeles

    2009-01-01

    El citocromo b559 (cytb559) forma parte del centro de reacción del fotosistema II. Está compuesto por dos subunidades: la subunidad ¿, codificada por el gen psbE, y la subunidad ß, codificada por el gen psbF. Ambos genes se encuentran en el genoma cloroplástico. Entre las dos subunidades se encuentra ensamblado un grupo hemo de tipo b, coordinado por dos histidinas, una de cada subunidad. Desempeña un papel estructural dentro del centro de reacción pero a pesar de los numerosos estudios reali...

  3. Implicaciones del estudio de inestabilidad del ciclo celular en la biología del cáncer.

    Directory of Open Access Journals (Sweden)

    Luis Tume-Farfán

    2014-01-01

    Full Text Available Todas las células poseen mecanismos para mantener la integridad genómica que es vital para la supervivencia celular y la proliferación. Las células se dividen a tasas normale s durante su tiempo de vida, cuando esta tasa sobrepasa los límites normales ocurren alteraciones a nivel genético que afectan el control del ciclo celular por lo tanto estas células crecen y se dividen sin control y ya no responden a señalización extrace lular que indica la detención del ciclo y la apoptosis, estos mecanismos son los encargados de la prevención del cáncer que por lo generales se produce a través de la regulación estricta del ciclo celular por grupos de proteínas que interactúan entre sí e n una secuencia muy específica de eventos. Son estos acontecimientos los que determinan si el ciclo celular seguirá adelante o quedará estancado entre etapas. La falta de eficiencia en la replicación del ADN y el mantenimiento de esta macromolécula puede s er consecuencia de mutaciones deletéreas que conducen a la muerte celular o, en los organismos multicelulares a cáncer. El objetivo de esta revisión es discutir las vías de transducción de señales conocidas que regulan la progresión del ciclo celular y los mecanismos que las células emplean para asegurar la estabilidad del ADN, así como los avances que se están alcanzando en una forma de evitar esta proliferación descontrolada en las células con tendencia a ser cancerosa

  4. Caracterización de las mutaciones en el gen rpoβ asociadas a la rifampicina en pacientes con tuberculosis pulmonar

    Directory of Open Access Journals (Sweden)

    Juan Agapito

    2002-07-01

    Full Text Available Antecedentes: La resistencia a rifampicina en M. tuberculosis involucra mutaciones en el gen rpoβ que codifica a la subunidad β de la ARN polimerasa. Objetivo: Identificar las mutaciones del gen rpoβ , en cepas de M. tuberculosis asociadas con resistencia a rifampicina aisladas de la Subregiσn de Salud Lima Norte, Perϊ. Materiales y métodos: Se cultivó en Lowestein - Jenseen 73 muestras de esputo de pacientes con tuberculosis pulmonar. A 62, con más de 10 colonias por tubo, se les comprobó susceptibilidad a isoniazida, rifampicina, estreptomicina y etambutol. Se realizó la extracción de ADN por PCR, clonación en el vector pGEM-T, transformación, selección de clonas recombinantes y secuenciamiento del ADN plasmídico para la determinación de los polimorfismos del gen rpoβ. Resultados: 52 (83,9% cepas fueron resistentes a rifampicina (Rif r y 10 (16,1% susceptibles (Rif s . Se encontró alteraciones en el gen rpoβ en 51 de 52 cepas Rif r Se identificaron 20 mutaciones. Las mutaciones mαs frecuentes fueron encontradas en los codones Ser-531 (62,7%, His-526 (15,7%, Asp-516 (11,8% y Gln-513 (5,9%. No se observσ mutaciσn alguna en las 10 cepas Rif s. 94,2% de nuestras cepas Rif r fueron también resistentes a isoniazida. Conclusiones: Se encontraron mutaciones en el gen rpoB de casi todas las cepas Rif r ; asimismo, casi todas las cepas Rif r fueron también resistentes a isoniazida.

  5. La genómica nutricional: un nuevo paradigma de la investigación de la nutrición humana.

    Directory of Open Access Journals (Sweden)

    Felipe García Vallejo

    2009-11-01

    Full Text Available La relación entre la dieta y la salud es un hecho que ha sido ampliamente demostrado; sin embargo, existe un interés creciente en cuáles de los componentes de la dieta son biológicamente activos y cómo ellos ejercen su efecto funcional. Estas preguntas han sido ejes centrales del desarrollo de la genómica nutricional. Así, la genómica nutricional es la aplicación de las tecnologías utilizadas en la funcional para entender, a nivel genómico, el efecto que tienen los alimentos. Una de las preguntas más comunes en nutrición es ¿Qué y cómo comer? La aceptada individualidad metabólica que se ha predicado en los últimos años, impide que se pueda dar una respuesta general. Actualmente se sabe que el genoma es individualizado y que la expresión de su contenido informacional es un universo único, que depende no sólo de factores exógenos sino que es modulado de manera muy compleja por múltiples factores endógenos. Es pues un reto de conocimiento el comenzar a definir cuáles son las variables que intervienen para poder tener una dieta acorde con cada individuo. En este sentido, la genómica nutricional (o nutrigenómica, plantea el estudio del efecto de los alimentos a nivel molecular y genético. En tal contexto, el proyecto del genoma humano provee herramientas para poder entenderla y se convierte en un nuevo paradigma de la investigación en nutrición humana.

  6. Variabilidad genética de Moniliophthora perniciosa (Stahel Aime y Phillips-Mora, comb. nov. (Agaricales - Marasmiaceae en variedades de cacao (Theobroma cacao L.

    Directory of Open Access Journals (Sweden)

    Osorio Solano Carolina

    2012-11-01

    Full Text Available

    Moniliophthora perniciosa, agente causante de la 'escoba de bruja' en cacao (Theobroma cacao, presen- ta una elevada variabilidad genética y discrepancias en su taxonomía y es una de las enfermedades más importantes en plantaciones cacaoteras que ocasiona pérdidas económicas a nivel mundial cer- canas a 70%, y de 40% a nivel nacional. La caracterización de la diversidad genética de los biotipos es importante para la ejecución de proyectos encaminados al manejo de este patógeno y el desarrollo de materiales resistentes de cacao. En este estudio se analizaron 12 aislamientos del hongo obtenidos de diferentes materiales de cacao. Cada una de las muestras se evaluó con marcadores moleculares que tienen como blanco una región del ADN ribosomal (ADNr nuclear conocida como ITS (Internal Trans- cribed Spacer, una región intergénica (IGS-1 y cinco secuencias simples repetidas (SSR. El marcador IGS-1 permitió la determinación del biotipo C, no obstante se encontró una variabilidad genética evi- dente dentro de este biotipo, aún no registrada. El análisis de la diversidad genética de M. perniciosa por medio de marcadores microsatélite arrojó un valor total de 0.4260, una heterocigosidad total de

    0.6143 y un Indice de información polimórfica (PIC de 0.3407, valores considerados de rango medio a

    alto para los aislamientos estudiados y que estiman la variabilidad genética presente en M. perniciosa.

  7. Variabilidad genética de Moniliophthora perniciosa (Stahel Aime y Phillips-Mora, comb. nov. (Agaricales - Marasmiaceae en variedades de cacao (Theobroma cacao L.

    Directory of Open Access Journals (Sweden)

    Carolina Osorio-Solano

    2012-04-01

    Full Text Available Moniliophthora perniciosa, agente causante de la ‘escoba de bruja’ en cacao (Theobroma cacao, presenta una elevada variabilidad genética y discrepancias en su taxonomía y es una de las enfermedades más importantes en plantaciones cacaoteras que ocasiona pérdidas económicas a nivel mundial cercanas a 70%, y de 40% a nivel nacional. La caracterización de la diversidad genética de los biotipos es importante para la ejecución de proyectos encaminados al manejo de este patógeno y el desarrollo de materiales resistentes de cacao. En este estudio se analizaron 12 aislamientos del hongo obtenidos de diferentes materiales de cacao. Cada una de las muestras se evaluó con marcadores moleculares que tienen como blanco una región del ADN ribosomal (ADNr nuclear conocida como ITS (Internal Transcribed Spacer, una región intergénica (IGS-1 y cinco secuencias simples repetidas (SSR. El marcador IGS-1 permitió la determinación del biotipo C, no obstante se encontró una variabilidad genética evidente dentro de este biotipo, aún no registrada. El análisis de la diversidad genética de M. perniciosa por medio de marcadores microsatélite arrojó un valor total de 0.4260, una heterocigosidad total de 0.6143 y un índice de información polimórfica (PIC de 0.3407, valores considerados de rango medio a alto para los aislamientos estudiados y que estiman la variabilidad genética presente en M. perniciosa.

  8. Disección transcripcional del Locus GH del genoma humano

    OpenAIRE

    CANIZALES ESPINOSA, M.; MARTÍNEZ RODRÍGUEZ, H. G.; J. L. Castillo; JEAN MARC, EGLY; H. A. Barrera Saldaña

    2006-01-01

    El locus de la hormona del crecimiento humano (hGH) presenta variaciones en los niveles de expre- sión en algunos de sus componentes hasta en tres órdenes de magnitud. Este estudio comparó deleciones (140 a 3,100 pb) y la fuerza de transcrip- ción de todos los promotores del locus con un gen reportero (hGH-N) mediante expresión transitoria. Los promotores largos tuvieron mayor expresión, paradójicamente hGH-V fue uno de los más acti- vos. Se detectaron tres elementos promotores ne- gativos y ...

  9. Polimorfismos de 17 marcadores STR del cromosoma-Y en una muestra poblacional del altiplano cundiboyacense*

    OpenAIRE

    Korina María Rojas; Martha Roa; Ignacio Briceño; Carolina Guaneme; Alberto Gómez

    2011-01-01

    Introducción: La tipificación molecular de ADN de cromosoma-Y es una herramienta de reconocida importancia en el proceso de identificación de individuos de género masculino en diversos casos forenses. Actualmente es una herramienta de apoyo para los laboratorios de genética estatales en la identificación de víctimas del conflicto armado en Colombia, dentro de los procesos enmarcados en la Ley de Justicia y Paz. En este estudiose determina el haplotipo del cromosoma-Y que será comparado con pa...

  10. Polimorfismos de 17 marcadores STR del cromosoma-Y en una muestra poblacional del altiplano cundiboyacense

    OpenAIRE

    Korina María Rojas; Martha Roa; Ignacio Briceño; Carolina Guaneme; Alberto Gómez

    2011-01-01

    Introducción: La tipificación molecular de ADN de cromosoma-Y es una herramienta de reconocida importancia en el proceso de identificación de individuos de género masculino en diversos casos forenses. Actualmente es una herramienta de apoyo para los laboratorios de genética estatales en la identificación de víctimas del conflicto armado en Colombia, dentro de los procesos enmarcados en la Ley de Justicia y Paz. En este estudiose determina el haplotipo del cromosoma-Y que será comparado con pa...

  11. Gen-Umwelt-Interaktionen und Gen-Umwelt-Korrelationen bei psychiatrischen Erkrankungen

    Directory of Open Access Journals (Sweden)

    Winkler D

    2010-01-01

    Full Text Available Die seit Langem bestehende Frage, in welchem Ausmaß Anlage und Umwelt zu psychologischen Merkmalen und psychiatrischen Erkrankungen beitragen, wird durch Ergebnisse von Zwillingsstudien und in letzter Zeit durch Untersuchungen des Zusammenhangs zwischen molekulargenetischen Merkmalen und Umwelteinflüssen bereichert. Eine Gen-Umwelt-Interaktion liegt dann vor, wenn genetische Faktoren die Auswirkungen von Umweltbedingungen modulieren. Die Genetik kann weiters die Wahrscheinlichkeit der Exposition gegenüber bestimmten Umwelteinflüssen verändern, was als Gen- Umwelt-Korrelation bezeichnet wird. Beide Phänomene liegen aber häufig gleichzeitig vor, was eine besondere Herausforderung für die Konzeption von wissenschaftlichen Studien darstellt.

  12. NextGen Future Safety Assessment Game

    Science.gov (United States)

    Ancel, Ersin; Gheorghe, Adrian; Jones, Sharon Monica

    2011-01-01

    The successful implementation of the next generation infrastructure systems requires solid understanding of their technical, social, political and economic aspects along with their interactions. The lack of historical data that relate to the long-term planning of complex systems introduces unique challenges for decision makers and involved stakeholders which in turn result in unsustainable systems. Also, the need to understand the infrastructure at the societal level and capture the interaction between multiple stakeholders becomes important. This paper proposes a methodology in order to develop a holistic approach aiming to provide an alternative subject-matter expert (SME) elicitation and data collection method for future sociotechnical systems. The methodology is adapted to Next Generation Air Transportation System (NextGen) decision making environment in order to demonstrate the benefits of this holistic approach.

  13. Protección de la tradición. Los derechos no tradicionales de la propiedad intelectual. Comité intergubernamental de recursos genéticos, conocimientos tradicionales y folclore de la OMPI

    Directory of Open Access Journals (Sweden)

    Laura Sofía Gómez Madrigal

    2013-11-01

    Full Text Available Los recursos genéticos, los conocimientos tradicionales y las expresiones culturales tradicionales/expresiones del folclore son activos intangibles con un valor cultural y económico para las comunidades indígenas y locales. Este trabajo pretende explicar a qué se refieren estos temas que actualmente se debaten a nivel internacional sobre la protección del saber tradicional.

