Directory of Open Access Journals (Sweden)
Sheila J Semaan
2010-03-01
Full Text Available Pro-apoptotic Bax is essential for RGC (retinal ganglion cell death. Gene dosage experiments in mice, yielding a single wild-type Bax allele, indicated that genetic background was able to influence the cell death phenotype. DBA/2J Bax+/− mice exhibited complete resistance to nerve damage after 2 weeks (similar to Bax −/− mice, but 129B6 Bax+/− mice exhibited significant cell loss (similar to wild-type mice. The different cell death phenotype was associated with the level of Bax expression, where 129B6 neurons had twice the level of endogenous Bax mRNA and protein as DBA/2J neurons. Sequence analysis of the Bax promoters between these strains revealed a single nucleotide polymorphism (T129B6 to CDBA/2J at position −515. A 1.5- to 2.5-fold increase in transcriptional activity was observed from the 129B6 promoter in transient transfection assays in a variety of cell types, including RGC5 cells derived from rat RGCs. Since this polymorphism occurred in a p53 half-site, we investigated the requirement of p53 for the differential transcriptional activity. Differential transcriptional activity from either 129B6 or DBA/2J Bax promoters were unaffected in p53−/− cells, and addition of exogenous p53 had no further effect on this difference, thus a role for p53 was excluded. Competitive electrophoretic mobility-shift assays identified two DNA-protein complexes that interacted with the polymorphic region. Those forming Complex 1 bound with higher affinity to the 129B6 polymorphic site, suggesting that these proteins probably comprised a transcriptional activator complex. These studies implicated quantitative expression of the Bax gene as playing a possible role in neuronal susceptibility to damaging stimuli.
International Nuclear Information System (INIS)
Semaan, Sheila J; Nickells, Robert W
2010-01-01
Many chemotherapeutic agents promote tumor cell death by activating the intrinsic pathway of apoptosis. Intrinsic apoptosis involves permeabilization of the mitochondrial outer membrane and the release of cytochrome c, a process that is controlled by proteins of the BCL2 gene family. Chemoresistance is often associated with abnormalities in concentrations of BCL2 family proteins. Although stoichiometirc interactions between anti-apoptotic and BH3-only BCL2 family proteins have been well documented as affecting cell death, the association between changes in BAX concentration and intrinsic apoptosis are poorly understood. Exogenous GFP-murine Bax fusion constructs were transfected into BAX-deficient HCT116 cells. To titrate the expression of the fusion protein, GFP-BAX was cloned into a tetracycline sensitive expression cassette and cotransfected with a plasmid expressing the rtTA transcription factor into HCT116 BAX-/- cells. Linear expression of the fusion gene was induced with doxycycline and monitored by quantitative PCR and immunoblotting. Cell death was assayed by DAPI staining cells after exposure to indomethacin, and scoring nuclei for condensed chromatin and fragmented nuclei. HCT116 BAX-/- cells were resistant to indomethacin, but susceptibility could be recovered in cells expressing a GFP-BAX fusion protein. Titration of GFP-BAX expression revealed that the concentration of BAX required to induce a saturating apoptosis response from baseline, was rapidly achieved. Increased levels of GFP-BAX were unable to stimulate higher levels of cell death. Examination of GFP-BAX distribution before and after indomethacin treatment indicated that BAX protein did not form aggregates when present at sub-lethal concentrations. Within the limitations of this experimental system, BAX-dependent apoptosis in HCT116 cells exhibits an all-or-none response depending on the level of BAX protein present. The lack of BAX aggregation at sub-saturation levels suggests that the
Directory of Open Access Journals (Sweden)
Semaan Sheila J
2010-10-01
Full Text Available Abstract Background Many chemotherapeutic agents promote tumor cell death by activating the intrinsic pathway of apoptosis. Intrinsic apoptosis involves permeabilization of the mitochondrial outer membrane and the release of cytochrome c, a process that is controlled by proteins of the BCL2 gene family. Chemoresistance is often associated with abnormalities in concentrations of BCL2 family proteins. Although stoichiometirc interactions between anti-apoptotic and BH3-only BCL2 family proteins have been well documented as affecting cell death, the association between changes in BAX concentration and intrinsic apoptosis are poorly understood. Methods Exogenous GFP-murine Bax fusion constructs were transfected into BAX-deficient HCT116 cells. To titrate the expression of the fusion protein, GFP-BAX was cloned into a tetracycline sensitive expression cassette and cotransfected with a plasmid expressing the rtTA transcription factor into HCT116BAX-/- cells. Linear expression of the fusion gene was induced with doxycycline and monitored by quantitative PCR and immunoblotting. Cell death was assayed by DAPI staining cells after exposure to indomethacin, and scoring nuclei for condensed chromatin and fragmented nuclei. Results HCT116BAX-/- cells were resistant to indomethacin, but susceptibility could be recovered in cells expressing a GFP-BAX fusion protein. Titration of GFP-BAX expression revealed that the concentration of BAX required to induce a saturating apoptosis response from baseline, was rapidly achieved. Increased levels of GFP-BAX were unable to stimulate higher levels of cell death. Examination of GFP-BAX distribution before and after indomethacin treatment indicated that BAX protein did not form aggregates when present at sub-lethal concentrations. Conclusion Within the limitations of this experimental system, BAX-dependent apoptosis in HCT116 cells exhibits an all-or-none response depending on the level of BAX protein present. The lack of
Directory of Open Access Journals (Sweden)
Paola De Feudis
2000-05-01
Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.
THE EXPRESSION AND CLINICAL VALUE OF APOPTOSIS CONTROL GENE Bcl-2 AND Bax IN BREAST CANCER
Institute of Scientific and Technical Information of China (English)
ZHENG Jun; YAO Zhen-xiang; ZHANG Jing
1999-01-01
Objective: To study the expression and clinical value of apoptosis control gene bcl-2 and bax in breast cancer.Methods: Protein bax and bcl-2 in 41 breast cancers obtained from operations in our hospital in 1996 were detected using ABC immunohistochemical stain assay and compared with 10 cases with normal breast tissues.Results: The positive rate of bax in normal breast tissue was 90% and in breast cancer was 59%, with a significant statistical difference between them (P<0.05), but there was no statistical difference in bcl-2 protein expression. Among the 41 breast cancer, the group with lymph node metastasis (21 cases) had obviously low bax expression (43%) and high bcl-2 expression (76%), showing significant difference to the group without lymph node metastasis (P<0.05).Conclusion: The antiapoptosis function of bcl-2 was stronger than bax in breast cancer. Protein bax and bcl-2 assay may be useful in understanding the biological behaviors of breast cancer.
Bcl-xL stimulates Bax relocation to mitochondria and primes cells to ABT-737.
Renault, Thibaud T; Teijido, Oscar; Missire, Florent; Ganesan, Yogesh Tengarai; Velours, Gisèle; Arokium, Hubert; Beaumatin, Florian; Llanos, Raul; Athané, Axel; Camougrand, Nadine; Priault, Muriel; Antonsson, Bruno; Dejean, Laurent M; Manon, Stéphen
2015-07-01
Bax cytosol-to-mitochondria translocation is a central event of the intrinsic pathway of apoptosis. Bcl-xL is an important regulator of this event and was recently shown to promote the retrotranslocation of mitochondrial Bax to the cytosol. The present study identifies a new aspect of the regulation of Bax localization by Bcl-xL: in addition to its role in Bax inhibition and retrotranslocation, we found that, like with Bcl-2, an increase of Bcl-xL expression levels led to an increase of Bax mitochondrial content. This finding was substantiated both in pro-lymphocytic FL5.12 cells and a yeast reporting system. Bcl-xL-dependent increase of mitochondrial Bax is counterbalanced by retrotranslocation, as we observed that Bcl-xLΔC, which is unable to promote Bax retrotranslocation, was more efficient than the full-length protein in stimulating Bax relocation to mitochondria. Interestingly, cells overexpressing Bcl-xL were more sensitive to apoptosis upon treatment with the BH3-mimetic ABT-737, suggesting that despite its role in Bax inhibition, Bcl-xL also primes mitochondria to permeabilization and cytochrome c release. Copyright © 2015 Elsevier Ltd. All rights reserved.
Niu, Xin; Brahmbhatt, Hetal; Mergenthaler, Philipp; Zhang, Zhi; Sang, Jing; Daude, Michael; Ehlert, Fabian G R; Diederich, Wibke E; Wong, Eve; Zhu, Weijia; Pogmore, Justin; Nandy, Jyoti P; Satyanarayana, Maragani; Jimmidi, Ravi K; Arya, Prabhat; Leber, Brian; Lin, Jialing; Culmsee, Carsten; Yi, Jing; Andrews, David W
2017-04-20
Aberrant apoptosis can lead to acute or chronic degenerative diseases. Mitochondrial outer membrane permeabilization (MOMP) triggered by the oligomerization of the Bcl-2 family proteins Bax/Bak is an irreversible step leading to execution of apoptosis. Here, we describe the discovery of small-molecule inhibitors of Bax/Bak oligomerization that prevent MOMP. We demonstrate that these molecules disrupt multiple, but not all, interactions between Bax dimer interfaces thereby interfering with the formation of higher-order oligomers in the MOM, but not recruitment of Bax to the MOM. Small-molecule inhibition of Bax/Bak oligomerization allowed cells to evade apoptotic stimuli and rescued neurons from death after excitotoxicity, demonstrating that oligomerization of Bax is essential for MOMP. Our discovery of small-molecule Bax/Bak inhibitors provides novel tools for the investigation of the mechanisms leading to MOMP and will ultimately facilitate development of compounds inhibiting Bax/Bak in acute and chronic degenerative diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ahmed Shalaby
2009-01-01
Full Text Available Background. We studied the effect of fast induction of cardiac arrest with denosine on myocardial bax and bcl-2 expression. Methods and Results. 40 elective CABG patients were allocated into two groups. The adenosine group (n=20 received 250 μg/kg adenosine into the aortic root followed by blood potassium cardioplegia. The control group received potassium cardioplegia in blood. Bcl-2 and bax were measured. Bax was reduced in the postoperative biopsies (1.38 versus 0.47, P=.002 in the control group. Bcl-2 showed a reducing tendency (0.14 versus 0.085, P=.07. After the adenosine treatment, the expression of both bax (0.52 versus 0.59, P=.4 and bcl-2 (0.104 versus 0.107, P=.4 remained unaltered after the operation. Conclusion. Open heart surgery is associated with rapid reduction in the expression of apoptosis regulating genes bax and bcl-2. Fast Adenosine induction abolished changes in their expression.
A novel plant glutathione S-transferase/peroxidase suppresses Bax lethality in yeast
DEFF Research Database (Denmark)
Kampranis, S C; Damianova, R; Atallah, M
2000-01-01
The mammalian inducer of apoptosis Bax is lethal when expressed in yeast and plant cells. To identify potential inhibitors of Bax in plants we transformed yeast cells expressing Bax with a tomato cDNA library and we selected for cells surviving after the induction of Bax. This genetic screen allows...... for the identification of plant genes, which inhibit either directly or indirectly the lethal phenotype of Bax. Using this method a number of cDNA clones were isolated, the more potent of which encodes a protein homologous to the class theta glutathione S-transferases. This Bax-inhibiting (BI) protein was expressed...... in Escherichia coli and found to possess glutathione S-transferase (GST) and weak glutathione peroxidase (GPX) activity. Expression of Bax in yeast decreases the intracellular levels of total glutathione, causes a substantial reduction of total cellular phospholipids, diminishes the mitochondrial membrane...
E2F-1 induces melanoma cell apoptosis via PUMA up-regulation and Bax translocation
International Nuclear Information System (INIS)
Hao, Hongying; Dong, Yanbin; Bowling, Maria T; Gomez-Gutierrez, Jorge G; Zhou, H Sam; McMasters, Kelly M
2007-01-01
PUMA is a pro-apoptotic Bcl-2 family member that has been shown to be involved in apoptosis in many cell types. We sought to ascertain whether induction of PUMA plays a crucial role in E2F-1-induced apoptosis in melanoma cells. PUMA gene and protein expression levels were detected by real-time PCR and Western blot in SK-MEL-2 and HCT116 cell lines after Ad-E2F-1 infection. Activation of the PUMA promoter by E2F-1 overexpression was detected by dual luciferase reporter assay. E2F-1-induced Bax translocation was shown by immunocytochemistry. The induction of caspase-9 activity was measured by caspase-9 colorimetric assay kit. Up-regulation of the PUMA gene and protein by E2F-1 overexpression was detected by real-time PCR and Western blot analysis in the SK-MEL-2 melanoma cell line. In support of this finding, we found six putative E2F-1 binding sites within the PUMA promoter. Subsequent dual luciferase reporter assay showed that E2F-1 expression could increase the PUMA gene promoter activity 9.3 fold in SK-MEL-2 cells. The role of PUMA in E2F-1-induced apoptosis was further investigated in a PUMA knockout cell line. Cell viability assay showed that the HCT116 PUMA-/- cell line was more resistant to Ad-E2F-1-mediated cell death than the HCT116 PUMA+/+ cell line. Moreover, a 2.2-fold induction of the PUMA promoter was also noted in the HCT116 PUMA+/+ colon cancer cell line after Ad-E2F-1 infection. Overexpression of a truncated E2F-1 protein that lacks the transactivation domain failed to up-regulate PUMA promoter, suggesting that PUMA may be a transcriptional target of E2F-1. E2F-1-induced cancer cell apoptosis was accompanied by Bax translocation from the cytosol to mitochondria and the induction of caspase-9 activity, suggesting that E2F-1-induced apoptosis is mediated by PUMA through the cytochrome C/Apaf-1-dependent pathway. Our studies strongly demonstrated that E2F-1 induces melanoma cell apoptosis via PUMA up-regulation and Bax translocation. The signaling
The effect of radiation on bcl-2 and bax in hyperplastic prostatic tissues
International Nuclear Information System (INIS)
Ma Qingjie; Li Yuxin; Gu Xinquan; Cao Xia; Zhao Jie; Kong Xiangbo; Cai Shanyu
2004-01-01
Aim: To investigate the expressions of bcl-2 and bax in benign prostatic hyperplasia (BPH) and the effect of β-rays on bcl-2 and bax. Methods: The expressions of bcl-2 and bax are studied by means of immunohistochemical method in 9 normal prostate (NP) and 15 BPH and 35 patients treated with 90Sr/90Y Prostatic Hyperplasia Applicator. Results: The expressions of bcl-2 in epithelia of NP and BPH are higher than that in stroma P<0.01=. The expressions of bcl-2 in epithelia and stroma of BPH are higher than that in NP P<0.01=. The expressions of bax in epithelia of NP are higher than that in BPH P<0.05=. However ,the expressions of bcl-2 in epithelia and stroma of BPH are higher than bax P<0.01 =. Compared with the control group, the expressions of bcl-2 in epithelia and stroma of BPH treated with 90Sr/90Y Prostatic Hyperplasia Applicator decreased and the expressions of bax increased P<0.01=. Conclusion: bcl-2 gene and bax gene play an important role in the regulation of prostatic apoptosis and the treatment of β-rays can accelerate the apoptosis of prostatic tissues. (authors)
Radogna, Flavia
2015-03-01
Extra-neurological functions of melatonin include control of the immune system and modulation of apoptosis. We previously showed that melatonin inhibits the intrinsic apoptotic pathway in leukocytes via stimulation of high affinity MT1/MT2 receptors, thereby promoting re-localization of the anti-apoptotic Bcl-2 protein to mitochondria. Here we show that Bcl-2 sequesters pro-apoptotic Bax into mitochondria in an inactive form after melatonin treatment, thus reducing cell propensity to apoptosis. Bax translocation and the anti-apoptotic effect of melatonin are strictly dependent on the presence of Bcl-2, and on the 5-lipoxygenase (5-LOX) metabolite 5-hydroxyeicosatetraenoic acid (5-HETE), which we have previously shown to be produced as a consequence of melatonin binding to its low affinity target calmodulin. Therefore, the anti-apoptotic effect of melatonin requires the simultaneous, independent interaction with high (MT1/MT2) and low (calmodulin) affinity targets, eliciting two independent signal transduction pathways converging into Bax sequestration and inactivation. MT1/MT2 vs. lipoxygenase pathways are activated by 10-9 vs. 10-5M melatonin, respectively; the anti-apoptotic effect of melatonin is achieved at 10-5M, but drops to 10-9M upon addition of exogenous 5-HETE, revealing that lipoxygenase activation is the rate-limiting pathway. Therefore, in areas of inflammation with increased 5-HETE levels, physiological nanomolar concentrations of melatonin may suffice to maintain leukocyte viability.
International Nuclear Information System (INIS)
Liu Guangwei; Wang Chunyan; Lu Zhe; Liu Shunchun; Gong Shouliang
2003-01-01
The different kinds of spermatogenic cells were separated using density gradient centrifugation and their apoptosis and Bcl-2 and Bax protein expression were measured with flow cytometry and immunohistochemical method, respectively. The results showed the apoptosis in all kinds of spermatogenic cells induced by low dose radiation (LDR) had a obvious regularity. When the doses were 0.025 and 0.05 Gy, spermatogonia apoptosis was dominant. With the increase of irradiation dose (0.075-0.2 Gy), spermatocytes also showed an apoptotic change, but the apoptotic percentage of spermatogonia was significantly higher than that of spermatocytes. Moreover, the apoptosis of spermatids and spermatozoa scarcely occurred after LDR. Bax protein was primarily expressed in spermatogonia and spermatocytes, and the former was significantly higher than that of the latter after LDR. With the increase of irradiation dose, Bax protein expression showed a upgrading tendency, but that of spermatids and spermatozoa scarcely occurred. Bcl-2 protein was primarily expressed in spermatids and spermatozoa, but the Bcl-2 protein expressions of spermatogonia and spermatocytes scarcely occurred after LDR. These results imply that the interacting regulation of Bcl-2 and Bax gene expression might be involved in selective apoptosis of spermatogenic cells induced by LDR, which provided an experimental evidence for further exploring the apoptotic mechanism of adaptive response of spermatogenic cells by LDR
Directory of Open Access Journals (Sweden)
Katharine J Goodall
Full Text Available Apoptosis mediated by Bax or Bak is usually thought to be triggered by BH3-only members of the Bcl-2 protein family. BH3-only proteins can directly bind to and activate Bax or Bak, or indirectly activate them by binding to anti-apoptotic Bcl-2 family members, thereby relieving their inhibition of Bax and Bak. Here we describe a third way of activation of Bax/Bak dependent apoptosis that does not require triggering by multiple BH3-only proteins. In factor dependent myeloid (FDM cell lines, cycloheximide induced apoptosis by a Bax/Bak dependent mechanism, because Bax-/-Bak-/- lines were profoundly resistant, whereas FDM lines lacking one or more genes for BH3-only proteins remained highly sensitive. Addition of cycloheximide led to the rapid loss of Mcl-1 but did not affect the expression of other Bcl-2 family proteins. In support of these findings, similar results were observed by treating FDM cells with the CDK inhibitor, roscovitine. Roscovitine reduced Mcl-1 abundance and caused Bax/Bak dependent cell death, yet FDM lines lacking one or more genes for BH3-only proteins remained highly sensitive. Therefore Bax/Bak dependent apoptosis can be regulated by the abundance of anti-apoptotic Bcl-2 family members such as Mcl-1, independently of several known BH3-only proteins.
Mitochondrial shape governs BAX-induced membrane permeabilization and apoptosis.
Renault, Thibaud T; Floros, Konstantinos V; Elkholi, Rana; Corrigan, Kelly-Ann; Kushnareva, Yulia; Wieder, Shira Y; Lindtner, Claudia; Serasinghe, Madhavika N; Asciolla, James J; Buettner, Christoph; Newmeyer, Donald D; Chipuk, Jerry E
2015-01-08
Proapoptotic BCL-2 proteins converge upon the outer mitochondrial membrane (OMM) to promote mitochondrial outer membrane permeabilization (MOMP) and apoptosis. Here we investigated the mechanistic relationship between mitochondrial shape and MOMP and provide evidence that BAX requires a distinct mitochondrial size to induce MOMP. We utilized the terminal unfolded protein response pathway to systematically define proapoptotic BCL-2 protein composition after stress and then directly interrogated their requirement for a productive mitochondrial size. Complementary biochemical, cellular, in vivo, and ex vivo studies reveal that Mfn1, a GTPase involved in mitochondrial fusion, establishes a mitochondrial size that is permissive for proapoptotic BCL-2 family function. Cells with hyperfragmented mitochondria, along with size-restricted OMM model systems, fail to support BAX-dependent membrane association and permeabilization due to an inability to stabilize BAXα9·membrane interactions. This work identifies a mechanistic contribution of mitochondrial size in dictating BAX activation, MOMP, and apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.
Effect of JTV1 gene on the proliferation and apoptosis of K562 cells and its mechanism
Directory of Open Access Journals (Sweden)
Yan WU
2011-05-01
Full Text Available Objective To investigate the effect of tumor-suppressing gene JTV1 on proliferation and apoptosis of leukemic K562 cells,and the changes in apoptosis factors Bcl-2,C-myc and Bax genes.Methods The recombinate vector pcDNA3.1-JTV1,and the empty vector pcDNA3.1 were transfected into K562 cells as control.The cell proliferation of K562 cells was evaluated by colony formation assay;the cell cycle and apoptosis rate were assessed by flow cytometry(FCM;the mRNA levels of apoptosis related genes Bax,Bcl-2 and C-myc were determined by RT-PCR;the protein levels of Bax,Bcl-2 and C-myc were assayed by Western Blotting.Results The colony formation assay showed that the proliferation of K562 cells decreased when the expression of JTV1 gene was up-regulated.FCM assay showed that the G phase cells in pcDNA3.1-JTV1 positive transfection group increased compared with that of the control group and the pcDNA3.1 empty vector transfected group,and the differences were statistically significant(P < 0.05.Compared with the control group and the empty vector group,the mRNA transcription level and the protein translation level of Bax gene increased significantly,and the mRNA transcription level and the protein translation level of Bcl-2 and C-myc gene were reduced significantly(P < 0.05.Conclusions The expressions of Bcl-2 and C-myc gene are inhibited when the gene JTV1 is up-regulated,leading to an increase in Bax gene expression,inhibition of K562 cell proliferation,and promotion of tumor cells apoptosis.Over expression of JTV1 gene can inhibit the proliferation of K562 cells and promote cell apoptosis by inhibiting Bcl-2 and C-myc expression and up-regulating that of Bax.
The radiosensitivity of glioblastoma cell lines after hypoxia-induced Bax expression
International Nuclear Information System (INIS)
Chen, J.K.; Hu, L.J.; Kong, E.L.; Lamborn, K.R.; Deen, D.F.
2003-01-01
Full text: Radiation therapy is the most effective treatment after surgery for patients with malignant gliomas. However, the hypoxic cells exclusive to tumor tissue have proven resistant to both radiotherapy and many forms of chemotherapy. In order to specifically target these hypoxic cells, U-251 MG and U-87 MG human glioblastoma cells were stably transfected with constructs containing the suicide gene Bax under the regulation of nine copies of hypoxia-responsive elements (HREs). During hypoxia, the transcriptional complex hypoxia-inducible-factor 1 (HIF-1) binds to HRE and facilitates the transcription of downstream genes. Previously, hypoxia-induced Bax expression in transfected U-251 and U-87 clone cells has been shown to increase cell killing. The benefits of the gene therapy could be further expanded if Bax also acted to increase the sensitivity of these clone cells to radiation. To determine whether this was the case, parent and clone cells were irradiated with graded doses of X-rays under hypoxic conditions. These cells were then left hypoxic for varying durations of time, after which they were incubated for two weeks under aerated conditions to assay for clonogenic cell survival. After less than an hour under hypoxia, both U-251 and U-87 clone cells appeared significantly more sensitive to radiation than their respective parent cells. However, after longer amounts of time under anoxia, higher surviving fractions were found in each clone that were consistent with those of their respective parent cell line, showing that potentially lethal damage repair (PLDR) had occurred in the clone cells. Parent cells did not exhibit PLDR. Results are inconclusive at this point in time. Western blot analyses detailing the amount of Bax expression at each time point as well as further research exploring different durations of hypoxia will be necessary to reveal the nature of the correlation between Bax expression and radiosensitivity. Supported by NS-42927 and CA-85356
WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer
Energy Technology Data Exchange (ETDEWEB)
Zeilstra, Jurrit; Joosten, Sander P.J. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Wensveen, Felix M. [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Dessing, Mark C.; Schuetze, Denise M. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Eldering, Eric [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Spaargaren, Marcel [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Pals, Steven T., E-mail: s.t.pals@amc.uva.nl [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands)
2011-03-04
Research highlights: {yields} Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. {yields} Expression profiling of apoptosis-related genes in Apc{sup Min/+} mice revealed the differential expression of pro-apoptotic Bok and Bax. {yields} APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. {yields} Blocking of {beta}-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or {beta}-catenin causes constitutively active {beta}-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc{sup Min/+} mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of {beta}-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which
WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer
International Nuclear Information System (INIS)
Zeilstra, Jurrit; Joosten, Sander P.J.; Wensveen, Felix M.; Dessing, Mark C.; Schuetze, Denise M.; Eldering, Eric; Spaargaren, Marcel; Pals, Steven T.
2011-01-01
Research highlights: → Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. → Expression profiling of apoptosis-related genes in Apc Min/+ mice revealed the differential expression of pro-apoptotic Bok and Bax. → APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. → Blocking of β-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or β-catenin causes constitutively active β-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc Min/+ mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of β-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which uncontrolled epithelial cell proliferation in the
The oxidized phospholipid PazePC promotes permeabilization of mitochondrial membranes by Bax
Czech Academy of Sciences Publication Activity Database
Lidman, M.; Pokorná, Šárka; Dingeldein, A. P. G.; Sparrman, T.; Wallgren, M.; Šachl, Radek; Hof, Martin; Gröbner, G.
2016-01-01
Roč. 1858, č. 6 (2016), s. 1288-1297 ISSN 0005-2736 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388955 Keywords : Apoptosis * Bax-protein * Calorimetry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.498, year: 2016
Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao
2015-01-01
Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.
Bax regulates neuronal Ca2+ homeostasis.
D'Orsi, Beatrice; Kilbride, Seán M; Chen, Gang; Perez Alvarez, Sergio; Bonner, Helena P; Pfeiffer, Shona; Plesnila, Nikolaus; Engel, Tobias; Henshall, David C; Düssmann, Heiko; Prehn, Jochen H M
2015-01-28
Excessive Ca(2+) entry during glutamate receptor overactivation ("excitotoxicity") induces acute or delayed neuronal death. We report here that deficiency in bax exerted broad neuroprotection against excitotoxic injury and oxygen/glucose deprivation in mouse neocortical neuron cultures and reduced infarct size, necrotic injury, and cerebral edema formation after middle cerebral artery occlusion in mice. Neuronal Ca(2+) and mitochondrial membrane potential (Δψm) analysis during excitotoxic injury revealed that bax-deficient neurons showed significantly reduced Ca(2+) transients during the NMDA excitation period and did not exhibit the deregulation of Δψm that was observed in their wild-type (WT) counterparts. Reintroduction of bax or a bax mutant incapable of proapoptotic oligomerization equally restored neuronal Ca(2+) dynamics during NMDA excitation, suggesting that Bax controlled Ca(2+) signaling independently of its role in apoptosis execution. Quantitative confocal imaging of intracellular ATP or mitochondrial Ca(2+) levels using FRET-based sensors indicated that the effects of bax deficiency on Ca(2+) handling were not due to enhanced cellular bioenergetics or increased Ca(2+) uptake into mitochondria. We also observed that mitochondria isolated from WT or bax-deficient cells similarly underwent Ca(2+)-induced permeability transition. However, when Ca(2+) uptake into the sarco/endoplasmic reticulum was blocked with the Ca(2+)-ATPase inhibitor thapsigargin, bax-deficient neurons showed strongly elevated cytosolic Ca(2+) levels during NMDA excitation, suggesting that the ability of Bax to support dynamic ER Ca(2+) handling is critical for cell death signaling during periods of neuronal overexcitation. Copyright © 2015 the authors 0270-6474/15/351706-17$15.00/0.
Csatlós, Éva; Máté, Szabolcs; Laky, Marcella; Rigó, János; Joó, József Gábor
2015-07-01
To describe gene expression patterns of the apoptotic regulatory genes Bcl and Bax in human uterine leiomyoma tissue. To investigate the relationship between alterations of gene expression patterns and several relevant clinical parameters. We obtained samples from 101 cases undergoing surgery for uterine leiomyoma for gene expression analysis of the Bcl-2 and Bax genes. Gene expression was quantified using RT-PCR technique. In the leiomyoma group, the Bcl-2 gene was significantly overexpressed compared with the control group although there was no such difference in the gene expression of Bax. Gene activity of Bcl-2 positively correlated with the tumor number in individual uterine leiomyoma cases. Although there was no significant correlation between the length of the cumulative lactation period before the development of uterine leiomyoma and Bcl-2 gene expression in the leiomyoma tissue, we observed a trend for a shorter cumulative lactation period to be associated with overexpression of the Bcl-2 gene. Overexpression of the antiapoptotic Bcl-2 gene appeared to be a factor in the development of uterine leiomyoma, whereas gene activity of the proapoptotic Bax gene did not seem to play a role in the process.
Bartchewsky, Waldemar; Martini, Mariana R; Squassoni, Aline C; Alvarez, Marisa C; Ladeira, Marcelo S P; Salvatore, Daisy M F; Trevisan, Miriam A; Pedrazzoli, José; Ribeiro, Marcelo L
2010-01-01
The aim of the present study is to evaluate the influence of Helicobacter pylori on Bax and Bcl-2 mRNA and protein levels in patients with chronic gastritis and gastric cancer. The study included 217 patients, of which 26 were uninfected; 127 had chronic gastritis and were H. pylori-positive, and 64 had gastric cancer. Bacterial genotypes were evaluated by PCR, and the expression values were determined by quantitative real-time PCR and immunohistochemistry. Our data showed that the up-regulationary effects of H. pylori infection on the pro-apoptotic gene, Bax, were stronger than its induction of Bcl-2; this effect may increase apoptosis in patients with chronic gastritis. In patients with gastric cancer, the up-regulation of the anti-apoptotic gene, Bcl-2, counteracted the pro-apoptotic effects of Bax, leading to a deregulation of apoptosis-associated gene expression, favoring cell proliferation. Thus, the disturbance in Bax and Bcl-2 balance, induced by H. pylori, might be important in gastric cancer development.
Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A
2003-10-15
An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX
Directory of Open Access Journals (Sweden)
Hangjun Ruan
1999-11-01
Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.
BAX protein expression and clinical outcome in epithelial ovarian cancer.
Tai, Y T; Lee, S; Niloff, E; Weisman, C; Strobel, T; Cannistra, S A
1998-08-01
Expression of the pro-apoptotic protein BAX sensitizes ovarian cancer cell lines to paclitaxel in vitro by enhancing the pathway of programmed cell death. The present study was performed to determine the relationship between BAX expression and clinical outcome in 45 patients with newly diagnosed ovarian cancer. BAX protein expression was analyzed by immunohistochemistry, and its relationship with clinical outcome was determined. Assessment of BAX mRNA transcript levels and mutational analysis of the BAX coding region were also performed. BAX protein was expressed at high levels (defined as > or = 50% of tumor cells positive) in tumor tissue from 60% of newly diagnosed patients. All patients whose tumors expressed high levels of BAX achieved a complete response (CR) to first-line chemotherapy that contained paclitaxel plus a platinum analogue, compared with 57% of patients in the low-BAX group (P = .036). After a median follow-up of 1.9 years, the median disease-free survival (DFS) of patients in the high-BAX group has not been reached, compared with a median DFS of 1.1 years for low-BAX expressors (P = .0061). BAX retained independent prognostic significance in multivariate analysis when corrected for stage and histology. BAX mRNA transcripts were easily detected in samples with low BAX protein expression, and no BAX mutations were identified. The correlation between high BAX levels and improved clinical outcome suggests that an intact apoptotic pathway is an important determinant of chemoresponsiveness in ovarian cancer patients who receive paclitaxel.
Mitochondrial ceramide-rich macrodomains functionalize Bax upon irradiation.
Directory of Open Access Journals (Sweden)
Hyunmi Lee
Full Text Available Evidence indicates that Bax functions as a "lipidic" pore to regulate mitochondrial outer membrane permeabilization (MOMP, the apoptosis commitment step, through unknown membrane elements. Here we show mitochondrial ceramide elevation facilitates MOMP-mediated cytochrome c release in HeLa cells by generating a previously-unrecognized mitochondrial ceramide-rich macrodomain (MCRM, which we visualize and isolate, into which Bax integrates.MCRMs, virtually non-existent in resting cells, form upon irradiation coupled to ceramide synthase-mediated ceramide elevation, optimizing Bax insertion/oligomerization and MOMP. MCRMs are detected by confocal microscopy in intact HeLa cells and isolated biophysically as a light membrane fraction from HeLa cell lysates. Inhibiting ceramide generation using a well-defined natural ceramide synthase inhibitor, Fumonisin B1, prevented radiation-induced Bax insertion, oligomerization and MOMP. MCRM deconstruction using purified mouse hepatic mitochondria revealed ceramide alone is non-apoptogenic. Rather Bax integrates into MCRMs, oligomerizing therein, conferring 1-2 log enhanced cytochrome c release. Consistent with this mechanism, MCRM Bax isolates as high molecular weight "pore-forming" oligomers, while non-MCRM membrane contains exclusively MOMP-incompatible monomeric Bax.Our recent studies in the C. elegans germline indicate that mitochondrial ceramide generation is obligate for radiation-induced apoptosis, although a mechanism for ceramide action was not delineated. Here we demonstrate that ceramide, generated in the mitochondrial outer membrane of mammalian cells upon irradiation, forms a platform into which Bax inserts, oligomerizes and functionalizes as a pore. We posit conceptualization of ceramide as a membrane-based stress calibrator, driving membrane macrodomain organization, which in mitochondria regulates intensity of Bax-induced MOMP, and is pharmacologically tractable in vitro and in vivo.