  14. The GenDev Curriculum Development Workshop.

    Science.gov (United States)

    D'cunha, J

    1997-01-01

    This article describes the second Curriculum Development Workshop held in May 1997 at the Asian Institute of Technology (AIT) in Bangkok, Thailand. The workshop aimed to review critically and restructure the Gender and Development Studies (GenDev) curriculum and to assess AIT's role in training gender experts for the region. Participants included 22 people from 16 countries in Asia, Europe, and the US who were teaching graduate students about gender issues and who were activists with nongovernmental organizations working on gender issues. It was determined that the following were required courses: Culture, Knowledge and Gender Relations; Gender, Technology, and Development; Principles of Gender Research and Methodology in Science and Technology; and Gender Analysis and Field Methods. Other suggested core courses included: Gender and Natural Resource Management; Enterprise Management, Technology, and Gender; Gender and Agrarian Reform; Urbanization: A Gender Perspective; Gender-Responsive Development Planning; and Gender and Economic Change: Past and Present Concerns. Participants distinguished between GenDev courses offered to anyone attending AIT and training courses designed to produce gender experts in the region. The aim of training courses for AIT graduate students was to sensitize potential managers, technologists, and others on gender issues and to create awareness of the importance of including gender perspectives within decision-making, policy formation, and implementation. Training courses to produce gender experts should be directed to those with a prior background in gender studies and include gender analysis in field methods. Participants agreed that there should be an independent and autonomous field of gender and development studies. Participants made six recommendations for such a field of study. PMID:12179927

  15. Diversidad y diferenciación genética de la yuca ( Manihot esculenta Crantz con marcadores microsatélites en poblaciones de África y Latinoamérica

    Directory of Open Access Journals (Sweden)

    Fregene Martin

    2004-12-01

    Full Text Available Se estudió la diversidad y diferenciación genética de 224 accesiones de yuca tradicionalmente cultivadas en Uganda. Adicionalmente, se incluyeron estudios previos de diversidad, 20 materiales de Tanzania, 20 de Ghana, 22 de Nigeria, 20 de Guatemala y 12 accesiones representando la colección núcleo de Latinoamérica, mantenidas en CIAT. Nueve grupos basados en el país de origen fueron creados para estudiar la variación genética dentro y entre países. Usando secuencias simples repetidas (SSR o marcadores microsatélites, la variación en las frecuencias alélicas en 35 loci no ligados sirvió para estimar los parámetros de diversidad y diferenciación genética. Los resultados afirman una divergencia genética entre accesiones africanas y latinoamericanas, y una fuerte diferenciación de algunas accesiones de Guatemala con respecto a los
    otros países. Ellos también muestran una alta diversidad genética dentro de países y una moderada diferenciación entre ellos. En particular Uganda mantiene alta diversidad genética
    dentro Distritos aún después de una reciente epidemia de CMD (cassava mosaic disease pero baja diferenciación entre ellos. Se discuten las posibles fuerzas implicadas en la dinámica de la diversidad genética, la importancia de Guatemala en los programas de mejoramiento de yuca en la búsqueda de grupos con potencial heterótico, el bajo impacto causado por CMD en la constitución genética del cultivo en Uganda y la observación de una distribución continua de la diversidad genética.

  16. Determinación de los polimorfismos genéticos taqla (ANKK1), taqlb (DRD2), -141c ins/del (DRD2) y vntr 40pb (DAT1) en población colombiana y evaluación de su asociación con el alcoholismo

    OpenAIRE

    Castro Matiz, Tatiana Ximena

    2013-01-01

    La Organización Mundial de la Salud define a la alcohol dependencia como el consumo crónico y continuado o al consumo periódico de alcohol que se caracteriza por un deterioro del control de la bebida, episodios frecuentes de intoxicación y obsesión por el alcohol y su consumo a pesar de sus consecuencias adversas. La alcohol dependencia es una enfermedad de herencia compleja y amplia heterogeneidad, donde múltiples genes pueden estar involucrados y donde el ambiente juega un rol importante en...

  17. Clima i condicions de conreu en els orígens de l'agricultura mediterrània: evidències a partir de la composició isotòpica del carboni en restes arqueobotàniques

    OpenAIRE

    Ferrio Díaz, Juan Pedro; Alonso, Natàlia; Voltas Velasco, Jordi; Buxó i Capdevila, Ramon; Araus Ortega, José Luis

    2006-01-01

    Este trabajo ilustra cómo el análisis de la composición isotópica del carbono en restos arqueobotánicos aporta información sobre las condiciones climáticas y de cultivo en el pasado. Tras una introducción metodológica, se presentan distintos ejemplos que utilizan semillas carbonizadas (trigo y cebada) y/o carbones de especies forestales (pino carrasco, encina, etc.), ambos tipos de restos recuperados en yacimientos de la cuenca mediterránea. Mientras la composición isotópica en cereales pr...

  18. Estudio de bloques constructivos en algoritmos genéticos

    OpenAIRE

    Murias Rodríguez, Angel

    2007-01-01

    Estudio experimental sobre el efecto de las modificaciones en los bloques constructivos. Para conseguirlo, primero se ha diseñado un algoritmo genético genérico con posibilidad de adaptarlo a un problema específico (función de objetivo a optimizar) e incorporar fácilmente diferentes características que pueden tener estos algoritmos. Como referencia de comparación se ha diseñado y implementado un algoritmo genético estándar y los algoritmos con las modificaciones. Se han probado los algorit...

  19. Desarrollo del esquema conceptual del concepto de integral definida en el marco teórico APOE: un estudio de caso

    OpenAIRE

    Aldana, Eliécer; González, Mª Teresa

    2011-01-01

    En esta comunicación se presenta un estudio sobre el desarrollo del esquema conceptual del concepto de integral definida en el marco teórico APOE de un estudiante de tercer año de Licenciatura de Matemáticas en la Universidad del Quindío que estudia por primera vez este concepto. Para realizar esta investigación, inicialmente se identificaron los elementos matemáticos que configuran el concepto, lo que permitió realizar una descomposición genética del concepto. Posteriormente, se recogió info...

  20. Caracterización del sistema proteolítico de Moniliophthora roreri (Cif.) Evans et al., causante de la moniliasis del cacao

    OpenAIRE

    García Hernández, Claudia

    2012-01-01

    El presente trabajo constituye el primer reporte sobre el estudio del sistema proteolítico del hongo Moniliophthora roreri, agente causal de la moniliasis del cacao. El trabajo inició con la identificación de la cepa aislada a partir de frutos de cacao infectados. La amplificación y secuenciación de un fragmento del gen 18S rDNA, permitió la identificación molecular de la cepa aislada como M. roreri, designada como MRO1. A continuación, se evaluó el crecimiento celular de ...

  1. Correlaciones fenotípicas, genéticas y ambientales en cucurbita moschata duch. ex poir

    OpenAIRE

    Baena García D.; Espitia Camacho M.; Vallejo Cabrera F. A.

    2006-01-01

    El estudio estimó las correlaciones fenotípicas, genéticas y ambientales entre doce caracteres agronómicos en dos dialélicos de zapallo (uno entre cinco variedades y otro entre cinco líneas S1, originadas de las anteriores). Se usó un diseño en bloques completos al azar con 15 tratamientos (5 progenitores + 10 cruzamientos F1) para cada dialélico y cinco repeticiones. Los resultados señalaron mayor estimación de las correlaciones (en magnitud y significancia estadística) a favor del dialélico...

  2. Detección de Leishmania spp. en base al gen que codifica la proteína HSP20

    Directory of Open Access Journals (Sweden)

    Ana M Montalvo

    2014-10-01

    Full Text Available Objetivos. Explorar una nueva diana para el diagnóstico molecular de Leishmania. Materiales y métodos. Se evaluó la utilidad del gen que codifica la proteína de choque térmico de 20kDa (hsp20 para la detección de Leishmania por medio de la reacción en cadena de la polimerasa (PCR.Se normalizó la PCR y se determinaron los parámetros analíticos, así como la validez y seguridad diagnóstica y la concordancia con la PCR-18S. Se evaluó la PCR-hsp20 con ADN obtenido de un grupo de muestras clínicas de distinta procedencia. Resultados. Los parámetros analíticos resultaron adecuados. La sensibilidad obtenida fue de 86% y la especificidad del 100%, la concordancia con el método de referencia resultó buena (κ = 0,731, lo que apoya su posible uso para el diagnóstico. La posibilidad de identificación posterior de la especie mediante secuenciación del producto amplificado le confiere una ventaja adicional. Conclusiones. Se demuestra la utilidad de este gen como una nueva diana para la detección del género Leishmania. Debido a su potencial, se recomienda mejorar la sensibilidad del procedimiento y realizar su evaluación en diversas regiones endémicas.

  3. Detección de Leishmania spp. en base al gen que codifica la proteína HSP20

    Directory of Open Access Journals (Sweden)

    Ana M. Montalvo

    2014-12-01

    Full Text Available Objetivos. Explorar una nueva diana para el diagnóstico molecular de Leishmania. Materiales y métodos. Se evaluó la utilidad del gen que codifica la proteína de choque térmico de 20kDa (hsp20 para la detección de Leishmania por medio de la reacción en cadena de la polimerasa (PCR.Se normalizó la PCR y se determinaron los parámetros analíticos, así como la validez y seguridad diagnóstica y la concordancia con la PCR-18S. Se evaluó la PCR-hsp20 con ADN obtenido de un grupo de muestras clínicas de distinta procedencia. Resultados. Los parámetros analíticos resultaron adecuados. La sensibilidad obtenida fue de 86% y la especificidad del 100%, la concordancia con el método de referencia resultó buena (κ = 0,731, lo que apoya su posible uso para el diagnóstico. La posibilidad de identificación posterior de la especie mediante secuenciación del producto amplificado le confiere una ventaja adicional. Conclusiones. Se demuestra la utilidad de este gen como una nueva diana para la detección del género Leishmania. Debido a su potencial, se recomienda mejorar la sensibilidad del procedimiento y realizar su evaluación en diversas regiones endémicas.

  4. Banco de recursos genéticos de Auricularia spp. con fines industriales

    Directory of Open Access Journals (Sweden)

    Edwin Ortiz

    2016-09-01

    Full Text Available La Auricularia spp. presenta amplio potencial industrial debido a sus propiedades nutricionales y medicinales. La obtención de cepas viables y puras de este género se ha visto limitada por una identificación de especies meramente macroscópica y la utilización tanto de medios como técnicas de conservación inadecuados. El objetivo de esta revisión fue describir el proceso de obtención de cepas puras y viables del género Auricularia spp. a partir del medio natural, para resaltar datos técnicos, que faciliten la conformación de bancos de recursos genéticos fúngicos. Estos fungarios constituyen una alternativa para la preservación la biodiversidad fúngica del Ecuador y la obtención de cepas puras y viables. Lo anterior se logra con buenas prácticas de identificación tanto fenotípica como genotípica, de aislamiento en medio selectivos para evitar la inhibición competitiva por otros microorganismos, de conservación y de almacenamiento de especies por congelación, liofilización, repique o inmersión en líquidos inertes como agua o aceite mineral.

  5. Polimorfismos FVII IVS7, FVII R353Q en el gen del Factor VII y FXIII Val34Leu y su asociación con el riesgo de infarto agudo del miocardio en pacientes costarricenses FVII polymorphisms IVS7, FVII R353Q in FVII gene and FXIII Val34Leu and its association with the risk of acute myocardial infartion in Costa Rica Patients

    Directory of Open Access Journals (Sweden)

    Lizbeth Salazar-Sánchez

    2012-12-01

    Full Text Available Resumen Los Niveles aumentados de los factores de la coagulación como el FVII y FXIII se han asociado con infarto agudo del Miocardio (IAM. Los estudios de biología molecular han permitido detectar varias mutaciones en los genes del FVII y FXIII que se han asociado al riesgo de enfermedad coronaria. Métodos: Se estudiaron 186 pacientes que sufrieron infarto agudo del miocardio y 201 controles sanos. Se determinaron los polimorfismos FXIII (Val34Leu; FVII, IV(S7, FVII (R353Q, según las técnicas descritas. Cabe destacar que esta investigación siguió los lineamientos de bioética. Resultados: La edad de los pacientes fue de 46,2 años (147 hombres/39 mujeres, y la de los controles fue de 46 años (141 hombres/ 60 mujeres. La prevalencia de las mutaciones obtenidas tanto en pacientes como controles fue: FVII IVS7 OR: 0,60 (0,26-1,38 p=0,193 y FVIIR353Q OR: 0,81(0,61-1,08 p=0,729; respectivamente. El fenotipo Leu/Leu tiene más elevada prevalencia en los casos controles que en los pacientes infartados, al hacer el ajuste de factores de riesgo cardiovascular, se demostró que este fenotipo es un factor protector para el desarrollo del IAM OR: 0,66(0,47-0,93 p=0,01. Los factores de riesgo tradicionales fueron estadísticamente significativos. En el FVII, y en el FVII IVS se encontraron nuevas variantes (4 y 8, no descritas previamente. Conclusión: El FXIII Val34Leu se presenta como factor protector contra el IAM, y ninguno de los polimorfismos del FVII se encontró asociados como factor de riesgo para IAM. El FXIII Val34Leu ha sido descrito como un facilitador de la activación del factor XIII, durante la fase final de la coagulación, incrementando y acelerando la estabilización de la fibrina, confiriendo más resistencia ante la fibrinólisis. Se incrementan el interés de este polimorfismo en el IAM y en especial para los pacientes que fueran sometidos a terapia antifibrinolítica.Increased levels of coagulation factors such as FVII and

  6. Desarrollo de microarrays de altas prestaciones basados en atrapamiento con un hidrogel. Aplicación a inmunoensayo y ensayos genéticos.

    OpenAIRE

    GUERRERO PICÓ, ISMAEL

    2015-01-01

    [ES] La detección temprana de enfermedades muchas veces se basa en la medición de una o varias proteínas y/o en el análisis genético. El formato microarray es un buen candidato para aplicarlo a los dispositivos de detección porque posee una gran capacidad de trabajo y poco consumo de reactivos y muestra. En este formato la inmovilización del receptor es crucial en las prestaciones del ensayo final. Tradicionalmente, la inmovilización covalente ha sido la mejor considerada, por su robustez...

  7. Síndrome de Down hereditario poco común debido a la translocación robertsoniana 15/21: asesoramiento genético y reproductivo

    OpenAIRE

    Azevedo Moreira, L.M.; Damasceno Espirito Santo, L.; Fernandes Lacerda Carvalho, A.

    2013-01-01

    Los portadores de un reordenamiento que afecta al cromosoma 21 tienen un riesgo potencial de concepciones genéticamente desequilibradas que pueden dar origen a niños con síndrome de Down (SD). Los riesgos reproductivos de las parejas portadoras de una translocación robertsoniana equilibrada dependen de los cromosomas reordenados y del sexo del portador. Este artículo tiene como objetivo analizar la tendencia de segregación y reproductiva de una rara translocación 15/21 en cinco generaciones d...

  8. GenBank blastx search result: AK243655 [KOME

    Lifescience Database Archive (English)

    Full Text Available putative transcriptional activator; similar to cAMP-receptor (CAP, CRP) protein: PIR Access...ion Number A26049; similar to fnr (nirR) gene product encoded by GenBank Accession Number J01608;

  9. GenBank blastx search result: AK242621 [KOME

    Lifescience Database Archive (English)

    Full Text Available putative transcriptional activator; similar to cAMP-receptor (CAP, CRP) protein: PIR Access...ion Number A26049; similar to fnr (nirR) gene product encoded by GenBank Accession Number J01608;

  10. GenBank blastx search result: AK062102 [KOME

    Lifescience Database Archive (English)

    Full Text Available transcriptional activator; similar to cAMP-receptor (CAP, CRP) protein: PIR Access...ion Number A26049; similar to fnr (nirR) gene product encoded by GenBank Accession Number J01608; aspartic

  11. From genetic neighbourhood to local community: Estimating a key parameter of the Unified Neutral Theory of Biodiversity A partir del vecindario genético al vecindario de comunidad: Estimación de un parámetro clave de la Teoría Neutral Unificada de la biodiversidad

    Directory of Open Access Journals (Sweden)

    BARRY J RICHARDSON

    2011-12-01

    la Teoría Neutral Unificada. Avances en el campo de la Teoría neutral de la Genética permiten calcular el tamaño de un vecindario genético en el contexto de aislamiento a través de procesos de distancia, lo cual sugiere una manera de estimar los tamaños equivalentes de una comunidad local (el vecindario de la comunidad ecológica. Ellos se deriva estimando valores de autocorrelación espacial a la distancia geográfica cero, lo cual se obtiene usando la distribución de frecuencias relativas de las especies de las muestras de campos, separadas por distintas distancias geográficas. Para demostrar los métodos propuestos, consistentes muestras de coleópteros fueron colectadas con la fumigación de 52 árboles en bosques de Nothofagus y 24 árboles en bosques de Araucaria, los cuales estaban ampliamente distribuidos en el centro sur de Chile. También se obtuvo un set de datos de 62000 coleópteros para otros propósitos. El tamaño efectivo estimado de las comunidades de coleópteros locales para cada tipo de bosque es alrededor de 12000 individuos para depredadores y 30000 individuos para fitófago/xilófagos. Por otra parte, la extensión geográfica de la comunidad de un barrio puede ser utilizados de otras maneras. En primer lugar, porque se relaciona con la distancia recorrida entre el nacimiento y la crianza, lo que proporciona información sobre los procesos de la comunidad a escala geográfica; entrega medidas de escalas donde la recolonización rápida es posible y escalas en las cuales las sobre que barreras no son fáciles de pasar en un hábitat. En segundo lugar, las réplicas de muestras geográficamente separadas por el tamaño de la comunidad de un barrio, no son independientes, representando pseudoréplicas de la metacomunidad característica.

  12. Modificación del patrón de expresión genética de células madre mesenquimales de origen de pulpa dental humana mediante medio de diferenciación comercial y medio condicionado

    OpenAIRE

    Notario Martín, Eva María

    2016-01-01

    El término de célula madre hace referencia a un tipo de célula que es capaz de diferenciarse a distintos tipos de células. En realidad, por motivos técnicos no se experimenta con las mejores células madre que hay que son las embrionarias y que dada su pluripotencialidad, podrían dar lugar a cualquier tipo de célula de un organismo. Las células madre que tenemos a nuestro alcance son las del adulto o postnatales y son multipotentes, diferenciándose a linajes específicos. Dentro de este grupo, ...

  13. Valor genético estimado y qtl que afecta el porcentaje de sólidos totales en la raza bovina gyr

    Directory of Open Access Journals (Sweden)

    Ariosto Ardila Silva

    2010-12-01

    Full Text Available Además de todos los progresos que ha representado el mejoramiento genético animal clásico, este presenta algunas limitaciones como en algunos casos donde el fenotipo no se expresa en el individuo. Con el advenimiento de las enzimas de restricción, del secuenciamiento y de la amplificación del ADN, fue posible el uso de marcadores moleculares asociados con loci de características cuantitativas (QTL, como herramienta que auxilia y perfecciona el mejoramiento genético animal por medio de la selección asistida por marcadores (MAS, lo que aumenta el mérito genético para características de difícil medida, baja heredabilidad y limitadas por el sexo. La raza bovina gyr se caracteriza por su rusticidad y adaptación al trópico, y presenta una buena producción de leche para los países tropicales, por lo que es fundamental en la conformación de la raza gyrholando (5/8holstein y 3/8 gyr. El propósito del presente estudio fue complementar el análisis cuantitativo con la genética molecular, en el mejoramiento genético de la característica porcentaje de sólidos totales en la razagyr en Brasil. Catorce familias (toros gyr con 657 hijas fueron analizadas, siendo el promedio 0,095 % y la desviación estándar 0,1923 del valor genético estimadopara porcentaje de sólidos totales. Al utilizar 27 marcadores microsatélites en el análisis a travésde las 14 familias para porcentaje de sólidos totales en el cromosoma 6, un QTL fue identificado con P< 0,05 y F = 2,34 en la posición 58 cm, próximo al marcador MNB-208 (60,21 cm. Al emplear las familias3 y 4, las más significativas, el mismo QTL fue identificado con P < 0,01 y F = 7,61, pero en la posición 58 cm, próximo al marcador MNB-208.

  14. RELACIÓN DE LOS NIVELES SÉRICOS DE LÍPIDOS Y LIPOPROTEÍNAS CON EL POLIMORFISMO ε 2, ε 3 Y ε 4 DEL GEN DE LA APOLIPOPROTEÍNA E, EN INDIVIDUOS CON DIABETES MELLITUS TIPO 2 Y EL RIESGO CARDIOVASCULAR

    Directory of Open Access Journals (Sweden)

    N. Coiza-Vargas

    2005-12-01

    Full Text Available Este trabajo describe la respuesta del perfil lipídico según el genotipo de la apolipoproteína E en personas con diabetes mellitus tipo 2 y la presencia o no de riesgo cardiovascular, por medio de la revisión sistemática de artículos científicos publicados entre 1990 y 2003. Seis estudios cumplieron con los criterios de inclusión y fueron seleccionados para realizar el trabajo de investigación.Inicialmente se realizó una descripción de características generales de los estudios y se utilizó la prueba estadística Chi - cuadrado para determinar diferencias entre grupos. Se encontró que el 66.6% de los artículos fueron realizados en Europa, el promedio de personas de los estudios fue de 473 y el promedio de edad estuvo en los 58 años.La distribución del genotipo E 3/3 (78.2%, fue la de mayor prevalencia en los diferentes grupos de diabéticos, seguido de E 4/3 en 12.8% y E 3/2 con un 8.7%. Las fracciones lipídicas más elevadas en los estudios fueron las de colesterol total, colesterol LDL y triglicéridos. Se observó que el polimorfismo de la apo E influye sobre el perfil lipídico, y por tanto, en el desarrollo de la enfermedad cardiovascular en los sujetos con DM tipo 2.

  15. Variabilidad genética en cepas de Sporothrix schenckii aisladas en Abancay, Perú

    Directory of Open Access Journals (Sweden)

    Susan Holechek

    2004-04-01

    Full Text Available Objetivo: Identificar los genotipos de S. schenckii que circulan en 2 distritos de la provincia de Abancay, Perú. Material y Métodos: Se evaluaron 17 cepas procedentes de pacientes con lesiones linfocutáneas y lesión cutánea fija mediante la técnica del ADN Polimorfo Amplificado Aleatorio - Reacción en Cadena de la Polimerasa (RAPD - PCR con el cebador GTG 5 (GTG GTG GTG GTG GTG. Resultados: Identificamos 6 genotipos, siendo el genotipo I el predominante en las áreas de estudio. No se logró asociar los genotipos obtenidos con caracteres clínicos y geográficos. Conclusiones: Nuestros resultados evidencian que existe biodiversidad genética entre las cepas de S. schenckii que circulan en ambas zonas.

  16. The politics of seeing ghosts in Les Chevaliers du Cygne by Madame de Genlis

    Directory of Open Access Journals (Sweden)

    Lesley H. Walker

    2013-09-01

    Full Text Available A travers une analyse des éditions de 1795 et de 1805 des Chevaliers du Cygne ainsi que de la réception du roman, cet essai examine l'espace mouvant de ce moment d'entre-deux, alors que régnait la contingence et que la fin des tribulations n'était pas encore en vue. Avec ce roman, Mme de Genlis cherchait à se mêler de la politique culturelle des années 1793-1795, en regardant en arrière vers un passé glorieux, afin d'aller de l'avant, par-delà la Terreur. Mais, en 1805, le sentiment d'urgence avait disparu, et les fantômes ne demandaient plus à être vus.

  17. Pulcinella tuttofare. Un caso di perdita colmata nel dramma musicale Livlægens besøg di Bo Holten

    Directory of Open Access Journals (Sweden)

    Fabrizio Meraviglia

    2012-12-01

    Full Text Available

    Il paper è incentrato sul dramma musicale Livlægens besøg (2009 del compositore danese Bo Holten, basato sul complesso omonimo bestseller di Per Olov Enquist imperniato sulle vicende del regno danese di Christian VII. Scopo dell’articolo è riuscire a comprendere quale sia la funzione della presenza di Pulcinella nelle scelte registiche della prima messinscena. Per giungere a dei risultati concreti si sono presi in considerazione alcuni studi relativi ai Pulcinella disegnati da Giandomenico Tiepolo, studi nei quali l’iconografia del personaggio comico viene studiata sia da un punto di vista storico-artistico (Bostock sia da un punto di vista prettamente psicologico (Carli. Pulcinella interagisce sull’azione, la maschera gli impedisce la comunicazione mimica del viso ma non quella corporea. La sua funzione è in linea con la lettura psicologica di Carli, secondo la quale Pulcinella rappresenta una sorta di sospensione del giudizio emotivo. Christian è il personaggio che più è legato a Pulcinella, in quanto esso assume un valore metateatrale. Infatti, come emerge dal romanzo di Enquist ma non dal libretto dell’opera, il sovrano era molto attaccato all’arte drammatica e Pulcinella incarna questa sua passione. Pulcinella ha quindi un carattere unificatore all’interno della complessità di Livlægens besøg.

  18. Regulación del ciclo celular y desarrollo de cáncer: perspectivas terapéuticas

    Directory of Open Access Journals (Sweden)

    PERALTA-ZARAGOZA OSCAR

    1997-01-01

    Full Text Available Durante el proceso de transformación de las células normales a células cancerosas, ocurren varias alteraciones genéticas. En este proceso se presenta la pérdida del control de los mecanismos de replicación y reparación del ADN, así como de la segregación del material genético. Aunque las células normales tienen estrategias de defensa contra el desarrollo del cáncer, las células tumorales activan diferentes vías de escape que permiten la progresión de la neoplasia. Avances recientes han permitido enfocar la investigación del cáncer hacia la identificación de algunos de sus factores etiológicos. El estudio del ciclo celular y su regulación han permitido conocer cómo la fidelidad y la integridad de la replicación del genoma son mantenidas por las funciones coordinadas de los puntos de control y de los sistemas de reparación del ADN. El funcionamiento adecuado de estos procesos puede ser alterado por mutaciones genéticas. Estos hallazgos sugieren que los mecanismos moleculares de regulación que participan en la transformación celular pueden ser empleados como sistemas potenciales para instrumentar nuevas terapias contra el desarrollo del cáncer.

  19. New sequestrate fungi from Guyana: Jimtrappea guyanensis gen. sp. nov., Castellanea pakaraimophila gen. sp. nov., and Costatisporus cyanescens gen. sp. nov. (Boletaceae, Boletales).