International Nuclear Information System (INIS)
Yashiro, Masakazu; Hirakawa, Kosei; Boland, C Richard
2010-01-01
Microsatellite instability (MSI) occurs in 15% of colorectal cancers (CRC). The genetic targets for mutation in the MSI phenotype include somatic mutations in the transforming growth factor beta receptor typeII (TGFbetaRII), BAX, hMSH3 and hMSH6. It is not clear how mutations of these genes mediate tumor progression in the MSI pathway, and the temporal sequence of these mutations remains uncertain. In this study, early stage CRCs were examined for frameshift mutations in these target genes, and compared with late stage tumors and CRC cell lines. We investigated 6 CRC cell lines and 71 sporadic CRCs, including 61 early stage cancers and 10 late stage cancers. Mutations of repetitive mononucleotide tracts in the coding regions of TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR and Fas antigen were identified by direct sequencing. Thirteen (18.3%) of 71 CRC, including 9/61 (14.7%) early stage cancers and 4/10 (40%) late stage cancers, were identified as MSI and analyzed for frameshift mutations. No mutation in the target genes was observed in any of the 9 early stage MSI CRCs. In contrast, frameshift mutations of TGFbetaRII, BAX, hMSH3 and hMSH6 were present in 3/4 late stage MSI tumors. There is a statistical association (p = 0.014) between mutation in any one gene and tumor stage. TGFbetaRII, BAX, hMSH3 and hMSH6 mutations are relatively late events in the genesis of MSI CRCs. The frameshift mutations in these target genes might mediate progression from early to late stage cancer, rather than mediating the adenoma to carcinoma transition
Directory of Open Access Journals (Sweden)
Tushar eDwivedi
2015-01-01
Full Text Available Bipolar disorder (BD, one of the most debilitating mental disorders, is associated with increased morbidity and mortality. Lithium is the first line of treatment option for BD and is often used for maintenance therapy. Recently, the neuroprotective action of lithium has gained tremendous attention, given that BD is associated with structural and functional abnormalities of the brain. However, the precise molecular mechanism by which lithium exerts its neuroprotective action is not clearly understood. In hippocampal neurons, the effects of lithium on neuronal viability against glutamate-induced cytotoxicity, dendritic length and number, and expression and methylation of BDNF promoter exons and expression of apoptotic regulatory genes were studied. In rat hippocampal neurons, lithium not only increased dendritic length and number, but also neuronal viability against glutamate-induced cytotoxicity. While lithium increased the expression of BDNF as well as genes associated with neuroprotection such as Bcl2 and Bcl-XL, it decreased the expression of pro-apoptotic genes Bax, Bad, and caspases 3. Interestingly, lithium activated transcription of specific exon IV to induce BDNF gene expression. This was accompanied by hypomethylation of BDNF exon IV promoter. This study delineates mechanisms by which lithium mediates its effects in protecting neurons.
Calin, G A; Gafà, R; Tibiletti, M G; Herlea, V; Becheanu, G; Cavazzini, L; Barbanti-Brodano, G; Nenci, I; Negrini, M; Lanza, G
2000-05-20
Colon carcinomas with microsatellite mutator phenotype exhibit specific genetic and clinico-pathological features. This report describes the analysis of 63 "microsatellite instability-high" (MSI-H) tumors for the presence of mutations in microsatellites located in the coding regions (CDRs) of 6 genes: TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR, and BLM. The following frequencies of mutations were detected: TGFbetaRII (70%), BAX (54%), hMSH3 (36.5%), IGFIIR (22%), hMSH6 (17.5%), and BLM (16%). The overall picture revealed combinations of mutations suggestive of a progressive order of accumulation, with mutations of TGFbetaRII and BAX first, followed by frameshifts in hMSH3, hMSH6, IGFIIR, and BLM. Correlations with 12 clinico-pathological parameters revealed that tumors with frameshifts in 1 or 2 CDRs were significantly better differentiated than tumors with frameshifts in more than 2 CDRs. We also found that mutations in the hMSH3 gene were significantly associated with decreased wall invasiveness and aneuploidy, and frameshifts in the BLM gene were significantly associated with the mucinous histotype. A trend toward an association between hMSH3 and IGFIIR with the medullary and conventional adenocarcinoma histotypes, respectively, was seen. Our results strengthen the concept that mutations in target genes have a role in the tumorigenic process of MSI-H tumors, and indicate that frameshifts in microsatellites located in CDRs occur in a limited number of combinations that could determine distinct clinico-pathological traits. Copyright 2000 Wiley-Liss, Inc.
NFAT2 mediates high glucose-induced glomerular podocyte apoptosis through increased Bax expression
International Nuclear Information System (INIS)
Li, Ruizhao; Zhang, Li; Shi, Wei; Zhang, Bin; Liang, Xinling; Liu, Shuangxin; Wang, Wenjian
2013-01-01
Background: Hyperglycemia promotes podocyte apoptosis and plays a key role in the pathogenesis of diabetic nephropathy. However, the mechanisms that mediate hyperglycemia-induced podocyte apoptosis is still far from being fully understood. Recent studies reported that high glucose activate nuclear factor of activated T cells (NFAT) in vascular smooth muscle or pancreatic β-cells. Here, we sought to determine if hyperglycemia activates NFAT2 in cultured podocyte and whether this leads to podocyte apoptosis. Meanwhile, we also further explore the mechanisms of NFAT2 activation and NFAT2 mediates high glucose-induced podocyte apoptosis. Methods: Immortalized mouse podocytes were cultured in media containing normal glucose (NG), or high glucose (HG) or HG plus cyclosporine A (a pharmacological inhibitor of calcinerin) or 11R-VIVIT (a special inhibitor of NFAT2). The activation of NFAT2 in podocytes was detected by western blotting and immunofluorescence assay. The role of NFAT2 in hyperglycemia-induced podocyte apoptosis was further evaluated by observing the inhibition of NFAT2 activation by 11R-VIVIT using flow cytometer. Intracellular Ca 2+ was monitored in HG-treated podcocytes using Fluo-3/AM. The mRNA and protein expression of apoptosis gene Bax were measured by real time-qPCR and western blotting. Results: HG stimulation activated NFAT2 in a time- and dose-dependent manner in cultured podocytes. Pretreatment with cyclosporine A (500 nM) or 11R-VIVIT (100 nM) completely blocked NFAT2 nuclear accumulation. Meanwhile, the apoptosis effects induced by HG were also abrogated by concomitant treatment with 11R-VIVIT in cultured podocytes. We further found that HG also increased [Ca 2+ ]i, leading to activation of calcineurin, and subsequent increased nuclear accumulation of NFAT2 and Bax expression in cultured podocytes. Conclusion: Our results identify a new finding that HG-induced podocyte apoptosis is mediated by calcineurin/NFAT2/Bax signaling pathway, which may
NFAT2 mediates high glucose-induced glomerular podocyte apoptosis through increased Bax expression
Energy Technology Data Exchange (ETDEWEB)
Li, Ruizhao, E-mail: liruizhao1979@126.com [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Zhang, Li, E-mail: Zhanglichangde@163.com [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Southern Medical University, Guangzhou, Guangdong (China); Shi, Wei, E-mail: shiwei.gd@139.com [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Zhang, Bin, E-mail: zhangbinyes@yahoo.com.cn [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Liang, Xinling, E-mail: xinlingliang@yahoo.com [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Liu, Shuangxin, E-mail: mplsxi@yahoo.com.cn [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China); Wang, Wenjian, E-mail: wwjph@yahoo.com [Department of Nephrology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan No. 2 Road, Guangzhou, 510080 (China)
2013-04-15
Background: Hyperglycemia promotes podocyte apoptosis and plays a key role in the pathogenesis of diabetic nephropathy. However, the mechanisms that mediate hyperglycemia-induced podocyte apoptosis is still far from being fully understood. Recent studies reported that high glucose activate nuclear factor of activated T cells (NFAT) in vascular smooth muscle or pancreatic β-cells. Here, we sought to determine if hyperglycemia activates NFAT2 in cultured podocyte and whether this leads to podocyte apoptosis. Meanwhile, we also further explore the mechanisms of NFAT2 activation and NFAT2 mediates high glucose-induced podocyte apoptosis. Methods: Immortalized mouse podocytes were cultured in media containing normal glucose (NG), or high glucose (HG) or HG plus cyclosporine A (a pharmacological inhibitor of calcinerin) or 11R-VIVIT (a special inhibitor of NFAT2). The activation of NFAT2 in podocytes was detected by western blotting and immunofluorescence assay. The role of NFAT2 in hyperglycemia-induced podocyte apoptosis was further evaluated by observing the inhibition of NFAT2 activation by 11R-VIVIT using flow cytometer. Intracellular Ca{sup 2+} was monitored in HG-treated podcocytes using Fluo-3/AM. The mRNA and protein expression of apoptosis gene Bax were measured by real time-qPCR and western blotting. Results: HG stimulation activated NFAT2 in a time- and dose-dependent manner in cultured podocytes. Pretreatment with cyclosporine A (500 nM) or 11R-VIVIT (100 nM) completely blocked NFAT2 nuclear accumulation. Meanwhile, the apoptosis effects induced by HG were also abrogated by concomitant treatment with 11R-VIVIT in cultured podocytes. We further found that HG also increased [Ca{sup 2+}]i, leading to activation of calcineurin, and subsequent increased nuclear accumulation of NFAT2 and Bax expression in cultured podocytes. Conclusion: Our results identify a new finding that HG-induced podocyte apoptosis is mediated by calcineurin/NFAT2/Bax signaling pathway
Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein
2017-09-01
The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.
Li, Zhiqiang; Sun, Yang; Wan, Hongxing; Chai, Fang
2017-01-01
Objective To investigate the role of N-myc downstream regulated gene 2 (NDRG2) gene in the proliferation, migration and apoptosis of rectal cancer cells. Methods Human rectal cancer SW480 cells were cultured and transfected with pCDNA3.1-NDRG2 and empty vector (SW480-Ve). SW480 cells were set as a control group. Cell proliferation was detected in SW480 cells, SW480-Ve cells and SW480-NDRG2 cells by MTT assay; cell migration distance in the three groups at 24, 48, 72 hours was tested by wound healing assay; apoptosis rate was determined in the three groups at 48 hours by flow cytometry; the expressions of Bax, caspase-3, Bcl-2 proteins in the three groups were examined by Western blotting. Results After the cells were cultured for 7 days, cell survival rate in SW480-NDRG2 group was significantly lower than that in SW480 cells and SW480-Ve cells; the cell survival rate decreased gradually with the prolongation of the culture time; and it had no significant difference between SW480-Ve group and SW480 group. Cell migration distance in SW480-NDRG2 group was significantly lower than that in SW480-Ve cells and SW480 cells, and it had also no significant difference between SW480-Ve cells and SW480 cells. The apoptosis rate in SW480-NDRG2 group was significantly higher than that in SW480 group and SW480-Ve group, and SW480 cells and SW480-Ve cells had no significant difference in the rate. The expressions of Bax and caspase-3 proteins in SW480-NDRG2 group were significantly higher than those in SW480 cells and SW480-Ve cells; Bcl-2 protein expression was significantly lower in SW480-NDRG2 group than in SW480 cells and SW480-Ve cells; and the expressions of Bax, caspase-3 and Bcl-2 proteins were not significantly different between SW480 cells and SW480-Ve cells. Conclusion Overexpression of NDRG2 can inhibit the proliferation, reduce cell migration, and promote cell apoptosis by regulating the expressions of Bcl-2, Bax and caspase-3 proteins in SW480 cells.
Role of Bax in resveratrol-induced apoptosis of colorectal carcinoma cells
International Nuclear Information System (INIS)
Mahyar-Roemer, Mojgan; Köhler, Hans; Roemer, Klaus
2002-01-01
The natural plant polyphenol resveratrol present in some foods including grapes, wine, and peanuts, has been implicated in the inhibition, delay, and reversion of cellular events associated with heart diseases and tumorigenesis. Recent work has suggested that the cancer chemoprotective effect of the compound is primarily linked to its ability to induce cell division cycle arrest and apoptosis, the latter possibly through the activation of pro-apoptotic proteins such as Bax. The expression, subcellular localization, and importance of Bax for resveratrol-provoked apoptosis were assessed in human HCT116 colon carcinoma cells and derivatives with both bax alleles inactivated. Low to moderate concentrations of resveratrol induced co-localization of cellular Bax protein with mitochondria, collapse of the mitochondrial membrane potential, activation of caspases 3 and 9, and finally, apoptosis. In the absence of Bax, membrane potential collapse was delayed, and apoptosis was reduced but not absent. Resveratrol inhibited the formation of colonies by both HCT116 and HCT116 bax -/- cells. Resveratrol at physiological doses can induce a Bax-mediated and a Bax-independent mitochondrial apoptosis. Both can limit the ability of the cells to form colonies
Directory of Open Access Journals (Sweden)
Biagosch J
2010-10-01
Full Text Available Abstract Resistance to cisplatin in the course of chemotherapy contributes to the poor prognosis of small cell lung cancer (SCLC. B cell lymphoma-2 is the founding member of a large family of proteins that either promote or inhibit apoptosis. We aimed at investigating if the pro-apoptotic members Bad, Bax, Bim and Bid are involved in cisplatin-resistance. Cisplatin-resistance in the SCLC cell line H1339 was induced by repetitive exposure to cisplatin. Protein expression was quantified by Western Blot and immuno-fluorescence analysis. Protein expression was altered using siRNA interference. Four "cycles" of 0.5 μg/ml cisplatin led to partial cisplatin-resistance in H1339 cells. The expression of Bad, Bim and Bid was comparable in naïve and resistant cells while the expression of Bax was reduced in the resistant clone. But, reducing Bax expression in naïve cells did not lead to altered cisplatin sensitivity neither in H1339 nor in H187 SCLC cells. We conclude that the reduced Bax expression after exposure to cisplatin is not sufficient to induce cis-platin-resistance in SCLC cells.
Directory of Open Access Journals (Sweden)
Kaori Shima
Full Text Available Mononucleotide tracts in the coding regions of the TGFBR2 and BAX genes are commonly mutated in microsatellite instability-high (MSI-high colon cancers. The receptor TGFBR2 plays an important role in the TGFB1 (transforming growth factor-β, TGF-β signaling pathway, and BAX plays a key role in apoptosis. However, a role of TGFBR2 or BAX mononucleotide mutation in colorectal cancer as a prognostic biomarker remains uncertain.We utilized a database of 1072 rectal and colon cancers in two prospective cohort studies (the Nurses' Health Study and the Health Professionals Follow-up Study. Cox proportional hazards model was used to compute mortality hazard ratio (HR, adjusted for clinical, pathological and molecular features including the CpG island methylator phenotype (CIMP, LINE-1 methylation, and KRAS, BRAF and PIK3CA mutations. MSI-high was observed in 15% (162/1072 of all colorectal cancers. TGFBR2 and BAX mononucleotide mutations were detected in 74% (117/159 and 30% (48/158 of MSI-high tumors, respectively. In Kaplan-Meier analysis as well as univariate and multivariate Cox regression analyses, compared to microsatellite stable (MSS/MSI-low cases, MSI-high cases were associated with superior colorectal cancer-specific survival [adjusted HR, 0.34; 95% confidence interval (CI, 0.20-0.57] regardless of TGFBR2 or BAX mutation status. Among MSI-high tumors, TGFBR2 mononucleotide mutation was associated with CIMP-high independent of other variables [multivariate odds ratio, 3.57; 95% CI, 1.66-7.66; p = 0.0011].TGFBR2 or BAX mononucleotide mutations are not associated with the patient survival outcome in MSI-high colorectal cancer. Our data do not support those mutations as prognostic biomarkers (beyond MSI in colorectal carcinoma.
Expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia
Li, Sheng-Mian; Yao, Shu-Kun; Yamamura, Nobuyoshi; Nakamura, Toshitsugu
2003-01-01
AIM: To compare the difference of expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia, and to analyze the role of Bcl-2 and Bax proteins in the progression from dysplasia to carcinoma and to evaluate the correlation of Bcl-2/Bax protein expression with the biological behaviors. METHODS: Expressions of Bcl-2 and Bax were examined immunohistochemically in 27 cases of extrahepatic biliary tract carcinomas (bile duct carcinoma: n = 21, carcinoma of ampulla of Vater: n = 6), and 10 cases of atypical dysplasia. Five cases of normal biliary epithelial tissues were used as controls. A semiquantitative scoring system was used to assess the Bcl-2 and Bax reactivity. RESULTS: The expression of Bcl-2 was observed in 10 out of 27 (37.0%) invasive carcinomas, 1 out of 10 dysplasias, none out of 5 normal epithelial tissues. Bax expression rate was 74.1% (20/27) in invasive carcinoma, 30% (3/10) in dysplasia, and 40% (2/5) in normal biliary epithelium. Bcl-2 and Bax activities were more intense in carcinoma than in dysplasia, with no significant difference in Bcl-2 expression (P = 0.110), and significant difference in Bax expression (P = 0.038). Level of Bax expression was higher in invasive carcinoma than in dysplasia and normal tissue (P = 0.012). Bcl-2 expression was correlated to Bax expression (P = 0.0059). However, Bcl-2/Bax expression had no correlation with histological subtype, grade of differentiation, or level of invasion. CONCLUSION: Increased Bcl-2/Bax expression from dysplasia to invasive tumors supports the view that this is the usual route for the development of extrahepatic biliary tract carcinoma. Bcl-2/Bax may be involved, at least in part, in the apoptotic activity in extrahepatic biliary carcinoma. PMID:14606101
Shukla, Sanjeev; Fu, Pingfu; Gupta, Sanjay
2014-01-01
Dysfunction of the apoptotic pathway in prostate cancer cells confers apoptosis resistance towards various therapies. A novel strategy to overcome resistance is to directly target the apoptotic pathway in cancer cells. Apigenin, an anticancer agent, selectively toxic to cancer cells induces cell cycle arrest and apoptosis through mechanisms which are not fully explored. In the present study we provide novel insight into the mechanisms of apoptosis induction by apigenin. Treatment of androgen-refractory human prostate cancer PC-3 and DU145 cells with apigenin resulted in dose-dependent suppression of XIAP, c-IAP1, c-IAP2 and survivin protein levels. Apigenin treatment resulted in significant decrease in cell viability and apoptosis induction with the increase of cytochrome C in time-dependent manner. These effects of apigenin were accompanied by decrease in Bcl-xL and Bcl-2 and increase in the active form of Bax protein. The apigenin-mediated increase in Bax was due to dissociation of Bax from Ku70 which is essential for apoptotic activity of Bax. Apigenin treatment resulted in the inhibition of class I histone deacetylases and HDAC1 protein expression, thereby increasing the acetylation of Ku70 and the dissociation of Bax resulting in apoptosis of cancer cells. Furthermore, apigenin significantly reduced HDAC1 occupancy at the XIAP promoter, suggesting that histone deacetylation might be critical for XIAP downregulation. These results suggest that apigenin targets inhibitor of apoptosis proteins and Ku70–Bax interaction in the induction of apoptosis in prostate cancer cells and in athymic nude mouse xenograft model endorsing its in vivo efficacy. PMID:24563225
Bax function in the absence of mitochondria in the primitive protozoan Giardia lamblia.
Directory of Open Access Journals (Sweden)
Adrian B Hehl
Full Text Available Bax-induced permeabilization of the mitochondrial outer membrane and release of cytochrome c are key events in apoptosis. Although Bax can compromise mitochondria in primitive unicellular organisms that lack a classical apoptotic machinery, it is still unclear if Bax alone is sufficient for this, or whether additional mitochondrial components are required. The protozoan parasite Giardia lamblia is one of the earliest branching eukaryotes and harbors highly degenerated mitochondrial remnant organelles (mitosomes that lack a genome. Here we tested whether human Bax expressed in Giardia can be used to ablate mitosomes. We demonstrate that these organelles are neither targeted, nor compromised, by Bax. However, specialized compartments of the regulated secretory pathway are completely ablated by Bax. As a consequence, maturing cyst wall proteins that are sorted into these organelles are released into the cytoplasm, causing a developmental arrest and cell death. Interestingly, this ectopic cargo release is dependent on the carboxy-terminal 22 amino acids of Bax, and can be prevented by the Bax-inhibiting peptide Ku70. A C-terminally truncated Bax variant still localizes to secretory organelles, but is unable to permeabilize these membranes, uncoupling membrane targeting and cargo release. Even though mitosomes are too diverged to be recognized by Bax, off-target membrane permeabilization appears to be conserved and leads to cell death completely independently of mitochondria.
BAX channel activity mediates lysosomal disruption linked to Parkinson disease.
Bové, Jordi; Martínez-Vicente, Marta; Dehay, Benjamin; Perier, Celine; Recasens, Ariadna; Bombrun, Agnes; Antonsson, Bruno; Vila, Miquel
2014-05-01
Lysosomal disruption is increasingly regarded as a major pathogenic event in Parkinson disease (PD). A reduced number of intraneuronal lysosomes, decreased levels of lysosomal-associated proteins and accumulation of undegraded autophagosomes (AP) are observed in PD-derived samples, including fibroblasts, induced pluripotent stem cell-derived dopaminergic neurons, and post-mortem brain tissue. Mechanistic studies in toxic and genetic rodent PD models attribute PD-related lysosomal breakdown to abnormal lysosomal membrane permeabilization (LMP). However, the molecular mechanisms underlying PD-linked LMP and subsequent lysosomal defects remain virtually unknown, thereby precluding their potential therapeutic targeting. Here we show that the pro-apoptotic protein BAX (BCL2-associated X protein), which permeabilizes mitochondrial membranes in PD models and is activated in PD patients, translocates and internalizes into lysosomal membranes early following treatment with the parkinsonian neurotoxin MPTP, both in vitro and in vivo, within a time-frame correlating with LMP, lysosomal disruption, and autophagosome accumulation and preceding mitochondrial permeabilization and dopaminergic neurodegeneration. Supporting a direct permeabilizing effect of BAX on lysosomal membranes, recombinant BAX is able to induce LMP in purified mouse brain lysosomes and the latter can be prevented by pharmacological blockade of BAX channel activity. Furthermore, pharmacological BAX channel inhibition is able to prevent LMP, restore lysosomal levels, reverse AP accumulation, and attenuate mitochondrial permeabilization and overall nigrostriatal degeneration caused by MPTP, both in vitro and in vivo. Overall, our results reveal that PD-linked lysosomal impairment relies on BAX-induced LMP, and point to small molecules able to block BAX channel activity as potentially beneficial to attenuate both lysosomal defects and neurodegeneration occurring in PD.
Bermudez-Hernandez, Keria; Lu, Yi-Ling; Moretto, Jillian; Jain, Swati; LaFrancois, John J; Duffy, Aine M; Scharfman, Helen E
2017-09-01
The dentate gyrus (DG) principal cells are glutamatergic granule cells (GCs), and they are located in a compact cell layer. However, GCs are also present in the adjacent hilar region, but have been described in only a few studies. Therefore, we used the transcription factor prospero homeobox 1 (Prox1) to quantify GCs at postnatal day (PND) 16, 30, and 60 in a common mouse strain, C57BL/6J mice. At PND16, there was a large population of Prox1-immunoreactive (ir) hilar cells, with more in the septal than temporal hippocampus. At PND30 and 60, the size of the hilar Prox1-ir cell population was reduced. Similar numbers of hilar Prox1-expressing cells were observed in PND30 and 60 Swiss Webster mice. Prox1 is usually considered to be a marker of postmitotic GCs. However, many Prox1-ir hilar cells, especially at PND16, were not double-labeled with NeuN, a marker typically found in mature neurons. Most hilar Prox1-positive cells at PND16 co-expressed doublecortin (DCX) and calretinin, markers of immature GCs. Double-labeling with a marker of actively dividing cells, Ki67, was not detected. These results suggest that, surprisingly, a large population of cells in the hilus at PND16 are immature GCs (Type 2b and Type 3 cells). We also asked whether hilar Prox1-ir cell numbers are modifiable. To examine this issue, we conditionally deleted the proapoptotic gene BAX in Nestin-expressing cells at a time when there are numerous immature GCs in the hilus, PND2-8. When these mice were examined at PND60, the numbers of Prox1-ir hilar cells were significantly increased compared to control mice. However, deletion of BAX did not appear to change the proportion that co-expressed NeuN, suggesting that the size of the hilar Prox1-expressing population is modifiable. However, deleting BAX, a major developmental disruption, does not appear to change the proportion that ultimately becomes neurons.
International Nuclear Information System (INIS)
Sun, Lihua; Wang, Wensheng; Xiao, Weidong; Liang, Hongyin; Yang, Yang; Yang, Hua
2012-01-01
Highlights: ► Ang II-induced apoptosis in intestinal epithelial cell through AT2 receptor. ► The apoptosis process involves in the Bax/Bcl-2 intrinsic pathway. ► GATA-6 short hairpin RNA reduced Bax expression, but not Bcl-2. ► GATA-6 may play a critical role in apoptosis in response to the Ang II challenge. -- Abstract: Angiotensin II (Ang II) has been shown to play an important role in cell apoptosis. However, the mechanisms of Ang-II-induced apoptosis in intestinal epithelial cells are not fully understood. GATA-6 is a zinc finger transcription factor expressed in the colorectal epithelium, which directs cell proliferation, differentiation and apoptosis. In the present study we investigated the underlying mechanism of which GATA-6 affects Ang-II induced apoptosis in intestinal epithelial cells. The in vitro intestinal epithelial cell apoptosis model was established by co-culturing Caco-2 cells with Ang II. Pretreatment with Angiotensin type 2 (AT2) receptor antagonist, PD123319, significantly reduced the expression of Bax and prevented the Caco-2 cells apoptosis induced by Ang II. In addition, Ang II up-regulated the expression of GATA-6. Interestingly, GATA-6 short hairpin RNA prevented Ang II-induced intestinal epithelial cells apoptosis and reduced the expression of Bax, but not Bcl-2. Taken together, the present study suggests that Angiotensin II promotes apoptosis in intestinal epithelial cells through GATA-6 and the Bax pathway in an AT2 receptor-dependent manner.
Interaction of caveolin-1 with Ku70 inhibits Bax-mediated apoptosis.
Directory of Open Access Journals (Sweden)
Huafei Zou
Full Text Available Caveolin-1, the structural protein component of caveolae, acts as a scaffolding protein that functionally regulates signaling molecules. We show that knockdown of caveolin-1 protein expression enhances chemotherapeutic drug-induced apoptosis and inhibits long-term survival of colon cancer cells. In vitro studies demonstrate that caveolin-1 is a novel Ku70-binding protein, as shown by the binding of the scaffolding domain of caveolin-1 (amino acids 82-101 to the caveolin-binding domain (CBD of Ku70 (amino acids 471-478. Cell culture data show that caveolin-1 binds Ku70 after treatment with chemotherapeutic drugs. Mechanistically, we found that binding of caveolin-1 to Ku70 inhibits the chemotherapeutic drug-induced release of Bax from Ku70, activation of Bax, translocation of Bax to mitochondria and apoptosis. Potentiation of apoptosis by knockdown of caveolin-1 protein expression is greatly reduced in the absence of Bax expression. Finally, we found that overexpression of wild type Ku70, but not a mutant form of Ku70 that cannot bind to caveolin-1 (Ku70 Φ→A, limits the chemotherapeutic drug-induced Ku70/Bax dissociation and apoptosis. Thus, caveolin-1 acts as an anti-apoptotic protein in colon cancer cells by binding to Ku70 and inhibiting Bax-dependent cell death.
Tempo enhances heat-induced apoptosis by mitochondrial targeting of Bax
International Nuclear Information System (INIS)
Zhao, Q.-L.; Fujiwara, Y.; Kondo, T.
2003-01-01
A stable membrane-permeable nitroxide, Tempo, exerts an SOD-like antioxidant activity against ROS. Reportedly, Tempo inhibits ROS-induced thymocyte apoptosis, while 10 mM Tempo activates JNK1 to induce apoptosis in breast cancer cells. We have observed that nontoxic 5 mM Tempo enhances suboptimal hyperthermia (44 deg C/10 min)-induced apoptosis in U937 cells. Here we report the enhancing mechanism, focusing on activation and targeting of Bax to mitochondria and cytochrome c release. Methods: U937 cells were treated with either Tempo (5 mM, 37 deg C/10 min), heating (44 deg C/10 min), or Tempo-plus-heating, washed and incubated for various times up to 6 h, until assessing apoptosis, mitochondrial potential (ΔΨ>), and amount of superoxide by flow cytometry using Annexin V-FITC/PI, TMRM, and dihydroethidium, respectively. Bax, Bcl-2 and Bcl-XL, and cytochrome c were detected by western blotting, activated Bax was by immunoprecipitation, and ATP was by a luciferase assay. Bax targeting to and cytochrome c release from mitochorndria were also detected immunocytochemically under fluorescent microscopy. Results and Discussion: Treatment of U937 cells with 5 mM Tempo for 10 min at 37 deg C or suboptimal heating (44 deg C/ 10 min) alone did not induce apoptosis. The combined treatment with 5 mM Tempo and 44 deg C for 10 min dramatically induced ∼90% apoptosis in 6 h, as did the 44 deg C/30 min heating. During the enhanced apoptosis, cytochrome c release progressed. Although signals of Bcl-2, Bcl-XL and Bax in cell lysates were not altered, Bax was specifically activated and translocated to mitochondria after the combined treatment. Further, loss of ΔΨ>and decreases in superoxide and ATP progressed after the combined treatment, suggesting that the treatment may disturb mitochondrial electron transport. Thus, Tempo sensitizes the heat-induced apoptosis through (1) targeting of Bax to mitochondria and releasing cytochrome c, and (2) mitochondrial dysfunction
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Andrographolide reversed 5-FU resistance in human colorectal cancer by elevating BAX expression.
Wang, Weicheng; Guo, Wenjie; Li, Lele; Fu, Zan; Liu, Wen; Gao, Jian; Shu, Yongqian; Xu, Qiang; Sun, Yang; Gu, Yanhong
2016-12-01
5-FU is the first line therapy for colorectal cancer, however, treatment effect is often hampered by the development of drug resistance or toxicity at high doses. Andrographolide is a natural diterpenoid from Andrographis paniculata which has anti-bacterial, anti-antiviral and anti-inflammation activities. In the current study, we test the hypothesis that Andrographolide reverses 5-FU resistance in colorectal cancer and examine the underlying mechanism. In vitro and vivo studies indicated that Andrographolide treatment significantly re-sensitizes HCT116/5-FUR cells (HCT116 cells which are 5-FU resistant) to cytotoxicity of 5-FU. Mechanism analysis showed that Andrographolide/5-FU co-treatment elevated apoptosis level of HCT116/5-FUR cells with highly increased level of BAX. By using biotin-Andrographolide pull down and cellular thermal shift assay, we found out that Andrographolide can directly target to BAX. Andrographolide-BAX interaction prevented BAX degradation, enhancing mitochondria-mediated apoptosis thus reversed 5-FU resistance while BAX silence diminished this effect. Further, by analyzing patient samples who received 5-FU involved chemotherapy, we found that expression level of BAX is correlated with PFS. Our results here provide a novel combination treatment strategy, especially for patients with 5-FU-resistant tumors expressing low level of BAX. Meanwhile, we also proposed that BAX expression may be a predicted and prognosis marker of 5-FU involved chemotherapy. Copyright © 2016 Elsevier Inc. All rights reserved.