    Science.gov (United States)

    Smith, Matthew E; Amses, Kevin R; Elliott, Todd F; Obase, Keisuke; Aime, M Catherine; Henkel, Terry W

    2015-12-01

    Jimtrappea guyanensis gen. sp. nov., Castellanea pakaraimophila gen. sp. nov., and Costatisporus cyanescens gen. sp. nov. are described as new to science. These sequestrate, hypogeous fungi were collected in Guyana under closed canopy tropical forests in association with ectomycorrhizal (ECM) host tree genera Dicymbe (Fabaceae subfam. Caesalpinioideae), Aldina (Fabaceae subfam. Papilionoideae), and Pakaraimaea (Dipterocarpaceae). Molecular data place these fungi in Boletaceae (Boletales, Agaricomycetes, Basidiomycota) and inform their relationships to other known epigeous and sequestrate taxa within that family. Macro- and micromorphological characters, habitat, and multi-locus DNA sequence data are provided for each new taxon. Unique morphological features and a molecular phylogenetic analysis of 185 taxa across the order Boletales justify the recognition of the three new genera. PMID:26732137

  20. Banque Cantonale de Genève

    CERN Multimedia

    Banque Cantonale de Genève

    2011-01-01

    7e Salon Immobilier BCGE le samedi 3 septembre 2011, de 8 h 30 à 13 h 00, au Centre de formation de Conches À cette occasion, les meilleurs spécialistes professionnels genevois de l’immobilier seront réunis en un seul et même lieu. Si vous le souhaitez, un conseiller spécialisé dans les financements hypothécaires évaluera vos possibilités d’investissement immobilier adaptées à votre situation personnelle. En parallèle, les plus importantes régies immobilières de Genève seront à votre disposition pour vous présenter leurs offres actuelles, ainsi que les projets immobiliers futurs et discuter avec vous de la meilleure stratégie à adopter pour trouver l’objet de vos rêves. De plus, vous aurez la possibilité...

  1. Relaciones genéticas en localidades de Salta, Argentina: ¿qué reflejan las medidas de distancia?

    Directory of Open Access Journals (Sweden)

    Albeza, María V.

    2010-01-01

    Full Text Available A partir de datos de once STRs autosómicos se calcularon diferentes coeficientes de distancia genética en cinco poblaciones de la provincia de Salta y se elaboraron los dendrogramas correspondientes. Cuando se incorporaron datos de la bibliografía, se amplió el análisis a 16 poblaciones (siete de la provincia y nueve de diferentes regiones del país, reduciéndose a 9 el número de loci comunes utilizados en la estimación de las diferentes medidas de distancia. Las representaciones gráficas no reflejaron las vinculaciones esperadas en función de sus proximidades geográficas, pues hubo una amplia gama de asociaciones, reflejando inconsistencias mutuas. De acuerdo al test de Mantel, no existe correlación con la matriz de distancia geográfica en cada caso (0,23 < r < 0,40 con niveles de significación que variaron entre 0,22 y 0,98, por lo que las distancias genéticas no tuvieron relación con la proximidad geográfica entre poblaciones. Tampoco existió correlación entre STRs y otros marcadores genéticos para localidades de la provincia (r = 0,10163; t = 2,3918, p = 0,9916

  2. Estado de las prácticas ambientales de las empresas del sector del empaque y embalaje en Colombia en el año 2012. Retos para la construcción de un futuro sostenible.

    OpenAIRE

    Rafael Alejandro Piñeros Espinosa; Juan David Rubio Ramos; Gustavo Adolfo Ortiz Garzón

    2013-01-01

    Este estudio presenta una breve descripción del panorama mundial en la dimensión ambiental del empaque, iniciando con una contextualización de la ética y responsabilidad social empresarial. Posteriormente desarrolla un modelo de acuerdo a los principios del Sello Ambiental Colombiano “SAC”, que permite describir de forma genérica, el estado de las prácticas ambientales de las empresas del sector del empaque y embalaje en Colombia durante el año 2012. Finalmente presenta, discute y analiza las...

  3. Tetralogía de Fallot asociada a duplicación distal del brazo largo del cromosoma 11

    Directory of Open Access Journals (Sweden)

    Elodia Torres

    2015-04-01

    Full Text Available La tetralogía de Fallot es una cardiopatía frecuente y puede representar hasta el 11 al 13% de todas las cardiopatías congénitas clínicas, se presenta en 1 de cada 8.500 nacidos vivos. En la mayoría de los casos, se asocia a una microdeleción del cromosoma 22 y con menor frecuencia al síndrome de Down. El síndrome de la dup 11q es una anomalía cromosómica causada por la duplicación de la porción distal del extremo del brazo largo del cromosoma 11, ocasionando una trisomía parcial del mismo, producto de un desbalance cromosómico, con disfunción de los genes involucrados en este material genético adicional que ocasiona anormalidades tanto físicas como mentales en un recién nacido. Se presenta el caso de un niño de 3 meses de vida que es derivado a la consulta genética por fenotipo sindromático, Tetralogía de Fallot y retraso del crecimiento. El estudio citogenético se realizó en sangre periférica, los cromosomas fueron procesados con técnicas de tinción convencional, bandas de alta resolución y centroméricas, observándose una duplicación 11q. Cariotipo: 46, XY, dup11 (q23àqter. Se enfatiza la importancia del estudio cromosómico en recién nacidos con malformaciones congénitas mayores para el diagnóstico de certeza y posterior asesoramiento genético a los progenitores.

  4. Organización espacial y funcional del genoma en células aneuploides

    OpenAIRE

    Paz Gandiaga, Nerea

    2014-01-01

    198 p. El genoma se encuentra altamente organizado en el espacio nuclear de las células eucariotas. Los cromosomas y los genes ocupan una posición preferente respecto del centro o de la periferia del núcleo, y respecto de otros elementos genéticos. En la actualidad se cuenta con un volumen importante de evidencias que apoyan la noción que la organización espacial del genoma tiene influencia sobre la función del mismo y viceversa. Variaciones en el número y estructura de los cromosomas ...

  5. Sincronización del ciclo celular en una línea celular modelo para ensayo de gene targeting

    OpenAIRE

    Velázquez Gómez, Miguel

    2014-01-01

    La terapia génica es una campo de la biomedicina que incluye distintas técnicas orientadas a la cura de enfermedades basadas en errores en el genoma, ya sea por ausencia del gen o por pérdida de su función, a través del envío del material genético corrector (RNA, DNA) al interior de células diana, en las cuales se integra y corrige el fallo. La terapia génica puede orientarse al tratamiento de células germinales o somáticas. La modificación genética de células destinadas a generar espermat...

  6. La crisis latente del Darwinismo

    Directory of Open Access Journals (Sweden)

    Abdalla, Maurício

    2006-06-01

    Full Text Available In this article I will be analyzing the Darwinist paradigm in the biological science, discussing its capacity to give satisfactory understanding of the new data from biochemistry, microbiology and genetics. The general aim of this analysis is to contribute for the debate about the statute of the scientific theories. Its specific aim is to reflect upon a possible crisis of the Darwinist paradigm, which could corroborate the conception of scientific theories as something historically transitory, and not as definitive discoveries.

    El presente artículo analiza el paradigma darwinista en las ciencias biológicas a partir de la pregunta sobre su capacidad de explicar satisfactoriamente los nuevos datos obtenidos de la bioquímica, la microbiología y la genética. El objetivo general del análisis es contribuir con una discusión acerca del estado de las teorías científicas y el objetivo específico es reflexionar sobre una posible crisis del paradigma darwinista, lo que corroboraría la concepción de las teorías científicas como algo históricamente transitorio y no como descubrimientos definitivos.

  7. Características morfométricas, genéticas, alimenticias y vectoriales de Panstrongylus herreri procedentes de Jaén (Cajamarca) y Cajaruro (Amazonas), Perú

    OpenAIRE

    Jenny Ancca; Jesús Pinto; Silvia Vega; Abraham G. Cáceres; Cesar Náquira

    2008-01-01

    Objetivo. Comparar las características morfológicas, alimenticias y genéticas de dos poblaciones de Panstrongylus herreri, de los distritos de Jaén (Cajamarca) y Cajaruro (Amazonas). Materiales y métodos. Se colectó especímenes adultos de P. herreri, 42 (Jaén) y 68 (Cajaruro). Se utilizó la morfometría geométrica para evaluar el dimorfismo sexual de tamaño y conformación. El perfil genómico se realizó por amplificación del espaciador interno transcrito del ADNr (ITS-2). La amplificación del e...

  8. Los usuarios ante los alimentos genéticamente modificados y su información en el etiquetado

    Directory of Open Access Journals (Sweden)

    Miren Itxaso Sebastian-Ponce

    2014-02-01

    Full Text Available OBJETIVO : Analizar la opinión que los usuarios tienen sobre alimentos genéticamente modificados y su información en el etiquetado. MÉTODOS : Realizada revisión sistemática de la literatura científica sobre los alimentos transgénicos y el etiquetado a partir de la consulta de las bases de datos bibliográficas: Medline (vía PubMed, EMBASE, ISI-Web of Knowledge, Cochrane Library Plus, FSTA, LILACS, CINAHL y AGRICOLA. Los descriptores seleccionados fueron: «organisms, genetically modified » y «food labeling». La búsqueda se realizó desde la primera fecha disponible hasta junio de 2012, seleccionando los artículos pertinentes escritos en inglés, portugués y castellano. RESULTADOS : Se seleccionaron 40 artículos. En todos ellos, se debía haber realizado una intervención poblacional enfocada al conocimiento de los consumidores sobre los alimentos genéticamente modificados y su necesidad, o no, de incluir información en el etiquetado. El consumidor expresa su preferencia por el producto no-genéticamente modificado, y apunta que está dispuesto a pagar algo más por él, pero, en definitiva compra el artículo que está a mejor precio en un mercado que acoge las nuevas tecnologías. En 18 artículos la población se mostraba favorable a su etiquetado obligatorio y seis al etiquetado voluntario; siete trabajos demostraban el poco conocimiento de la población sobre los transgénicos y, en tres, la población subestimó la cantidad que consumía. En todo caso, se observó la influencia del precio del producto genéticamente modificado. CONCLUSIONES : La etiqueta debe ser homogénea y aclarar el grado de tolerancia en humanos de alimentos genéticamente modificados en comparación con los no modificados. Asimismo, debe dejar claro su composición, o no, de alimento genéticamente modificado y la forma de producción de estos artículos de consumo. La etiqueta también debe ir acompañada de un sello de certificación de una agencia

  9. DNA Barcode, una alternativa para identificar especies del Complejo Midas Chichlidae en Nicaragua

    Directory of Open Access Journals (Sweden)

    Lucia Páiz Medina

    2008-04-01

    Full Text Available EL COMPLEJO MIDAS CICHLIDAE (especies del género Amphilophus ha sido objeto de discusión entre diferentes grupos de científicos debido a que desde los primeros intentos de su clasificación taxonómica presentó problemas dada la similitud morfológica entre especies del Complejo. Inicialmente se pensó que era solamente una especie polimórfica pero, luego de realizar diferentes estudios, se sabe queson diferentes especies. DNA Barcode (Código de Barras genético es una técnica moderna que se está implementando en el Centro de Biología Molecular, y que pretende identificar las diferentes especies del Complejo Midas Ciclhidae utilizando una secuencia relativamente corta del gen mitocondrial COI.

  10. Identificación genética de subpoblaciones de aedes aegypti en Cartagena de Indias – Colombia

    Directory of Open Access Journals (Sweden)

    Malambo Dacia

    2011-09-01

    Full Text Available INTRODUCCIÓN: el mosquito Aedes aegypti es el principal vector de la fiebre Dengue (FD en ambientes urbanos y suburbanos enpaíses tropicales y subtropicales. Se estima que la FD infecta 50 millones de personas anualmente y más de quinientas milcontraen su forma más grave (PAHO 2008; Romano, 2010. En Colombia se notificaron 127.292 casos, 8.919 de dengue grave y 138muertes. El estudio de la variabilidad genética de una población de Ae. Aegypti permite identificar sub-poblaciones a través delespacio geográfico. Tal variación genética se ha relacionado con una expresión heterogénea en la capacidad vectorial del insectofrente a la FD debido a procesos de selección sobre serotipos virales circulantes aun a escala local.OBJETIVO: describir la variabilidad genética de Ae. Aegypti en Cartagena de Indias.MÉTODOS: estudio de corte transversal mediante un muestreo aleatorio por conglomerados que incluyó las 15 comunasadministrativas del distrito. 6300 viviendas fueron inspeccionadas mediante el protocolo de vigilancia entomológica dirigido alarvas de Ae. Aegypti. La implementación de las pruebas moleculares se realizó sobre 260 insectos de 36 sitios geográficosseleccionados al azar. La extracción del DNA genómico fue realizado mediante el método CTAB. La prueba RAPD PCR empleó losoligonucleótidos iniciadores: TTGCACCAACAGTCAATGTCTTCAGGTTC, CGTCTCAGTGATCCGGGGG y CGCCACAAGGGCCATGAACAG. Se realizó una electroforesis a los productos de amplificación RAPDs en un gel de agarosa al 1%, el cual fue conbromuro de etídio y fotodocumentado bajo luz UV. Las bandas obtenidas fueron asimiladas en una matriz binaria. Fueronutilizadas 1000 réplicas para obtener una matriz de distancia utilizando el paquete PHYLIP. El análisis filogenéticos se realizómediante el método de Neighbor-Joining y la visualización del árbol de consenso mediante el programa Tree view.RESULTADOS: 1361 viviendas fueron positivas a larvas del mosquito. Los perfiles

  11. EVALUACIÓN DE GENOTIPOS DE Lycopersicon esculentum Mill. FRENTE AL VIRUS DEL ENCRESPAMIENTO AMARILLO DE LA HOJA DEL TOMATE (TYLCV

    Directory of Open Access Journals (Sweden)

    F. Dueñas

    2006-01-01

    Full Text Available El virus del encrespamiento amarillo de la hoja del tomate (TYLCV constituye uno de los mayores factores limitantes del cultivo del tomate en Cuba. La obtención de genotipos con niveles de resistencia es una de las soluciones más atractivas para la producción, por la amenaza de esta enfermedad viral para el rendimiento de este cultivo. En el Instituto Nacional de Ciencias Agrícolas (INCA se comenzó un programa de mejora genética de sus variedades comerciales, con la incorporación del gen de resistencia (Ty-1 a TYLCV a partir de la variedad resistente Vyta. Se realizaron cruzamientos entre la variedad resistente Vyta y las variedades susceptibles Amalia, Mariela, Mara, Inifat-28 e Inca-33, a cuya descendencia híbrida, F1, se le hizo el diagnóstico del virus (molecular y no molecular, así como la evaluación agronómica a estos, a los genotipos parentales, al híbrido HA-3019 y a la variedad Campbell-28, estos últimos utilizados como control resistente y susceptible respectivamente. Los resultados del diagnóstico corroboraron el carácter resistente de la variedad Vyta ante la enfermedad, el buen comportamiento de los híbridos derivados de esta así como del híbrido HA 3019, la susceptibilidad de las variedades comerciales y de la variedad Campbell-28.La combinación de los resultados del diagnóstico y las evaluaciones agronómicas permitieron seleccionar a los híbridos Mara x Vyta y Mariela x Vyta como promisorios para la continuación del programa de mejora genética a TYLCV que se desarrolla en el INCA.