Quantifying export production in the Southern Ocean: Implications for the Baxs proxy
Hernandez-Sanchez, Maria T.; Mills, Rachel A.; Planquette, HéLèNe; Pancost, Richard D.; Hepburn, Laura; Salter, Ian; Fitzgeorge-Balfour, Tania
2011-12-01
The water column and sedimentary Baxs distribution around the Crozet Plateau is used to decipher the controls and timing of barite formation and to evaluate how export production signals are recorded in sediments underlying a region of natural Fe fertilization within the Fe limited Southern Ocean. Export production estimated from preserved, vertical sedimentary Baxs accumulation rates are compared with published export fluxes assessed from an integrated study of the biological carbon pump to determine the validity of Baxs as a quantitative proxy under different Fe supply conditions typical of the Southern Ocean. Detailed assessment of the geochemical partitioning of Ba in sediments and the lithogenic end-member allows appropriate correction of the bulk Ba content and determination of the Baxs content of sediments and suspended particles. The upper water column distribution of Baxs is extremely heterogeneous spatially and temporally. Organic carbon/Baxs ratios in deep traps from the Fe fertilized region are similar to other oceanic settings allowing quantification of the inferred carbon export based on established algorithms. There appears to be some decoupling of POC and Ba export in the Fe limited region south of the Plateau. The export production across the Crozet Plateau inferred from the Baxs sedimentary proxy indicates that the Fe fertilized area to the north of the Plateau experiences enhanced export relative to equivalent Southern Ocean settings throughout the Holocene and that this influence may also have impacted the site to the south for significant periods. This interpretation is corroborated by alternative productivity proxies (opal accumulation, 231Paxs/230Thxs). Baxs can be used to quantify export production in complex settings such as naturally Fe-fertilized (volcanoclastic) areas, providing appropriate lithogenic correction is undertaken, and sediment focusing is corrected for along with evaluation of barite preservation.
Directory of Open Access Journals (Sweden)
Sopio Simonishvili
2013-11-01
Full Text Available OPC (oligodendrocyte progenitor cell death contributes significantly to the pathology and functional deficits following hypoxic-ischemic injury in the immature brain and to deficits resulting from demyelinating diseases, trauma and degenerative disorders in the adult CNS. Glutamate toxicity is a major cause of oligodendroglial death in diverse CNS disorders, and previous studies have demonstrated that AMPA/kainate receptors require the pro-apoptotic protein Bax in OPCs undergoing apoptosis. The goal of the present study was to define the pro-apoptotic and anti-apoptotic effectors that regulate Bax in healthy OPCs and after exposure to excess glutamate in vitro and following H–I (hypoxia–ischemia in the immature rat brain. We show that Bax associates with a truncated form of Bid, a BH3-only domain protein, subsequent to glutamate treatment. Furthermore, glutamate exposure reduces Bax association with the anti-apoptotic Bcl family member, Bcl-xL. Cell fractionation studies demonstrated that both Bax and Bid translocate from the cytoplasm to mitochondria during the early stages of cell death consistent with a role for Bid as an activator, whereas Bcl-xL, which normally complexes with both Bax and Bid, disassociates from these complexes when OPCs are exposed to excess glutamate. Bax remained unactivated in the presence of insulin-like growth factor-1, and the Bcl-xL complexes were protected. Our data similarly demonstrate loss of Bcl-xL–Bax association in white matter following H–I and implicate active Bad in Bax-mediated OPC death. To identify other Bax-binding partners, we used proteomics and identified cofilin as a Bax-associated protein in OPCs. Cofilin and Bax associated in healthy OPCs, whereas the Bax–cofilin association was disrupted during glutamate-induced OPC apoptosis.
Directory of Open Access Journals (Sweden)
Kangkai Wang
Full Text Available Mipu1 (myocardial ischemic preconditioning up-regulated protein 1, recently identified in our lab, is a novel zinc-finger transcription factor which is up-regulated during ischemic preconditioning. However, it is not clear what transcription factor contributes to its inducible expression. In the present study, we reported that HIF-1 regulates the inducible expression of Mipu1 which is involved in the cytoprotection of HIF-1α against oxidative stress by inhibiting Bax expression. Our results showed that the inducible expression of Mipu1 was associated with the expression and activation of transcription factor HIF-1 as indicated by cobalt chloride (CoCl2 treatment, HIF-1α overexpression and knockdown assays. EMSA and luciferase reporter gene assays showed that HIF-1α bound to the hypoxia response element (HRE within Mipu1 promoter region and promoted its transcription. Moreover, our results revealed that Mipu1 inhibited the expression of Bax, an important pro-apoptosis protein associated with the intrinsic pathway of apoptosis, elevating the cytoprotection of HIF-1 against hydrogen peroxide (H2O2-mediated injury in H9C2 cells. Our findings implied that Bax may be a potential target gene of transcription factor Mipu1, and provided a novel insight for understanding the cytoprotection of HIF-1 and new clues for further elucidating the mechanisms by which Mipu1 protects cell against pathological stress.
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data
DEFF Research Database (Denmark)
Kannan, Soumya; Sams, Thomas; Maury, Jérôme
2018-01-01
activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...
Precise regulation of gene expression dynamics favors complex promoter architectures.
Directory of Open Access Journals (Sweden)
Dirk Müller
2009-01-01
Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.
A BAX/BAK and cyclophilin D-independent intrinsic apoptosis pathway.
Directory of Open Access Journals (Sweden)
Sebastián Zamorano
Full Text Available Most intrinsic death signals converge into the activation of pro-apoptotic BCL-2 family members BAX and BAK at the mitochondria, resulting in the release of cytochrome c and apoptosome activation. Chronic endoplasmic reticulum (ER stress leads to apoptosis through the upregulation of a subset of pro-apoptotic BH3-only proteins, activating BAX and BAK at the mitochondria. Here we provide evidence indicating that the full resistance of BAX and BAK double deficient (DKO cells to ER stress is reverted by stimulation in combination with mild serum withdrawal. Cell death under these conditions was characterized by the appearance of classical apoptosis markers, caspase-9 activation, release of cytochrome c, and was inhibited by knocking down caspase-9, but insensitive to BCL-X(L overexpression. Similarly, the resistance of BIM and PUMA double deficient cells to ER stress was reverted by mild serum withdrawal. Surprisingly, BAX/BAK-independent cell death did not require Cyclophilin D (CypD expression, an important regulator of the mitochondrial permeability transition pore. Our results suggest the existence of an alternative intrinsic apoptosis pathway emerging from a cross talk between the ER and the mitochondria.
Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors
International Nuclear Information System (INIS)
Ahmed, M.
2003-01-01
Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
Viral promoters can initiate expression of toxin genes introduced into Escherichia coli
Directory of Open Access Journals (Sweden)
Jacob Daniela
2005-06-01
Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters
Directory of Open Access Journals (Sweden)
Gagniuc Paul
2012-09-01
Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
Liu, Qi; Si, Tianlei; Xu, Xiaoyun; Liang, Fuqiang; Wang, Lufeng; Pan, Siyi
2015-08-04
The decreased reproductive capacity of men is an important factor contributing to infertility. Accumulating evidence has shown that Electromagnetic radiation potentially has negative effects on human health. However, whether radio frequency electromagnetic radiation (RF-EMR) affects the human reproductive system still requires further investigation. Therefore, The present study investigates whether RF-EMR at a frequency of 900 MHz can trigger sperm cell apoptosis and affect semen morphology, concentration, and microstructure. Twenty four rats were exposed to 900 MHz electromagnetic radiation with a special absorption rate of 0.66 ± 0.01 W/kg for 2 h/d. After 50d, the sperm count, morphology, apoptosis, reactive oxygen species (ROS), and total antioxidant capacity (TAC), representing the sum of enzymatic and nonenzymatic antioxidants, were investigated. Western blotting and reverse transcriptase PCR were used to determine the expression levels of apoptosis-related proteins and genes, including bcl-2, bax, cytochrome c, and capase-3. In the present study, the percentage of apoptotic sperm cells in the exposure group was significantly increased by 91.42% compared with the control group. Moreover, the ROS concentration in exposure group was increased by 46.21%, while the TAC was decreased by 28.01%. Radiation also dramatically decreased the protein and mRNA expression of bcl-2 and increased that of bax, cytochrome c, and capase-3. RF-EMR increases the ROS level and decreases TAC in rat sperm. Excessive oxidative stress alters the expression levels of apoptosis-related genes and triggers sperm apoptosis through bcl-2, bax, cytochrome c and caspase-3 signaling pathways.
Mutational analysis of Bax and Bcl-2 in childhood acute lymphoblastic leukaemia
Salomons, G. S.; Buitenhuis, C. K.; Martínez Muñoz, C.; Verwijs-Jassen, M.; Behrendt, H.; Zsiros, J.; Smets, L. A.
1998-01-01
In childhood acute lymphoblastic leukaemia there are large interpatient variations in levels of the apoptosis-regulating proteins Bax and Bcl-2, but the molecular basis for this variation is unknown. Point-mutations in bax have been reported in cell lines derived from haematological malignancies.
Expression and significance of Bax protein in model of radiation injury in mouse skin
International Nuclear Information System (INIS)
Feng Yizhong; Mo Yahong
2002-01-01
Objective: The study is to find some valuable criteria for diagnosis and treatment of radiation injury in skin. Methods: The expression of Bax protein was studied by SP immunohistochemistry in 40 cases of model of radiation injury in mouse skin. Their relationship relating to radiation dose was also investigated. Results: The expression rates of Bax were 30%, 30%, 70%, 70% in 5 Gy group, 15 Gy group, 30 Gy group, 45 Gy group respectively. There was no significant correlation between the expression of Bax and radiation groups. Conclusions: The experiment shows that radiation can increase the expression of Bax protein which might be related to poor healing in radiation skin injury
Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...
African Journals Online (AJOL)
Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...
Directory of Open Access Journals (Sweden)
Ana Maria Furtado-Veloso
2008-04-01
Full Text Available OBJETIVO: avaliar a expressão do antígeno Bax no epitélio mamário normal de mulheres na pré-menopausa tratadas com raloxifeno. MÉTODOS: estudo randomizado duplo-cego, envolvendo 33 mulheres pré-menopáusicas com fibroadenoma. As pacientes foram divididas em dois grupos: Placebo, (n=18 e Raloxifeno 60 mg, (n=15. A medicação foi usada durante 22 dias, começando no primeiro dia do ciclo menstrual. Uma biópsia foi realizada no 23º dia do ciclo menstrual, durante a qual uma amostra do tecido mamário normal adjacente ao fibroadenoma foi coletada e submetida a estudo imuno-histoquímico utilizando o anticorpo policlonal anti-Bax para avaliar a expressão da proteína Bax. A imunorreação para a proteína Bax foi avaliada, levando-se em consideração a intensidade e a fração de células coradas, cuja combinação resultou em um escore final de 0 a 6. Os casos com escore final >3 foram classificados como positivos para proteína Bax. O teste do c2 foi usado para análise estatística dos dados (pPURPOSE: to evaluate the expression of Bax antigen in the normal mammary epithelium of premenopausal women treated with raloxifene. METHODS: a randomized double-blind study was conducted in 33 ovulatory premenopausal women with fibroadenoma. Patients were divided into two groups: Placebo, (n=18 and Raloxifene 60 mg, (n=15. The medication was used for 22 days, beginning on the first day of the menstrual cycle. An excisional biopsy was carried out on the 23rd day of the menstrual cycle and a sample of normal breast tissue adjacent to the fibroadenoma was collected and submitted to immunohistochemical study using anti-Bax polyclonal antibody to evaluate the expression of Bax protein. Immunoreaction for Bax was evaluated taking into consideration intensity and fraction of stained cells, whose combination resulted in a final score ranging from 0 to 6. Cases with a final score >3 were classified as positive for Bax. The c2 test was used for statistical
Dyugovskaya, Larissa; Polyakov, Andrey; Cohen-Kaplan, Victoria; Lavie, Peretz; Lavie, Lena
2012-10-22
inhibition decreased Mcl-1 expression. Similar to neutrophils of healthy subjects exposed to IH (0.97± 0.2), in OSA neutrophils, Bax/Mcl-1 ratio was significantly lower compared to normoxic controls (1.0±0.5 vs.1.99±0.3, p=0.015), and Bax did not co-localize with mitochondria. These findings suggest that decreased Bax/Mcl-1 balance promotes neutrophil survival in IH in-vitro as well as in OSA patients. Moreover, Bax/Mcl-1 protein function in IH and SH might be regulated by different signal transduction pathways, highlighting a novel regulatory function through ERK1/2 signaling in IH.
Directory of Open Access Journals (Sweden)
Dyugovskaya Larissa
2012-10-01
the IH-induced Mcl-1 increase. In SH, only p38MAPK inhibition decreased Mcl-1 expression. Similar to neutrophils of healthy subjects exposed to IH (0.97± 0.2, in OSA neutrophils, Bax/Mcl-1 ratio was significantly lower compared to normoxic controls (1.0±0.5 vs.1.99±0.3, p=0.015, and Bax did not co-localize with mitochondria. Conclusions These findings suggest that decreased Bax/Mcl-1 balance promotes neutrophil survival in IH in-vitro as well as in OSA patients. Moreover, Bax/Mcl-1 protein function in IH and SH might be regulated by different signal transduction pathways, highlighting a novel regulatory function through ERK1/2 signaling in IH.
Tice, George; Andaloro, Bridget; White, H Kirk; Bolton, Lance; Wang, Siqun; Davis, Eugene; Wallace, Morgan
2009-01-01
In 2006, DuPont Qualicon introduced the BAX system Q7 instrument for use with its assays. To demonstrate the equivalence of the new and old instruments, a validation study was conducted using the BAX system PCR Assay for Salmonella, AOAC Official Method 2003.09, on three food types. The foods were simultaneously analyzed with the BAX system Q7 instrument and either the U.S. Food and Drug Administration Bacteriological Analytical Manual or the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook reference method for detecting Salmonella. Comparable performance between the BAX system and the reference methods was observed. Of the 75 paired samples analyzed, 39 samples were positive by both the BAX system and reference methods, and 36 samples were negative by both the BAX system and reference methods, demonstrating 100% correlation. Inclusivity and exclusivity for the BAX system Q7 instrument were also established by testing 50 Salmonella strains and 20 non-Salmonella isolates. All Salmonella strains returned positive results, and all non-Salmonella isolates returned a negative response.
Opposite role of Bax and BCL-2 in the anti-tumoral responses of the immune system
International Nuclear Information System (INIS)
Bougras, Gwenola; Cartron, Pierre-François; Gautier, Fabien; Martin, Stéphane; LeCabellec, Marité; Meflah, Khaled; Gregoire, Marc; Vallette, François M
2004-01-01
The relative role of anti apoptotic (i.e. Bcl-2) or pro-apoptotic (e.g. Bax) proteins in tumor progression is still not completely understood. The rat glioma cell line A15A5 was stably transfected with human Bcl-2 and Bax transgenes and the viability of theses cell lines was analyzed in vitro and in vivo. In vitro, the transfected cell lines (huBax A15A5 and huBcl-2 A15A5) exhibited different sensitivities toward apoptotic stimuli. huBax A15A5 cells were more sensitive and huBcl-2 A15A5 cells more resistant to apoptosis than mock-transfected A15A5 cells (pCMV A15A5). However, in vivo, in syngenic rat BDIX, these cell lines behaved differently, as no tumor growth was observed with huBax A15A5 cells while huBcl-2 A15A5 cells formed large tumors. The immune system appeared to be involved in the rejection of huBax A15A5 cells since i) huBax A15A5 cells were tumorogenic in nude mice, ii) an accumulation of CD8+ T-lymphocytes was observed at the site of injection of huBax A15A5 cells and iii) BDIX rats, which had received huBax A15A5 cells developed an immune protection against pCMV A15A5 and huBcl-2 A15A5 cells. We show that the expression of Bax and Bcl-2 controls the sensitivity of the cancer cells toward the immune system. This sensitization is most likely to be due to an increase in immune induced cell death and/or the amplification of an anti tumour immune response
Directory of Open Access Journals (Sweden)
Julie Jodoin
2009-08-01
Full Text Available Previously, we have shown the loss of anti-Bax function in Creutzfeldt Jakob disease (CJD-associated prion protein (PrP mutants that are unable to generate cytosolic PrP (CyPrP. To determine if the anti-Bax function of PrP modulates the manifestation of prion diseases, we further investigated the anti-Bax function of eight familial Gerstmann-Sträussler-Scheinker Syndrome (GSS-associated PrP mutants. These PrP mutants contained their respective methionine ((M or valine ((V at codon 129. All of the mutants lost their ability to prevent Bax-mediated chromatin condensation or DNA fragmentation in primary human neurons. In the breast carcinoma MCF-7 cells, the F198S(V, D202N(V, P102L(V and Q217R(V retained, whereas the P102L(M, P105L(V, Y145stop(M and Q212P(M PrP mutants lost their ability to inhibit Bax-mediated condensed chromatin. The inhibition of Bax-mediated condensed chromatin depended on the ability of the mutants to generate cytosolic PrP. However, except for the P102L(V, none of the mutants significantly inhibited Bax-mediated caspase activation. These results show that the cytosolic PrP generated from the GSS mutants is not as efficient as wild type PrP in inhibiting Bax-mediated cell death. Furthermore, these results indicate that the anti-Bax function is also disrupted in GSS-associated PrP mutants and is not associated with the difference between CJD and GSS.
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Molahosseini, A; Taghavi, M M; Taghipour, Z; Shabanizadeh, A; Fatehi, F; Kazemi Arababadi, M; Eftekhar Vaghefe, S H
2016-10-31
Diabetes is the most common endocrine disorder in humans with multiple complications including nervous system damages. The aim of the present study was to determine the effect of ginger extract on apoptosis of the neurons of hippocampus, via evaluation of BAX and Cyclin D1 and also histological analysis, in male diabetic rats. In this experimental study, 60 Wistar rats (220 ± 30gr) were conducted in 5 groups as follow: diabetic group treated with saline (group 1), normal group treated with saline (group 2), diabetic group treated with ginger (group 3), diabetic group treated with ginger-insulin (group 4), diabetic group treated with insulin (group 5). STZ (60 mg/kg) was intraperitoneally used to induce the diabetes. Expression levels of BAX and Cyclin D1 were examined using Real-Time PCR technique and the normality of neurons was evaluated using H&E staining method. The results showed that blood glucose level significantly decreased in group 4 when compared to group 1. In molecular analysis, there was no significant difference between groups regarding the expression of BAX gens, while, the expression of Cyclin D1 were significantly decreased in group 4 compared with group 1. Histological analysis revealed that pathological symptoms were lower in group 4 than the other diabetic groups. The results of present study showed that the ginger in addition to lowering blood sugar level, changes the expression of Cyclin D1 gene and histological characteristics in a positive manner. This means that the ginger may protects neurons of the hippocampus from apoptosis in diabetic patients.
Heaton, Marieta Barrow; Siler-Marsiglio, Kendra; Paiva, Michael; Kotler, Alexandra; Rogozinski, Jonathan; Kubovec, Stacey; Coursen, Mary; Madorsky, Vladimir
2012-01-01
These studies investigated interactions taking place at the mitochondrial membrane in neonatal rat cerebellum following ethanol exposure, and focused on interactions between pro-apoptotic Bax and proteins of the permeability transition pore (PTP), voltage-dependent anion channel (VDAC), and adenine nucleotide translocator (ANT), of the outer and inner mitochondrial membranes, respectively. Cultured cerebellar granule cells were used to assess the role of these interactions in ethanol neurotoxicity. Analyses were made at the age of maximal cerebellar ethanol vulnerability (P4), compared to the later age of relative resistance (P7), to determine whether differential ethanol sensitivity was mirrored by differences in these molecular interactions. We found that following ethanol exposure, Bax pro-apoptotic associations with both VDAC and ANT were increased, particularly at the age of greater ethanol sensitivity, and these interactions were sustained at this age for at least two hours post-exposure. Since Bax:VDAC interactions disrupt protective VDAC interactions with mitochondrial hexokinase (HXK), we also assessed VDAC:HXK associations following ethanol treatment, and found such interactions were altered by ethanol treatment, but only at two-hours post-exposure, and only in the P4, ethanol-sensitive cerebellum. Ethanol neurotoxicity in cultured neuronal preparations was abolished by pharmacological inhibition of both VDAC and ANT interactions with Bax, but not by a Bax channel blocker. Therefore, we conclude that at this age, within the constraints of our experimental model, a primary mode of Bax-induced initiation of the apoptosis cascade following ethanol insult involves interactions with proteins of the PTP complex, and not channel formation independent of PTP constituents. PMID:22767450
Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu
2017-11-24
Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagnostic value of TUG1 in LAD patients, and further uncovered the underlying functional mechanism. Our results showed that TUG1 was significantly upregulated in LAD cells and serum samples. Receiver operator characteristic (ROC) analysis suggested a relatively higher area under the curve (AUC) of TUG1 (0.756) contrast to cyfra21-1 (0.619). In addition, high TUG1 level was associated with enhanced tumor size, degree of differentiation, lymph node metastases, distant metastasis and TNM stage. Cell functional assays showed that knockdown of TUG1 suppressed LAD cell viability and promoted cell apoptosis. We then sought to reveal the underlying regulatory mechanism, and the pro-apoptotic protein BAX was then identified as the downstream target of TUG1. Gain and loss functional assays showed that inhibition of BAX reversed the induced apoptosis by TUG1 knockdown. Finally, RNA immunoprecipitation and Chromatin immunoprecipitation revealed that TUG1 suppressed BAX expression through physically interacting with EZH2. In conclusion, lncRNA TUG1 is a promising diagnostic marker for LAD patients and suppression of TUG1 levels could be a future direction to promote the prognosis of LAD patients.
Directory of Open Access Journals (Sweden)
Molouki Aidin
2012-08-01
Full Text Available Abstract Background Recently it was shown that following infection of HeLa cells with Newcastle disease virus (NDV, the matrix (M protein binds to Bax and subsequently the intrinsic pathway of apoptosis is activated. Moreover, there was very little alteration on mRNA and protein levels of Bax and Bcl-2 after infection with NDV. Finding In order to further investigate the role of members of the Bcl-2 family, Bax-knockout and wild-type HCT116 cells were infected with NDV strain AF2240. Although both cells underwent apoptosis through the activation of the intrinsic pathway and the release of cytochrome c from mitochondria, the percentage of dead Bax-knockout cells was significantly lower than wt cells (more than 10% at 48 h post-infection. In a parallel experiment, the effect of NDV on HT29 cells, that are originally Bcl-2-free, was studied. Apoptosis in HT29 cells was associated with Bax redistribution from cytoplasm to mitochondria, similar to that of HeLa and wt HCT116 cells. Conclusion Although the presence of Bax during NDV-induced apoptosis contributes to a faster cell death, it was concluded that other apoptotic protein(s upstream of mitochondria are also involved since cancer cells die whether in the presence or absence of Bax. Therefore, the classic Bax/Bcl-2 ratio may not be a major determinant in NDV-induced apoptosis.
A novel BDNF gene promoter directs expression to skeletal muscle
Directory of Open Access Journals (Sweden)
Heinrich Gerhard
2003-06-01
Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.
Directory of Open Access Journals (Sweden)
Jianqing Pan
Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
The studies on thyrocyte apoptosis and expression of Bcl-2 and Bax in Hashimoto's thyroiditis
International Nuclear Information System (INIS)
Zhao Yaping; Wang Jialing; Fan Zhiyong; Liu Zehong; Wu HeJun; Zhou Wei; Jia Meizhai
2003-01-01
To investigate the thyrocyte apoptosis, the expression of Bcl-2, Bax and the relationship between apoptosis and the pathogenesis in Hashimoto's thyroiditis (HT), 41 HT thyroid and 10 normal thyroid specimens were selected. The level of apoptosis was detected by TUNEL methods. The expression and distribution of Bcl-2 and Bax were detected using immunohistochemical methods and analyzed by Mias99 pathological image system. Immunohistochemical staining was carried out using S-P kit. The Result showed that an increased level of apoptosis was observed in Hashimoto's glands. The apoptosis mainly distributed in thyroid follicles destruction area. This was associated with increased Bax expression. The strongly positive Bcl-2 staining was observed in the thyrocyte of intact thyroid follicles. The ratios of positive granule area and total light density of Bcl-2 to those of Bax in HT thyroid follicle area were lower than those in normal thyroid. The apoptosis of thyrocyte induced by dysregulation of Bcl-2 and Bax may be involved in the pathogeneses of HT
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Siu, Woen Ping; Pun, Pamela Boon Li; Latchoumycandane, Calivarathan; Boelsterli, Urs A
2008-03-15
Diclofenac, a widely used nonsteroidal anti-inflammatory drug, has been associated with rare but severe cases of clinical hepatotoxicity. Diclofenac causes concentration-dependent cell death in human hepatocytes (after 24-48 h) by mitochondrial permeabilization via poorly defined mechanisms. To explore whether the cyclophilin D (CyD)-dependent mitochondrial permeability transition (mPT) and/or the mitochondrial outer membrane permeabilization (MOMP) was primarily involved in mediating cell death, we exposed immortalized human hepatocytes (HC-04) to apoptogenic concentrations of diclofenac (>500 microM) in the presence or absence of inhibitors of upstream mediators. The CyD inhibitor, cyclosporin A (CsA, 2 microM) fully inhibited diclofenac-induced cell injury, suggesting that mPT was involved. However, CyD gene silencing using siRNA left the cells susceptible to diclofenac toxicity, and CsA still protected the CyD-negative cells from lethal injury. Diclofenac induced early (9 h) activation of Bax and Bak and caused mitochondrial translocation of Bax, indicating that MOMP was involved in cell death. Inhibition of Bax protein expression by using siRNA significantly protected HC-04 from diclofenac-induced cell injury. Diclofenac also induced early Bid activation (tBid formation, 6 h), which is an upstream mechanism that initiates Bax activation and mitochondrial translocation. Bid activation was sensitive to the Ca2+ chelator, BAPTA. In conclusion, we found that Bax/Bak-mediated MOMP is a key mechanism of diclofenac-induced lethal cell injury in human hepatocytes, and that CsA can prevent MOMP through inhibition of Bax activation. These data support our concept that the Ca2+-Bid-Bax-MOMP axis is a critical pathway in diclofenac (metabolite)-induced hepatocyte injury.
International Nuclear Information System (INIS)
Siu, W.P.; Pun, Pamela Boon Li; Latchoumycandane, Calivarathan; Boelsterli, Urs A.
2008-01-01
Diclofenac, a widely used nonsteroidal anti-inflammatory drug, has been associated with rare but severe cases of clinical hepatotoxicity. Diclofenac causes concentration-dependent cell death in human hepatocytes (after 24-48 h) by mitochondrial permeabilization via poorly defined mechanisms. To explore whether the cyclophilin D (CyD)-dependent mitochondrial permeability transition (mPT) and/or the mitochondrial outer membrane permeabilization (MOMP) was primarily involved in mediating cell death, we exposed immortalized human hepatocytes (HC-04) to apoptogenic concentrations of diclofenac (> 500 μM) in the presence or absence of inhibitors of upstream mediators. The CyD inhibitor, cyclosporin A (CsA, 2 μM) fully inhibited diclofenac-induced cell injury, suggesting that mPT was involved. However, CyD gene silencing using siRNA left the cells susceptible to diclofenac toxicity, and CsA still protected the CyD-negative cells from lethal injury. Diclofenac induced early (9 h) activation of Bax and Bak and caused mitochondrial translocation of Bax, indicating that MOMP was involved in cell death. Inhibition of Bax protein expression by using siRNA significantly protected HC-04 from diclofenac-induced cell injury. Diclofenac also induced early Bid activation (tBid formation, 6 h), which is an upstream mechanism that initiates Bax activation and mitochondrial translocation. Bid activation was sensitive to the Ca 2+ chelator, BAPTA. In conclusion, we found that Bax/Bak-mediated MOMP is a key mechanism of diclofenac-induced lethal cell injury in human hepatocytes, and that CsA can prevent MOMP through inhibition of Bax activation. These data support our concept that the Ca 2+ -Bid-Bax-MOMP axis is a critical pathway in diclofenac (metabolite)-induced hepatocyte injury
International Nuclear Information System (INIS)
Sun Yuanlin; Tang Jian; Gu Xiaohong; Li Deyuan
2009-01-01
Objective: To investigate the effect of polysaccharides from Angelica sinensis (ASP3) on Bcl-2 and Bax protein expression of irradiated liver cells from mice. Methods: Bcl-2 and Bax protein expression of liver cells in vitro exposed to 2.0 Gy rays were examined by using immunohistochemistry method. Results: The expression of apoptosis-accelerating protein Bax in the irradiation group was enhanced obviously (70.83%), while apoptosis inhibiting protein Bcl-2 tended to decline (55.60%), with the statistically significant difference (P <0.01) compared with that of the control. ASP3 pretreatment could regulate Bcl-2 and Bax protein expression of liver cells, inhibiting Bax protein expression(64.14/58.37%) and increasing Bcl-2 protein expression(59.21%/ 67.45%). The differences between the high dosage (100 mg/L of ASP3) and the irradiation group were statistically significant (P<0.05). Conclusions: ASP3 pretreatment could prohibit the apoptosis of radiation- damaged liver cells due to abnormal expression of Bcl-2 and Bax, and reduce the cell apoptosis by increasing Bcl-2/Bax protein expression so as to enhance the radiation endurance of liver cells. (authors)
Gao, Meili; Li, Yongfei; Ji, Xiaoying; Xue, Xiaochang; Chen, Lan; Feng, Guodong; Zhang, Huqin; Wang, Huichun; Shah, Walayat; Hou, Zhanwu; Kong, Yu
2016-03-01
Epidemiological studies have demonstrated that cigarette smoking is an important cofactor or an independent risk factor for the development of cervical cancer. Benzo(a)pyrene (BaP) is one of the most potent tobacco smoke carcinogens in tobacco smoke. BaP induced DNA damage and over expression in p53 cervical tissue of mice as demonstrated in our previous study. Here we present the findings of exposure to BaP on the expression of Bcl-2, C-myc, Ki-67, Caspase-3 and Bax genes in mouse cervix. Acute intraperitoneal administration of BaP (12.5, 25, 50, 100mg/kg body weight) to ICR female mice induced a significant increase in Bcl-2, C-myc, Ki-67 mRNA and protein level till 72h except in Bcl-2 at 24h with 12.5, 25, 50mg/kg as well as at 48h with 12.5mg/kg body weight post treatment. A significant increase was also seen in Caspase-3 and Bax mRNA and protein level with peak level at 24h and gradual decrease till 72h, however, the expression of caspase-3 increased while that of Bax decreased with increasing dose of Bap after 24h. In sub chronic intraperitoneal and oral gavage administration of BaP (2.5, 5, 10mg/kg body weight), similar significant increase was observed for all the examined genes as compared to the control and vehicle groups, however the expression of Bax decreased in a dose dependent manner. The findings of this study will help in further understanding the molecular mechanism of BaP induced carcinogenesis of cervical cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.
Bax/Bcl-2 expression ratio in prediction of response to breast cancer radiotherapy
Directory of Open Access Journals (Sweden)
Hosein Azimian
2018-03-01
Full Text Available Objective(s: Radiotherapy is one of the most effective modalities of cancer therapy, but clinical responses of individual patients varies considerably. To enhance treatment efficiency it is essential to implement an individual-based treatment. The aim of present study was to identify the mechanism of intrinsic apoptosis pathway on radiosensitivity and normal tissue complications caused by the radiotherapy. Materials and Methods: Peripheral blood mononuclear cells from ten breast cancer patients were exposed to 6MV X-rays to deliver 1 and 2 Gy. Expression levels of Bax, Bcl-2, and Bax/Bcl-2 ratio were examined by relative quantitative RT-PCR. All the patients received similar tangential irradiation of the whole breast and conventional fractionation. Skin dosimetry was done by GAFChromic EBT-3 film and clinical radiosensitivity was determined using the acute reactions to radiotherapy of the skin according to Radiation Therapy Oncology Group score. All statistical analyses were performed using GraphPad Prism, version 7.01. Results: In the in-vitro experiment, Bax and Bax/Bcl-2 ratios were significantly increased with 1 and 2 Gy doses (PP0.05 for all patients. Conclusion: Significant correlation between Bax/Bcl-2 ratio determined before radiation therapy and clinical response in the patients, can be used as a biomarker to identify radiosensitive individuals. However, further studies are required to validate radiation-induced apoptotic biomarkers.
Directory of Open Access Journals (Sweden)
Andrea Degl'Innocenti
Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings
Directory of Open Access Journals (Sweden)
Ji-Hyun Yeom
Full Text Available Use of non-biological agents for mRNA delivery into living systems in order to induce heterologous expression of functional proteins may provide more advantages than the use of DNA and/or biological vectors for delivery. However, the low efficiency of mRNA delivery into live animals, using non-biological systems, has hampered the use of mRNA as a therapeutic molecule. Here, we show that gold nanoparticle-DNA oligonucleotide (AuNP-DNA conjugates can serve as universal vehicles for more efficient delivery of mRNA into human cells, as well as into xenograft tumors generated in mice. Injections of BAX mRNA loaded on AuNP-DNA conjugates into xenograft tumors resulted in highly efficient mRNA delivery. The delivered mRNA directed the efficient production of biologically functional BAX protein, a pro-apoptotic factor, consequently inhibiting tumor growth. These results demonstrate that mRNA delivery by AuNP-DNA conjugates can serve as a new platform for the development of safe and efficient gene therapy.
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation
International Nuclear Information System (INIS)
Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.
2005-01-01
The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV
Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.
Directory of Open Access Journals (Sweden)
María Berdasco
Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
International Nuclear Information System (INIS)
Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.
1997-01-01
Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant
Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene
International Nuclear Information System (INIS)
Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.
International Nuclear Information System (INIS)
Romani, Antonello A; Soliani, Paolo; Desenzani, Silvia; Borghetti, Angelo F; Crafa, Pellegrino
2006-01-01
Maspin, a member of the serpin family, is a suppressor of tumor growth, an inhibitor of angiogenesis and an inducer of apoptosis. Maspin induces apoptosis by increasing Bax, a member of the Bcl-2 family of apoptosis-regulating proteins. In this exploratory study, we investigated the associated expression of Maspin and Bax proteins as a potential prognostic factor in intrahepatic cholangiocarcinoma (IHCCA). Twenty-two paraffin-embedded samples were analyzed by immunohistochemical methods using Maspin, Bax and CD34 antibodies. Maspin was scored semiquantitatively (HSCORE). Apoptosis was assessed using an antibody against cleaved caspase-3. The strong relationship observed between the expression of Maspin and Bax, indicates that Bax is likely to be the key effector of Maspin-mediated induction of apoptosis as indicated by the activation of cleaved caspase-3. We categorized Maspin HSCORE by calculating the optimal cutpoint. A Maspin HSCORE above the cutpoint was inversely related with tumor dimension, depth of tumor and vascular invasion. Uni/multivariate analysis suggests that a Maspin HSCORE below the cutpoint significantly worsens the patients' prognosis. Tumors with Maspin HSCORE below the cutpoint had a shorter survival (11+/-5 months) than did patients with Maspin HSCORE above the cutpoint (27+/-4 months), whereas Kaplan-Meier analysis and logrank test showed no significant difference in overall survival between the patients. The associated expression of Maspin and Bax might delay tumor progression in IHCCA. Maspin above the cutpoint might counteract tumor development by increasing cell apoptosis, and by decreasing tumor mass and cell invasion. The combined expression of Maspin and Bax appears to influence the susceptibility of tumor cholangiocytes to apoptosis and thus may be involved in delaying IHCCA progression
Benard, Anne; Janssen, Connie M; van den Elsen, Peter J; van Eggermond, Marja C J A; Hoon, Dave S B; van de Velde, Cornelis J H; Kuppen, Peter J K
2014-12-01
The apoptosis pathway of programmed cell death is frequently deregulated in cancer. An intact apoptosis pathway is required for proper response to anti-cancer treatment. We investigated the chromatin status of key apoptosis genes in the apoptosis pathway in colorectal cancer cell lines in relation to apoptosis induced by chemo-, immune- or radiation therapy. Using chromatin immunoprecipitation (ChIP), we measured the presence of transcription-activating histone modifications H3Ac and H3K4me3 and silencing modifications H3K9me3 and H3K27me3 at the gene promoter regions of key apoptosis genes Bax, Bcl2, Caspase-9, Fas (CD95) and p53. Cell lines DLD1, SW620, Colo320, Caco2, Lovo and HT29 were treated with cisplatin, anti-Fas or radiation. The apoptotic response was measured by flow cytometry using propidium iodide and annexin V-FITC. The chromatin status of the apoptosis genes reflected the activation status of the intrinsic (Bax, Bcl2, Caspase-9 and p53) and extrinsic (Fas) pathways. An active intrinsic apoptotic pathway corresponded to sensitivity to cisplatin and radiation treatment of cell lines DLD1, SW620 and Colo320. An active Fas promoter corresponded to an active extrinsic apoptotic pathway in cell line DLD1. mRNA expression data correlated with the chromatin status of the apoptosis genes as measured by ChIP. In conclusion, the results presented in this study indicate that the balance between activating and silencing histone modifications, reflecting the chromatin status of apoptosis genes, can be used to predict the response of tumor cells to different anti-cancer therapies and could provide a novel target to sensitize tumors to obtain adequate treatment responses.
Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina
Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue
2006-12-01
Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Moradzadeh, Maliheh; Tabarraei, Alijan; Sadeghnia, Hamid Reza; Ghorbani, Ahmad; Mohamadkhani, Ashraf; Erfanian, Saiedeh; Sahebkar, Amirhossein
2018-02-01
Acute promyelocytic leukemia (APL) is one of the most life-threatening hematological malignancies. Defects in the cell growth and apoptotic pathways are responsible for both disease pathogenesis and treatment resistance. Therefore, pro-apoptotic agents are potential candidates for APL treatment. Kaempferol is a flavonoid with antioxidant and anti-tumor properties. This study was designed to investigate the cytotoxic, pro-apoptotic, and differentiation-inducing effects of kaempferol on HL-60 and NB4 leukemia cells. Resazurin assay was used to determine cell viability following treatment with kaempferol (12.5-100 μM) and all-trans retinoic acid (ATRA; 10 μM; used as a positive control). Apoptosis and differentiation were also detected using propidium iodide and NBT staining techniques, respectively. Furthermore, the expression levels of genes involved in apoptosis (PI3 K, AKT, BCL2, BAX, p53, p21, PTEN, CASP3, CASP8, and CASP9), differentiation (PML-RAR and HDAC1), and multi-drug resistance (ABCB1 and ABCC1) were determined using quantitative real-time PCR. The protein expressions of Bax/Bcl2 and casp3 were confirmed using Western blot. The results showed that kaempferol decreased cell viability and increased subG1 population in the tested leukemic cells. This effect was associated with decreased expression of Akt, BCL2, ABCB1, and ABCC1 genes, while the expression of CASP3 and BAX/BCL-2 ratio were significantly increased at both gene and protein levels. Kaempferol promoted apoptosis and inhibited multidrug resistance in a concentration-dependent manner, without any differential effect on leukemic cells. In conclusion, this study suggested that kaempferol may be utilized as an appropriate alternative for ATRA in APL patients. © 2017 Wiley Periodicals, Inc.
Nardiello, Tricia; Jungbluth, Achim A; Mei, Anna; Diliberto, Maurizio; Huang, Xiangao; Dabrowski, Ania; Andrade, Valéria C C; Wasserstrum, Rebecca; Ely, Scott; Niesvizky, Ruben; Pearse, Roger; Coleman, Morton; Jayabalan, David S; Bhardwaj, Nina; Old, Lloyd J; Chen-Kiang, Selina; Cho, Hearn Jay
2011-07-01
The type I Melanoma Antigen GEnes (MAGEs) are commonly expressed in cancers, fueling speculation that they may be therapeutic targets with oncogenic potential. They form complexes with RING domain proteins that have E3 ubiquitin ligase activity and promote p53 degradation. MAGE-A3 was detected in tumor specimens from patients with multiple myeloma and its expression correlated with higher frequencies of Ki-67(+) malignant cells. In this report, we examine the mechanistic role of MAGE-A in promoting survival of proliferating multiple myeloma cells. The impact of MAGE-A3 expression on survival and proliferation in vivo was examined by immunohistochemical analysis in an independent set of tumor specimens segregated into two groups: newly diagnosed, untreated patients and patients who had relapsed after chemotherapy. The mechanisms of MAGE-A3 activity were investigated in vitro by silencing its expression by short hairpin RNA interference in myeloma cell lines and primary cells and assessing the resultant effects on proliferation and apoptosis. MAGE-A3 was detected in a significantly higher percentage of relapsed patients compared with newly diagnosed, establishing a novel correlation with progression of disease. Silencing of MAGE-A showed that it was dispensable for cell cycling, but was required for survival of proliferating myeloma cells. Loss of MAGE-A led to apoptosis mediated by p53-dependent activation of proapoptotic Bax expression and by reduction of survivin expression through both p53-dependent and -independent mechanisms. These data support a role for MAGE-A in the pathogenesis and progression of multiple myeloma by inhibiting apoptosis in proliferating myeloma cells through two novel mechanisms.
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
A novel binary T-vector with the GFP reporter gene for promoter characterization.
Directory of Open Access Journals (Sweden)
Shu-Ye Jiang
Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.
Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer
Directory of Open Access Journals (Sweden)
V Shilpa
2014-01-01
Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Directory of Open Access Journals (Sweden)
Yousif A. Asiri
2010-01-01
Full Text Available Cyclophosphamide (CP is a widely used drug in cancer chemotherapy and immunosuppression, which could cause toxicity of the normal cells due to its toxic metabolites. Probucol, a cholesterol-lowering drug, acts as potential inhibitor of DNA damage and shows to protect against doxorubicin-induced cardiomyopathy by enhancing the endogenous antioxidant system including glutathione peroxidase, catalase and superoxide dismutase. This study examined the possible protective effects of probucol, a lipid-lowering compound with strong antioxidant properties, against CPinduced cardiotoxicity. This objective could be achieved through studying the gene expression-based on the possible protective effects of probucol against CP-induced cardiac failure in rats. Adult male Wistar albino rats were assigned into four treatment groups: Animals in the first (control and second (probucol groups were injected intraperitoneally with corn oil and probucol (61 mg/kg/day, respectively, for two weeks. Animals in the third (CP and fourth (probucol plus CP groups were injected with the same doses of corn oil and probucol (61 mg/kg/day, respectively, for one week before and one week after a single dose of CP (200 mg/kg, I.P.. The p53, Bax, Bcl2 and oxidative genes signal expression were measured by real time PCR. CP-induced cardiotoxicity was clearly observed by a significant increase in serum creatine phosphokinase isoenzyme (CK-MB (117%, lactate dehydrogenase (LDH (64%, free (69% and esterified cholesterol (42% and triglyceride (69% compared to control group. In cardiac tissues, CP significantly increases the mRNA expression levels of apoptotic genes, p53 with two-fold and Bax with 1.6-fold, and decreases the anti-apoptotic gene Bcl2 with 0.5-fold. Moreover, CP caused downregulation of antioxidant genes, glutathione peroxidase, catalase, and superoxide dismutase and increased the lipid peroxidation and decreased adenosine triphosphate (ATP (40% and ATP/ADP (44% in cardiac
Kopić, A; Benamara, K; Piskernik, C; Plaimauer, B; Horling, F; Höbarth, G; Ruthsatz, T; Dietrich, B; Muchitsch, E-M; Scheiflinger, F; Turecek, M; Höllriegl, W
2016-07-01
Essentials ADAMTS-13-deficiency is a cause of thrombotic thrombocytopenic purpura (TTP). Preclinical safety of recombinant human ADAMTS-13 (BAX930) was shown in animal models. Preclinical efficacy of BAX930 was shown in a mouse model of TTP. BAX930 showed advantageous efficacy over fresh frozen plasma, the current standard of care. Click to hear Dr Cataland and Prof. Lämmle present a seminar on Thrombotic Thrombocytopenic Purpura (TTP): new Insights in Pathogenesis and Treatment Modalities. Background Thrombotic thrombocytopenic purpura (TTP) is a rare blood disorder characterized by microthrombosis in small blood vessels of the body, resulting in a low platelet count. Baxalta has developed a new recombinant ADAMTS-13 (rADAMTS-13) product (BAX930) for on-demand and prophylactic treatment of patients with hereditary TTP (hTTP). Objectives To evaluate the pharmacokinetics, efficacy and safety of BAX930 in different species, by use of an extensive preclinical program. Methods The prophylactic and therapeutic efficacies of BAX930 were tested in a previously established TTP mouse model. Pharmacokinetics were evaluated after single intravenous bolus injection in mice and rats, and after repeated dosing in cynomolgus monkeys. Toxicity was assessed in rats and monkeys, safety pharmacology in monkeys, and local tolerance in rabbits. Results BAX930 was shown to be efficacious, as demonstrated by a stabilized platelet count in ADAMTS-13 knockout mice that were thrombocytopenic when treated. Prophylactic efficacy was dose-dependent and comparable with that achieved by treatment with fresh frozen plasma, the mainstay of hTTP treatment. Therapeutic efficacy was treatment interval-dependent. Safety pharmacology evaluation did not show any deleterious effects of BAX930 on cardiovascular and respiratory functions in monkeys. The compound's pharmacokinetics were similar and dose-proportional in mice, rats, and monkeys. BAX930 was well tolerated in rats, monkeys, and rabbits, even
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio
Directory of Open Access Journals (Sweden)
Azimahtol Hawariah LP
2007-04-01
Full Text Available Abstract Background Zerumbone is a cytotoxic component isolated from Zingiber zerumbet Smith, a herbal plant which is also known as lempoyang. This new anticancer bioactive compound from Z. zerumbet was investigated for its activity and mechanism in human liver cancer cell lines. Results Zerumbone significantly showed an antiproliferative activity upon HepG2 cells with an IC50 of 3.45 ± 0.026 μg/ml. Zerumbone was also found to inhibit the proliferation of non-malignant Chang Liver and MDBK cell lines. However the IC50 obtained was higher compared to the IC50 for HepG2 cells (> 10 μg/ml. The extent of DNA fragmentation was evaluated by the Tdt-mediated dUTP nick end labelling assay which showed that, zerumbone significantly increased apoptosis in HepG2 cells in a time-course manner. In detail, the apoptotic process triggered by zerumbone involved the up-regulation of pro-apoptotic Bax protein and the suppression of anti-apoptotic Bcl-2 protein expression. The changes that occurred in the levels of this antagonistic proteins Bax/Bcl-2, was independent of p53 since zerumbone did not affect the levels of p53 although this protein exists in a functional form. Western blotting analysis for Bax protein was further confirmed qualitatively with an immunoassay that showed the distribution of Bax protein in zerumbone-treated cells. Conclusion Therefore, zerumbone was found to induce the apoptotic process in HepG2 cells through the up and down regulation of Bax/Bcl-2 protein independently of functional p53 activity.
The application of powerful promoters to enhance gene expression in industrial microorganisms.
Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen
2017-02-01
Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.
Altered gene-expression profile in rat plasma and promoted body ...
African Journals Online (AJOL)
Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification
Majidi Gharenaz, Nasrin; Movahedin, Mansoureh; Mazaheri, Zohreh; Pour beiranvand, Shahram
2016-01-01
Background: Nowadays, oocytes and embryos vitrification has become a routine technique. Based on clinical judgment, re-vitrification maybe required. But little is known about re-vitrification impact on genes expression. Objective: The impact of re-vitrification on apoptotic and implanting genes, Bax, Bcl-2 and ErbB4, at compaction stage embryos were evaluated in this study. Materials and Methods: In this experimental study, 8 cell embryos (n=240) were collected from female mature mice, 60-62 hr post HCG injection. The embryos were divided randomly to 3 groups included: fresh (n=80), vitrified at 8 cell stage (n=80), vitrified at 8 cell stage thawed and re-vitrified at compaction stage (n=80). Embryos were vitrified by using cryolock, (open system) described by Kuwayama. Q-PCR was used to examine the expression of Bax, Bcl2 ErbB4 genes in derived blastocysts. Results: Our result showed that expanded blastocyst rate was similar between vitrified and re-vitrified groups, while re-vitrified embryos showed significant decrease in expanded blastocyst rate comparing with fresh embryos (p=0.03). In addition, significant difference was observed on apoptotic gene expression when comparing re-vitrified and fresh embryos (p=0.004), however expression of Bax and Bcl-2 (apoptotic) genes didn't demonstrate a significant difference between re-vitrified and vitrified groups. The expression rate of ErbB4, an implantation gene was decreased in re-vitrified embryos comparing with fresh embryos (p=0.003), but it was similar between re-vitrified and vitrified embryos. Conclusion: Re-vitrification can alter the expression of Bax, Bcl-2 and ErbB4 genes and developmental rate of mouse embryos in compaction stage. PMID:27679826
International Nuclear Information System (INIS)
Zhang Yili; Du Hongwen; Zhang Yun; Zhang Yuelang; Kuang Fangjun; Guo Zuomin
2004-01-01
Objective: To discuss the correlation of mammographical imaging signs with the expression of bcl-2 and bax proteins in breast cancer for early diagnosis and forecast of its prognoses. Methods: Fifty-four breast cancers and 26 benign diseases were proved by pathologic methods and all cases underwent mammography. Immunohistochemical technique was used to measure the expression of bcl-2 and bax proteins in these tissues. The correlation of imaging signs with the expression of bcl-2 and bax proteins in breast cancer and benign lesion was analyzed. Results: The expression of bcl-2 or bax protein in the breast cancer was higher than that in breast benign diseases (χ 2 =15.116, 11.361, P 2 =10.358, 12.818, P 2 =10.996, 10.667, P 2 =10.405, P 2 =6.841, P<0.05). Conclusion: Some imaging signs of breast cancer were closely related to the expression of bcl-2 and bax proteins and these signs could reflect the biological behavior of tumor cells and prognoses. Therefore it could be helpful to the early diagnosis and treatment of breast cancer. (authors)
A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli
Directory of Open Access Journals (Sweden)
Li Mingji
2012-02-01
Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Role of promoter element in c-mpl gene expression induced by TPO.
Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao
2013-01-01
Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Hou, Xunyao; Jin, Yan; Chen, Jian; Hong, Yan; Luo, Dingzhen; Yin, Qingqing; Liu, Xueping
2017-01-10
Amyloid-β-peptide (Aβ) is considered to be the toxic species in AD and causes cell death in the affected areas of patient's brain. Insulin-like growth factor 1 (IGF-1) has been reported to attenuate Aβ toxicity in neuronal cells. However, the molecular mechanisms involved in the neuroprotective function of IGF-1 remain largely unknown. In the present study, we for the first time demonstrated that IGF-1 protects against Aβ-induced neurotoxicity via inhibition of PUMA expression and Bax activation. We found that IGF-1 could activate Akt, which in turn inhibited Aβ-induced FOXO3a nuclear translocation and thus decreased the binding ability of FOXO3a to PUMA promoter, leading to decreased PUMA expression. In addition, IGF-1 inhibited the translocation of Bax to the mitochondria induced by Aβ. Notably, addition of wortmannin, a specific inhibitor of PI3K, significantly abolished the neuroprotective effect of IGF-1, suggesting that IGF-1 exerts its anti-apoptotic effect depend on PI3K activity. Our findings may provide new insights into molecular mechanisms mediated by IGF-1 in cell survival against Aβ-induced apoptosis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Genes that cooperate with tumor promoters in transformation
International Nuclear Information System (INIS)
Colburn, N.H.; Smith, B.M.
1988-01-01
Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation
International Nuclear Information System (INIS)
Rotolo, Jimmy A.; Maj, Jerzy G.; Feldman, Regina; Ren, Decheng; Haimovitz-Friedman, Adriana; Cordon-Cardo, Carlos; Cheng, Emily H.-Y.; Kolesnick, Richard; Fuks, Zvi
2008-01-01
Purpose: To address in vivo the issue of whether Bax and Bak are functionally redundant in signaling apoptosis, capable of substituting for each other. Methods and Materials: Mice were exposed to whole-body radiation, and endothelial cell apoptosis was quantified using double immunostaining with TUNEL and anti-CD31 antibody. Crypt survival was determined at 3.5 days after whole-body radiation by the microcolony survival assay. Actuarial animal survival was calculated by the product-limit Kaplan-Meier method, and autopsies were performed to establish cause of death. Results: Radiation exposure of Bax- and Bak-deficient mice, both expressing a wild-type acid sphingomyelinase (ASMase) phenotype, indicated that Bax and Bak are both mandatory, though mutually independent, for the intestinal endothelial apoptotic response. However, neither affected epithelial apoptosis at crypt positions 4-5, indicating specificity toward endothelium. Furthermore, Bax deficiency and Bak deficiency each individually mimicked ASMase deficiency in inhibiting crypt lethality in the microcolony assay and in rescuing mice from the lethal gastrointestinal syndrome. Conclusions: The data indicate that Bax and Bak have nonredundant functional roles in the apoptotic response of the irradiated intestinal endothelium. The observation that Bax deficiency and Bak deficiency also protect crypts in the microcolony assay provides strong evidence that the microvascular apoptotic component is germane to the mechanism of radiation-induced damage to mouse intestines, regulating reproductive cell death of crypt stem cell clonogens
Proapoptotic Bak and Bax guard against fatal systemic and organ-specific autoimmune disease
Mason, Kylie D.; Lin, Ann; Robb, Lorraine; Josefsson, Emma C.; Henley, Katya J.; Gray, Daniel H. D.; Kile, Benjamin T.; Roberts, Andrew W.; Strasser, Andreas; Huang, David C. S.; Waring, Paul; O’Reilly, Lorraine A.
2013-01-01
Dysregulation of the “intrinsic” apoptotic pathway is associated with the development of cancer and autoimmune disease. Bak and Bax are two proapoptotic members of the Bcl-2 protein family with overlapping, essential roles in the intrinsic apoptotic pathway. Their activity is critical for the control of cell survival during lymphocyte development and homeostasis, best demonstrated by defects in thymic T-cell differentiation and peripheral lymphoid homeostasis caused by their combined loss. Because most bak−/−bax−/− mice die perinatally, the roles of Bax and Bak in immunological tolerance and prevention of autoimmune disease remain unclear. We show that mice reconstituted with a Bak/Bax doubly deficient hematopoietic compartment develop a fatal systemic lupus erythematosus-like autoimmune disease characterized by hypergammaglobulinemia, autoantibodies, lymphadenopathy, glomerulonephritis, and vasculitis. Importantly, these mice also develop a multiorgan autoimmune disease with autoantibodies against most solid glandular structures and evidence of glandular atrophy and necrotizing vasculitis. Interestingly, similar albeit less severe pathology was observed in mice containing a hematopoietic compartment deficient for only Bak, a phenotype reminiscent of the disease seen in patients with point mutations in BAK. These studies demonstrate a critical role for Bak and an ancillary role for Bax in safeguarding immunological tolerance and prevention of autoimmune disease. This suggests that direct activators of the intrinsic apoptotic pathway, such as BH3 mimetics, may be useful for treatment of diverse autoimmune diseases. PMID:23349374
Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification
Directory of Open Access Journals (Sweden)
Nasrin Majidi Gharenaz
2016-08-01
Full Text Available Background: Nowadays, oocytes and embryos vitrification has become a routine technique. Based on clinical judgment, re-vitrification maybe required. But little is known about re-vitrification impact on genes expression. Objective: The impact of re-vitrification on apoptotic and implanting genes, Bax, Bcl-2 and ErbB4, at compaction stage embryos were evaluated in this study. Materials and Methods: In this experimental study, 8 cell embryos (n=240 were collected from female mature mice, 60-62 hr post HCG injection. The embryos were divided randomly to 3 groups included: fresh (n=80, vitrified at 8 cell stage (n=80, vitrified at 8 cell stage thawed and re-vitrified at compaction stage (n=80. Embryos were vitrified by using cryolock, (open system described by Kuwayama. Q-PCR was used to examine the expression of Bax, Bcl2 ErbB4 genes in derived blastocysts. Results: Our result showed that expanded blastocyst rate was similar between vitrified and re-vitrified groups, while re-vitrified embryos showed significant decrease in expanded blastocyst rate comparing with fresh embryos (p=0.03. In addition, significant difference was observed on apoptotic gene expression when comparing re-vitrified and fresh embryos (p=0.004, however expression of Bax and Bcl-2 (apoptotic genes didn't demonstrate a significant difference between re-vitrified and vitrified groups. The expression rate of ErbB4, an implantation gene was decreased in re-vitrified embryos comparing with fresh embryos (p=0.003, but it was similar between re-vitrified and vitrified embryos. Conclusion: Re-vitrification can alter the expression of Bax, Bcl-2 and ErbB4 genes and developmental rate of mouse embryos in compaction stage
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
International Nuclear Information System (INIS)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Energy Technology Data Exchange (ETDEWEB)
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
BAX INHIBITOR-1 is required for full susceptibility of barley to powdery mildew.
Eichmann, Ruth; Bischof, Melanie; Weis, Corina; Shaw, Jane; Lacomme, Christophe; Schweizer, Patrick; Duchkov, Dimitar; Hensel, Götz; Kumlehn, Jochen; Hückelhoven, Ralph
2010-09-01
BAX INHIBITOR-1 (BI-1) is one of the few proteins known to have cross-kingdom conserved functions in negative control of programmed cell death. Additionally, barley BI-1 (HvBI-1) suppresses defense responses and basal resistance to the powdery mildew fungus Blumeria graminis f. sp. hordei and enhances resistance to cell death-provoking fungi when overexpressed in barley. Downregulation of HvBI-1 by transient-induced gene silencing or virus-induced gene silencing limited susceptibility to B. graminis f. sp. hordei, suggesting that HvBI-1 is a susceptibility factor toward powdery mildew. Transient silencing of BI-1 did not limit supersusceptibility induced by overexpression of MLO. Transgenic barley plants harboring an HvBI-1 RNA interference (RNAi) construct displayed lower levels of HvBI-1 transcripts and were less susceptible to powdery mildew than wild-type plants. At the cellular level, HvBI-1 RNAi plants had enhanced resistance to penetration by B. graminis f. sp. hordei. These data support a function of BI-1 in modulating cell-wall-associated defense and in establishing full compatibility of B. graminis f. sp. hordei with barley.
Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer
Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G
2017-11-26
Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License
International Nuclear Information System (INIS)
Khor, L.-Y.; De Silvio, Michelle; Li, Rile; McDonnell, Timothy J.; Hammond, M. Elizabeth H.; Sause, William T.; Pilepich, Miljenko V.; Okunieff, Paul; Sandler, Howard M.; Pollack, Alan
2006-01-01
Purpose: Bcl-2 and bax are proteins with opposing roles in apoptosis regulation; yet abnormal expression of either has been associated with failure after radiotherapy (RT). In this study we examined bcl-2 and bax expression as predictive markers in men treated with radiotherapy ± androgen deprivation on Radiation Therapy Oncology Group (RTOG) protocol 86-10. Experimental Design: Suitable archival diagnostic tissue was obtained from 119 (26%) patients for bcl-2 analysis and 104 (23%) patients for bax analysis. Cox proportional hazards multivariate analysis was used to determine the relationship of abnormal bcl-2 and bax expression to the end points of local failure, distant metastasis, cause-specific mortality, and overall mortality. Bcl-2 overexpression was classified as any tumor cell cytoplasmic staining and altered bax expression was classified as greater or lesser cytoplasmic staining intensity of tumor cells as compared with adjacent normal prostate epithelium. Results: The study cohort exhibited bcl-2 overexpression in 26% (n = 30) of cases and abnormal bax expression in 47% (n = 49) of cases. A borderline significant relationship was observed between abnormal bax expression and higher Gleason score (p = 0.08). In univariate and multivariate analyses, there was no statistically significant relationship seen between abnormal bcl-2 or bax expression and outcome. Conclusions: Abnormal bcl-2 and bax expression were not related to any of the end points tested. The cohort examined was comprised of patients with locally advanced disease and it is possible that these markers may be of greater value in men with earlier-stage prostate cancer
The progress of tumor gene-radiotherapy induced by Egr-1 promoter
International Nuclear Information System (INIS)
Guo Rui; Li Biao
2010-01-01
The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)
International Nuclear Information System (INIS)
Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.
1988-01-01
Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene
Estradiol increases the Bax/Bcl-2 ratio and induces apoptosis in the anterior pituitary gland.
Zaldivar, Verónica; Magri, María Laura; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Radl, Daniela; Ferraris, Jimena; Pisera, Daniel; Seilicovich, Adriana
2009-01-01
Estrogens are recognized as acting as modulators of pituitary cell renewal, sensitizing cells to mitogenic and apoptotic signals, thus participating in anterior pituitary homeostasis during the estrous cycle. The balance of pro- and antiapoptotic proteins of the Bcl-2 family is known to regulate cell survival and apoptosis. In order to understand the mechanisms underlying apoptosis during the estrous cycle, we evaluated the expression of the proapoptotic protein Bax and the antiapoptotic proteins Bcl-2 and Bcl-xL in the anterior pituitary gland in cycling female rats as well as the influence of estradiol on the expression of these proteins in anterior pituitary cells of ovariectomized rats. As determined by Western blot, the expression of Bax was higher in anterior pituitary glands from rats at proestrus than at diestrus I, Bcl-2 protein levels showed no difference and Bcl-xL expression was lower, thus increasing the Bax/Bcl-2 ratio at proestrus. Assessed by annexin V binding and flow cytometry, the percentage of apoptotic anterior pituitary cells was higher in rats at proestrus than at diestrus I. Chronic estrogen treatment in ovariectomized rats enhanced the Bax/Bcl-2 ratio and induced apoptosis. Moreover, incubation of cultured anterior pituitary cells from ovariectomized rats with 17beta-estradiol for 24 h increased the Bax/Bcl-2 ratio, decreased Bcl-xL expression and induced apoptosis. Our results demonstrate that estradiol increases the ratio between proapoptotic and antiapoptotic proteins of the Bcl-2 family. This effect could participate in the sensitizing action of estrogens to proapoptotic stimuli and therefore be involved in the high apoptotic rate observed at proestrus in the anterior pituitary gland.
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.
Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J
2018-05-01
Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.
Directory of Open Access Journals (Sweden)
Alexander Michael Bedford Johns
2016-10-01
Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Cloning and characterization of the human integrin β6 gene promoter.
Directory of Open Access Journals (Sweden)
Mingyan Xu
Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.
Peng, Linda X; Wallace, Morgan; Andaloro, Bridget; Fallon, Dawn; Fleck, Lois; Delduco, Dan; Tice, George
2011-01-01
The BAX System PCR assay for Salmonella detection in foods was previously validated as AOAC Research Institute (RI) Performance Tested Method (PTM) 100201. New studies were conducted on beef and produce using the same media and protocol currently approved for the BAX System PCR assay for E. coli O157:H7 multiplex (MP). Additionally, soy protein isolate was tested for matrix extension using the U.S. Food and Drug Administration-Bacteriological Analytical Manual (FDA-BAM) enrichment protocols. The studies compared the BAX System method to the U.S. Department of Agriculture culture method for detecting Salmonella in beef and the FDA-BAM culture method for detecting Salmonella in produce and soy protein isolate. Method comparison studies on low-level inoculates showed that the BAX System assay for Salmonella performed as well as or better than the reference method for detecting Salmonella in beef and produce in 8-24 h enrichment when the BAX System E. coli O157:H7 MP media was used, and soy protein isolate in 20 h enrichment with lactose broth followed by 3 h regrowth in brain heart infusion broth. An inclusivity panel of 104 Salmonella strains with diverse serotypes was tested by the BAX System using the proprietary BAX System media and returned all positive results. Ruggedness factors involved in the enrichment phase were also evaluated by testing outside the specified parameters, and none of the factors examined affected the performance of the assay.
Directory of Open Access Journals (Sweden)
Sunny R Slone
Full Text Available Disruption of 14-3-3 function by alpha-synuclein has been implicated in Parkinson's disease. As 14-3-3s are important regulators of cell death pathways, disruption of 14-3-3s could result in the release of pro-apoptotic factors, such as Bax. We have previously shown that overexpression of 14-3-3θ reduces cell loss in response to rotenone and MPP(+ in dopaminergic cell culture and reduces cell loss in transgenic C. elegans that overexpress alpha-synuclein. In this study, we investigate the mechanism for 14-3-3θ's neuroprotection against rotenone toxicity. While 14-3-3s can inhibit many pro-apoptotic factors, we demonstrate that inhibition of one factor in particular, Bax, is important to 14-3-3s' protection against rotenone toxicity in dopaminergic cells. We found that 14-3-3θ overexpression reduced Bax activation and downstream signaling events, including cytochrome C release and caspase 3 activation. Pharmacological inhibition or shRNA knockdown of Bax provided protection against rotenone, comparable to 14-3-3θ's neuroprotective effects. A 14-3-3θ mutant incapable of binding Bax failed to protect against rotenone. These data suggest that 14-3-3θ's neuroprotective effects against rotenone are at least partially mediated by Bax inhibition and point to a potential therapeutic role of 14-3-3s in Parkinson's disease.
Huang, Lei; Wu, Shengnan; Xing, Da
2011-03-01
Glycogen synthase kinase-3β (GSK-3β) is a critical activator of cell apoptosis induced by a diverse array of insults. However, the effects of GSK-3β on the human lung adenocarcinoma cell (ASTC-a-1) apoptosis induced by high fluence low-power laser irradiation (HF-LPLI) are not clear. Here, we showed that GSK-3β was constantly translocated from cytoplasm to nucleus and activated during HF-LPLI-induced cell apoptosis. In addition, we found that co-overexpression of YFP-GSK-3β and CFP-Bax in ASTC-a-1 cells accelerated both Bax translocations to mitochondria and cell apoptosis, compared to the cells expressed CFP-Bax only under HF-LPLI treatment, indicating that GSK-3β facilitated ASTC-a-1 cells apoptosis through acceleration mitochondrial translocation of Bax. Our results demonstrate that GSK-3β exerts some of its pro-apoptotic effects in ASTC-a-1 cells by regulating the mitochondrial localization of Bax, a key component of the intrinsic apoptotic cascade.
International Nuclear Information System (INIS)
Depto, A.S.; Stenberg, R.M.