  12. EFECTO DE LA EXPRESIÓN ECTÓPICA Y DEL SILENCIAMIENTO DE eIF3f EN CÉLULAS DE ADENOCARCINOMA PULMONAR HUMANO (A549)

    OpenAIRE

    Higareda Mendoza, Ana Edith

    2012-01-01

    El presente trabajo consiste en alterar, a través de su silenciamiento y sobre-expresión, la función del gen eIF3f (subunidad f del factor eucarióntico de iniciación 3) y evaluar su efecto celular. El gen eIF3f forma parte del complejo multiproteico eIF3, el cual tiene una función importante en el inicio de la traducción (Benne y Hershey 1978). Originalmente se observó que la expresión transcripcional del gen eIF3f de frijol (Phaseolus vulgaris) estaba relacionada a la división...

  13. Jurados ciudadanos y organismos genéticamente modificados

    Directory of Open Access Journals (Sweden)

    Luque, Emilio

    2005-04-01

    Full Text Available Apolitical sociology of food must look into the processes whereby regulatory decisions on food are made, and also into the democratic potential of their alternatives. Five "experiments in democracy" are described, in which a promising deliberative device has been used: citizens' juries. Indian and Brazilian peasants, on the one hand, and British consumers in the other took part in them, and they focused on Genetically Modified Organisms. These processes, whose defining trait is granting jurors access to expert witnesses presented by all stakeholders in the controversy, show the impressive ability of ordinary citizens to articulate their analysis of complex issues, a reassessment of risks, and a recontextualization of the use of GMOs. At any rate, deliberative democracy is not a magic bullet for the epistemic and political crisis that underlies food crisis; instead, it points at a paradigm change towards an experimental democratic polity in which the instances of representation of the public and publics are multiplied.

    Una sociología política de la alimentación debe analizar los procesos a través de los cuales se alcanzan las decisiones de regulación y control alimentario y examinar el potencial de sus alternativas. Se describen aquí cinco experimentos democráticos en los que se ha empleado uno de los dispositivos deliberativos más prometedores en condiciones de alta complejidad cognitiva, los llamados jurados ciudadanos, con la participación de campesinos hindúes y brasileños y consumidores británicos, y centrados en los Organismos Genéticamente Modificados. Estos procesos, caracterizados por el acceso de los miembros del jurado a testigos expertos presentados por los distintos participantes en la controversia, muestran la enorme capacidad de los ciudadanos "de a pie" para articular el análisis de un problema complejo, reevaluar sus riesgos y recontextualizar el uso de los OGM. En todo caso, la democracia deliberativa no es

  14. Propuesta de consulta para desregulación de alimentos derivados de cultivos genéticamente mejorados, desarrollados en Costa Rica Request for consultation for deregulation of foods derived from genetically enhanced crops developed in Costa Rica

    OpenAIRE

    M-Eugenia Villalobos Hernández; Ana M Espinoza Esquivel

    2009-01-01

    Objetivo: Proponer un proceso de desregulación de alimentos derivados de cultivos genéticamente mejorados desarrollados en Costa Rica, plantea un trámite a la Consulta de desregulación de un nuevo alimento desarrollado por ingeniería genética, labor que le competerá al Ministerio de Salud principalmente. Material y Métodos: La propuesta incluye procedimientos de iniciar la Consulta, conformación del equipo de evaluadores, información que se solicita en el dossier sobre alimentos derivados de ...

  15. del Nim

    Directory of Open Access Journals (Sweden)

    Arturo Martínez Rodríguez

    2007-01-01

    Full Text Available Dado su uso específico como fuente de insecticidas naturales de fácil biodegradación, entre otras ventajas, el cultivo del árbol Nim ha sido mundialmente extendido en muchas regiones de Asia, África, Australia y América Latina, incluyendo Cuba. La cosecha del fruto del Nim se hace engorrosa debido a la altura que adquieren estos árboles a los pocos años de sembrados, siendo la cosecha mecánica mediante sacudidores de ramas o del tronco, una posible vía de solución práctica de esta problemática. En el presente trabajo se efectúa, mediante la simulación con el empleo de herramientas CAD-3D y programas de análisis por elementos finitos, un análisis modal abarcador de un número importante de modos de vibración del sistema fruto-pedúnculo del Nim. Como resultado del estudio se pudieron recomendar entornos de frecuencias de las vibraciones a aplicar con mejores expectativas durante la cosecha mecanizada de este producto.

  16. Expresión del factor de transcripción SOX11: Su implicancia en el linfoma de células del manto

    Directory of Open Access Journals (Sweden)

    Alejandro Roisman

    2014-04-01

    Full Text Available El gen SOX11, perteneciente a la familia de genes SOXC, es un factor de transcripción involucrado en la neurogénesis embrionaria y el remodelado tisular, participando asimismo en el control de la proliferación celular. Su rol en la linfomagénesis es desconocido. Estudios recientes han mostrado expresión proteica nuclear aberrante y sobreexpresión de los niveles de transcripto de SOX11 en pacientes con linfoma de células del manto (LCM. Si bien la mayoría de estos linfomas presentan un curso clínico agresivo, existe un subgrupo de pacientes con enfermedad indolente, sugiriendo una mayor heterogeneidad de esta patología. Actualmente, existen contradicciones respecto de la asociación entre la expresión del gen SOX11 y la evolución clínica del LCM; mientras algunos autores relacionan la ausencia de expresión de SOX11 con buen pronóstico, otros lo encuentran asociado a un curso clínico adverso. Esta diferencia en la expresión estaría relacionada a mecanismos epigenéticos, metilación del ADN y modificaciones a nivel de histonas, que permitirían la expresión aberrante de este gen en algunas neoplasias linfoides, incluyendo LCM. La profundización del conocimiento del gen SOX11 en LCM hará factible, sin duda, lograr una mayor comprensión de los mecanismos involucrados en la patogénesis y/o progresión de este linfoma, así como del rol de SOX11 en estos procesos.

  17. Factores genéticos que inciden en la resistencia a enfermedades infecciosas en salmónidos y su aplicación en programas de mejoramiento Genetic factors involved in resistance to infectious diseases in salmonids and their application in breeding programmes

    OpenAIRE

    JM Yáñez; Martínez, V.

    2010-01-01

    El control de las enfermedades infecciosas es fundamental en el éxito del cultivo del salmón. El mejoramiento genético de la resistencia a enfermedades puede otorgar una opción factible y sustentable para el control de éstas. La Selección Asistida por Marcadores Moleculares (MAS) o Genes (GAS) se proyecta como una valiosa alternativa al mejoramiento convencional de la resistencia. Sin embargo, para implementar esta metodología es necesario el conocimiento previo de los factores genéticos invo...

  18. El papel de la genética en la aparición y desarrollo de la periodontitis: II: Polimorfismos asociados a la enfermedad periodontal The role of genetics in the development and progression of periodontitis: II: Polymorphism associated to periodontal disease

    OpenAIRE

    D. Rodrigo-Gómez; A Oteo-Calatayud; A Alonso-Rosado; A Bascones-Martínez

    2008-01-01

    La periodontitis es una enfermedad multifactorial que resulta de la interacción de bacterias periodontopatógenas con los mecanismos de respuesta inmune del huésped y que se caracteriza por una reacción inflamatoria que afecta al aparato de inserción del diente. Las enfermedades multifactoriales habitualmente envuelven complejas interacciones de muchos genes y factores ambientales. El tipo de variaciones genéticas involucradas en este tipo de enfermedades se denominan polimorfismos genéticos, ...

  19. Vocabulario b??sico del genoma humano

    OpenAIRE

    Institut Universitari de Ling????stica Aplicada

    2010-01-01

    El proyecto Vocabulario del genoma humano (Biotecnolog??a 2), aprobado el a??o 2003 en la reuni??n plenaria de REALITER, incorpora la terminolog??a b??sica m??s usual en textos de gen??mica. Presenta entradas seleccionadas en ingl??s y equivalentes en castellano peninsular, espa??ol de Am??rica, franc??s, italiano, gallego, portugu??s y catal??n. Adem??s de la informaci??n sobre equivalentes, los usuarios podr??n encontrar informaci??n gramatical y sin??nimos documentados como variantes en ca...

  20. Description of Cellulophaga baltica gen. nov., sp. nov. and Cellulophaga fucicola gen. nov., sp. nov. and reclassification of [Cytophaga] lytica to Cellulophaga lytica gen. nov., comb. nov.

    Science.gov (United States)

    Johansen, J E; Nielsen, P; Sjøholm, C

    1999-07-01

    Phenotypic data indicate that gliding, yellow/orange-pigmented, agar-digesting bacterial strains were members of the Cytophaga-Flavobacterium-Bacteroides (CFB) group. The strains were isolated from the surface of the marine benthic macroalga Fucus serratus L. and the surrounding seawater at three localities in Danish waters. The bacteria were Gram-negative, flexirubin-negative, aerobic, catalase-positive and oxidase-negative and were psychrophilic and halophilic. All strains utilized D-fructose, L-fucose and alpha-ketobutyric acid and degraded alginic acid, carrageenan, starch and autoclaved yeast cells. Amplification with primers specific for repetitive extragenic palindromic elements by PCR divided the strains of this study into two groups. Both groups showed unique PCR amplification patterns compared to reference strains of the CFB group. Phylogenetic analysis of 16S rDNA sequences showed association of these organisms and [Cytophaga] lytica at the genus level. Hybridization of total chromosomal DNA revealed that the new strains and [Cytophaga] lytica ATCC 23178T were clearly distinct from each other and other previously described species of the CFB group. A new genus is described, Cellulophaga gen. nov. comprising two new species, Cellulophaga baltica gen. nov., sp. nov. (NN015840T = LMG 18535T) and Cellulophaga fucicola gen. nov., sp. nov. (NN015860T = LMG 18536T), as well as the emendation of [Cytophaga] lytica to Cellulophaga lytica gen. nov., comb. nov. PMID:10425785

  1. Genetic analysis of greenbug populations of Schizaphis graminum (Hemiptera: Aphididae from Argentina and Chile based on enzyme variability Análisis genético de las poblaciones del pulgón verde Schizaphis graminum (Hemiptera: Aphididae, colectadas en Argentina y Chile, basado en su variabilidad enzimática

    Directory of Open Access Journals (Sweden)

    Luciana Saldúa

    2011-06-01

    menor que la esperada. Ningún alelo fue fijado, de acuerdo con el valor del Fsr. El primer grupo tuvo un ligero exceso de heterocigosis, mientras que los demás grupos mostraron valores ligeramente positivos de Fsr, debido al exceso de homocigosis. Con respecto a Frt, el tercer grupo mostró un valor alto que estuvo en concordancia con el alto valor de flujo génico. Tres poblaciones no pudieron ser incluidas en ningún grupo. Las α-carboxil- estearasas siempre estuvieron presentes incluso en clones y poblaciones colectadas en zonas no agrícolas, lo que implica que la resistencia a insecticidas está ampliamente extendida a lo largo del territorio argentino y chileno. No se encontró relación entre el patrón enzimático y el biotipo, así como tampoco con la especie hospedera de donde fueron colectados los áfidos.

  2. Microsatélites amplificados al azar (RAM en estudios de diversidad genética vegetal

    Directory of Open Access Journals (Sweden)

    Jaime Eduardo Muñoz Flórez

    2008-12-01

    Full Text Available Se revisó el uso e importancia, ventajas, desventajas y características de la técnica Microsatélites Amplificados al Azar (RAM en uchuva Physalis peruviana, mora Rubus spp, guayaba Psidium guajava y heliconias Heliconia spp. En mora se diferenciaron las especies R. glaucus, R. robustus y R. urticifolius, se detectaron duplicados y se encontró alta variabilidad genética en R. glaucus, la especie más importante. En uchuva se encontró alta diversidad y dos accesiones de fruto rojo que se diferenciaron genéticamente de las amarillas y una región geográfica con alta variabilidad. En guayaba los cebadores fueron altamente polimórficos y se encontró alta variabilidad en el Valle del Cauca. En heliconias y especies relacionadas se diferenciaron las familias del orden Zingiberales, algunos subgéneros y variaciones en la especie. La técnica es de bajo costo, utiliza un cebador, no requiere información previa, es altamente polimórfica y diferencia especies en los taxones evaluados.