1989-01-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
International Nuclear Information System (INIS)
Zhang Xin; Li Yaming; Zhang Yanjun; Tao Li; Zhu Yi; Yang Chun; Ji Xiaopeng; Zhao Ming; Tian Aijuan; Zhang Jianying; Zhao Zhenzhen
2007-01-01
The expression of bcl-2 and bax after the single dose of chemotherapy with 99 Tc m -rh-Annexin V as the tracer of tumor apoptosis imaging is studied. tumor cell apoptosis is examined by TUNEL methods, and the expression of bcl-2 and bax in tumor are determined by immunohistochemical methods. Single dose of chemotherapy significantly increased the tumor uptake of 99 Tc m -rh-annexin V and the positive number of TUNEL, as well as the expression of bax (P 99 Tc m -rh-annexin V in tumor reflectes not only the degree of apoptosis of tumor cells, but also the change of bax expression after the single dose of chemotherapy. (authors)
Directory of Open Access Journals (Sweden)
W. Y. Liu
2013-01-01
Full Text Available This work investigates the effects of oxidative stress due to exhaustive training on uncoupling protein 2 (UCP2 and Bcl-2/Bax in rat skeletal muscles. A total of 18 Sprague-Dawley female rats were randomly divided into three groups: the control group (CON, the trained control group (TC, and the exhaustive trained group (ET. Malondialdehyde (MDA, superoxide dismutase (SOD, xanthine oxidase (XOD, ATPase, UCP2, and Bcl-2/Bax ratio in red gastrocnemius muscles were measured. Exhaustive training induced ROS increase in red gastrocnemius muscles, which led to a decrease in the cell antiapoptotic ability (Bcl-2/Bax ratio. An increase in UCP2 expression can reduce ROS production and affect mitochondrial energy production. Thus, oxidative stress plays a significant role in overtraining.
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Directory of Open Access Journals (Sweden)
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Identification of distal silencing elements in the murine interferon-A11 gene promoter.
Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G
1996-08-01
The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.
Directory of Open Access Journals (Sweden)
Yoon TH
2012-03-01
Full Text Available Ki-Chun Yoo1, Chang-Hwan Yoon1, Dongwook Kwon2, Kyung-Hwan Hyun1, Soo Jung Woo1, Rae-Kwon Kim1, Eun-Jung Lim1, Yongjoon Suh1, Min-Jung Kim1, Tae Hyun Yoon2, Su-Jae Lee11Laboratory of Molecular Biochemistry, 2Laboratory of Nanoscale Characterization and Environmental Chemistry, Department of Chemistry, Hanyang University, Seoul, Republic of KoreaBackground: Titanium dioxide (TiO2 has been widely used in many areas, including biomedicine, cosmetics, and environmental engineering. Recently, it has become evident that some TiO2 particles have a considerable cytotoxic effect in normal human cells. However, the molecular basis for the cytotoxicity of TiO2 has yet to be defined.Methods and results: In this study, we demonstrated that combined treatment with TiO2 nanoparticles sized less than 100 nm and ultraviolet A irradiation induces apoptotic cell death through reactive oxygen species-dependent upregulation of Fas and conformational activation of Bax in normal human cells. Treatment with P25 TiO2 nanoparticles with a hydrodynamic size distribution centered around 70 nm (TiO2P25–70 together with ultraviolet A irradiation-induced caspase-dependent apoptotic cell death, accompanied by transcriptional upregulation of the death receptor, Fas, and conformational activation of Bax. In line with these results, knockdown of either Fas or Bax with specific siRNA significantly inhibited TiO2-induced apoptotic cell death. Moreover, inhibition of reactive oxygen species with an antioxidant, N-acetyl-L-cysteine, clearly suppressed upregulation of Fas, conformational activation of Bax, and subsequent apoptotic cell death in response to combination treatment using TiO2P25–70 and ultraviolet A irradiation.Conclusion: These results indicate that sub-100 nm sized TiO2 treatment under ultraviolet A irradiation induces apoptotic cell death through reactive oxygen species-mediated upregulation of the death receptor, Fas, and activation of the preapoptotic protein
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Interleukin-10 gene promoter polymorphism as a potential host ...
African Journals Online (AJOL)
10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...
Stidl, R; Fuchs, S; Bossard, M; Siekmann, J; Turecek, P L; Putz, M
2016-01-01
BAX 855 is a PEGylated human full-length recombinant factor VIII (rFVIII) based on licensed rFVIII (ADVATE). The applied PEGylation technology has been optimized to retain functionality of the FVIII molecule, improve its pharmacokinetic properties and allow less frequent injections while maintaining efficacy. The aim of this study was to confirm that the excellent safety profile of ADVATE remains unchanged after PEGylation. Non-clinical safety studies with BAX 855 and its respective unbound polyethylene glycol (PEG) were conducted in several species. The distribution of a single dose of radiolabelled BAX 855 was further investigated in rats. Publically available safety data on PEG alone and PEGylated biomolecules were summarized and reviewed for specific safety findings attributable to PEG or PEGylated biopharmaceuticals. Safety pharmacology studies in rabbits and macaques and repeated dose toxicity studies in rats and macaques identified no safety issues. Results of a distribution study in rats administered radiolabelled BAX 855 showed that radioactivity was completely excreted; urine was the major elimination route. A 28-day study in rats dosed with the unbound PEG constituent (PEG2ru20KCOOH) of BAX 855 showed no adverse or non-adverse effects. Safety data for PEG and PEG-protein conjugates indicate no safety concerns associated with PEG at clinically relevant dose levels. Although vacuolation of certain cell types has been reported in mammals, no such vacuolation was observed with BAX 855 or with the unbound PEG constituent. Non-clinical safety evaluation of PEG and BAX 855 identified no safety signals; the compound is now in clinical development for the treatment of patients with haemophilia A. © 2015 Baxalta Innovations GmbH. Haemophilia Published by John Wiley & Sons Ltd.
The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: a Meta-analysis
Directory of Open Access Journals (Sweden)
Yichang SUN
2014-03-01
Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
International Nuclear Information System (INIS)
Tannapfel, Andrea; Nuesslein, Siegfried; Fietkau, Rainer; Katalinic, Alexander; Koeckerling, Ferdinand; Wittekind, Christian
1998-01-01
Purpose: To investigate the relationship between apoptotic cell death, proliferative activity, and the expression of apoptosis regulating proteins in rectal cancer prior to and after radiochemotherapy. Materials and Methods: In 32 patients dispositioned to receive preoperative radiochemotherapy for locally advanced rectal carcinoma, pretherapy biopsies and the final resected specimen after radiochemotherapy were available for analyses. Apoptotic cells were identified and quantified using in situ end labeling (ISEL) technique. The expression of the bax protein was assessed immunohistochemically. Additionally, double immunostaining was performed for apoptotic cells and bax expression. The proliferative activity was determined by immunohistochemical assessment of the Ki67 (MIB-1) and the proliferating cell nuclear antigen (PCNA). p53- and bcl-2 expression was analyzed immunohistochemically. A clinical-to-pathologic downstaging after radiochemotherapy was achieved in 25 of 32 patients (78%). During follow-up, tumor recurrence was observed in six cases. In one case, no residual tumor was detected after radiochemotherapy. Results: After radiochemotherapy, the apoptotic index increased significantly in almost every case examined. In contrast, the proliferative activity was significantly decreased in resected specimens as compared to biopsies. Bax immunostaining was detected in 12/31 (39%) biopsies and in 26/31 (84%) resected specimens. In the resected specimen, significantly more apoptotic cells that were bax-positive were found than in biopsies. Bcl-2 immunostaining occurred in 15/31 biopsies and 12/31 resected specimens, respectively. Tumors that were immunohistochemically negative for p53 (20/31 [65%]) generally exhibited a higher apoptotic index and a high expression level of bax than p53-positive tumors (11/31 [35%]). However, we did not find any correlation between the (pre- and post-therapeutic) rate of apoptosis or the level of bax expression and the degree of
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
The altered promoter methylation of oxytocin receptor gene in autism.
Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak
Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.
NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer
Directory of Open Access Journals (Sweden)
Shen Shourong
2010-04-01
Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.
A cII-dependent promoter is located within the Q gene of bacteriophage lambda.
Hoopes, B C; McClure, W R
1985-01-01
We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...
International Nuclear Information System (INIS)
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Promoter Methylation Analysis of IDH Genes in Human Gliomas
International Nuclear Information System (INIS)
Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.
2012-01-01
Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin
2016-06-01
Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.
Energy Technology Data Exchange (ETDEWEB)
Ghanem, M.M.; Battelli, L.A.; Mercer, R.R.; Scabilloni, J.F.; Kashon, M.L.; Ma, J.Y.C.; Nath, J.; Hubbs, A.F.
2006-09-15
Miners inhaling respirable coal dust (CD) frequently develop coal workers' pneumoconiosis. Many coal miners are also exposed to polycyclic aromatic hydrocarbon (PAH) components of diesel engine exhaust and cigarette smoke, which may contribute to lung disease in these workers. Recently, apoptosis was reported to play a critical role in the development of another pneumoconiosis of miners, silicosis. In addition, CID was reported to suppress cytochrome P450 1A1 (CYP1A1) induction by PAHs. We exposed rats intratracheally to 0.0, 2.5, 10.0, 20.0, or 40.0 mg/rat CD and, 11 days later, to intraperitoneal P-naphthoflavone (BNF), a PAH. In another group of rats exposed to CD and BNF, caspase activity was inhibited by injection of the pan-caspase inhibitor Q-VD-OPH (quinoline-Val-Asp (OMe)-CH{sub 2}-OPH). In rats exposed to BNF, CD exposure increased alveolar expression of the proapoptotic mediator Bax but decreased CYP1A1 induction relative to BNF exposure alone. Pan-caspase inhibition decreased CD-associated Bax expression and apoptosis but did not restore CYP1A1 activity. Further, CD-induced lung inflammation and alveolar epithelial cell hypertrophy and hyperplasia were not suppressed by caspase inhibition. It is concluded that combined BNF and CD exposure increased Bax expression and apoptosis in the lung, but Bax and apoptosis were not the major determinants of early lung injury in this model.
hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro
International Nuclear Information System (INIS)
Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan
2007-01-01
Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)
Del Puerto, H L; Martins, A S; Moro, L; Milsted, A; Alves, F; Braz, G F; Vasconcelos, A C
2010-01-26
Canine distemper is an immunosuppressive disease caused by the canine distemper virus (CDV). Pathogenesis mainly involves the central nervous system and immunosuppression. Dogs naturally infected with CDV develop apoptotic cells in lymphoid tissues and the cerebellum, but this apoptotic mechanism is not well characterized. To better understand this process, we evaluated the expression of Bax, Bcl-2, and caspase-3, -8 and -9, by evaluating mRNA levels in the peripheral blood, lymph nodes and cerebellum of CDV-infected (CDV+) and uninfected (CDV-) dogs by real-time polymerase chain reaction (PCR). Blood samples from 12 CDV+ and 8 CDV- dogs, diagnosed by reverse transcription-PCR, were subjected to hematological analysis and apoptotic gene expression was evaluated using real-time-PCR. Tissues from the cerebellum and lymph nodes of four CDV+ and three CDV-dogs were also subjected to real time-PCR. No significant differences were found between CDV+ and CDV- dogs in the hemotological results or in the expression of caspase-3, -8, -9, Bax, and Bcl-2 in the peripheral blood. However, expression of Bax, caspase-3, -8 and -9 was significantly higher in the cerebellum of CDV+ compared to CDV- dogs. Expression of caspase-3 and -8 was significantly higher in the lymph nodes of CDV+ compared to CDV- dogs. We concluded that infection with CDV induces apoptosis in the cerebellum and lymph nodes in different ways. Lymph node apoptosis apparently occurs via caspase-3 activation, through the caspase-8 pathway, and cerebellum apoptosis apparently occurs via caspase-3 activation, through the caspase-8 and mitochondrial pathways.
Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Directory of Open Access Journals (Sweden)
Victoria Gonzalo
Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant
Directory of Open Access Journals (Sweden)
M Zamani
2012-12-01
Full Text Available Introduction : Preliminary studies confirmed reduction in cell death following treatment with antioxidants. According to this finding we study the relationship between consumption of CoQ10 and expression of bax and bcl2 in hippocampus following ischemia/reperfusion as proteins involved in cell programmed death or apoptosis.Material & methods : We studied the protective role of CoQ10 against Ischemia-Reperfusion. Experimental design includes four groups: intact, ischemic control, sham control and treatment groups with CoQ10. The mice treated with CoQ10 as Pre - Treatment for a week. Then, ischemia induced by common carotid artery ligation and following the reduction in inflammation (a week the mice post-treated with CoQ10.Nissl staining applied to counting necrotic cells of hippocampus and the western blotting performed to measurement the bax and bcl2 expression.Results :. Cell death was significantly lower when mice treated with CoQ10. Bax expression was significantly high in ischemic group but in treatment group was less and reversely the bcl2 expression in ischemic group was lower than treatment and vehicle groups.Conclusion : Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake significantly reduced cell death and prevented the expression of bax while inducing an increase in expression of bcl2.
Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.
Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife
2016-05-01
Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.
Directory of Open Access Journals (Sweden)
Guodong Liu
2018-02-01
Full Text Available Background/Aims: Ischemia-reperfusion (I/R injury is an unavoidable event occurring during heart transplantation and is a key factor in graft failure and the long-term survival rate of recipients. Therefore, there is an urgent need for the development of new therapies to prevent I/R injury. Clusterin is a hetero-dimeric glycoprotein with an antiapoptotic function. In this study, we investigated whether clusterin was cardioprotective in heart transplantation against I/R injury using an in vivo rat model and an in vitro cell culture system, and examined the underlying mechanisms of I/R injury. Methods: Heart grafts from wild-type C57BL/6 mice were preserved in UW solution (control or UW solution containing recombinant human apolipoprotein-J (hr clusterin for 24 h. The preserved hearts were implanted into recipient mice of the same strain as the donors for 72 h, and the heart grafts were then taken for histopathological and gene expression analyses. An in vitro ischemia reperfusion model using H9C2 cells or H9C2/clusterin cDNA cells was constructed. The expression of clusterin, p65, Bax, Bcl-xL, IL-1β, and TNF-α protein and mRNA in heart tissue and H9C2 cells was detected by western blot, reverse transcription-polymerase chain reaction (RT-PCR, and quantitative RT-PCR assays; IL-1β and TNF-α protein was detected by enzyme-linked immunosorbent assays; NF-kB activity was detected by an electrophoretic mobility shift assay; cell apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling and flow cytometric analyses. Results: Cold I/R caused severe morphologic myocardial injury to heart grafts from wild-type C57BL/6 mice, whereas grafts from hr clusterin preservation showed less damage, as demonstrated by decreased cell apoptosis/death, decreased neutrophil infiltration, and the preservation of the normal structure of the heart. Clusterin reduced the expression of p65, pre-inflammatory IL-1β, and TNF-α, and
Liu, Guodong; Zhang, Hongmei; Hao, Fengyun; Hao, Jing; Pan, Lixiao; Zhao, Qing; Wo, Jinshan
2018-01-01
Ischemia-reperfusion (I/R) injury is an unavoidable event occurring during heart transplantation and is a key factor in graft failure and the long-term survival rate of recipients. Therefore, there is an urgent need for the development of new therapies to prevent I/R injury. Clusterin is a hetero-dimeric glycoprotein with an antiapoptotic function. In this study, we investigated whether clusterin was cardioprotective in heart transplantation against I/R injury using an in vivo rat model and an in vitro cell culture system, and examined the underlying mechanisms of I/R injury. Heart grafts from wild-type C57BL/6 mice were preserved in UW solution (control) or UW solution containing recombinant human apolipoprotein-J (hr clusterin) for 24 h. The preserved hearts were implanted into recipient mice of the same strain as the donors for 72 h, and the heart grafts were then taken for histopathological and gene expression analyses. An in vitro ischemia reperfusion model using H9C2 cells or H9C2/clusterin cDNA cells was constructed. The expression of clusterin, p65, Bax, Bcl-xL, IL-1β, and TNF-α protein and mRNA in heart tissue and H9C2 cells was detected by western blot, reverse transcription-polymerase chain reaction (RT-PCR), and quantitative RT-PCR assays; IL-1β and TNF-α protein was detected by enzyme-linked immunosorbent assays; NF-kB activity was detected by an electrophoretic mobility shift assay; cell apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling and flow cytometric analyses. Cold I/R caused severe morphologic myocardial injury to heart grafts from wild-type C57BL/6 mice, whereas grafts from hr clusterin preservation showed less damage, as demonstrated by decreased cell apoptosis/death, decreased neutrophil infiltration, and the preservation of the normal structure of the heart. Clusterin reduced the expression of p65, pre-inflammatory IL-1β, and TNF-α, and the pro-apoptotic gene Bax, while it enhanced the
Energy Technology Data Exchange (ETDEWEB)
Ueda, Masashi; Li, Shimo; Itoh, Masanori; Wang, Miao-xing; Hayakawa, Miki; Islam, Saiful; Tana; Nakagawa, Kiyomi [Department of Neurobiology, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan); Chen, Huayue [Department of Anatomy, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan); Nakagawa, Toshiyuki, E-mail: tnakagaw@gifu-u.ac.jp [Department of Neurobiology, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan)
2016-05-27
The endoplasmic reticulum (ER) is important in various cellular functions, such as secretary and membrane protein biosynthesis, lipid synthesis, and calcium storage. ER stress, including membrane distortion, is associated with many diseases such as Huntington's disease. In particular, nuclear envelope distortion is related to neuronal cell death associated with polyglutamine. However, the mechanism by which polyglutamine causes ER membrane distortion remains unclear. We used electron microscopy, fluorescence protease protection assay, and alkaline treatment to analyze the localization of polyglutamine in cells. We characterized polyglutamine embedded in the ER membrane and noted an effect on morphology, including the dilation of ER luminal space and elongation of ER-mitochondria contact sites, in addition to the distortion of the nuclear envelope. The polyglutamine embedded in the ER membrane was observed at the same time as Bax insertion. These results demonstrated that the ER membrane may be a target of polyglutamine, which triggers cell death through Bax. -- Highlights: •We characterized polyglutamine embedded in the ER membrane. •The polyglutamine embedded in the ER membrane was observed at the same time as Bax insertion. •The ER membrane may be a target of polyglutamine, which triggers cell death.
Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi
1998-01-01
Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276
The effect of N-nitrosodimethylamine (NDMA) on Bax and Mcl-1 expression in human neutrophils.
Jablonski, Jakub; Jablonska, Ewa; Leonik, Agnieszka
2011-12-01
In the present study we examined a role of pro-apoptotic Bax and anti-apoptotic Mcl-1 proteins, participating in the regulation of intrinsic apoptosis pathway in human neutrophils (PMNs) exposed to N-nitrosodimethylamine (NDMA), the environmental xenobiotic. For the purpose comparison, the same studies were conducted in autologous peripheral blood mononuclear cells (PBMCs). The production of cytochrome c by PMNs was also determined. A deficit of anti-apoptotic Mcl-1 and overexpression of the pro-apoptotic protein Bax suggest that the apoptosis process in human neutrophils exposed to NDMA is dependent on changes in the expression of these proteins. PMNs were more sensitive to NDMA than PBMCs.
Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor
International Nuclear Information System (INIS)
Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.
2006-01-01
The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Sadek, Kadry; Abouzed, Tarek; Nasr, Sherif
2016-04-01
The effect of monosodium glutamate (MSG) on brain tissue and the relative ability of lycopene to avert these neurotoxic effects were investigated. Thirty-two male Wistar rats were distributed into 4 groups: group I, untreated (placebo); group II, injected with MSG (5 mg·kg(-1)) s.c.; group III, gastrogavaged with lycopene (10 mg·kg(-1)) p.o.; and group IV received MSG with lycopene with the same mentioned doses for 30 days. The results showed that MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant homeostasis and increased the levels of brain and serum cholinesterase (ChE), total creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK-BB), and lactate dehydrogenase (LDH). Glutathione S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities and gene expression were increased and glutathione content was reduced in the MSG-challenged rats, and these effects were ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues reflected in upregulation of pro-apoptotic Bax while lycopene upregulated the anti-apoptotic Bcl-2. Our results indicate that lycopene appears to be highly effective in relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing modifications in the activity of cholinesterase and antioxidant pathways. Interestingly, lycopene protects brain tissue by inhibiting apoptosis signaling induced by MSG.
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Directory of Open Access Journals (Sweden)
Tung Shu-Yun
2011-04-01
Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.
Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering
Directory of Open Access Journals (Sweden)
Jared B. Fudge
2018-04-01
Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Razmi, Mahdieh; Rabbani-Chadegani, Azra; Hashemi-Niasari, Fatemeh; Ghadam, Parinaz
2018-07-01
The clinical use of potent anticancer drug mitomycin C (MMC) has limited due to side effects and resistance of cancer cells. The aim of this study was to investigate whether lithium chloride (LiCl), as a mood stabilizer, can affect the sensitivity of MDA-MB-231 breast cancer cells to mitomycin C. The cells were exposed to various concentrations of mitomycin C alone and combined with LiCl and the viability determined by trypan blue and MTT assays. Proteins were analyzed by western blot and mRNA expression of HMGB1 MMP9 and Bcl-2 were analyzed by RT-PCR. Flow cytometry was used to determine the cell cycle arrest and percent of apoptotic and necrotic cells. Concentration of Bax assessed by ELISA. Exposure of the cells to mitomycin C revealed IC 50 value of 20 μM, whereas pretreatment of the cells with LiCl induced synergistic cytotoxicity and IC 50 value declined to 5 μM. LiCl combined with mitomycin C significantly down-regulated HMGB1, MMP9 and Bcl-2 gene expression but significantly increased the level of Bax protein. In addition, the content of HMGB1 in the nuclei decreased and pretreatment with LiCl reduced the content of HMGB1 release induced by MMC. LiCl increased mitomycin C-induced cell shrinkage and PARP fragmentation suggesting induction of apoptosis in these cells. LiCl prevented mitomycin C-induced necrosis and changed the cell death arrest at G2/M-phase. Taking all together, it is suggested that LiCl efficiently enhances mitomycin C-induced apoptosis and HMGB1, Bax and Bcl-2 expression may play a major role in this process, the findings that provide a new therapeutic strategy for LiCl in combination with mitomycin C. Copyright © 2018 Elsevier GmbH. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Directory of Open Access Journals (Sweden)
Mohammad Zamani
2012-09-01
Full Text Available Introduction: Preliminary studies have con.rmed reduction in cell death following treatment with antioxidants. According to this .nding we study the relationship between consumption of CoQ10 and expression of Bax and Bcl2 in hippocampus following ischemia/reperfusion as proteins involved in cell programmed death or apoptosis. Methods: We studied the protective role of CoQ10 against ischemia-reperfusion. Experimental design includes four groups: intact, ischemic control, sham control and treatment group with CoQ10. The mice were pre-treated with CoQ10 for a week, then ischemia was induced by common carotid artery ligation and following the reduction in in.ammation (a week the mice was treated with CoQ10. Nissl staining was applied for counting the necrotic cells of hippocampus and the western blot was performed to measure the Bax and Bcl2 expression.Results: Cell death was signi.cantly lower when mice were treated with CoQ10. Bax expression was signi.cantly high in the ischemic group but low in the treatment group, and the bcl2 expression was lower in the ischemic group than the treatment and the vehicle groups.Discussion: Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake signi.cantly reduced cell death and prevented the expression of Bax while inducing an increase in expression of bcl2.
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei
Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.
1990-01-01
The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site
Directory of Open Access Journals (Sweden)
Javad Baharara
2015-02-01
Full Text Available Silver nanoparticles (Ag-NPs, the most popular nanoparticles, possess unique properties. Achillea biebersteinii is a plant of the Asteraceae family rich in active antitumor components. The aim of this research was the characterization and investigation of the cytotoxic properties of Ag-NPs synthesized using A. biebersteinii flower extract, on a human breast cancer cell line. The Ag-NPs were synthesized after approximately 180 min of reaction at 40 °C, then they were characterized by UV-visible spectroscopy, Fourier transform infrared spectroscopy (FTIR, transmission electron microscopy (TEM and dynamic light scattering (DLS. The anti-apoptosis effect of Ag-NPs on the MCF-7 cell line was investigated by MTT assay, DAPI and acridine orange staining and caspase activity. The transcriptional expression of bax, bcl-2, caspase-3, -8 and -9 were also evaluated by RT-PCR. The TEM images revealed that the Ag-NPs morphology had a different shape. The DLS indicated that the average hydrodynamic diameter of the biosynthesized Ag-NPs was around 12 nm. By UV-visible spectroscopy the strongest absorbance peak was observed at 460 nm. The FTIR results also showed interaction between the plant extract and Ag-NPs due to the similarity in the peak patterns. The EDS results showed that Ag-NPs display an absorption peak at 3 keV, indicating the presence of the element silver. The Ag-NPs caused a dose-dependent decrease in cell viability, fragmentation in nucleic acid, inhibited the proliferation and induction of apoptosis on MCF-7 by suppressing specific cell cycle genes, and simulation programmed cell dead genes. Further investigation is required to establish the potential of this novel and promising approach in cancer therapy.
Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.
Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S
2016-06-21
Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Directory of Open Access Journals (Sweden)
Rosner William
2009-05-01
Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.
Directory of Open Access Journals (Sweden)
Marcus Wallgren
Full Text Available The anti-apoptotic B-cell CLL/lymphoma-2 (Bcl-2 protein and its counterpart, the pro-apoptotic Bcl-2-associated X protein (Bax, are key players in the regulation of the mitochondrial pathway of apoptosis. However, how they interact at the mitochondrial outer membrane (MOM and there determine whether the cell will live or be sentenced to death remains unknown. Competing models have been presented that describe how Bcl-2 inhibits the cell-killing activity of Bax, which is common in treatment-resistant tumors where Bcl-2 is overexpressed. Some studies suggest that Bcl-2 binds directly to and sequesters Bax, while others suggest an indirect process whereby Bcl-2 blocks BH3-only proteins and prevents them from activating Bax. Here we present the results of a biophysical study in which we investigated the putative interaction of solubilized full-length human Bcl-2 with Bax and the scope for incorporating the former into a native-like lipid environment. Far-UV circular dichroism (CD spectroscopy was used to detect direct Bcl-2-Bax-interactions in the presence of polyoxyethylene-(23-lauryl-ether (Brij-35 detergent at a level below its critical micelle concentration (CMC. Additional surface plasmon resonance (SPR measurements confirmed this observation and revealed a high affinity between the Bax and Bcl-2 proteins. Upon formation of this protein-protein complex, Bax also prevented the binding of antimycin A2 (a known inhibitory ligand of Bcl-2 to the Bcl-2 protein, as fluorescence spectroscopy experiments showed. In addition, Bcl-2 was able to form mixed micelles with Triton X-100 solubilized neutral phospholipids in the presence of high concentrations of Brij-35 (above its CMC. Following detergent removal, the integral membrane protein was found to have been fully reconstituted into a native-like membrane environment, as confirmed by ultracentrifugation and subsequent SDS-PAGE experiments.
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh
2012-07-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.
2012-01-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
The study on Egr-1 promoter which is radioactive promoter
International Nuclear Information System (INIS)
Zhang Chunzhi; Guo Yang; Lv Zhonghong
2006-01-01
Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
International Nuclear Information System (INIS)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-01-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-07-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)
[Effects of blueberry on apoptosis and expression of Bcl-2 and Bax in HSC-T6].
Lu, Shuang; Cheng, Mingliang; Yang, Demeng; Liu, Yang; Guan, Li; Wu, Jun
2015-08-18
To investigate the effects of blueberry on the apoptosis, expression of Bcl-2 and Bax in rat hepatic stellate cell (HSC-T6). 10% blueberry serum at low, middle and high dose, 10% Fu-Fang-Bie-Jia-Ruan-Gan tablet serum and 10% saline serum were prepared by method of serum pharmacology. Subcultured HSC-T6 was divided into saline serum control group, blueberry serum at low, middle, high dose and Fu-Fang-Bie-Jia-Ruan-Gan tablet serum group, and then was respectively incubated at different dose of 10% blueberry serum, 10% Fu-Fang-Bie-Jia-Ruan-Gan tablet serum and 10% saline serum for 72 hours.Apoptosis of HSC-T6 was detected using flow cytometry with annexin V FITC/PI double staining. The expression of Bcl-2 and Bax in HSC-T6 were examined using immunocytochemistry and Western blotting, respectively. There was no significant difference for HSC-T6 Bax protein expression in the low, middle and high dose blueberry serum groups, compared with saline serum control group, respectively.In the high-dose blueberry serum group HSC-T6 early and total apoptosis rate increased significantly compared with the saline serum control group (5.55% ± 0.98% vs 2.53% ± 0.46%, 7.01% ± 1.05% vs 2.96% ± 0.81%, both Pblueberry serum group showed no significant difference with the saline serum control group. Blueberry can induce HSC-T6 apoptosis by down-regulating Bcl-2 expression and decreasing the ratio of Bcl-2/Bax in HSC-T6 cells, so it may have potential interference effects on hepatic fibrosis.
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2002-10-15
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2003-03-04
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Directory of Open Access Journals (Sweden)
Chun-Nun Chao
Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Kazi, Aslamuzzaman; Sun, Jiazhi; Doi, Kenichiro; Sung, Shen-Shu; Takahashi, Yoshinori; Yin, Hang; Rodriguez, Johanna M.; Becerril, Jorge; Berndt, Norbert; Hamilton, Andrew D.; Wang, Hong-Gang; Sebti, Saïd M.
2011-01-01
A critical hallmark of cancer cell survival is evasion of apoptosis. This is commonly due to overexpression of anti-apoptotic proteins such as Bcl-2, Bcl-XL, and Mcl-1, which bind to the BH3 α-helical domain of pro-apoptotic proteins such as Bax, Bak, Bad, and Bim, and inhibit their function. We designed a BH3 α-helical mimetic BH3-M6 that binds to Bcl-XL and Mcl-1 and prevents their binding to fluorescently labeled Bak- or Bim-BH3 peptides in vitro. Using several approaches, we demonstrate that BH3-M6 is a pan-Bcl-2 antagonist that inhibits the binding of Bcl-XL, Bcl-2, and Mcl-1 to multi-domain Bax or Bak, or BH3-only Bim or Bad in cell-free systems and in intact human cancer cells, freeing up pro-apoptotic proteins to induce apoptosis. BH3-M6 disruption of these protein-protein interactions is associated with cytochrome c release from mitochondria, caspase-3 activation and PARP cleavage. Using caspase inhibitors and Bax and Bak siRNAs, we demonstrate that BH3-M6-induced apoptosis is caspase- and Bax-, but not Bak-dependent. Furthermore, BH3-M6 disrupts Bcl-XL/Bim, Bcl-2/Bim, and Mcl-1/Bim protein-protein interactions and frees up Bim to induce apoptosis in human cancer cells that depend for tumor survival on the neutralization of Bim with Bcl-XL, Bcl-2, or Mcl-1. Finally, BH3-M6 sensitizes cells to apoptosis induced by the proteasome inhibitor CEP-1612. PMID:21148306
Preparation and Photocatalytic Properties of Sr2−xBaxTa3O10−yNz Nanosheets
Directory of Open Access Journals (Sweden)
Tatsumi Ishihara
2013-01-01
Full Text Available Sr2−xBaxTa3O10−yNz (x = 0.0, 0.5, 1.0 nanosheets were prepared by exfoliating layered perovskite compounds (CsSr2−xBaxTa3O10−yNz. The Sr1.5Ba0.5Ta3O9.7N0.2 nanosheet showed the highest photocatalytic activity for H2 production from the water/methanol system among the Sr2−xBaxTa3O9.7N0.2 nanosheets prepared. In addition, Rh-loaded Sr1.5Ba0.5Ta3O9.6N0.3 nanosheet showed the photocatalytic activity for oxygen and hydrogen production from water. The ratio of hydrogen to oxygen evolved was around two. These results indicate that the Rh-loaded Sr1.5Ba0.5Ta3O9.6N0.3 nanosheet is a potential catalyst for photocatalytic water splitting.
Expression of apoptotic genes in immature and in vitro matured equine oocytes and cumulus cells.
Leon, P M M; Campos, V F; Kaefer, C; Begnini, K R; McBride, A J A; Dellagostin, O A; Seixas, F K; Deschamps, J C; Collares, T
2013-08-01
The gene expression of Bax, Bcl-2, survivin and p53, following in vitro maturation of equine oocytes, was compared in morphologically distinct oocytes and cumulus cells. Cumulus-oocyte complexes (COC) were harvested and divided into two groups: G1 - morphologically healthy cells; and G2 - less viable cells or cells with some degree of atresia. Total RNA was isolated from both immature and in vitro matured COC and real-time reverse transcription polymerase chain reaction (qRT-PCR) was used to quantify gene expression. Our results showed there was significantly higher expression of survivin (P < 0.05) and lower expression of p53 (P < 0.01) in oocytes compared with cumulus cells in G1. No significant difference in gene expression was observed following in vitro maturation or in COC derived from G1 and G2. However, expression of the Bax gene was significantly higher in cumulus cells from G1 (P < 0.02).
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
International Nuclear Information System (INIS)
Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen
2007-01-01
Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses
Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.
2016-01-01
Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.
Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad
2018-02-01
The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.
Paclitaxel-induced apoptosis is BAK-dependent, but BAX and BIM-independent in breast tumor.
Directory of Open Access Journals (Sweden)
Anna V Miller
Full Text Available Paclitaxel (Taxol-induced cell death requires the intrinsic cell death pathway, but the specific participants and the precise mechanisms are poorly understood. Previous studies indicate that a BH3-only protein BIM (BCL-2 Interacting Mediator of cell death plays a role in paclitaxel-induced apoptosis. We show here that BIM is dispensable in apoptosis with paclitaxel treatment using bim(-/- MEFs (mouse embryonic fibroblasts, the bim(-/- mouse breast tumor model, and shRNA-mediated down-regulation of BIM in human breast cancer cells. In contrast, both bak (-/- MEFs and human breast cancer cells in which BAK was down-regulated by shRNA were more resistant to paclitaxel. However, paclitaxel sensitivity was not affected in bax(-/- MEFs or in human breast cancer cells in which BAX was down-regulated, suggesting that paclitaxel-induced apoptosis is BAK-dependent, but BAX-independent. In human breast cancer cells, paclitaxel treatment resulted in MCL-1 degradation which was prevented by a proteasome inhibitor, MG132. A Cdk inhibitor, roscovitine, blocked paclitaxel-induced MCL-1 degradation and apoptosis, suggesting that Cdk activation at mitotic arrest could induce subsequent MCL-1 degradation in a proteasome-dependent manner. BAK was associated with MCL-1 in untreated cells and became activated in concert with loss of MCL-1 expression and its release from the complex. Our data suggest that BAK is the mediator of paclitaxel-induced apoptosis and could be an alternative target for overcoming paclitaxel resistance.
The Octyl Ester of Ginsenoside Rh2 Induces Lysosomal Membrane Permeabilization via Bax Translocation
Directory of Open Access Journals (Sweden)
Fang Chen
2016-04-01
Full Text Available Ginsenoside Rh2 is a potential pharmacologically active metabolite of ginseng. Previously, we have reported that an octyl ester derivative of ginsenoside Rh2 (Rh2-O, has been confirmed to possess higher bioavailability and anticancer effect than Rh2 in vitro. In order to better assess the possibility that Rh2-O could be used as an anticancer compound, the underlying mechanism was investigated in this study. The present results revealed that lysosomal destabilization was involved in the early stage of cell apoptosis in HepG2 cells induced by Rh2-O. Rh2-O could induce an early lysosomal membrane permeabilization with the release of lysosomal protease cathepsins to the cytosol in HepG2 cells. The Cat B inhibitor (leu and Cat D inhibitor (pepA inhibited Rh2-O-induced HepG2 apoptosis as well as tBid production and Δφm depolarization, indicating that lysosomal permeabilization occurred upstream of mitochondrial dysfunction. In addition, Rh2-O induced a significant increase in the protein levels of DRAM1 and Bax (p < 0.05 in lysosomes of HepG2 cells. Knockdown of Bax partially inhibited Rh2-O-induced Cat D release from lysosomes. Thus it was concluded that Rh2-O induced apoptosis of HepG2 cells through activation of the lysosomal-mitochondrial apoptotic pathway involving the translocation of Bax to the lysosome.
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Interleukin 10 gene promoter polymorphism and risk of diffuse large ...
African Journals Online (AJOL)
Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-04-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.
Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M
2013-06-01
The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
Powers, Marissa V; Valenti, Melanie; Miranda, Susana; Maloney, Alison; Eccles, Suzanne A; Thomas, George; Clarke, Paul A; Workman, Paul
2013-11-01
Inhibitors of the molecular chaperone heat shock protein 90 (HSP90) are of considerable current interest as targeted cancer therapeutic agents because of the ability to destabilize multiple oncogenic client proteins. Despite their resulting pleiotropic effects on multiple oncogenic pathways and hallmark traits of cancer, resistance to HSP90 inhibitors is possible and their ability to induce apoptosis is less than might be expected. Using an isogenic model for BAX knockout in HCT116 human colon carcinoma cells, we demonstrate the induction of BAX-dependent apoptosis at pharmacologically relevant concentrations of the HSP90 inhibitor 17-AAG both in vitro and in tumor xenografts in vivo. Removal of BAX expression by homologous recombination reduces apoptosis in vitro and in vivo but allows a lower level of cell death via a predominantly necrotic mechanism. Despite reducing apoptosis, the loss of BAX does not alter the overall sensitivity to 17-AAG in vitro or in vivo. The results indicate that 17-AAG acts predominantly to cause a cytostatic antiproliferative effect rather than cell death and further suggest that BAX status may not alter the overall clinical response to HSP90 inhibitors. Other agents may be required in combination to enhance tumor-selective killing by these promising drugs. In addition, there are implications for the use of apoptotic endpoints in the assessment of the activity of molecularly targeted agents.
Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.
Directory of Open Access Journals (Sweden)
Francesca Grespi
2011-03-01
Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.
Kazi, Aslamuzzaman; Sun, Jiazhi; Doi, Kenichiro; Sung, Shen-Shu; Takahashi, Yoshinori; Yin, Hang; Rodriguez, Johanna M; Becerril, Jorge; Berndt, Norbert; Hamilton, Andrew D; Wang, Hong-Gang; Sebti, Saïd M
2011-03-18
A critical hallmark of cancer cell survival is evasion of apoptosis. This is commonly due to overexpression of anti-apoptotic proteins such as Bcl-2, Bcl-X(L), and Mcl-1, which bind to the BH3 α-helical domain of pro-apoptotic proteins such as Bax, Bak, Bad, and Bim, and inhibit their function. We designed a BH3 α-helical mimetic BH3-M6 that binds to Bcl-X(L) and Mcl-1 and prevents their binding to fluorescently labeled Bak- or Bim-BH3 peptides in vitro. Using several approaches, we demonstrate that BH3-M6 is a pan-Bcl-2 antagonist that inhibits the binding of Bcl-X(L), Bcl-2, and Mcl-1 to multi-domain Bax or Bak, or BH3-only Bim or Bad in cell-free systems and in intact human cancer cells, freeing up pro-apoptotic proteins to induce apoptosis. BH3-M6 disruption of these protein-protein interactions is associated with cytochrome c release from mitochondria, caspase-3 activation and PARP cleavage. Using caspase inhibitors and Bax and Bak siRNAs, we demonstrate that BH3-M6-induced apoptosis is caspase- and Bax-, but not Bak-dependent. Furthermore, BH3-M6 disrupts Bcl-X(L)/Bim, Bcl-2/Bim, and Mcl-1/Bim protein-protein interactions and frees up Bim to induce apoptosis in human cancer cells that depend for tumor survival on the neutralization of Bim with Bcl-X(L), Bcl-2, or Mcl-1. Finally, BH3-M6 sensitizes cells to apoptosis induced by the proteasome inhibitor CEP-1612.
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Directory of Open Access Journals (Sweden)
Yin Weilun
2010-01-01
Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that
Directory of Open Access Journals (Sweden)
Li Mei-zhi
2010-10-01
Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring
Directory of Open Access Journals (Sweden)
Liu Zhongjie
2015-11-01
Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.
Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter
International Nuclear Information System (INIS)
Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix
2011-01-01
Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing
Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells
DEFF Research Database (Denmark)
Mortensen, O V; Thomassen, M; Larsen, M B
1999-01-01
were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...
International Nuclear Information System (INIS)
Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua
2011-01-01
Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others
2011-09-09
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Becker, J S; Boulyga, S F
2001-07-01
This paper describes an analytical procedure for determining the stoichiometry of BaxSr1-xTiO3 perovskite layers using inductively coupled plasma mass spectrometry (ICP-MS). The analytical results of mass spectrometry measurements are compared to those of X-ray fluorescence analysis (XRF). The performance and the limits of solid-state mass spectrometry analytical methods for the surface analysis of thin BaxSr1-xTiO3 perovskite layers sputtered neutral mass spectrometry (SNMS)--are investigated and discussed.
Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis
DEFF Research Database (Denmark)
Xu, Wenming; Zhang, Sizhong; Qiu, Weimin
2009-01-01
reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...
CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.
Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan
2017-07-05
DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20
Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.
Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk
2009-07-01
To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
Directory of Open Access Journals (Sweden)
Oliveira Jorge
2007-07-01
Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.
Sandoval, V.; Barton, K.; Longhurst, A.
2012-12-01
Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.
Mishra, Avinash; Tanna, Bhakti
2017-01-01
Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Directory of Open Access Journals (Sweden)
Lyu C
2017-08-01
Full Text Available Chuang Lyu,1,2 Gong-Wei Lyu,3 Aurora Martinez,4 Tie-Jun Sten Shi4 1State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Harbin, People’s Republic of China; 2Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden; 3Department of Neurology, 1st Hospital of Harbin Medical University, Harbin, People’s Republic of China; 4Department of Biomedicine, University of Bergen, Bergen, Norway Background: The proapoptotic molecule BAX, plays an important role in mitochondrial apoptotic pathway. Dorsal root ganglion (DRG neurons depend on neurotrophic factors for survival at early developmental stages. Withdrawal of neurotrophic factors will induce apoptosis in DRG neurons, but this type of cell death can be delayed or prevented in neonatal Bax knockout (KO mice. In adult animals, evidence also shows that DRG neurons are less dependent upon neurotrophic factors for survival. However, little is known about the effect of Bax deletion on the survival of normal and denervated DRG neurons in adult mice. Methods: A unilateral sciatic nerve transection was performed in adult Bax KO mice and wild-type (WT littermates. Stereological method was employed to quantify the number of lumbar-5 DRG neurons 1 month post-surgery. Nerve injury-induced autotomy behavior was also examined on days 1, 3, and 7 post-surgery. Results: There were significantly more neurons in contralateral DRGs of KO mice as compared with WT mice. The number of neurons was reduced in ipsilateral DRGs in both KO and WT mice. No changes in size distributions of DRG neuron profiles were detected before or after nerve injury. Injury-induced autotomy behavior developed much earlier and was more serious in KO mice. Conclusion: Although postnatal death or loss of DRG neurons is partially prevented by Bax deletion, this effect cannot interfere with long-term nerve injury-induced neuronal loss. The exaggerated self
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de
2009-01-01
The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define
Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System
2005-10-01
absence of Bax inhibition would be expected to inhibit apoptosis. Few other mitochondrial apoptotic genes displayed differences. Bad , which binds Bcl...Jensen LI, Jarmer H, Berka R, Gautier L, Nielser HB, Saxild HH, Nielsen C, Brunak S, Knudsen S (2002): A new non-linear normalization method for reducing
Lintas, Carla; Sacco, Roberto; Persico, Antonio M
2016-01-01
Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Olayan, Rawan S.
2012-01-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Olayan, Rawan S.
2012-12-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Directory of Open Access Journals (Sweden)
Jolanta Kunert-Radek
2004-03-01
Full Text Available It is well established that disruption of apoptosis may lead to tumor initiation, progression or metastasis. It is also well documented that many anticancer drugs induce apoptosis. In the earlier studies, the dopamine D2 receptor agonist bromocriptine (BC and somatostatin analog octreotide (OCT were found to inhibit the growth of the estrogen-induced rat prolactinoma. Our previous investigations, applying the TUNEL method showed the involvement of the pro-apoptotic effect in the action of BC, and to a lesser degree, in the action of OCT. The aim of the present study was to investigate whether the pro-apoptotic action of these drugs involves the increased expression of Bax--a member of Bcl-2 protein family which is known to play an important role in the regulation of apoptosis. Male four-week Fisher 344 rats were used in the experiment. Capsules containing diethylstilboestrol (DES were implanted subcutaneously. Six weeks after the implantation the rats were given OCT (2 x 25 microg/animal/24, BC (3 mg/kg b.w./24 h or OCT and BC at the above doses for 10 days. Bax expression was detected by immunohistochemistry. Prolactin (PRL in blood serum was measured by radioimmunoassay (RIA. It has been found that both OCT and BC, alone or in combination, significantly reduce the tumor weight. Both OCT and BC suppressed PRL levels, but the inhibitory effect of BC was stronger than that of OCT. It has been found that the treatment with OCT and BC, alone or in combination, causes a significant increase in Bax expression in the rat prolactinoma cells. Our findings indicate that anti-tumoral action of bromocriptine and to some extent the action of octreotide in the experimental rat prolactinoma is connected with the induction of apoptosis and is associated with increased Bax expression.
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters
Directory of Open Access Journals (Sweden)
Avinash Mishra
2017-05-01
Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Directory of Open Access Journals (Sweden)
Aman Wang
2017-05-01
Full Text Available Resistance to platinum-based chemotherapy is one of the most important reasons for treatment failure in advanced non-small cell lung cancer, but the underlying mechanism is extremely complex and unclear. The present study aimed to investigate the correlation of ubiquitin-specific peptidase 22 (USP22 with acquired resistance to cisplatin in lung adenocarcinoma. In this study, we found that overexpression of USP22 could lead to cisplatin resistance in A549 cells. USP22 and its downstream proteins γH2AX and Sirt1 levels are upregulated in the cisplatin- resistant A549/CDDP cell line. USP22 enhances DNA damage repair and induce cisplatin resistance by promoting the phosphorylation of histone H2AX via deubiquitinating histone H2A. In addition, USP22 decreases the acetylation of Ku70 by stabilizing Sirt1, thus inhibiting Bax-mediated apoptosis and inducing cisplatin resistance. The cisplatin sensitivity in cisplatin-resistant A549/CDDP cells was restored by USP22 inhibition in vivo and vitro. In summary, our findings reveal the dual mechanism of USP22 involvement in cisplatin resistance that USP22 can regulate γH2AX-mediated DNA damage repair and Ku70/Bax-mediated apoptosis. USP22 is a potential target in cisplatin-resistant lung adenocarcinoma and should be considered in future therapeutic practice.
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
CAGE-defined promoter regions of the genes implicated in Rett Syndrome
DEFF Research Database (Denmark)
Vitezic, Morana; Bertin, Nicolas; Andersson, Robin
2014-01-01
BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Energy Technology Data Exchange (ETDEWEB)
Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)
2013-10-11
Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.
BAX/BAK–Independent Mitoptosis during Cell Death Induced by Proteasome Inhibition?
Lomonosova, Elena; Ryerse, Jan; Chinnadurai, G.
2009-01-01
Proteasome inhibitors induce rapid death of cancer cells. We show that in epithelial cancer cells, such death is associated with dramatic and simultaneous up-regulation of several BH3-only proteins, including BIK, BIM, MCL-1S, NOXA, and PUMA, as well as p53. Elevated levels of these proteins seem to be the result of direct inhibition of their proteasomal degradation, induction of transcription, and active translation. Subsequent cell death is independent of BAX, and probably BAK, and proceeds...
Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid
2017-01-01
The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of MLH1 promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig.
Ryan, Marion T; Hamill, Ruth M; O'Halloran, Aisling M; Davey, Grace C; McBryan, Jean; Mullen, Anne M; McGee, Chris; Gispert, Marina; Southwood, Olwen I; Sweeney, Torres
2012-07-25
The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK), a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs) in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP) and intramuscular fat (IMF) in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G) characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98), Duroc (n = 99) and Pietrain (n = 98) purebreds. Four major haplotypes including promoter SNP's g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL) and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT), pH at 45 min in LTL (pH(45)LT) and pH at 45 min in the M. semimembranosus muscle (pH(45)SM). HAP3 was associated with driploss%, pHULT pH(45)LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2, HAP3 and HAP4) in the Duroc breed. The
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig
Directory of Open Access Journals (Sweden)
Ryan Marion T
2012-07-01
Full Text Available Abstract Background The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK, a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. Results PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP and intramuscular fat (IMF in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98, Duroc (n = 99 and Pietrain (n = 98 purebreds. Four major haplotypes including promoter SNP’s g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT, pH at 45 min in LTL (pH45LT and pH at 45 min in the M. semimembranosus muscle (pH45SM. HAP3 was associated with driploss%, pHULT pH45LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
DEFF Research Database (Denmark)
Rohlin, A; Engwall, Y; Fritzell, K
2011-01-01
inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
Vitrification affects nuclear maturation and gene expression of immature human oocytes
Directory of Open Access Journals (Sweden)
Abbas Shahedi
2017-02-01
Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro (fIVM , and (II GV oocytes (n=107 that initially vitrified, then matured in in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile.
Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad
2014-12-01
One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.
c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells
International Nuclear Information System (INIS)
Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I
2011-01-01
The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
Association of Pro-apoptotic Bad Gene Expression Changes with Benign Thyroid Nodules.
Gül, Nurdan; Temel, Berna; Ustek, Duran; Sirma-Ekmekçi, Sema; Kapran, Yersu; Tunca, Fatih; Giles-Şenyürek, Yasemin; Özbek, Uğur; Alagöl, Faruk
2018-01-01
This study aimed to investigate the role of the mitochondrial apoptotic pathway in benign thyroid nodules. Paired samples of nodular and normal tissues were collected from 26 patients with nodular goiters undergoing thyroidectomy. Variable expression of Bcl-2, Bax and Bad genes were evaluated by quantitative PCR. Expression level of Bad gene in nodules was found to be significantly decreased compared to normal tissues (p=0.049). A positive correlation was observed between nodule size and Bad expression levels (correlation coefficient=0.563, p=0.004); and this correlation was stronger in hot nodules (n=18, correlation coefficient=0.689, p=0.003). No significant difference was observed between nodular and normal tissue expressions of Bax and Bcl-2. These results suggest that Bad expression correlates with the size of benign thyroid nodules and also its relatively lower expression in nodules, warrant further investigation. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter
International Nuclear Information System (INIS)
Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi
2006-01-01
The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid
Directory of Open Access Journals (Sweden)
Fang-Hui Li
2014-01-01
Full Text Available Objective. This study aimed to analyze the effects of low level laser irradiation (LLLI on Bax and IGF-1 and Bcl-2 protein contents and SIRT1/PGC-1α axis mRNA expression levels to prevent sarcopenia in aged rats. Material and Methods. Twenty female Sprague Dawley rats (18 months old were randomly divided into two groups (n=10 per group: control (CON and LLLI groups. The gallium-aluminum-arsenium (GaAlAs laser irradiation at 810 nm was used in the single point contact mode (3.75 J/cm2; 0.4 cm2; 125 mW/cm2; 30 s. Bax, Bcl-2, and IGF-1 proteins and SIRT1/PGC-1α axis mRNA expression were assessed 24 h after LLLI on gastrocnemius in aged rat. Results. Gastrocnemius muscle weights, gastrocnemius mass/body mass, Bcl-2/BAX ratio, Bcl-2 protein, IGF-1 protein, and the mRNA contents in SIRT1, PGC-1α, NRF1, TMF, and SOD2 were significantly (P<0.05 increased by LLLI compared to CON group without LLLI. However, levels of BAX protein and caspase 3 mRNA were significantly attenuated by LLLI compared to CON group (P<0.05. Conclusion. LLLI at 810 nm inhibits sarcopenia associated with upregulation of Bcl-2/BAX ratio and IGF-1 and SIRT1/PGC-1α axis mRNA expression in aged rats. This indicates that LLLI has potential to decrease progression of myocyte apoptosis in sarcopenic muscles.
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Glucose metabolism in pigs expressing human genes under an insulin promoter.
Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David
2015-01-01
Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Lincoln Matthew R
2008-07-01
Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.
Eissa, Sanaa; Zohny, Samir F; Shehata, Hanan Hussien; Hegazy, Marwa G A; Salem, Ahmed M; Esmat, Mohamed
2012-04-01
We evaluated the significance of urinary retinoic acid receptor-β2 (RAR-β2) gene promoter methylation and hyaluronidase activity in comparison with voided urine cytology (VUC) in diagnosis of bladder cancer. This study included 100 patients diagnosed with bladder cancer, 65 patients with benign urological disorders and 51 healthy volunteers. Urine supernatant was used for determining hyaluronidase activity by zymography while urine sediment was used for cytology and detection of methylated RAR-β2 gene promoter by methylation specific nested PCR. The sensitivity and specificity were 53% and 90.5% for VUC, 65% and 89.7% for percent methylation fraction of RAR-β2 gene promoter, and 89% and 90.5% for hyaluronidase activity; combination of the three parameters increased sensitivity to 95%. A significant association was observed between investigated markers and advanced grade tumor. Combined use of RAR-β2 gene promoter methylation, hyaluronidase activity and VUC is promising non-invasive tool for bladder cancer detection. Copyright © 2012. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Jalal Hassanshahi
2013-10-01
Full Text Available Introduction: Preliminary studies confirmed reduction of cell death following treatment with antioxidants. According to this finding we investigated the relationship between consumption of CoQ10 and expression of bax and bcl2 in hippocampus ischemia that this expression related to cell programmed death.Material and Methods: We studied the protective role of CoQ10 against ischemia-reperfusion. Experimental design includes four groups: intact (N=7, ischemic control (N=7, sham control (N=7 and treatment groups with CoQ10 (N=7. The mice (treatment group treated with CoQ10 as Pre-Treatment for a week. Then, ischemia induced by common carotid artery ligation and following the reduction in inflammation (a week the treatment group post-treated with CoQ10 for a week. Nissl staining applied to counting necrotic cells of hippocampus and the western blotting performed to measurement the bax and bcl2 expression. Tunnel kit was used to quantify apoptotic cell death while to short term memory scale, we apply Y-maze.Results: Cell death was significantly lower when mice treated with CoQ10. Bax expression was significantly high in ischemic group but in treatment group was less and reversely the bcl2 expression in ischemic group was lower than treatment and vehicle groups. The memory test results were consistent with cell death results. Conclusion: Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake significantly reduced cell death and decreased memory loss. with prevent of expression of bax and increase in expression of bcl2.
Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System
2009-09-01
enlarged fracture cartilage. Real-time RT-PCR measurements compared Bax KO mouse fracture gene expression to C57BL/6J (wild-type) mouse fracture gene...2 mM l-glutamine, 100 U/mL peni - cillin, and 100 µg/mL streptomycin (Invitrogen) in 60-mm plates, and cultured in a humidified 37°C incubator with 5...increased callus size and callus cartilage formation during the early phase of the fracture healing process, the enlarged callus and cartilage area were
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Heaton, Marieta Barrow; Paiva, Michael; Kubovic, Stacey; Kotler, Alexandra; Rogozinski, Jonathan; Swanson, Eric; Madorsky, Vladimir; Posados, Michelle
2011-01-01
These studies investigated ethanol effects on upstream cellular elements and interactions which contribute to Bax-related apoptosis in neonatal rat cerebellum at ages of peak ethanol sensitivity (postnatal day 4 [P4]), compared to later ages of relative resistance (P7). Analyses were made of basal levels of the pro-apoptotic c-jun N-termimal kinase (JNK), Bax, and the 14-3-3 anchoring proteins, as well as the responsiveness of these substances to ethanol at P4 versus P7. Dimerization of Bax with 14-3-3 was also investigated at the two ages following ethanol treatment, a process which sequesters Bax in the cytosol, thus inhibiting its mitochondrial translocation and disruption of the mitochondrial membrane potential. Cultured cerebellar granule cells were used to examine the protective potential of JNK inhibition on ethanol-mediated cell death. Basal levels of JNK were significantly higher at P4 than P7, but no differences in the other proteins were found. Activated JNK, and cytosolic and mitochondrially-translocated Bax were increased in P4 but not P7 animals following ethanol exposure, while protective 14-3-3 proteins were increased only at P7. Ethanol treatment resulted in decreases in Bax:14-3-3 heterodimers at P4, but not at P7. Inhibition of JNK activity in vitro provided partial protection against ethanol neurotoxicity. Thus, differential temporal vulnerability to ethanol in this CNS region correlates with differences in both levels of apoptosis-related substances (e.g., JNK), and differential cellular responsiveness, favoring apoptosis at the most sensitive age and survival at the resistant age. The upstream elements contributing to this vulnerability can be targets for future therapeutic strategies. PMID:22169498
Interacciones hiperfinas en BaxSr1-xHfO3
Directory of Open Access Journals (Sweden)
López García, A.
1999-10-01
Full Text Available In order to determine the microscopic role of cation A in ABO3 perovskites the hyperfine interaction in the Sr1-xBaxHfO3 system using Perturbed Angular Correlation spectroscopy (PAC is studied. As a previous result the compositions x = 0.50 and 0.25 are shown. The PAC spectra were obtained in the temperature range from 20 to 1000ºC. In both compounds a phase transition to higher symmetry structure was observed at T≈400 and 200ºC, respectively. This structure is proposed to be cubic in both compositions. The results are compared with those obtained in SrHfO3 and BaHfO3.Con el fin de determinar el papel microscópico que juega el catión A en las perovskitas ABO3 se estudia la interacción hiperfina el sistema Sr1-xBaxHfO3 usando la espectroscopia Correlaciones Angulares Perturbadas (PAC en función de la temperatura y la composición. Como resultado previo se muestra en este trabajo, el estudio de las composiciones x = 0.5 y 0.75. Las medidas PAC se realizaron en el intervalo de temperaturas que va desde 20 a 1000ºC. Para x=0.50 y 0.75 se determinó una transición a una fase de mayor simetría a T≈400 y 200ºC, respectivamente. Se propone que esta fase de mayor simetría es cúbica en ambas composiciones. Los resultados obtenidos son comparados con los compuestos puros SrHfO3 y BaHfO3.
Directory of Open Access Journals (Sweden)
eyed Ataollah Sadat Shandiz
2016-02-01
Full Text Available Objective: To evaluate the effect of imatinib mesylate on KAI1 gene expression and apoptosis properties in human gastric carcinoma AGS cell line. Methods: Cell viability was assessed by MTT assay and quantitative real time PCR method was applied for investigation of Bax, Bcl-2, and KAI1 gene expression in AGS cells. The quantity of KAI1, Bax, and Bcl-2 compared to GAPDH gene expressions were examined using the formula 2-∆∆Ct. Furthermore, cell apoptosis/necrosis was carried out by annexin V/PI staining and quantified with flow cytometry after treatment with imatinib. Results: Imatinib mesylate was showed to have a dose-dependent toxicity effect against AGS cells. KAI1/GAPDH gene expression ratios were 1.07 ± 0.02 (P > 0.05, 1.68 ± 0.19 (P > 0.05, 3.60 ± 0.55 (P < 0.05, 6.54 ± 0.27 (P < 0.001 for 20, 50, 80 and 100 μmol/L of imatinib concentrations. The mRNA levels of Bax detected by real-time PCR after treatment with imatinib mesylate were significantly increased. Also, the number of apoptotic cells was increased from 3.72% (statistically significant; P < 0.05 in untreated AGS cells to 21.72%, 83.04% and 85.80%, respectively, following treatment with 20, 40, and 60 μmol/L imatinib mesylate. Conclusions: The results suggest that imatinib mesylate can induce apoptosis pathway in a dose-dependent mode and might modulate metastasis by up regulating KAI1 gene expression in human gastric carcinoma AGS cell line.
Energy Technology Data Exchange (ETDEWEB)
Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)
2010-07-30
Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.
AMP-activated protein kinase phosphorylates CtBP1 and down-regulates its activity
Energy Technology Data Exchange (ETDEWEB)
Kim, Jae-Hwan; Choi, Soo-Youn; Kang, Byung-Hee; Lee, Soon-Min [National Creative Research Center for Epigenome Reprogramming Network, Departments of Biomedical Sciences and Biochemistry and Molecular Biology, Ischemic/Hypoxic Disease Institute, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Hyung Soon; Kang, Gum-Yong; Bang, Joo Young [Center for Biomedical Mass Spectrometry, Diatech Korea Co., Ltd., Seoul (Korea, Republic of); Cho, Eun-Jung [National Research Laboratory for Chromatin Dynamics, College of Pharmacy, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Youn, Hong-Duk, E-mail: hdyoun@snu.ac.kr [National Creative Research Center for Epigenome Reprogramming Network, Departments of Biomedical Sciences and Biochemistry and Molecular Biology, Ischemic/Hypoxic Disease Institute, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); WCU Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence and Technology, Seoul National University, Seoul (Korea, Republic of)
2013-02-01
Highlights: ► AMPK phosphorylates CtBP1 on serine 158. ► AMPK-mediated phosphorylation of CtBP1 causes the ubiquitination and nuclear export of CtBP1. ► AMPK downregulates the CtBP1-mediated repression of Bax transcription. -- Abstract: CtBP is a transcriptional repressor which plays a significant role in the regulation of cell proliferation and tumor progression. It was reported that glucose withdrawal causes induction of Bax due to the dissociation of CtBP from the Bax promoter. However, the precise mechanism involved in the regulation of CtBP still remains unclear. In this study, we found that an activated AMP-activated protein kinase (AMPK) phosphorylates CtBP1 on Ser-158 upon metabolic stresses. Moreover, AMPK-mediated phosphorylation of CtBP1 (S158) attenuates the repressive function of CtBP1. We also confirmed that triggering activation of AMPK by various factors resulted in an increase of Bax gene expression. These findings provide connections of AMPK with CtBP1-mediated regulation of Bax expression for cell death under metabolic stresses.
Thangapazham, Rajesh L; Gaddipati, Jaya P; Rajeshkumar, N V; Sharma, Anuj; Singh, Anoop K; Ives, John A; Maheshwari, Radha K; Jonas, Wayne B
2006-12-01
Homeopathy is an alternative medical system practiced in all parts of the world. Although several theories are proposed to explain the mechanisms of action, none are scientifically verified. In this study, the authors investigate the effect of selected homeopathic remedies often used to treat prostate and breast cancer. The authors investigated the effect of the homeopathic medicines Conium maculatum, Sabal serrulata, Thuja occidentalis, Asterias, Phytolacca, and Carcinosin on prostate and breast cancer cell (DU-145, LNCaP, MAT-LyLu, MDA-MB-231) growth and on gene expression that regulates apoptosis, using MTT and multiprobe ribonuclease protection assay. None of the homeopathic remedies tested in different potencies produced significant inhibitory or growth-promoting activity in either prostate or breast cancer cells. Also, gene expression studies by ribonuclease protection assay produced no significant changes in mRNA levels of bax, bcl-2, bcl-x, caspase-1, caspase-2, caspase-3, Fas, or FasL after treatment with homeopathic medicines. The results demonstrate that the highly diluted homeopathic remedies used by homeopathic practitioners for cancer show no measurable effects on cell growth or gene expression in vitro using currently available methodologies.
Genomic organization and promoter cloning of the human X11α gene APBA1.
LENUS (Irish Health Repository)
Chai, Ka-Ho
2012-05-01
X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes
DEFF Research Database (Denmark)
Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard
2009-01-01
with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Energy Technology Data Exchange (ETDEWEB)
Descours, A.
1997-02-14
The separation of para-xylene from C8 aromatics is performed industrially bu adsorption process on zeolitic molecular sieves. The sorption properties of these zeolites are strongly linked to their structure, and their comprehension require an accurate knowledge of the interactions between sorbate molecules and zeolitic structure. The aim of this work is to characterise from a structural point of view the adsorption of para- and meta-xylenes in BaX and NaX zeolites. The former is selective for para-xylene, and the latter has not selective properties for para- and meta-isomers of xylene. For each zeolite, the adsorption of pure para-xylene and meta-xylene or a mixture of the two isomers, is investigated as a function of coverage. Powder neutron diffraction is used to determine the crystalline structure of these zeolites and the different crystallographic adsorption sites of the molecules. The influence of coverage on sorbate-sorbent and sorbate-sorbate interactions is investigated. Infrared spectroscopy allows to determine the chemical environment of the sorbate molecules at low coverage or when the coverage increases, and is particularly effective for the study of the binary mixture of xylenes. This study is performed by sorbing a mixture of xylene isomers, or by sorbing these isomers successively. Infrared studies and crystallographic analysis are compared in order to get a consistent description of adsorption mechanism of xylene isomers for both zeolites as a function of coverage. The role of coverage, of cation type, an the presence of the two xylene isomers is the super-cages is essential. For both zeolites, the increase of coverage actually leads to steric hindrances between sorbed molecules and molecular rearrangements. These reorganizations are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are particularly confined in BaX zeolite
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Directory of Open Access Journals (Sweden)
Akihiro Kawashima
Full Text Available Maternal cigarette smoking is reportedly associated with miscarriage, fetal growth restriction and placental abruption, and is paradoxically associated with a decreased risk of developing preeclampsia. In the present study, we investigated the gene expression levels of villous tissues in early gestation. We compared the expression levels of the genes related to angiogenesis and apoptosis in the villous tissues obtained from smoking and non-smoking pregnant women.We collected villous tissue samples from 57 women requesting surgical termination due to non-medical reasons at 6-8 weeks of gestation. The maternal cigarette smoking status was evaluated by the level of serum cotinine and patients were divided into active smokers and non-smokers by the serum cotinine level. The placental levels of VEGFA, PGF, FLT1, HIF1A, TP53, BAX and BCL2 mRNA were quantified by real time PCR.The gene expression level of PGF and HIF1A in the active smoker group was significantly higher than that in the non-smoker group. We did not observe any significant differences in the VEGFA or FLT1 expression between the groups. In active smoker group, the gene expression levels of TP53 and BAX were significantly higher than those in the non-smoker group. The ratio of BAX/BCL2 mRNA in the active smoker group was significantly higher than that in the non-smoker group.Our findings revealed that smoking might affect the placenta during early pregnancy. Maternal cigarette smoking in early pregnancy may be associated with villus hypoxia, which may influence angiogenesis and apoptosis.
Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters
Energy Technology Data Exchange (ETDEWEB)
Shin, Ilchung [Ames Laboratory; Ray, Judhajeet [Ames Laboratory; Gupta, Vinayak [Iowa State University; Ilgu, Muslum [Ames Laboratory; Beasley, Jonathan [Iowa State University; Bendickson, Lee [Ames Laboratory; Mehanovic, Samir [Molecular Express; Kraus, George A. [Iowa State University; Nilsen-Hamilton, Marit [Ames Laboratory
2014-04-20
We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.
Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.
2010-01-01
Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Yin, Xian; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Liu, Long; Chen, Jian
2017-03-15
The dynamic control of gene expression is important for adjusting fluxes in order to obtain desired products and achieve appropriate cell growth, particularly when the synthesis of a desired product drains metabolites required for cell growth. For dynamic gene expression, a promoter responsive to a particular environmental stressor is vital. Here, we report a low-pH-inducible promoter, P gas , which promotes minimal gene expression at pH values above 5.0 but functions efficiently at low pHs, such as pH 2.0. First, we performed a transcriptional analysis of Aspergillus niger , an excellent platform for the production of organic acids, and we found that the promoter P gas may act efficiently at low pH. Then, a gene for synthetic green fluorescent protein ( sGFP ) was successfully expressed by P gas at pH 2.0, verifying the results of the transcriptional analysis. Next, P gas was used to express the cis -aconitate decarboxylase ( cad ) gene of Aspergillus terreus in A. niger , allowing the production of itaconic acid at a titer of 4.92 g/liter. Finally, we found that P gas strength was independent of acid type and acid ion concentration, showing dependence on pH only. IMPORTANCE The promoter P gas can be used for the dynamic control of gene expression in A. niger for metabolic engineering to produce organic acids. This promoter may also be a candidate tool for genetic engineering. Copyright © 2017 American Society for Microbiology.
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
Energy Technology Data Exchange (ETDEWEB)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; Jin, Lu; Gohil, Suresh; Sandström, Corine; Olsson, Helena; Persson, Cecilia; Höglund, Anna-Stina; Fransson, Gunnel; Ruan, Ying; Åman, Per; Jansson, Christer; Liu, Chunlin; Andersson, Roger; Sun, Chuanxin
2017-12-01
Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.
Love, Dona C; Ghosh, Salil; Mondoux, Michelle A; Fukushige, Tetsunari; Wang, Peng; Wilson, Mark A; Iser, Wendy B; Wolkow, Catherine A; Krause, Michael W; Hanover, John A
2010-04-20
Nutrient-driven O-GlcNAcylation of key components of the transcription machinery may epigenetically modulate gene expression in metazoans. The global effects of GlcNAcylation on transcription can be addressed directly in C. elegans because knockouts of the O-GlcNAc cycling enzymes are viable and fertile. Using anti-O-GlcNAc ChIP-on-chip whole-genome tiling arrays on wild-type and mutant strains, we detected over 800 promoters where O-GlcNAc cycling occurs, including microRNA loci and multigene operons. Intriguingly, O-GlcNAc-marked promoters are biased toward genes associated with PIP3 signaling, hexosamine biosynthesis, and lipid/carbohydrate metabolism. These marked genes are linked to insulin-like signaling, metabolism, aging, stress, and pathogen-response pathways in C. elegans. Whole-genome transcriptional profiling of the O-GlcNAc cycling mutants confirmed dramatic deregulation of genes in these key pathways. As predicted, the O-GlcNAc cycling mutants show altered lifespan and UV stress susceptibility phenotypes. We propose that O-GlcNAc cycling at promoters participates in a molecular program impacting nutrient-responsive pathways in C. elegans, including stress, pathogen response, and adult lifespan. The observed impact of O-GlcNAc cycling on both signaling and transcription in C. elegans has important implications for human diseases of aging, including diabetes and neurodegeneration.
Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L
1999-09-24
To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Directory of Open Access Journals (Sweden)
Xian-E Peng
Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
International Nuclear Information System (INIS)
Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran
2012-01-01
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC
Zhuang, Fengfeng; Nguyen, Manuel P; Shuler, Charles; Liu, Yi-Hsin
2009-04-03
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent transactivation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and heat shock factors may play a contributing role.
Anticancer copper(II) phosphorus dendrimers are potent proapoptotic Bax activators.
Mignani, Serge; El Brahmi, Nabil; Eloy, Laure; Poupon, Joel; Nicolas, Valérie; Steinmetz, Anke; El Kazzouli, Said; Bousmina, Mosto M; Blanchard-Desce, Mireille; Caminade, Anne-Marie; Majoral, Jean-Pierre; Cresteil, Thierry
2017-05-26
A multivalent phosphorus dendrimer 1G 3 and its corresponding Cu-complex, 1G 3 -Cu have been recently identified as agents retaining high antiproliferative potency. This antiproliferative capacity was preserved in cell lines overexpressing the efflux pump ABC B1, whereas cross-resistance was observed in ovarian cancer cell lines resistant to cisplatin. Theoretical 3D models were constructed: the dendrimers appear as irregularly shaped disk-like nano-objects of about 22 Å thickness and 49 Å diameter, which accumulated in cells after penetration by endocytosis. To get insight in their mode of action, cell death pathways have been examined in human cancer cell lines: early apoptosis was followed by secondary necrosis after multivalent phosphorus dendrimers exposure. The multivalent plain phosphorus dendrimer 1G 3 moderately activated caspase-3 activity, in contrast with the multivalent Cu-conjugated phosphorus dendrimer 1G 3 -Cu which strikingly reduced the caspase-3 content and activity. This decrease of caspase activity is not related to the presence of copper, since inorganic copper has no or little effect on caspase-3. Conversely the potent apoptosis activation could be related to a noticeable translocation of Bax to the mitochondria, resulting in the release of AIF into the cytosol, its translocation to the nucleus and a severe DNA fragmentation, without alteration of the cell cycle. The multivalent Cu-conjugated phosphorus dendrimer is more efficient than its non-complexed analog to activate this pathway in close relationship with the higher antiproliferative potency. Therefore, this multivalent Cu-conjugated phosphorus dendrimer 1G 3 -Cu can be considered as a new and promising first-in-class antiproliferative agent with a distinctive mode of action, inducing apoptosis tumor cell death through Bax activation pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V
2015-01-01
Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (pmastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.
Dash, S.; Kajita, T.; Okawa, M.; Saitoh, T.; Ikenaga, E.; Saini, N. L.; Katsufuji, T.; Mizokawa, T.
2018-04-01
We have studied a charge-orbital driven metal-insulator transition (MIT) in hollandite-type BaxTi8O16 +δ by means of hard x-ray photoemission spectroscopy (HAXPES). The Ti 2 p HAXPES indicates strong Ti3 +/Ti4 + charge fluctuation in the metallic phase above the MIT temperature. The metallic phase is characterized by a power-law spectral function near the Fermi level which would be a signature of bad metal with non-Drude polaronic behavior. The power-law spectral shape is associated with the large Seebeck coefficient of the metallic phase in BaxTi8O16 +δ .
Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan
To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells
International Nuclear Information System (INIS)
Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella
2011-01-01
Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.
Directory of Open Access Journals (Sweden)
Raheleh Farahzadi
Full Text Available The use of mesenchymal stem cells (MSCs for cell therapy and regenerative medicine has received widespread attention over the past few years, but their application can be complicated by factors such as reduction in proliferation potential, the senescent tendency of the MSCs upon expansion and their age-dependent decline in number and function. It was shown that all the mentioned features were accompanied by a reduction in telomerase activity and telomere shortening. Furthermore, the role of epigenetic changes in aging, especially changes in promoter methylation, was reported. In this study, MSCs were isolated from the adipose tissue with enzymatic digestion. In addition, immunocytochemistry staining and flow cytometric analysis were performed to investigate the cell-surface markers. In addition, alizarin red-S, sudan III, toluidine blue, and cresyl violet staining were performed to evaluate the multi-lineage differentiation of hADSCs. In order to improve the effective application of MSCs, these cells were treated with 1.5 × 10-8 and 2.99 × 10-10 M of ZnSO4 for 48 hours. The length of the absolute telomere, human telomerase reverse transcriptase (hTERT gene expression, telomerase activity, the investigation of methylation status of the hTERT gene promoter and the percentage of senescent cells were analyzed with quantitative real-time PCR, PCR-ELISA TRAP assay, methylation specific PCR (MSP, and beta-galactosidase (SA-β-gal staining, respectively. The results showed that the telomere length, the hTERT gene expression, and the telomerase activity had significantly increased. In addition, the percentage of senescent cells had significantly decreased and changes in the methylation status of the CpG islands in the hTERT promoter region under treatment with ZnSO4 were seen. In conclusion, it seems that ZnSO4 as a proper antioxidant could improve the aging-related features due to lengthening of the telomeres, increasing the telomerase gene expression
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
International Nuclear Information System (INIS)
Spink, Barbara C.; Bloom, Michael S.; Wu, Susan; Sell, Stewart; Schneider, Erasmus; Ding, Xinxin; Spink, David C.
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC) n , located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC) 2 alleles were observed; however, in western gorilla, (GGGGC) n alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC) n was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC) n alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC) 2 was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC) n short tandem repeats are inherited, and that the (GGGGC) 2 allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC) n , where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC) n microsatellite instability • AHR promoter activity of a construct with (GGGGC) 2 was lower than that of (GGGGC) 4 • The frequency of (GGGGC) 2 in lung cancer patients was 8-fold higher than in neonates • The
Xu, Guogang; Vogel, Kristine S; McMahan, C Alex; Herbert, Damon C; Walter, Christi A
2010-12-01
During the first wave of spermatogenesis, and in response to ionizing radiation, elevated mutant frequencies are reduced to a low level by unidentified mechanisms. Apoptosis is occurring in the same time frame that the mutant frequency declines. We examined the role of apoptosis in regulating mutant frequency during spermatogenesis. Apoptosis and mutant frequencies were determined in spermatogenic cells obtained from Bax-null or Trp53-null mice. The results showed that spermatogenic lineage apoptosis was markedly decreased in Bax-null mice and was accompanied by a significantly increased spontaneous mutant frequency in seminiferous tubule cells compared to that of wild-type mice. Apoptosis profiles in the seminiferous tubules for Trp53-null were similar to control mice. Spontaneous mutant frequencies in pachytene spermatocytes and in round spermatids from Trp53-null mice were not significantly different from those of wild-type mice. However, epididymal spermatozoa from Trp53-null mice displayed a greater spontaneous mutant frequency compared to that from wild-type mice. A greater proportion of spontaneous transversions and a greater proportion of insertions/deletions 15 days after ionizing radiation were observed in Trp53-null mice compared to wild-type mice. Base excision repair activity in mixed germ cell nuclear extracts prepared from Trp53-null mice was significantly lower than that for wild-type controls. These data indicate that BAX-mediated apoptosis plays a significant role in regulating spontaneous mutagenesis in seminiferous tubule cells obtained from neonatal mice, whereas tumor suppressor TRP53 plays a significant role in regulating spontaneous mutagenesis between postmeiotic round spermatid and epididymal spermatozoon stages of spermiogenesis.
International Nuclear Information System (INIS)
Seong, J. S.
1997-01-01
To analyze the involvement of apoptosis regulatory genes p53, p21 waf1/cip1 , bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21 waf1/cip1 , and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21 waf1/cip1 , although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21 waf1/cip1 as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21 waf1/cip1 . These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author)
Energy Technology Data Exchange (ETDEWEB)
Seong, J S [Yonsei Univ., Seoul (Korea, Republic of). Coll. of Medicine; Hunter, N R; Milas, L [Texas Univ., Houston, TX (United States)
1997-09-01
To analyze the involvement of apoptosis regulatory genes p53, p21{sup waf1/cip1}, bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21{sup waf1/cip1}, and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21{sup waf1/cip1}, although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21{sup waf1/cip1} as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21{sup waf1/cip1}. These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author).
International Nuclear Information System (INIS)
Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert
2014-01-01
In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang
2017-12-19
WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.
Directory of Open Access Journals (Sweden)
Ramesh
2015-06-01
Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Correlation between the methylation of APC gene promoter and colon cancer.
Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua
2017-08-01
The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Zhuang, Fengfeng; Nguyen, Manuel P.; Shuler, Charles; Liu, Yi-Hsin
2009-01-01
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent trans-activation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and Heat shock factors may play a contributing role. PMID:19338779
Directory of Open Access Journals (Sweden)
Mika Masumoto
Full Text Available Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively; however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Fu, Chunli; Xing, Yingqi; Song, Xiaonan
2011-04-01
To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
Directory of Open Access Journals (Sweden)
Shian-Ying Sung
Full Text Available Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.
Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro
2016-09-01
Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.
Directory of Open Access Journals (Sweden)
Xiao-Xi Guo
2012-11-01
Full Text Available Ginsenoside Rh2 (G-Rh2 has been shown to induce apoptotic cell death in a variety of cancer cells. However, the details of the signal transduction cascade involved in G-Rh2-induced cell death is unclear. In this manuscript we elucidate the molecular mechanism of G-Rh2-induced apoptosis in human hepatoma SK-HEP-1 cells by demonstrating that G-Rh2 causes rapid and dramatic translocation of both Bak and Bax, which subsequently triggers mitochondrial cytochrome c release and consequent caspase activation. Interestingly, siRNA-based gene inactivation of caspase-8 effectively delays caspase-9 activation and apoptosis induced by G-Rh2, indicating that caspase-8 also plays an important role in the G-Rh2-induced apoptosis program. Taken together, our results indicate that G-Rh2 employs a multi pro-apoptotic pathway to execute cancer cell death, suggesting a potential role for G-Rh2 as a powerful chemotherapeutic agent.
MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
Directory of Open Access Journals (Sweden)
Skiriute Daina
2012-06-01
Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.
Directory of Open Access Journals (Sweden)
Shahram Golbabapour
2013-01-01
Full Text Available Schiff base complexes have appeared to be promising in the treatment of different diseases and disorders and have drawn a lot of attention to their biological activities. This study was conducted to evaluate the regulatory effect of Schiff base metal derivatives on the expression of heat shock proteins (HSP 70 and BAX in protection against acute haemorrhagic gastric ulcer in rats. Rats were assigned to 6 groups of 6 rats: the normal control (Tween 20 5% v/v, 5 mL/kg, the positive control (Tween 20 5% v/v, 5 mL/kg, and four Schiff base derivative groups named Schiff_1, Schiff_2, Schiff_3, and Schiff_4 (25 mg/kg. After 1 h, all of the groups received ethanol 95% (5 mL/kg but the normal control received Tween 20 (Tween 20 5% v/v, 5 mL/kg. The animals were euthanized after 60 min and the stomachs were dissected for histology (H&E, immunohistochemistry, and western blot analysis against HSP70 and BAX proteins. The results showed that the Schiff base metal derivatives enhanced the expression of HSP70 and suppressed the expression of BAX proteins during their gastroprotection against ethanol-induced gastric lesion in rats.
Golbabapour, Shahram; Gwaram, Nura Suleiman; Al-Obaidi, Mazen M Jamil; Soleimani, A F; Ali, Hapipah Mohd; Abdul Majid, Nazia
2013-01-01
Schiff base complexes have appeared to be promising in the treatment of different diseases and disorders and have drawn a lot of attention to their biological activities. This study was conducted to evaluate the regulatory effect of Schiff base metal derivatives on the expression of heat shock proteins (HSP) 70 and BAX in protection against acute haemorrhagic gastric ulcer in rats. Rats were assigned to 6 groups of 6 rats: the normal control (Tween 20 5% v/v, 5 mL/kg), the positive control (Tween 20 5% v/v, 5 mL/kg), and four Schiff base derivative groups named Schiff_1, Schiff_2, Schiff_3, and Schiff_4 (25 mg/kg). After 1 h, all of the groups received ethanol 95% (5 mL/kg) but the normal control received Tween 20 (Tween 20 5% v/v, 5 mL/kg). The animals were euthanized after 60 min and the stomachs were dissected for histology (H&E), immunohistochemistry, and western blot analysis against HSP70 and BAX proteins. The results showed that the Schiff base metal derivatives enhanced the expression of HSP70 and suppressed the expression of BAX proteins during their gastroprotection against ethanol-induced gastric lesion in rats.
Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu
2009-09-01
We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.
Directory of Open Access Journals (Sweden)
zahra Kiasalari
2016-04-01
Full Text Available Background & objectives: Temporal lobe epilepsy is associated with neuronal apoptosis. Curcumin has antioxidant and anticonvulsant activities, therefore this study was conducted to assess involvement of Bax and Bcl2 in protective effect of curcumin in epileptic rats. Methods: 28 rats were divided into sham, curcumin-pretreated sham, epileptic (kainate, and curcumin-pretreated epileptic groups. Experimental model of epilepsy was induced by intrahippocampal administration of kainic acid. Rats received curcumin at a dose of 100 mg/kg. Finally, Nissl staining and Bax and Bcl2 immunohistochemistry were conducted on hippocampal sections and data were analyzed using one-way ANOVA and unpaired t-test. The p-value less than 0.05was considered statistically significant. Results: Induction of epilepsy was followed by a significant seizure and curcumin pretreatment significantly reduced seizure intensity (p<0.01. In addition, there were no significant differences between the groups in Nissl staining of CA3 area neurons. In addition, Bax positive neurons were observed in CA3 area in kainate group and significantly decreased in curcumin pretreated rats (p<0.05. Meanwhile, Bcl2 positive neurons were also moderately observed in kainate group and curcumin pretreatment significantly increased it (p<0.05. Conclusion: Curcumin pretreatment exhibits anticonvulsant activity in epileptic rats. It also decreases the expression of pro-apoptotic protein Bax and significantly enhances the expression of anti-apoptotic protein Bcl2 and hence could reduce neuronal apoptosis.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W
2017-09-01
The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.
CSIR Research Space (South Africa)
Kebede, MA
2011-07-01
Full Text Available Europium-doped barium magnesium aluminate (BaxMgyAl2O4:Eu) phosphors were obtained at low temperature using the solution-combustion of corresponding metal nitrate-urea solution mixtures. The particle sizes, morphology, structural and luminescent...
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
Zhuang, Fengfeng; Nguyen, Manuel P.; Shuler, Charles; Liu, Yi-Hsin
2009-01-01
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent trans-activation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in...
Directory of Open Access Journals (Sweden)
Naoko Minatani
Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
DEFF Research Database (Denmark)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
2013-01-01
, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Weterings, K; Schrauwen, J; Wullems, G; Twell, D
1995-07-01
Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
ΔNp73 enhances promoter activity of TGF-β induced genes.
Directory of Open Access Journals (Sweden)
Maarten Niemantsverdriet
Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells
Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X
2009-01-01
Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...
Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo
2018-02-01
Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
CSIR Research Space (South Africa)
Crampton, Michael C
2010-07-01
Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...
Directory of Open Access Journals (Sweden)
Nomeda Girnius
2017-11-01
Full Text Available Summary: Developmental morphogenesis, tissue injury, and oncogenic transformation can cause the detachment of epithelial cells. These cells are eliminated by a specialized form of apoptosis (anoikis. While the processes that contribute to this form of cell death have been studied, the underlying mechanisms remain unclear. Here, we tested the role of the cJUN NH2-terminal kinase (JNK signaling pathway using murine models with compound JNK deficiency in mammary and kidney epithelial cells. These studies demonstrated that JNK is required for efficient anoikis in vitro and in vivo. Moreover, JNK-promoted anoikis required pro-apoptotic members of the BCL2 family of proteins. We show that JNK acts through a BAK/BAX-dependent apoptotic pathway by increasing BIM expression and phosphorylating BMF, leading to death of detached epithelial cells. : Developmental morphogenesis, tissue injury, and oncogenic transformation can cause epithelial cell detachment. These cells are eliminated by a specialized form of apoptosis termed anoikis. Girnius and Davis show that anoikis is mediated by the cJUN NH2-terminal kinase (JNK, which increases BIM expression and phosphorylates BMF to engage BAK/BAX-dependent apoptosis. Keywords: apoptosis, anoikis, epithelial cell, mammary gland, JNK, BAX, BAK, BH3-only protein, BIM, BMF
Directory of Open Access Journals (Sweden)
Marwa H. Saied
2018-04-01
Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Directory of Open Access Journals (Sweden)
Casart Yveth
2008-03-01
Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.
Directory of Open Access Journals (Sweden)
Ruixi Liu
2012-01-01
Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.
Arroyo-Jousse, Viviana; Garcia-Diaz, Diego F; Codner, Ethel; Pérez-Bravo, Francisco
2016-12-01
TNF-α is a pro-inflammatory cytokine that is involved in type 1 diabetes (T1D) pathogenesis. The TNFa gene is subject of epigenetic regulation in which folate and homocysteine are important molecules because they participate in the methionine cycle where the most important methyl group donor (S-adenosylmethionine) is formed. We investigated whether TNFa gene promoter methylation status in T1D patients was related to blood folate, homocysteine and TNF-α in a transversal case-control study. We studied T1D patients (n 25, mean=13·7 years) and healthy control subjects (n 25, mean=31·1 years), without T1D and/or other autoimmune diseases or direct family history of these diseases. A blood sample was obtained for determination of serum folate, plasma homocysteine and TNF-α concentrations. Whole blood was used for the extraction of DNA to determine the percentage of methylation by real-time PCR and melting-curve analysis. Results are expressed as means and standard deviations for parametric variables and as median (interquartile range) for non-parametric variables. T1D patients showed a higher TNFa gene promoter methylation (39·2 (sd 19·5) %) when compared with control subjects (25·4 (sd 13·7) %) (P=0·008). TNFa gene promoter methylation was positively associated only with homocysteine levels in T1D patients (r 0·55, P=0·007), but not in control subjects (r -0·122, P=0·872). To our knowledge, this is the first work that reports the methylation status of the TNFa gene promoter and its relationship with homocysteine metabolism in Chilean T1D patients without disease complications.
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
Energy Technology Data Exchange (ETDEWEB)
Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-04-15
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging
International Nuclear Information System (INIS)
Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-01-01
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2007-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls
Energy Technology Data Exchange (ETDEWEB)
Spink, Barbara C. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Bloom, Michael S. [Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Wu, Susan [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Sell, Stewart; Schneider, Erasmus [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Ding, Xinxin [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Spink, David C., E-mail: spink@wadsworth.org [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States)
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2} in lung
International Nuclear Information System (INIS)
Mohseni, Mehran; Mihandoost, Ehsan; Shirazi, Alireza; Sepehrizadeh, Zargham; Bazzaz, Javad Tavakkoly; Ghazi-khansari, Mahmoud
2012-01-01
The close relationship between free radicals effects and apoptosis process has been proved. Melatonin has been reported as a direct free radical scavenger. We investigated the capability of melatonin in the modification of radiation-induced apoptosis and apoptosis-associated upstream regulators expression in rat peripheral blood lymphocytes. Rats were irradiated with a single whole body Cobalt 60-gamma radiation dose of 8 Gy at a dose rate of 101 cGy/min with or without melatonin pretreatments at different concentrations of 10 and 100 mg/kg body weight. The rats were divided into eight groups of control, irradiation-only, vehicle-only, vehicle plus irradiation, 10 mg/kg melatonin alone, 10 mg/kg melatonin plus irradiation, 100 mg/kg melatonin alone and 100 mg/kg melatonin plus irradiation. Rats were given an intraperitoneal (IP) injection of melatonin or the same volume of vehicle alone 1 h prior to irradiation. Blood samples were taken 4, 24, 48 and 72 h after irradiation for evaluation of flow cytometric analysis of apoptotic lymphocytes using Annexin V/PI assay and measurement of bax and bcl-2 expression using quantitative real-time PCR (RT 2 qPCR). Irradiation-only and vehicle plus irradiation showed an increase in the percentage of apoptotic lymphocytes significantly different from control group (P < 0.01), while melatonin pretreatments in a dose-dependent manner reduced it as compared with the irradiation-only and vehicle plus irradiation groups (P < 0.01) in all time points. This reduced apoptosis by melatonin was related to the downregulation of bax, upregulation of bcl-2, and therefore reduction of bax/bcl-2 ratio. Our results suggest that melatonin in these doses may provide modulation of bax and bcl-2 expression as well as bax/bcl-2 ratio to protect rat peripheral blood lymphocytes from gamma irradiation-induced apoptosis.
Energy Technology Data Exchange (ETDEWEB)
Mohseni, Mehran [Department of Radiology and Medical Physics, Faculty of Paramedicine, Kashan University of Medical Sciences, Kashan (Iran, Islamic Republic of); Mihandoost, Ehsan, E-mail: mihandoost.e@gmail.com [Department of Medical Radiation Engineering, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Shirazi, Alireza [Department of Medical Physics and Biomedical Engineering, Faculty of Medicine, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Sepehrizadeh, Zargham [Department of Pharmaceutical Biotechnology, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Bazzaz, Javad Tavakkoly [Department of Medical Genetics, Faculty of Medicine, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Ghazi-khansari, Mahmoud [Department of Pharmacology, Faculty of Medicine, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)
2012-10-15
The close relationship between free radicals effects and apoptosis process has been proved. Melatonin has been reported as a direct free radical scavenger. We investigated the capability of melatonin in the modification of radiation-induced apoptosis and apoptosis-associated upstream regulators expression in rat peripheral blood lymphocytes. Rats were irradiated with a single whole body Cobalt 60-gamma radiation dose of 8 Gy at a dose rate of 101 cGy/min with or without melatonin pretreatments at different concentrations of 10 and 100 mg/kg body weight. The rats were divided into eight groups of control, irradiation-only, vehicle-only, vehicle plus irradiation, 10 mg/kg melatonin alone, 10 mg/kg melatonin plus irradiation, 100 mg/kg melatonin alone and 100 mg/kg melatonin plus irradiation. Rats were given an intraperitoneal (IP) injection of melatonin or the same volume of vehicle alone 1 h prior to irradiation. Blood samples were taken 4, 24, 48 and 72 h after irradiation for evaluation of flow cytometric analysis of apoptotic lymphocytes using Annexin V/PI assay and measurement of bax and bcl-2 expression using quantitative real-time PCR (RT{sup 2}qPCR). Irradiation-only and vehicle plus irradiation showed an increase in the percentage of apoptotic lymphocytes significantly different from control group (P < 0.01), while melatonin pretreatments in a dose-dependent manner reduced it as compared with the irradiation-only and vehicle plus irradiation groups (P < 0.01) in all time points. This reduced apoptosis by melatonin was related to the downregulation of bax, upregulation of bcl-2, and therefore reduction of bax/bcl-2 ratio. Our results suggest that melatonin in these doses may provide modulation of bax and bcl-2 expression as well as bax/bcl-2 ratio to protect rat peripheral blood lymphocytes from gamma irradiation-induced apoptosis.
Directory of Open Access Journals (Sweden)
Tognon Raquel
2012-02-01
Full Text Available Abstract Background Essential Thrombocythemia (ET and Primary Myelofibrosis (PMF are Chronic Myeloproliferative Neoplasms (MPN characterized by clonal myeloproliferation/myeloaccumulation without cell maturation impairment. The JAK2 V617F mutation and PRV1 gene overexpression may contribute to MPN physiopathology. We hypothesized that deregulation of the apoptotic machinery may also play a role in the pathogenesis of ET and PMF. In this study we evaluated the apoptosis-related gene and protein expression of BCL2 family members in bone marrow CD34+ hematopoietic stem cells (HSC and peripheral blood leukocytes from ET and PMF patients. We also tested whether the gene expression results were correlated with JAK2 V617F allele burden percentage, PRV1 overexpression, and clinical and laboratory parameters. Results By real time PCR assay, we observed that A1, MCL1, BIK and BID, as well as A1, BCLW and BAK gene expression were increased in ET and PMF CD34+ cells respectively, while pro-apoptotic BAX and anti-apoptotic BCL2 mRNA levels were found to be lower in ET and PMF CD34+ cells respectively, in relation to controls. In patients' leukocytes, we detected an upregulation of anti-apoptotic genes A1, BCL2, BCL-XL and BCLW. In contrast, pro-apoptotic BID and BIMEL expression were downregulated in ET leukocytes. Increased BCL-XL protein expression in PMF leukocytes and decreased BID protein expression in ET leukocytes were observed by Western Blot. In ET leukocytes, we found a correlation between JAK2 V617F allele burden and BAX, BIK and BAD gene expression and between A1, BAX and BIK and PRV1 gene expression. A negative correlation between PRV1 gene expression and platelet count was observed, as well as a positive correlation between PRV1 gene expression and splenomegaly. Conclusions Our results suggest the participation of intrinsic apoptosis pathway in the MPN physiopathology. In addition, PRV1 and JAK2 V617F allele burden were linked to deregulation
Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.
2001-01-01
Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
Directory of Open Access Journals (Sweden)
Matei Irina
2001-08-01
Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.
Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo
2001-01-01
Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193
DEFF Research Database (Denmark)
Dimitrova, Irina; Toby, Garabet G; Tili, Esmerina
2004-01-01
-transferase (BI-GST) leads to aggregation, but not fusion of the mitochondria. In addition, Bax affects the integrity of yeast vacuoles, resulting in the disintegration and eventual loss of the organelles, and the disruption of intracellular protein traffic. While Bcl-2 coexpression only partially corrects...
Directory of Open Access Journals (Sweden)
Nina Milutin Gašperov
Full Text Available Change in the host and/or human papillomavirus (HPV DNA methylation profile is probably one of the main factors responsible for the malignant progression of cervical lesions to cancer. To investigate those changes we studied 173 cervical samples with different grades of cervical lesion, from normal to cervical cancer. The methylation status of nine cellular gene promoters, CCNA1, CDH1, C13ORF18, DAPK1, HIC1, RARβ2, hTERT1, hTERT2 and TWIST1, was investigated by Methylation Specific Polymerase Chain Reaction (MSP. The methylation of HPV18 L1-gene was also investigated by MSP, while the methylated cytosines within four regions, L1, 5'LCR, enhancer, and promoter of the HPV16 genome covering 19 CpG sites were evaluated by bisulfite sequencing. Statistically significant methylation biomarkers distinguishing between cervical precursor lesions from normal cervix were primarily C13ORF18 and secondly CCNA1, and those distinguishing cervical cancer from normal or cervical precursor lesions were CCNA1, C13ORF18, hTERT1, hTERT2 and TWIST1. In addition, the methylation analysis of individual CpG sites of the HPV16 genome in different sample groups, notably the 7455 and 7694 sites, proved to be more important than the overall methylation frequency. The majority of HPV18 positive samples contained both methylated and unmethylated L1 gene, and samples with L1-gene methylated forms alone had better prognosis when correlated with the host cell gene promoters' methylation profiles. In conclusion, both cellular and viral methylation biomarkers should be used for monitoring cervical lesion progression to prevent invasive cervical cancer.
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Kwon, Oh Sang; Pyo, Hyun Keol; Oh, Youn Jin; Han, Ji Hyun; Lee, Se Rah; Chung, Jin Ho; Eun, Hee Chul
2007-01-01
Minoxidil induces hair growth in male pattern baldness and prolongs the anagen phase. All-trans retinoic acid (ATRA) has been reported to act synergistically with minoxidil in vivo: they can enhance more dense hair regrowth than either compound alone. We evaluated the effect of minoxidil combined with ATRA on hair growth in vitro. The effect of co-treatment of minoxidil and ATRA on hair growth was studied in hair follicle organ culture. In cultured human dermal papilla cells (DPCs) and normal human epidermal keratinocytes, the expressions of Erk, Akt, Bcl-2, Bax, P53 and P21 were evaluated by immunoblot analysis. Minoxidil plus ATRA additively promoted hair growth in vitro, compared with minoxidil alone. In addition, minoxidil plus ATRA elevated phosphorylated Erk, phosphorylated Akt and the ratio of Bcl-2/Bax, but decreased the expressions of P53 and P21 more effectively than by minoxidil alone. Our results suggest that minoxidil plus ATRA would additively enhance hair growth by mediating dual functions: 1) the prolongation of cell survival by activating the Erk and Akt signaling pathways, and 2) the prevention of apoptosis of DPCs and epithelial cells by increasing the ratio of Bcl-2/Bax and downregulating the expressions of P53 and P21. PMID:17449938
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
BaxSr1-xTi1.02O3 metal-insulator-metal capacitors on planarized alumina substrates
Tiggelman, M.P.J.; Reimann, K.; Klee, M.; Mauczok, R.; Keur, W.; Hueting, Raymond Josephus Engelbart
2010-01-01
Nanocrystalline barium strontium titanate (BaxSr1−xTi1.02O3) thin films with a barium content of x=0.8, 0.9 and 1 have been fabricated in a metal–insulator–metal configuration on glass-planarized alumina substrates. Cost-effective processing measures have been utilized by using poly-crystalline
Ramalingam, R; Rafii, S; Worgall, S; Brough, D E; Crystal, R G
1999-05-01
Although endothelial cells are quiescent and long-lived in vivo, when they are removed from blood vessels and cultured in vitro they die within days to weeks. In studies of the interaction of E1(-)E4(+) replication-deficient adenovirus (Ad) vectors and human endothelium, the cells remained quiescent and were viable for prolonged periods. Evaluation of these cultures showed that E1(-)E4(+) Ad vectors provide an "antiapoptotic" signal that, in association with an increase in the ratio of Bcl2 to Bax levels, induces the endothelial cells to enter a state of "suspended animation," remaining viable for at least 30 days, even in the absence of serum and growth factors. Although the mechanisms initiating these events are unclear, the antiapoptoic signal requires the presence of E4 genes in the vector genome, suggesting that one or more E4 open reading frames of subgroup C Ad initiate a "pro-life" program that modifies cultured endothelial cells to survive for prolonged periods.