  3. Modelos de regresión aleatoria para la estimación de funciones de covarianza, parámetros genéticos y predicción de valores genéticos en una población bovina multirracial bos indicus-bos taurus en colombia

    OpenAIRE

    Martínez, Carlos Alberto; Elzo, Mauricio; Manrique, Carlos; Grajales, Luis Fernando; Jiménez, Ariel

    2011-01-01

    En este trabajo presentamos una aplicación de modelos de regresión aleatoria (RRM) para obtener estimadores de máxima verosimilitud restringida de funciones de covarianza y predicciones del valor genético para datos longitudinales de área de ojo del lomo medidos por ultrasonido (REA) en una población bovina multirracial en Colombia. El conjunto de datos contenía 708 registros de 340 animales descendientes de 37 toros de 9 razas apareados con hembras Brahman Gris. Los modelos mixtos empleados ...

  4. El papel de la genética en la aparición y desarrollo de la periodontitis: I: evidencias científicas de la asociación entre periodontitis y genética The role of genetics in the development and progression of periodontits: I: evidence of the association between periodontitis and genetics

    OpenAIRE

    D. Rodrigo-Gómez; A Oteo-Calatayud; A Alonso-Rosado; A Bascones-Martinez

    2007-01-01

    La periodontitis es una enfermedad multifactorial que se caracteriza por una reacción inflamatoria que afecta al aparato de inserción del diente. Esta inflamación es consecuencia de la interacción de ciertas bacterias con los mecanismos de respuesta inmune del huésped. Mientras que la infección es un requisito necesario para la aparición de la periodontitis, su curso y severidad depende de un número variable de determinantes ambientales, conductuales y genéticos. Se ha constatado que los indi...

  5. Análisis ultraestructural de la formación ósea en relación con el OsteoGen®

    Directory of Open Access Journals (Sweden)

    C. López Valenzuela

    2002-04-01

    Full Text Available El OsteoGen®, ha sido profusamente utilizado como material osteoconductor en cirugía periodontal. Sin embargo las características estructurales de la interfase y del hueso neoformado han sido escasamente evaluadas en el ser humano. Con el objeto de estudiar la calidad de la reparación ósea alrededor de OsteoGen®, se injertó el material en defectos óseos de dos pacientes . Las biopsias fueron tomadas a los 6 y 12 meses y procesadas para microscopía optica ( MO y electrónica de transmisión ( MET . Los resultados con MO a los seis meses demuestran una clara osteoconducción, lo que se hace notorio a los doce meses practicamente para todas las partículas.OsteoGen®, has been widely used as osteoconductor material in periodontal surgery. Neverthelees the structural characteristic of the interfase and neoformated bone have scarcely assessed in human being. In order to be able to study the quality of the bone repairing around OsteoGen®, the material was grafted in bone defects in two patients. The biopsies were taken after 6 months and 12 months and processed for optical microscopy (mo and electronic transmission (met. The results with mo after 6 months show a clear osteoconduction, which is noticiable at 12 months in practically all the particles.

  6. Condiciones legales y administrativas para la secuenciación del genoma humano en el ámbito militar

    OpenAIRE

    J. Bobo-Ruiz

    2015-01-01

    La Genómica trae nuevas cuestiones jurídicas además de profundizar aquellas que ya se plantearon desde la Genética molecular. La secuenciación completa del genoma humano ha pasado de requerir los esfuerzos económicos de un consorcio internacional a ser asequible por el ciudadano medio. Este cambio revolucionario también afecta a las administraciones exigiendo un replanteamiento del status jurídico de las bases de datos con fines de investigación biomédica y de las de ADN policiales y su posib...

  7. Potencial del agua del suelo

    OpenAIRE

    Bustamante Heliodoro

    2012-01-01

    La energía potencial del agua presenta diferencias de un punto del suelo a otro; esas diferencias son las que originan el movimiento del agua de acuerdo a la tendencia universal de la materia en el sentido de moverse de donde la energía potencial es mayor a donde dicha energía es menor. En el suelo el agua en consecuencia se mueve hacia donde su energía decrece hasta lograr su estado de equilibrio. Se desprende entonces que la cantidad de energía potencial absoluta contenida en el agua, no es...

  8. Diversidad genética de la población colombiana de ganado Cebú Brahman Americano Bos Indicus (Bovidae

    Directory of Open Access Journals (Sweden)

    Novoa Bravo Miguel Adriano

    2006-12-01

    Full Text Available La raza Cebú Brahman Americano se encuentra en Colombia alrededor de 100 años. Todo ese tiempo, esta raza ha estado bajo un proceso continuo de selección artificial dirigida, reproducción endogámica, efectos de deriva genética causados por eventos fundadores, migraciones de ejemplares entre las fincas del país y animales importados desde otros países. Estos hechos hacen a esta raza interesante y particular desde el punto de vista de la genética de poblaciones. El objetivo de este trabajo es estudiar la estructura y diversidad genética de la raza Cebú Brahman americano. Se utilizaron 162 animales registrados en la asociación colombiana de criadores de ganado cebú (ASOCEBU de 20 departamentos de Colombia. La genotipificación de los animales se llevó a cabo con el kit StockMarks® for cattle bovine genotyping de Applied Biosystems®, empleando 10 microsatélites dinucleótidos. Los resultados de los distintos análisis multivariados (Análisis de componentes principales y análisis de correspondencias múltiples, de inferencia bayesiana y distancias genéticas interindividuales, demuestran que no se presenta subestructura en la población, lo cual se explica por una alta tasa de migración de animales entre las diferentes fincas y regiones, que homogeniza las frecuencias en todo el país. Además, esta población posee un alto grado de heterocigocidad y diversidad alélica, comparado con otras razas, lo cual refleja su origen de mezcla multiracial. También se encontraron diferencias genéticas entre sexos, lo cual es causado por un proceso reproductivo diferencial, donde actúan diferentes criterios de selección entre sexos. Finalmente, al realizar un análisis de componentes principales para analizar las relaciones genéticas de Cebú Brahman americano colombiano con las razas cebuinas y taurinas, se determinó que esta raza se diferencia genéticamente de las demás razas cebuinas, debido a un aporte genético de razas taurinas

  9. Prevalencia de delgadez en poblaciones de altura del Noroeste Argentino

    OpenAIRE

    Dipierri, José Edgardo; Bejarano, Ignacio; Lomaglio, Delia Beatriz; Alfaro Gómez, Emma Laura; Marrodán, María D.; Mesa Saturnino, María Soledad; Moreno Romero, Susana

    2009-01-01

    En países en vías de desarrollo se observa la coexistencia de desnutrición y obesidad y en poblaciones adolescentes un incremento de trastornos alimentarios (anorexia/bulimia). El tamaño, forma y composición corporal están condicionados por múltiples factores genéticos y ambientales, entre los cuales en las poblaciones del NOA, se destaca la altura y la hipoxia asociada a la misma. Se analiza la prevalencia de delgadez en poblaciones del NOA localizadas a distinto niveles altitudinales. Los d...

  10. GENÉTICA DEL COMPORTAMIENTO: ABEJAS, un ejemplo.

    Directory of Open Access Journals (Sweden)

    Nates Parra Guiomar

    2011-12-01

    Full Text Available El concepto de que el comportamiento de los animales esta determinado genéticamente no es nuevo si se considera que ya Darwin en su famosa obra El origen del hombre, en 1871 mencionaba que… “los rasgos del temperamento de los animales son heredados”. Pero solo hasta hace casi 50 años fue que la genética del comportamiento surgió como una especialidad importante dentro de la Genética; desde esa época muchos son los avances que refuerzan la idea generalmente aceptada de que todos los patrones comportamentales están determinados por componentes tanto ambientales como genotípicos. El análisis del control genético de un determinado comportamiento es complicado por el hecho de que las acciones primarias de un gene pueden afectar: 1. Los órganos sensoriales, cambiando la información recibida. 2. Sistemas intermedios (nervioso, endocrino, alterando capacidades de coordinación y percepción y 3. Órganos efectores, alterando la respuesta. Las mutaciones inducidas, que bloquean o alteran los patrones normales de comportamiento, proporcionan una herramienta muy útil para entender como los genes influencian la conducta (Hall et al, 1982. Al respecto hay muchos ejemplos, cuyo conocimiento ha servido para controlar o seleccionar caracteres indeseables o deseables (respectivamente, importantes para el mejoramiento en algunas especies animales. Por ejemplo, con la llegada de la abeja africanizada a América del Sur (Brasil,1958 (Kerr, 1967 llegaron también varios inconvenientes generados por el fuerte comportamiento defensivo de la nueva subespecie introducida (Apis mellifera scutellata , lo cual hizo que se iniciaran programas de investigación tendientes a conocer la biología y el comportamiento de la nueva especie introducida, de manera que se pudieran establecer cepas de abejas menos defensivas, conjuntamente con otras características como productividad o comportamiento higiénico. El establecimiento de las bases

  11. Respuesta mecánica del grafito bajo condiciones extremas

    OpenAIRE

    Corro García, Elena del

    2011-01-01

    Nuestro interés fundamental es conocer la respuesta del grafito bajo condiciones extremas de estrés; aunque queda claro que, para ello, necesitaremos desarrollar nuevas metodologías de análisis o mejorar las existentes. Por ello, nos planteamos los dos grandes objetivos genéricos. En primer lugar, estudiar el comportamiento elástico de los yunques utilizados para generar el estrés, zafiro y moissanita, tanto en la superficie del yunque, que estará en contacto con la muestra, como a lo largo d...

  12. Identidad biocultural de las poblaciones del Noroeste Argentino (NOA)

    OpenAIRE

    Alfaro Gómez, Emma Laura

    2005-01-01

    La identidad de un individuo y también de una población puede analizarse a través de apellidos, marcadores moleculares y la asociación entre ambos. Históricamente, el NOA ha visto afectada la distribución de la variación genética de sus poblaciones, resultado del mestizaje entre grupos autóctonos y poblaciones alóctonas principalmente españoles y en menor medida africanos. Para reconstruir la identidad biocultural de las poblaciones del NOA se analizan datos censales, distribución y frecuenci...

  13. Genetic Analysis of Relative Cell Injury Percentage and Some Yield Contributing Traits in Wheat Under Nomral and Heat Stress Conditions Análisis Genético del Porcentaje Relativo de Daño celular y algún Rasgo que Contribuye al Rendimiento en Trigo bajo Condiciones Normales y de Estrés Térmico

    Directory of Open Access Journals (Sweden)

    Jehanzeb Farooq

    2011-12-01

    Full Text Available Several wheat genotypes were screened against heat stress. Seven wheat (Triticum aestivum L. cultivars obtained after screening against heat classified as tolerant, moderately tolerant, and susceptible to heat stress, were mated in a complete diallel mating system to study the inheritance pattern of relative cell injury percentage (cell injury % and some yield contributing parameters under normal and heat stress conditions. Significant genotypic differences were found (P Varios genotipos de trigo se discriminaron para estrés térmico. De ellos siete cultivares de trigo (Triticum aestivum L. incluyendo tolerantes, moderadamente tolerantes, y susceptibles a estrés térmico obtenidos después de discriminar con calor se aparearon en un sistema de apareamiento de dialelo completo para estudiar el patrón de heredabilidad del porcentaje de daño celular relativo (daño celular % y algunos parámetros que contribuyen al rendimiento bajo condiciones normales o de estrés térmico. Se encontraron diferencias genotípicas significativas (P < 0.01 para todos los rasgos estudiados bajo ambas condiciones. Pruebas de ajuste revelaron adecuación parcial para rasgos como días a espigadura y días a madurez en ambas condiciones pero mostraron suficiencia completa para área hoja bandera y daño celular % en ambas condiciones. El modelo para producción de grano por planta y biomasa por planta fue completamente suficiente bajo condiciones normales y completamente adecuado en estrés. El componente aditivo de variación genotípica (D fue significativo para todos los rasgos estudiados y más que los componentes de dominancia H1 y H2. Los valores de la proporción de genes con efectos positivos y negativos en los progenitores (H2/4H1 demostraron distribución desigual de genes dominantes en los progenitores para casi todos los rasgos excepto área de hoja bandera, producción de grano, y daño celular % en ambas condiciones. Se encontraron estimaciones

  14. Construcción de un vector para la integración cromosomal de un gen de fitasa de Bacillus licheniformis

    Directory of Open Access Journals (Sweden)

    Maria Teresa Fernández

    2011-07-01

    Full Text Available Las fitasas son una clase especial de fosfatasas que catalizan la hidrólisis secuencial del fitato. La incapacidad de las plantas para utilizar el fósforo a partir de los fitatos del suelo es debido a la baja actividad de fitasas en sus raíces. Los microorganismos del suelo juegan un importante papel en los procesos que afectan la trans- formación de los compuestos fosforados. Muchos de ellos pueden solubilizar el fósforo a partir de los fitatos, mediante la liberación de fitasas. Este proceso permite la movilización del fósforo hacia las plantas y un mejor aprovechamiento de este nutriente. Sin embargo, muchas bacterias carecen de los genes que codifican para estas enzimas, lo que disminuye la disponibilidad de este elemento en el suelo. Una alternativa es mejorar las rizobacterias en cuanto a su capacidad de solubilizar los fitatos del suelo, mediante la transformación genética. En este trabajo el gen phyL de Bacillus licheniformis fue clonado en el vector de liberación suicida pJMT6 (vector derivado del sistema pUT/mini Tn5. La construcción recombinante que contiene un marcador de selección no antibiótico, fue transformada en Escherichia coli CC118λpir. Un clon transformante (F16 fue seleccionado y posteriormente caracterizado. Estos resultados constituyen un primer paso para desarrollar rizobacterias promotoras del crecimiento mejoradas en cuanto a la producción de actividad fitasa recombinante, como alternativa para reducir la contaminación ambiental y mejorar la productividad de los cultivos.

  15. ANALISIS GEN HAEMAGGLUTININ PADA VIRUS CAMPAK LIAR

    Directory of Open Access Journals (Sweden)

    Subangkit Subangkit

    2015-05-01

    Full Text Available AbstrakPenyakit Campak disebabkan oleh virus campak yang termasuk genus Morbilivirus dan Family Paramyxoviridae. Penyakit campak masih menjadi masalah kesehatan karena masih ditemukan Kejadian Luar Biasa (KLB di Indonesia. Salah satu penyebab terjadinya KLB tersebut diduga sebagaiakibat perbedaan antigenesitas antara strain vaksin yang digunakan dengan strain virus campak liar yang beredar di Indonesia. Penelitian ini bertujuan mendapatkan gambaran tentang karakteristik genetik gen Haemagglutinin virus campak liar yang ada di Indonesia. Spesimen yang digunakan sebanyak 27 isolat virus penyebab KLB dari 17 propinsi selama periode tahun 2003-2010. Isolat virus dilakukan pemeriksaan secara RT-PCR dan sekuensing dengan metode Sanger. Hasil sekuensing dianalisis dengan menggunakan perangkat lunak Bioedit 7.0 dan MEGA 4.0. Hasil penelitian didapatkan perbedaan 10 asam amino antara virus campak strain vaksin CAM-70 dan virus campak liar pada posisi D416N; K424T; V451M; N455T; V466I; I473T; F476L; Y481S atau Y481N; H495N; G505D. Kesimpulan penelitian ini adalah terdapat perbedaan karakteristik genetik antara virus campak liar di Indonesia berbeda dengan strain virus vaksin CAM-70.Kata kunci : Campak, Analisis Molekuler, Hemagglutinin, CD46AbstractMeasles is caused by virus belonging to the genus Morbilivirus and Family Paramyxoviridae. Measles is still a public health problem because outbreak of measles still found in Indonesia. Outbreak is suspected as a result of differences in antigenicity between vaccine strains used with wild-type measles virus strains circulating in Indonesia. This study aims to get genetic characteristics of wild-type measles virus haemagglutinin gene in Indonesia. The specimens were used 27 viral isolates from 17 provinces period 2003-2010. Viral isolates examined by RT-PCR and sequencing with Sanger method. Sequencing analysis were conducted using Bioedit 7.0 and MEGA 4.0 software. The results showed 10 amino acid differences

  16. A novel role of human holliday junction resolvase GEN1 in the maintenance of centrosome integrity.

    Directory of Open Access Journals (Sweden)

    Min Gao

    Full Text Available The maintenance of genomic stability requires accurate genome replication, repair of DNA damage, and the precise segregation of chromosomes in mitosis. GEN1 possesses Holliday junction resolvase activity in vitro and presumably functions in homology driven repair of DNA double strand breaks. However, little is currently known about the cellular functions of human GEN1. In the present study we demonstrate that GEN1 is a novel centrosome associated protein and we characterize the various phenotypes associated with GEN1 deficiency. We identify an N-terminal centrosome localization signal in GEN1, which is required and sufficient for centrosome localization. We report that GEN1 depletion results in aberrant centrosome numbers associated with the formation of multiple spindle poles in mitosis, an increased number of cells with multi-nuclei, increased apoptosis and an elevated level of spontaneous DNA damage. We find homologous recombination severely impaired in GEN1 deficient cells, suggesting that GEN1 functions as a Holliday junction resolvase in vivo as well as in vitro. Complementation of GEN1 depleted cells with various GEN1 constructs revealed that centrosome association but not catalytic activity of GEN1 is required for preventing centrosome hyper-amplification, formation of multiple mitotic spindles, and multi-nucleation. Our findings provide novel insight into the biological functions of GEN1 by uncovering an important role of GEN1 in the regulation of centrosome integrity.

  17. Análisis de la función del antiportador Nha1 en la progresión del ciclo celular en Saccharomyces cerevisiae

    OpenAIRE

    Simón Vecilla, Ernesto

    2004-01-01

    Consultable des del TDX Títol obtingut de la portada digitalitzada Esta tesis está estructurada en forma de dos publicaciones. En la primera de ellas se utiliza una cepa de Saccharomyces cerevisiae que presenta un fenotipo sintético letal condicional que consiste en una parada del ciclo celular en la fase G1 con el fin de identificar genes que en multicopia revierten este fenotipo. La cepa en cuestión presenta una delección del gen que codifica la fosfatasa Sit4 y una sobreactivación de...

  18. Algoritmos genéticos para planejamento em inteligencia artificial

    OpenAIRE

    Lecheta, Edson Martins

    2011-01-01

    Este trabalho apresenta uma revisão bibliográfica atualizada sobre duas grandes áreas da Inteligência Artificial: Planejamento e Algoritmos Genéticos. A pesquisa se estende pela criação de modelos genéticos implementados em um sistema planejador dedicado à resolução de uma conhecida classe de problemas de planejamento, usando bibliotecas de código de domínio público em ambas as áreas. Uma análise dos resultados motivou a remodelagem e nova implementação, alterando a plataforma e o sistema ope...

  19. INFLUENCIA DEL NITRÓGENO EN LA CALIDAD DEL GRANO DE SORGO EN EL SALVADOR

    Directory of Open Access Journals (Sweden)

    Vilma Ruth Calder\\u00F3n-Chinchilla

    2008-01-01

    Full Text Available Se evaluó el efecto de la aplicación y el uso efi ciente de nitrógeno (UEN en el rendimiento y la calidad del grano de 12 líneas experimentales de sorgo [Sorghum bicolor Moench (L] y dos variedades comerciales ('Soberan' y 'Jocoro' durante el año 2004. Los niveles dec nitrógeno empleados fueron de 0 y 21 kg/ha. Se presentaron interacciones entre las variedades y los niveles de nitrógeno para el rendimiento del grano y el UEN. La aplicación de 21 kg/ha aumentó el rendimiento del grano en 0,9 t/ha (45%, la concentración de N en el grano en 0,3% y la densidad verdadera del grano, con un efecto pequeño en otras variables de la calidad del grano. Se encontraron diferencias entre las líneas para todas las variables de calidad, pero ninguna de las líneas experimentales fue superior a las variedades Soberano y Jocoro. Las líneas ICSVLM-90520, ICSVLM-89537 e ICSVLM-90510 dieron rendimientos similares a Soberano y Jocoro; y ICSVLM-90510 presentó igual o superior calidad del grano, pudiendo ser utilizada para incrementar la diversidad genética.

  20. Cáncer oral: genética, prevención, diagnóstico y tratamiento. revisión de la literatura

    Directory of Open Access Journals (Sweden)

    M.C. Mateo-Sidrón Antón

    2015-08-01

    Full Text Available El objetivo de esta revisión es actualizar la situación actual del cáncer oral, así como de otros aspectos en general de esta enfermedad y del mecanismo genético y tumorogénesis del cáncer. Para ello hemos revisado los trabajos publicados de los últimos diez años sobre todos los aspectos generales del cáncer oral, destacando, entre otros, los referentes a factores de riesgo, diagnóstico y tratamiento. Las conclusiones más importantes de esta revisión han sido que, el cáncer oral, es un problema que aumenta con la edad, a partir de los 50 años en adelante, y que el 90% de los tumores que aparecen en boca son carcinomas mucoepidermoides de células escamosas. Es una enfermedad multifactorial, pero dentro de los factores de riesgo, se destacan el papel del tabaco y el alcohol. La prevalencia del cáncer oral sigue en aumento, por lo que el papel del odontólogo es primordial para la detección precoz de estos procesos, realizando una correcta historia clínica y exploración extra e intraoral, consiguiendo disminuir su morbimortalidad.

  1. A Novel Role of Human Holliday Junction Resolvase GEN1 in the Maintenance of Centrosome Integrity

    DEFF Research Database (Denmark)

    Gao, M.; Danielsen, Jannie Michaela Rendtlew; Wei, L.-Z.;

    2012-01-01

    but not catalytic activity of GEN1 is required for preventing centrosome hyper-amplification, formation of multiple mitotic spindles, and multi-nucleation. Our findings provide novel insight into the biological functions of GEN1 by uncovering an important role of GEN1 in the regulation of centrosome integrity......The maintenance of genomic stability requires accurate genome replication, repair of DNA damage, and the precise segregation of chromosomes in mitosis. GEN1 possesses Holliday junction resolvase activity in vitro and presumably functions in homology driven repair of DNA double strand breaks....... However, little is currently known about the cellular functions of human GEN1. In the present study we demonstrate that GEN1 is a novel centrosome associated protein and we characterize the various phenotypes associated with GEN1 deficiency. We identify an N-terminal centrosome localization signal in GEN1...

  2. Asesoramiento genético a mujeres en edad fértil sobrevivientes de cáncer

    Directory of Open Access Journals (Sweden)

    Isabel Castro-Volio

    2007-10-01

    Full Text Available Las personas que han padecido cáncer en su infancia, adolescencia, o antes de la menopausia, y han sobrevivido, merecen, además de cantidad, calidad de vida. Un aspecto muy importante del bienestar personal se relaciona con la procreación. Lamentablemente, es posible que las mismas terapias que les han salvado la vida, puedan comprometer su fertilidad, el pronóstico del embarazo y del parto, o la salud del bebé. De igual manera, en aquellos tipos de cáncer con influencia hormonal, nace la duda sobre la prudencia de un embarazo posterior. Otro aspecto fundamental es la posibilidad de transmitir el cáncer a generaciones futuras. El objetivo de esta revisión es apoyar al personal de salud en el abordaje de esta temática e ilustrar la forma como el asesoramiento genético puede contribuir al manejo de estos casos.Survivors of pediatric, adolescent or pre-menopausal cancer also deserve good quality of life. An important aspect of personal roll being is related to procreation. It is possible that some of the therapeutic interventions which have saved their lives could have jeopardized their fertility, their future deliveries or their offspring health. Hereditary transmission of cancer is another source of concern. Cancer is a new paradigm for genetic counseling. All these issues are approached in this review.

  3. Asesoramiento genético a mujeres en edad fértil sobrevivientes de cáncer

    Directory of Open Access Journals (Sweden)

    Isabel Castro-Volio

    2007-10-01

    Full Text Available Las personas que han padecido cáncer en su infancia, adolescencia, o antes de la menopausia, y han sobrevivido, merecen, además de cantidad, calidad de vida. Un aspecto muy importante del bienestar personal se relaciona con la procreación. Lamentablemente, es posible que las mismas terapias que les han salvado la vida, puedan comprometer su fertilidad, el pronóstico del embarazo y del parto, o la salud del bebé. De igual manera, en aquellos tipos de cáncer con influencia hormonal, nace la duda sobre la prudencia de un embarazo posterior. Otro aspecto fundamental es la posibilidad de transmitir el cáncer a generaciones futuras. El objetivo de esta revisión es apoyar al personal de salud en el abordaje de esta temática e ilustrar la forma como el asesoramiento genético puede contribuir al manejo de estos casos.

  4. DIFERENCIAS ENTRE EL MEJORAMIENTO GENÉTICO CLÁSICO DEL MAÍZ Y EL MEJORAMIENTO POR INGENIERÍA GENÉTICA

    OpenAIRE

    Antonio Turrent Fernández; José Isabel Cortés Flores; Alejandro Espinosa Calderón; José Antonio Serratos Hernández; Hugo Mejía Andrade

    2011-01-01

    En este ensayo se analizan dos aseveraciones: a) no hay diferencias fundamentales entre el mejoramiento genético clásico (MGC) o fitomejoramiento, y el mejoramiento por ingeniería genética (MIG); este último es una extensión del primero pero es más preciso, por lo que da mayor seguridad al consumidor; y b) la transformación por ingeniería genética es equivalente a una mutación natural. Se concurre con la afirmación de que el MGC y el MIG persiguen objetivos que pueden ser complementarios; sin...

  5. Corrección a una equivocación de Karl Pearson (1904: la suma de fracciones de Mendel no produce acoplamientos genéticos incompletos

    Directory of Open Access Journals (Sweden)

    Conrado Ruiz Hernández

    2014-01-01

    Full Text Available A comienzos del siglo xx, matemáticos prominentes encontraron una conexión entre el binomio de Newton y las leyes de Mendel con el objetivo de proyectarla a poblaciones enteras considerando a descendientes de varias generaciones. Dentro de esta búsqueda, en 1904 Karl Pearson formuló objeciones sobre los preceptos de Mendel, en particular respecto a los descendientes puros (dominantes y recesivos, que provienen de progenitores híbridos que a su parecer se constituyen en acoplamientos genéticos incompletos, resultado de la suma de fracciones. Se realiza el análisis matemático de este algoritmo (considerando el contexto biológico de su aplicación y se concluye que los descendientes puros previstos en las leyes de Mendel son acoplamientos genéticos completos.