International Nuclear Information System (INIS)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn
2013-01-01
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Directory of Open Access Journals (Sweden)
Sweeney Torres
2010-12-01
Full Text Available Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF/juiciness or tenderness in a genome-assisted selection framework.
DEFF Research Database (Denmark)
Liang, Y G; Jorgensen, A G; Kaestel, C G
2000-01-01
PURPOSE. The aim of this study was to determine the role of Bcl-2, Bcl-X L, Bax, and c-Fos in regulation of apoptosis, induced by ultraviolet-light A (UV-A) and daunorubicin (DNR), in retinal pigment epithelium (RPE) cells grown on bovine extracellular matrix (ECM)-coated or uncoated plastic dishes....... METHODS. Apoptosis in confluent RPE cells cultured on ECM-coated or uncoated dishes was induced by UV-A or DNR. Apoptosis was detected by 7-amino-actinomycin D labeling followed by flow cytometry and by terminal deoxy-transferase mediated X-dUTP nick end labeling (TUNEL). Cellular expression of Bcl-2, Bcl......-X L, Bax, and c-Fos was determined by the use of antibodies and flow cytometry, Western blot analysis, and immunocytochemical staining. RESULTS. Both UV-A and DNR induce apoptosis in human RPE cells in vitro. Human fetal RPE cells grown on ECM-coated dishes were significantly more resistant to UV...
Directory of Open Access Journals (Sweden)
Xiaoyan Wang
Full Text Available Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1 gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13 and Gossypium arboreum L. genome (A-genome, n = 13 databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26. Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319 exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses.
Directory of Open Access Journals (Sweden)
Mason Philip J
2004-06-01
Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh
2017-07-01
Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Sandvej, K; Andresen, B S; Zhou, X G
2000-01-01
AIMS: To study the distribution of Epstein-Barr virus (EBV) variants containing mutations in the latent membrane protein 1 (LMP-1) oncogene and promoter in EBV associated Hodgkin's disease and infectious mononucleosis compared with previous findings in asymptomatic EBV carriers. METHODS: Sequence...... analysis of the EBV LMP-1 promoter and gene in isolates from Danish patients with Hodgkin's disease (n = 61) and infectious mononucleosis (n = 10). RESULTS: Viruses (previously designated group D) that contain two mutations in the activating transcription factor/cAMP response element (ATF/CRE) in the LMP-1...... promoter, which are known to decrease promoter activity greatly, were significantly less frequent in Hodgkin's disease than in both infectious mononucleosis (p = 0.0081) and asymptomatic EBV carriers (p = 0.0084). In some cases, the LMP-1 gene contained mutations in a recently identified cytotoxic T cell...
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Directory of Open Access Journals (Sweden)
Sourav Roy
2013-03-01
Full Text Available Most eukaryotic pathogens have complex life cycles in which gene expression networks orchestrate the formation of cells specialized for dissemination or host colonization. In the oomycete Phytophthora infestans, the potato late blight pathogen, major shifts in mRNA profiles during developmental transitions were identified using microarrays. We used those data with search algorithms to discover about 100 motifs that are over-represented in promoters of genes up-regulated in hyphae, sporangia, sporangia undergoing zoosporogenesis, swimming zoospores, or germinated cysts forming appressoria (infection structures. Most of the putative stage-specific transcription factor binding sites (TFBSs thus identified had features typical of TFBSs such as position or orientation bias, palindromy, and conservation in related species. Each of six motifs tested in P. infestans transformants using the GUS reporter gene conferred the expected stage-specific expression pattern, and several were shown to bind nuclear proteins in gel-shift assays. Motifs linked to the appressoria-forming stage, including a functionally validated TFBS, were over-represented in promoters of genes encoding effectors and other pathogenesis-related proteins. To understand how promoter and genome architecture influence expression, we also mapped transcription patterns to the P. infestans genome assembly. Adjacent genes were not typically induced in the same stage, including genes transcribed in opposite directions from small intergenic regions, but co-regulated gene pairs occurred more than expected by random chance. These data help illuminate the processes regulating development and pathogenesis, and will enable future attempts to purify the cognate transcription factors.
Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.
Busk, P K; Jensen, A B; Pagès, M
1997-06-01
The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.
Energy Technology Data Exchange (ETDEWEB)
Joshi, J.B. (National Heart, Lung, and Blood Inst., Bethesda, MD (United States)); Dave, H.P.G. (National Inst. of Health, Bethesda, MD (United States))
1992-02-01
Human T-cell lymphotropic virus type I (HTLV-I), an etiologic agent for adult T-cell leukemia, is strongly associated with certain neurological diseases. The HTLV-I genome encodes a protein, Tax{sub 1}, that transactivates viral gene transcription. CD4-positive T helper lymphocytes express the proenkephalin gene, and enkephalins have been implicated as neuroimmunomodulators. The authors have investigated the effect of Tax{sub 1} on the proenkephalin gene promoter in C6 rat glioma cells and demonstrated its transactivation. Analysis using 5{prime} deletion mutants of the promoter region showed that sequences upstream of base pair - 190 are necessary for maximal transactivation. Forskolin, a cAMP modulator, synergistically increased Tax{sub 1}-mediated transactivation of the proenkephalin promoter. Neither Tax{sub 1} transactivation alone nor Tax{sub 1}/cAMP synergism exclusively involved cAMP-responsive elements. Endogenous proenkephalin gene expression increased in Tax{sub 1}-expressing C6 cells. Since HTLV-I infects lymphocytes, which express proenkephalin mRNA, Tax{sub 1} transregulation of proenkephalin expression may provide bidirectional communication between the nervous and immune systems in HTLV-I-related diseases.
Directory of Open Access Journals (Sweden)
de Souza Emanuel M
2009-03-01
Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma
International Nuclear Information System (INIS)
Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de
2009-01-01
ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was
Directory of Open Access Journals (Sweden)
Chelli S.
2015-12-01
Full Text Available The structural, elastic, electronic and thermodynamic properties of BaxSr1−xS ternary alloys have been investigated using the full-potential (linearized augmented plane wave method. The ground state properties, such as lattice constant, bulk modulus and elastic constants, are in good agreement with numerous experimental and theoretical data. The dependence of the lattice parameters, bulk modulus and band gap on the composition x was analyzed. Deviation of the lattice constant from Vegard’s law and the bulk modulus from linear concentration dependence (LCD was observed. The microscopic origins of the gap bowing were explained by using the approach of Zunger et al. The thermodynamic stability of BaxSr1−xS alloy was investigated by calculating the excess enthalpy of mixing, ΔHm and the calculated phase diagram showed a broad miscibility gap with a critical temperature.
LENUS (Irish Health Repository)
Murphy, Therese M
2011-01-01
Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).
Wei, Dawei; Raza, Sayed Haidar Abbas; Zhang, Jiupan; Gui, Linsheng; Rahman, Siddiq Ur; Khan, Rajwali; Hosseini, Seyed Mahdi; Kaleri, Hubdar Ali; Zan, Linsen
2018-05-20
The sine oculis homeobox homolog 4 (SIX4) gene belongs to the SIX gene family, which plays a critical role in muscle regeneration and early stages of ontogeny. This study aimed to detect promoter variations of bovine SIX4 genes in Qinchuan cattle, and to evaluate the effect of transcription regulations and body measurement traits. Quantitative real-time PCR (qPCR) results showed that the mRNA expression levels of SIX4 gene were found significantly highest in longissimus thoracis tissue and individual before attaining the stage of physiological maturity. Using sequencing technology on a total of 428 Qinchuan cattle, seven single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIX4, and seven haplotypes representing 18 potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the H 3 -H 3 diplotype performed greater withers height, chest depth, chest circumference, back fat thickness and ultrasound loin muscle area (P cattle. Copyright © 2018 Elsevier B.V. All rights reserved.
Engineered Promoters for Potent Transient Overexpression.
Directory of Open Access Journals (Sweden)
Dan Y Even
Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.
Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca
2015-02-01
The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Kiss Nimrod B
2012-09-01
Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N
2008-12-01
Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
Energy Technology Data Exchange (ETDEWEB)
Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)
2012-07-06
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
International Nuclear Information System (INIS)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi
2012-01-01
Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the
Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Carpenetti, Tiffany L. G.; Aryan, Azadeh; Myles, Kevin M.; Adelman, Zach N.
2011-01-01
Aedes aegypti is an important vector of the viruses that cause dengue fever, dengue hemorrhagic fever, and yellow fever. Reverse genetic approaches to the study of gene function in this mosquito have been limited by the lack of a robust inducible promoter to allow precise temporal control over a protein-encoding or hairpin RNA transgene. Likewise, investigations into the molecular and biochemical basis of vector competence would benefit from the ability to activate an anti-pathogen molecule at specific times during infection. We have characterized the ability of genomic sequences derived from two Ae. aegypti hsp70 genes to drive heat-inducible expression of a reporter in both transient and germline transformation contexts. AaHsp70-luciferase transcripts accumulated specifically after heat shock, and displayed a pattern of rapid induction and decay similar to endogenous AaHsp70 genes. Luciferase expression in transgenic Ae. aegypti increased by ∼25-50 fold in whole adults by four hours after heat-shock, with significant activity (∼20 fold) remaining at 24 hr. Heat-induced expression was even more dramatic in midgut tissues, with one strain showing a ∼2500-fold increase in luciferase activity. The AaHsp70 promoters described could be valuable for gene function studies as well as for the precise timing of the expression of anti-pathogen molecules. PMID:22142225
Tyrka, A R; Parade, S H; Welch, E S; Ridout, K K; Price, L H; Marsit, C; Philip, N S; Carpenter, L L
2016-07-05
Early adversity increases risk for developing psychopathology. Epigenetic modification of stress reactivity genes is a likely mechanism contributing to this risk. The glucocorticoid receptor (GR) gene is of particular interest because of the regulatory role of the GR in hypothalamic-pituitary-adrenal (HPA) axis function. Mounting evidence suggests that early adversity is associated with GR promoter methylation and gene expression. Few studies have examined links between GR promoter methylation and psychopathology, and findings to date have been mixed. Healthy adult participants (N=340) who were free of psychotropic medications reported on their childhood experiences of maltreatment and parental death and desertion. Lifetime depressive and anxiety disorders and past substance-use disorders were assessed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Methylation of exon 1F of the GR gene (NR3C1) was examined in leukocyte DNA via pyrosequencing. On a separate day, a subset of the participants (n=231) completed the dexamethasone/corticotropin-releasing hormone (Dex/CRH) test. Childhood adversity and a history of past substance-use disorder and current or past depressive or anxiety disorders were associated with lower levels of NR3C1 promoter methylation across the region as a whole and at individual CpG sites (Pdisorder. GR promoter methylation was linked to altered cortisol responses to the Dex/CRH test (Pdepressive, anxiety and substance-use disorders in adults. This finding stands in contrast to our prior work, but is consistent with emerging findings, suggesting complexity in the regulation of this gene.
International Nuclear Information System (INIS)
Tarawneh, A. K
1997-01-01
In this study sphareroplastes of white Neurospora crassa mutant auxotroph for aromatic am no acids a rom 9 q a-2 inv, was transformed by the pKF-Tyr7-wt DNA construct. This construct contains the promoter of neurospora crassa glucose-repressible gene-1 (G rg-1) usp stream of Neurospora tyrosinase gene. The co transformation of this mutant with pKF-Tyr-7-wt cincture's and the pKAL-1, a plasmid which contains the Neurospora q a-2+ gene transform it to photophor. The transform ant contains the tyrosinase gene which catalyzes the unique step in the synthesis of the black pigment melanin. The activity of the tyrosinase in this transform ant was followed by measuring the absorbance of the dark coloured pigment at 332 nm. The maximum of the tyrosinase activity was shown at 16.36 and 56 hours after the shift of the transformed mycelia from constant light (L L) to constant dark (Dd). The rate of the enzyme activity was changed according to ci radian cycle of 20 hours. This G rg 1/tyrosinase construct provides a good system to study to study the temporal control of gene expression and the interaction between the different environmental c uses that affects gene expression. (author). 20 refs., 4 figs
Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L
2014-01-01
Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.
Alteration of apoptosis-related genes in postmenopausal women with uterine prolapse.
Saatli, Bahadir; Kizildag, Sefa; Cagliyan, Erkan; Dogan, Erbil; Saygili, Ugur
2014-07-01
We aimed to compare expression levels of antiapoptotic and proapoptotic genes in parametrial and vaginal tissues from postmenopausal women with and without pelvic organ prolapse (POP). We hypothesized that the expression of genes that induce apoptosis may be altered in vaginal and parametrial tissues in postmenopausal women with POP. Samples of vaginal and parametrial tissues were obtained from postmenopausal women with (n = 10) and without (n = 10) POP who underwent vaginal or abdominal hysterectomy. Expression levels of antiapoptotic (BCL-2, BCL-XL) and proapoptotic (BAX, BAD) genes were studied by real-time reverse-transcription polymerase chain reaction (RT-PCR). Gene expression levels of BCL-2 (P gene expression levels of BCL-2 (p gene expression levels differed significantly between postmenopausal women with and without POP. Bcl-2 family genes were overexpressed in the parametrium of patients with POP compared with vaginal tissue, suggesting that the processes responsible for POP have a greater effect on parametrial tissue than vaginal tissue during the development of POP.
Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica
2014-01-01
Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Darling, Nicola J; Balmanno, Kathryn; Cook, Simon J
2017-01-01
Disruption of protein folding in the endoplasmic reticulum (ER) causes ER stress. Activation of the unfolded protein response (UPR) acts to restore protein homeostasis or, if ER stress is severe or persistent, drive apoptosis, which is thought to proceed through the cell intrinsic, mitochondrial pathway. Indeed, cells that lack the key executioner proteins BAX and BAK are protected from ER stress-induced apoptosis. Here we show that chronic ER stress causes the progressive inhibition of the extracellular signal-regulated kinase (ERK1/2) signalling pathway. This is causally related to ER stress since reactivation of ERK1/2 can protect cells from ER stress-induced apoptosis whilst ERK1/2 pathway inhibition sensitises cells to ER stress. Furthermore, cancer cell lines harbouring constitutively active BRAFV600E are addicted to ERK1/2 signalling for protection against ER stress-induced cell death. ERK1/2 signalling normally represses the pro-death proteins BIM, BMF and PUMA and it has been proposed that ER stress induces BIM-dependent cell death. We found no evidence that ER stress increased the expression of these proteins; furthermore, BIM was not required for ER stress-induced death. Rather, ER stress caused the PERK-dependent inhibition of cap-dependent mRNA translation and the progressive loss of pro-survival proteins including BCL2, BCLXL and MCL1. Despite these observations, neither ERK1/2 activation nor loss of BAX/BAK could confer long-term clonogenic survival to cells exposed to ER stress. Thus, ER stress induces cell death by at least two biochemically and genetically distinct pathways: a classical BAX/BAK-dependent apoptotic response that can be inhibited by ERK1/2 signalling and an alternative ERK1/2- and BAX/BAK-independent cell death pathway.
Directory of Open Access Journals (Sweden)
Nicola J Darling
Full Text Available Disruption of protein folding in the endoplasmic reticulum (ER causes ER stress. Activation of the unfolded protein response (UPR acts to restore protein homeostasis or, if ER stress is severe or persistent, drive apoptosis, which is thought to proceed through the cell intrinsic, mitochondrial pathway. Indeed, cells that lack the key executioner proteins BAX and BAK are protected from ER stress-induced apoptosis. Here we show that chronic ER stress causes the progressive inhibition of the extracellular signal-regulated kinase (ERK1/2 signalling pathway. This is causally related to ER stress since reactivation of ERK1/2 can protect cells from ER stress-induced apoptosis whilst ERK1/2 pathway inhibition sensitises cells to ER stress. Furthermore, cancer cell lines harbouring constitutively active BRAFV600E are addicted to ERK1/2 signalling for protection against ER stress-induced cell death. ERK1/2 signalling normally represses the pro-death proteins BIM, BMF and PUMA and it has been proposed that ER stress induces BIM-dependent cell death. We found no evidence that ER stress increased the expression of these proteins; furthermore, BIM was not required for ER stress-induced death. Rather, ER stress caused the PERK-dependent inhibition of cap-dependent mRNA translation and the progressive loss of pro-survival proteins including BCL2, BCLXL and MCL1. Despite these observations, neither ERK1/2 activation nor loss of BAX/BAK could confer long-term clonogenic survival to cells exposed to ER stress. Thus, ER stress induces cell death by at least two biochemically and genetically distinct pathways: a classical BAX/BAK-dependent apoptotic response that can be inhibited by ERK1/2 signalling and an alternative ERK1/2- and BAX/BAK-independent cell death pathway.
Uesaka, Masahiro; Agata, Kiyokazu; Oishi, Takao; Nakashima, Kinichi; Imamura, Takuya
2017-01-01
Background Recent transcriptome analyses have shown that long non-coding RNAs (ncRNAs) play extensive roles in transcriptional regulation. In particular, we have reported that promoter-associated ncRNAs (pancRNAs) activate the partner gene expression via local epigenetic changes. Results Here, we identify thousands of genes under pancRNA-mediated transcriptional activation in five mammalian species in common. In the mouse, 1) pancRNA-partnered genes confined their expression pattern to certai...
Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin
2015-03-01
The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.
Directory of Open Access Journals (Sweden)
Xiu-Yun Li
2018-05-01
Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.
Directory of Open Access Journals (Sweden)
Raymond L Fields
Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.
Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung
2016-10-01
The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Comparative analyses of bidirectional promoters in vertebrates
Directory of Open Access Journals (Sweden)
Taylor James
2008-05-01
Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.
2012-01-01
Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654
The Helicobacter pylori duodenal ulcer promoting gene, dupA in China
Directory of Open Access Journals (Sweden)
Liu Wenzhong
2008-10-01
Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.
The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.
Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong
2008-10-25
The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.
Directory of Open Access Journals (Sweden)
Mozhgan Rasti
2009-06-01
Full Text Available Background: Aberrant methylation of cytosine-guanine dinucleotideislands leads to inactivation of tumor suppressorgenes in breast cancer. Tumor suppressor genes are unmethylatedin normal tissue and often become hypermethylatedduring tumor formation, leading to gene silencing. We investigatedthe association between E-cadherin (CDH1 and estrogenreceptor-α (ESRα gene promoter methylation andmajor clinical and pathological features of breast cancer inIranian women.Methods: DNA was extracted from 67 primary breast tumorsand gene promoter methylation was analyzed by methylationspecificpolymerase chain reaction method.Results: Fifty percent of the samples showed aberrant methylationin at least one of the two tested loci. We detectedCDH1 hypermethylation in 41% of invasive tumors and receptor-α gene hypermethylation in 18% of invasive tumorsamples. We found no association between CDH1 and receptor-α gene hypermethylation (P=0.45. There was a correlationbetween hypermethylation of CDH1 locus and tumorsize ≥5 cm (P=0.019.Conclusion: Our data suggest that the malignant progressionof human ductal and lobular breast carcinoma in Iranianwomen involves a heterogeneous pattern of cytosine-guaninedinucleotide island hypermethylation of the CDH1 gene.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
International Nuclear Information System (INIS)
Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong
2015-01-01
Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS
Directory of Open Access Journals (Sweden)
Elainy Patricia Lino Gasparotto
2011-12-01
Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0
Energy Technology Data Exchange (ETDEWEB)
Yang, Yan [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China); The First Affiliated Hospital of ChengDu Medical College, Department of Radiology, ChengDu (China); Gong, Ming-fu; Yang, Hua; Zhang, Song; Wang, Guang-xian; Su, Tong-sheng; Wen, Li; Zhang, Dong [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China)
2016-11-15
Using the human telomerase reverse transcriptase (hTERT) promoter and the modified ferritin heavy chain (Fth) reporter gene, reporter gene expression for MRI was examined in telomerase positive and negative tumour cells and xenografts. Activity of the reporter gene expression vector Lenti-hTERT-Fth1-3FLAG-Puro was compared to constitutive CMV-driven expression and to the untransfected parental control in five tumour cell lines: A549, SKOV3, 293T, U2OS and HPDLF. In vitro, transfected cells were evaluated for FLAG-tagged protein expression, iron accumulation and transverse relaxation. In vivo, tumours transduced by lentiviral vector injection were imaged using T2*WI. Changes in tumour signal intensity were validated by histology. Only telomerase positive tumour cells expressed FLAG-tagged Fth and displayed an increase in R2* above the parental control, with a corresponding change in T2*WI. In addition, only telomerase positive tumours, transduced by injection of the reporter gene expression construct, exhibited a change in signal intensity on T2*WI. Tumour histology verified the expression of FLAG-tagged Fth and iron accumulation in telomerase positive tissue. Reporter gene expression for MRI, using the Fth reporter and the hTERT promoter, may be a useful strategy for the non-invasive diagnosis of many types of cancer. (orig.)
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Energy Technology Data Exchange (ETDEWEB)
Khin, Sann Sanda [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Pathology Research Unit, Department of Medical Research (Central Myanmar), Naypyitaw, Union of (Myanmar); Kitazawa, Riko [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Haraguchi, Ryuma [Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Mori, Kiyoshi [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Kitazawa, Sohei, E-mail: kitazawa@m.ehime-u.ac.jp [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan)
2011-03-03
Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.
International Nuclear Information System (INIS)
Khin, Sann Sanda; Kitazawa, Riko; Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo; Haraguchi, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei
2011-01-01
Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression
Directory of Open Access Journals (Sweden)
Cynthia J Thomson
Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.
Bing, Lelin; Wu, Junfeng; Zhang, Jianfeng; Chen, Yinghui; Hong, Zhen; Zu, Hengbing
2015-01-01
Previous evidences indicate that androgen is neuroprotective in the brain. However, the underling mechanisms remain to be fully elucidated. Moreover, it is controversial whether dihydrotestosterone (DHT) modulates the expression of apoptosis-related effectors, such as survivin, XIAP, bax, and bcl-xl proteins mediated by the PI3-K/Akt pathway, which contributes to androgen neuroprotection. In this study using a C6 glial cell model, apoptotic cells were detected by flow cytometry. Akt, seladin-1, survivin, XIAP, bcl-xl, and bax protein expression is investigated by Western blot. After amyloid β-protein fragment (Aβ25-35) treatment, apoptotic cells at early (annexin V+, PI-) and late (annexin V+, PI+) stages were significantly increased. Apoptosis at early and late was obviously inhibited in the presence of DHT. The effect of DHT was markedly blocked by PI3-K inhibitor LY294002.To elicit the mechanism of DHT protection, the expression of seladin-1, survivin, XIAP, bax, and bcl-xl protein was determined in C6 cells treated with Aβ25-35, DHT, or LY294002. Aβ25-35 significantly downregulated the expression of seladin-1, survivin, XIAP, bcl-xl protein and upregulated the expression of bax protein. DHT significantly inhibited the expression of bax, seladin-1, survivin, XIAP, and bcl-xl protein induced by Aβ25-35. Further, we found the effect of DHT was significantly inhibited by LY294002. Collectively, in a C6 glial cell model, we firstly found that DHT inhibits Aβ25-35-induced apoptosis by a rapid nongenic PI-3K/Akt activation as well as regulation of seladin-1, survivin, XIAP, bcl-xl, and bax proteins.
Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David
Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing
Directory of Open Access Journals (Sweden)
PAZ A REYES
2007-01-01
Full Text Available Background: Infection of the Fallopian tubes (FT by Neisseria gonorrhoeae (Ngo can lead to acute salpingitis, an inflammatory condition resulting in damage primarily to the ciliated cells, with loss of ciliary activity and sloughing of the cells from the epithelium. Recently, we have shown that Ngo infection induced apoptosis in FT epithelium cells by a TNF-alpha dependent mechanism that could contribute to the cell and tissue damage observed in gonococcal salpingitis. Aim: To investigate the apoptosis-related genes expressed during apoptosis induction in cultured FT epithelial cells infected in vitro by Ngo. Materials and Methods: In the current study, we used cDNA macroarrays and real time PCR to identify and determine the expression levels of apoptosis related genes during the in vitro gonococci infection of FT epithelial cells. Results: Significant apoptosis was induced following infection with Ngo. Macroarray analysis identified the expression of multiple genes of the TNF receptor family (TNFRSF1B, -4, -6, -10A, -10B and -10D and the Bcl-2 family (BAK1, BAX, BLK, HRK and MCL-1 without differences between controls and infected cells. This lack of difference was confirmed by RT-PCR of BAX, Bcl-2, TNFRS1A (TNFR-I and TNFRSF1B (TNFR-II. Conclusion: Several genes related to apoptosis are expressed in primary cultures of epithelial cells of the human Fallopian tube. Infection with Ngo induces apoptosis without changes in the pattern of gene expression of several apoptosis-related genes. Results strongly suggest that Ngo regulates apoptosis in the FT by post-transcriptional mechanisms that need to be further addressed
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Borghi, Monica; Xie, De-Yu
2016-02-01
Arabidopsis promoters of genes BANYULS and FRUITFULL are transcribed in Camelina. They triggered the transcription of limonene synthase and induced higher limonene production in seeds and fruits than CaMV 35S promoter. Camelina sativa (Camelina) is an oilseed crop of relevance for the production of biofuels and the plant has been target of a recent and intense program of genetic manipulation aimed to increase performance, seed yield and to modify the fatty acid composition of the oil. Here, we have explored the performance of two Arabidopsis thaliana (Arabidopsis) promoters in triggering transgene expression in Camelina. The promoters of two genes BANYULS (AtBAN pro ) and FRUITFULL (AtFUL pro ), which are expressed in seed coat and valves of Arabidopsis, respectively, have been chosen to induce the expression of limonene synthase (LS) from Citrus limon. In addition, the constitutive CaMV 35S promoter was utilized to overexpress LS in Camelina . The results of experiments revealed that AtBAN pro and AtFUL pro are actively transcribed in Camelina where they also retain specificity of expression in seeds and valves as previously observed in Arabidopsis. LS induced by AtBAN pro and AtFUL pro leads to higher limonene production in seeds and fruits than when the CaMV 35S was used to trigger the expression. In conclusion, the results of experiments indicate that AtBAN pro and AtFUL pro can be successfully utilized to induce the expression of the transgenes of interest in seeds and fruits of Camelina.
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.
Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun
2015-12-01
Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Boron neutron capture therapy induces apoptosis of glioma cells through Bcl-2/Bax
International Nuclear Information System (INIS)
Wang, Peng; Zhen, Haining; Jiang, Xinbiao; Zhang, Wei; Cheng, Xin; Guo, Geng; Mao, Xinggang; Zhang, Xiang
2010-01-01
Boron neutron capture therapy (BNCT) is an alternative treatment modality for patients with glioma. The aim of this study was to determine whether induction of apoptosis contributes to the main therapeutic efficacy of BNCT and to compare the relative biological effect (RBE) of BNCT, γ-ray and reactor neutron irradiation. The neutron beam was obtained from the Xi'an Pulsed Reactor (XAPR) and γ-rays were obtained from [ 60 Co] γ source of the Fourth Military Medical University (FMMU) in China. Human glioma cells (the U87, U251, and SHG44 cell lines) were irradiated by neutron beams at the XAPR or [ 60 Co] γ-rays at the FMMU with different protocols: Group A included control nonirradiated cells; Group B included cells treated with 4 Gy of [ 60 Co] γ-rays; Group C included cells treated with 8 Gy of [ 60 Co] γ-rays; Group D included cells treated with 4 Gy BPA (p-borono-phenylalanine)-BNCT; Group E included cells treated with 8 Gy BPA-BNCT; Group F included cells irradiated in the reactor for the same treatment period as used for Group D; Group G included cells irradiated in the reactor for the same treatment period as used for Group E; Group H included cells irradiated with 4 Gy in the reactor; and Group I included cells irradiated with 8 Gy in the reactor. Cell survival was determined using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium (MTT) cytotoxicity assay. The morphology of cells was detected by Hoechst33342 staining and transmission electron microscope (TEM). The apoptosis rate was detected by flow cytometer (FCM). The level of Bcl-2 and Bax protein was measured by western blot analysis. Proliferation of U87, U251, and SHG44 cells was much more strongly inhibited by BPA-BNCT than by irradiation with [ 60 Co] γ-rays (P < 0.01). Nuclear condensation was determined using both a fluorescence technique and electron microscopy in all cell lines treated with BPA-BNCT. Furthermore, the cellular apoptotic rates in Group D and Group E treated with
Li, Lian; Wu, Jie; Luo, Man; Sun, Yu; Wang, Genlin
2016-05-01
Summer heat stress (HS) is a major contributing factor in low fertility in lactating dairy cows in hot environments. Heat stress inhibits ovarian follicular development leading to diminished reproductive efficiency of dairy cows during summer. Ovarian follicle development is a complex process. During follicle development, granulosa cells (GCs) replicate, secrete hormones, and support the growth of the oocyte. To obtain an overview of the effects of heat stress on GCs, digital gene expression profiling was employed to screen and identify differentially expressed genes (DEGs; false discovery rate (FDR) ≤ 0.001, fold change ≥2) of cultured GCs during heat stress. A total of 1211 DEGs including 175 upregulated and 1036 downregulated ones were identified, of which DEGs can be classified into Gene Ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The results suggested that heat stress triggers a dramatic and complex program of altered gene expression in GCs. We hypothesized that heat stress could induce the apoptosis and dysfunction of GCs. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was used to evaluate the expression of steroidogenic genes (steroidogenic acute regulatory protein (Star), cytochrome P-450 (CYP11A1), CYP19A1, and steroidogenic factor 1 (SF-1)) and apoptosis-related genes (caspase-3, BCL-2, and BAX). Radio immunoassay (RIA) was used to analyze the level of 17β-estradiol (E2) and progesterone (P4). We also assessed the apoptosis of GCs by flow cytometry. Our data suggested that heat stress induced GC apoptosis through the BAX/BCL-2 pathway and reduced the steroidogenic gene messenger RNA (mRNA) expression and E2 synthesis. These results suggest that the decreased function of GCs may cause ovarian dysfunction and offer an improved understanding of the molecular mechanism responsible for the low fertility in cattle in summer.
Directory of Open Access Journals (Sweden)
N. Lale Satiroglu Tufan
2002-01-01
Full Text Available Hepatitis B virus encoded X antigen (HBxAg may contribute to the development of hepatocellular carcinoma (HCC by up-or downregulating the expression of cellular genes that promote cell growth and survival. To test this hypothesis, HBxAg-positive and-negative HepG2 cells were constructed, and the patterns of cellular gene expression compared by polymerase chain reaction select cDNA subtraction. The full-length clone of one of these upregulated genes (URG, URG4, encoded a protein of about 104 kDa. URG4 was strongly expressed in hepatitis 13-infected liver and in HCC cells, where it costained with HBxAg, and was weakly expressed in uninfected liver, suggesting URG4 was an effector of HBxAg in vivo. Overexpression of URG4 in HepG2 cells promoted hepatocellular growth and survival in tissue culture and in soft agar, and accelerated tumor development in nude mice. Hence, URG4 may be a natural effector of HBxAg that contributes importantly to multistep hepatocarcinogenesis.
Borghi, Monica; Xie, De Yu
2016-01-01
Main conclusion: Arabidopsis promoters of genesBANYULSandFRUITFULLare transcribed in Camelina. They triggered the transcription oflimonene synthaseand induced higher limonene production in seeds and fruits thanCaMV 35Spromoter.Camelina sativa (Camelina) is an oilseed crop of relevance for the
Characterization of Bc1-2, Bc1-xL, and Bax Pore Formation and Their Role in Apoptosis Regulation
2002-01-01
Bcl-2, Bcl-xL, and Bax Pore Formation and Their Role in Apoptosis Regulation PRINCIPAL INVESTIGATOR: Frank Stenner -Liewen, Ph.D. Sharon Schendel, Ph.D...AUTHOR(S) Frank Stenner -Liewen, Ph.D. Sharon Schendel, Ph.D. John C. Reed, M.D., Ph.D. 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING
Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma
International Nuclear Information System (INIS)
Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.
2016-01-01
Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).
International Nuclear Information System (INIS)
Zaid, A.; Salem, Gh.
2012-01-01
The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Pichon, Ch.
1999-10-19
The separation of p-xylene from C{sub 8} aromatics is performed industrially by selective adsorption on zeolitic materials. FAU-type zeolites are currently used for this separation and especially the partially hydrated BaX. The aim of this work is to characterize from a structural (by low temperature neutron powder diffraction) and an energetical (by temperature programmed desorption) point of view, the adsorption of para- and meta- isomers of xylene, for different fillings, as pure substances as well as mixtures, on pre-hydrated zeolite BaX. The influence of the water pre-adsorption on xylene adsorption selectivity is carefully discussed. The crystalline structure of the zeolite BaX (framework and compensation of charge cations) and of the adsorbed phase (water, p- and m-xylene molecules) are completely characterized by neutron diffraction. The location and the distribution of water and xylene molecules on their adsorption sites is especially followed as a function of the filling of the zeolite and of the composition of the adsorbed phase. Microscopic measurements were correlated to the energetical analysis (at a macroscopic level) in order to obtain a consistent description of adsorption phenomenon and to propose a possible origin for adsorption selectivity.