  6. Insereixen material genètic al nucli cel·lular per a teràpia gènica amb nanodiscs

    OpenAIRE

    Villaverde Corrales, Antonio; Vázquez Gómez, Esther

    2011-01-01

    Investigadors de la UAB han aconseguit encapsular material genètic i alliberar-lo directament dins el nucli de les cèl·lules, per tal de dur a terme teràpia gènica, mitjançant partícules amb forma de disc de la grandària de només un pocs nanòmetres. Els nanodiscs, tal i com els han batejat els investigadors, travessen ràpidament l'interior de la cèl·lula i es concentren en el nucli, de manera que incrementarien l'eficiència del procés de transferència genètica.

  7. Entrenamiento y evaluación de una competencia genérica para los títulos de grado universitarios

    OpenAIRE

    Rodríguez, Margarita; Gutiérrez, Juan J.; Beltrán, Juan F.; Conradi, Mercedes

    2011-01-01

    Este trabajo surge ante la necesidad de entrenar y evaluar una competencia genérica en la materia de Zoología del Grado de Biología “Solidez en los conocimientos básicos de la profesión”. Consideramos que es fundamental que los estudiantes adquieran conocimientos suficientes para valorar la importancia de los aspectos genéricos que poseen los animales tales como, morfología, anatomía, histología, fisiología, embriología, etología y ecología. Al ser una asignatura difícil y poco atractiva para...

  8. Mutación en el gen KCNH2 y el síndrome de QT largo: a propósito de un caso

    Directory of Open Access Journals (Sweden)

    B. de Pablo Márquez

    2016-09-01

    Full Text Available Presentamos el caso de un paciente portador de una mutación en el gen KCNH2 para el síndrome de QT largo, diagnosticado a raíz de muerte súbita de un familiar. El estudio genético para el síndrome del QT largo y otras canalopatías está siendo cada vez más utilizado en la prevención de la muerte súbita, empezando a aparecer en los últimos años las primeras recomendaciones para el manejo de los pacientes portadores de mutaciones sin expresión fenotípica.

  9. A Virtual Reality Framework to Optimize Design, Operation and Refueling of GEN-IV Reactors.

    Energy Technology Data Exchange (ETDEWEB)

    Rizwan-uddin; Nick Karancevic; Stefano Markidis; Joel Dixon; Cheng Luo; Jared Reynolds

    2008-04-23

    many GEN-IV candidate designs are currently under investigation. Technical issues related to material, safety and economics are being addressed at research laboratories, industry and in academia. After safety, economic feasibility is likely to be the most important crterion in the success of GEN-IV design(s). Lessons learned from the designers and operators of GEN-II (and GEN-III) reactors must play a vital role in achieving both safety and economic feasibility goals.

  10. A Virtual Reality Framework to Optimize Design, Operation and Refueling of GEN-IV Reactors

    International Nuclear Information System (INIS)

    Many GEN-IV candidate designs are currently under investigation. Technical issues related to material, safety and economics are being addressed at research laboratories, industry and in academia. After safety, economic feasibility is likely to be the most important criterion in the success of GEN-IV design(s). Lessons learned from the designers and operators of GEN-II (and GEN-III) reactors must play a vital role in achieving both safety and economic feasibility goals

  11. Analisis Kata Penghubung He (和), Gen ( 跟) Dan Yu (与) Dalam Kalimat Bahasa Mandarin

    OpenAIRE

    Tarigan, Cicilia Aprilina Kartika

    2013-01-01

    The tittle of this paper is “Analisis Kata Penghubung He, Gen, dan Yu dalam Kalimat Bahasa Mandarin. Researcher analyzes the use of Chinese cunjuctions, he, gen, yu in Chinese sentences. Actually he, gen and yu have the same meaning but differently in their own characteristics. The concepts of the thesis are The methodology on the thesis is descriptive method. The author analyze about characteristic and similarities and differences of cunjuctions, hen, gen, and yu. By this, author is try to ...

  12. Asesoría genética sobre cáncer en el Perú Genetic counseling about cancer in Peru

    OpenAIRE

    Javier E Manrique; Yasser Sullcahuamán-Allende; Abel Limache-García

    2013-01-01

    El cáncer es una enfermedad genética producto de alteraciones en la secuencia o expresión del ADN. Estas alteraciones, según su origen, nos permiten clasificar el cáncer como esporádico y hereditario o familiar. En base a los registros de cáncer, en el Perú se espera que del 5 al 30% de todos los pacientes con cáncer, que equivale aproximadamente entre 2000 a 12 000 personas, presentarían cáncer del tipo familiar o hereditario, lo que representaría un similar número de familias con un riesgo ...

  13. Nuevas aplicaciones en identificación genética New applications in genetic identification

    Directory of Open Access Journals (Sweden)

    M.J. Álvarez-Cubero

    2010-06-01

    Full Text Available Cada vez más, los avances en identificación genética permiten la aplicación de estas técnicas a áreas muy diferentes. Los progresos científicos y tecnológicos en las herramientas utilizadas en genética forense han permitido nuevas aplicaciones de este campo en otras disciplinas. En este trabajo se pretenden abordar algunas de esas nuevas alternativas. La primera de ellas es la creación de bases de datos genéticas civiles que ha permitido el desarrollo de dos programas de identificación de personas: programa FÉNIX de identificación de cadáveres y restos humanos desaparecidos y la iniciativa DNA-PROKIDS que lucha contra el tráfico de seres humanos y pretende reunir a las víctimas con sus familias. En la última década, cada vez con más frecuencia aparece el análisis del ADN en proyectos de historia, paleontología,… Es en estos casos donde nos encontramos con muestras antiguas. Por tanto, una segunda aplicación es el trabajo con aDNA, del que mostramos varios ejemplos. Gracias a estas nuevas técnicas se han podido identificar los restos de varios personajes históricos, el Zar Nicolás II de Rusia, Cristóbal Colón y sus familiares, Blanca de Navarra y el Príncipe de Viana y el general Miranda; así como la recuperación de especies en peligro de extinción y la caracterización de elementos históricos. Por último, tienen gran importancia sus aplicaciones en biomedicina, ya que cada día es más frecuente la colaboración entre grupos forenses y otras especialidades médicas. Dos ejemplos de ello serían, la caracterización de muestras provenientes de tumores y en la asociación de enfermedades a haplotipos genéticos.More now than ever, advances in genetic identification allow the application of these new techniques to different fields. Scientific and technological progress in the tools used in forensic genetics has permitted new implementations of this field to others. In this paper, some of the newest alternatives

  14. Epidemiologia genética: epidemiologia, genética ou nenhuma das anteriores?

    Directory of Open Access Journals (Sweden)

    Aguinaldo Gonçalves

    1990-12-01

    Full Text Available No esforço de contribuir para melhor entendimento da identidade da Epidemiologia Genética, são revistas sua concepção, campo de atuação, métodos e técnicas pertinentes e algumas instâncias de aplicação. Entendendo-a como a área de interesse dos fatores genéticos das doenças e suas interações ambientais, apresenta-se seu campo de atuação como constituído por dois segmentos: um descritivo, que lida com conhecimento da distribuição de tais afecções em famílias e populações, seu impacto a nível do coletivo e sua vigilância epidemiológica, bem como o estudo de seus determinantes; o segundo, caracterizado pela intervenção, refere-se às respectivas medidas preventivas. Em que pese possível limitação pela não-consideração de todas as situações existentes, particular atenção é destinada à revisão de métodos e técnicas que possam ser convergentemente aplicados, a partir de procedimentos genéticos e epidemiológicos. Entre eles, destacam-se como estudos de casos tanto metodologias laboratoriais (como os dermatóglifos quanto quantitativos, como cálculo de herdabilidade e análise multivariada. Alguns objetos de estudo são tomados como instância de aplicação, por contarem com investigações específicas em nosso meio: a hanseníase, o hidrargirismo e a esquizofrenia.In an attempt to contribute to a better undestanding of the identity of Genetic Epidemiology, we review its conception, its field of influence, its appropriate methods and techniques and, at last, some of its applications. Genetic Epidemiology involves the study of genetic factors acting on diseases and on their environmental interactions. These includes two major areas: a descriptive one, related to the distribution of such conditions in families and populations, to the epidemiologic surveillance and to the study of determinants; and another characterized by intervention, which is related to preventive measures. Because of the dificulty in

  15. La cuestión del sujeto en el psicoanálisis del autismo.

    Directory of Open Access Journals (Sweden)

    Françoise Ansermet

    1997-01-01

    Full Text Available Una exposición psicoanalítica sobre el autismo requiere orientarse de forma rigurosa sobre las consecuencias para el psicoanálisis de las investigaciones psiquiátricas actuales -citemos en particular las de Gilberg-, de las exploraciones de la genética, de las neurociencias, de las ciencias cognitivas -citemos a Uta Frith-o las perspectivas abiertas por la teoría del espíritu (theory of mind -citemos a Peter Hobson-, sin olvidar los datos de las aproximaciones educativas, por ejemplo de Peeters o de Schopler.

  16. La tragedia de los anticomunes en la construcción del conocimiento del genoma humano

    OpenAIRE

    Helder Osorio; Arturo Lara.

    2013-01-01

    El presente artículo estudia los diferentes factores dentro de los cuales los agentes relacionados con el estudio del genoma humano, al enfrentarse a la fragmentación en la propiedad intelectual, pueden (o no) lograr acuerdos de cooperación para así evitar la tragedia de los anticomunes. Se considera como factores claves: la naturaleza compleja de gen/función; la evolución de los derechos formales e informales de propiedad, y las características de los agentes.

  17. Condiciones legales y administrativas para la secuenciación del genoma humano en el ámbito militar

    Directory of Open Access Journals (Sweden)

    J. Bobo-Ruiz

    2015-06-01

    Full Text Available La Genómica trae nuevas cuestiones jurídicas además de profundizar aquellas que ya se plantearon desde la Genética molecular. La secuenciación completa del genoma humano ha pasado de requerir los esfuerzos económicos de un consorcio internacional a ser asequible por el ciudadano medio. Este cambio revolucionario también afecta a las administraciones exigiendo un replanteamiento del status jurídico de las bases de datos con fines de investigación biomédica y de las de ADN policiales y su posible desarrollo en el ámbito militar. Del mismo modo ocurre con los biobancos asociados a ellas. Las restricciones que los tratados internacionales imponen sobre los fines de la investigación genómica no deben hacer olvidar los amplios cometidos de los Ejércitos en el marco más general de la Defensa Nacional. Se exponen aquí los condicionantes que cumplidos permitirían bases de datos genéticos y biobancos en dicho contexto, bajo el nuevo potencial de la Genómica, y se trata de articular su régimen con el derecho nacional vigente.

  18. Culturas del Mundo

    DEFF Research Database (Denmark)

    Benwell, Ann Fenger; Costa, Alberto; Waehle, Espen

    2006-01-01

    ’Culturas del mundo. Colecciones del Museo Nacional de Dinamarca’ with Ann Fenger Benwell in Culturas del Mundo. Colecciones del Museo Nacional de Dinamarca, ed. Silvia Sauquet, Fundación "la Caixa", Barcelona 2006, pp. 31-39......’Culturas del mundo. Colecciones del Museo Nacional de Dinamarca’ with Ann Fenger Benwell in Culturas del Mundo. Colecciones del Museo Nacional de Dinamarca, ed. Silvia Sauquet, Fundación "la Caixa", Barcelona 2006, pp. 31-39...

  19. Investigación sobre el desarrollo de las estructuras lógicas del niño, analizadas a través del concepto de peso, en diferentes grupos socioeconómicos

    OpenAIRE

    Ballarin O., Carmenza; Casas M., Carmen Elisa

    2012-01-01

    Al llevar a cabo esta Tesis, nos hemos propuesto hacer un análisis sobre el desarrollo de las estructuras lógicas del niño, medidas a través del concepto de peso, en diferentes grupos socioeconómicos. Conociendo la importancia que tiene el estudio de la Psicología Genética en el desarrollo evolutivo del niño, tomamos las bases teóricas expuestas por uno de sus mas gran des representantes: Jean Piaget, Director del Instituto Juan Jacobo Rousseau, Profesor de la Sorbona y de la Facultad de Cien...

  20. Productividad acumulada y su relación genética con características reproductivas en hembras Brahman

    Directory of Open Access Journals (Sweden)

    Orlando Duitama C.

    2013-10-01

    Full Text Available Objetivo. Estimar parámetros genéticos para la característica de productividad acumulada (PAC y correlaciones genéticas con edad al primer parto (EPP, intervalo entre el primero y segundo parto (IEP1 y longevidad (LONG. Materiales y métodos. Fueron usados 8584 registros de hembras Brahman, utilizando un modelo animal en análisis multi-característico con el método de máxima verosimilitud restricta, implementado en el software WOMBAT. Los modelos consideraron los efectos fijos de grupo contemporáneo, número de partos, y la covariable peso al destete del primer ternero; el único efecto aleatorio fue el genético aditivo directo. El peso al destete (P240 fue incluido para disminuir el efecto de la selección en la estimación de los componentes de varianza. Resultados. Las estimativas de heredabilidad fueron de 0.3±0.04, 0.11±0.03, 0.07±0.03 y 0.24±0.04 para EPP, IEP1, LONG y PAC respectivamente. Las correlaciones entre PAC y las otras características se presentaron de moderadas a altas y en sentido favorable. Conclusiones. PAC puede ser incluida en los programas de mejoramiento genético para Brahman, y utilizada como criterio de selección por su heredabilidad moderada y correlación genética favorable con las características reproductivas en estudio.