Gene Acquisition Convergence between Entomopoxviruses and Baculoviruses

Directory of Open Access Journals (Sweden)

Julien Thézé

2015-04-01

Full Text Available Organisms from diverse phylogenetic origins can thrive within the same ecological niches. They might be induced to evolve convergent adaptations in response to a similar landscape of selective pressures. Their genomes should bear the signature of this process. The study of unrelated virus lineages infecting the same host panels guarantees a clear identification of phyletically independent convergent adaptation. Here, we investigate the evolutionary history of genes in the accessory genome shared by unrelated insect large dsDNA viruses: the entomopoxviruses (EPVs, Poxviridae and the baculoviruses (BVs. EPVs and BVs have overlapping ecological niches and have independently evolved similar infection processes. They are, in theory, subjected to the same selective pressures from their host’s immune responses. Their accessory genomes might, therefore, bear analogous genomic signatures of convergent adaption and could point out key genomic mechanisms of adaptation hitherto undetected in viruses. We uncovered 32 homologous, yet independent acquisitions of genes originating from insect hosts, different eukaryotes, bacteria and viruses. We showed different evolutionary levels of gene acquisition convergence in these viruses, underlining a continuous evolutionary process. We found both recent and ancient gene acquisitions possibly involved to the adaptation to both specific and distantly related hosts. Multidirectional and multipartite gene exchange networks appear to constantly drive exogenous gene assimilations, bringing key adaptive innovations and shaping the life histories of large DNA viruses. This evolutionary process might lead to genome level adaptive convergence.

Expression, Delivery and Function of Insecticidal Proteins Expressed by Recombinant Baculoviruses

Science.gov (United States)

Kroemer, Jeremy A.; Bonning, Bryony C.; Harrison, Robert L.

2015-01-01

Since the development of methods for inserting and expressing genes in baculoviruses, a line of research has focused on developing recombinant baculoviruses that express insecticidal peptides and proteins. These recombinant viruses have been engineered with the goal of improving their pesticidal potential by shortening the time required for infection to kill or incapacitate insect pests and reducing the quantity of crop damage as a consequence. A wide variety of neurotoxic peptides, proteins that regulate insect physiology, degradative enzymes, and other potentially insecticidal proteins have been evaluated for their capacity to reduce the survival time of baculovirus-infected lepidopteran host larvae. Researchers have investigated the factors involved in the efficient expression and delivery of baculovirus-encoded insecticidal peptides and proteins, with much effort dedicated to identifying ideal promoters for driving transcription and signal peptides that mediate secretion of the expressed target protein. Other factors, particularly translational efficiency of transcripts derived from recombinant insecticidal genes and post-translational folding and processing of insecticidal proteins, remain relatively unexplored. The discovery of RNA interference as a gene-specific regulation mechanism offers a new approach for improvement of baculovirus biopesticidal efficacy through genetic modification. PMID:25609310

The role of baculovirus apoptotic suppressors in AcMNPV-mediated translation arrest in Ld652Y cells

International Nuclear Information System (INIS)

Thiem, Suzanne M.; Chejanovsky, Nor

2004-01-01

Infecting the insect cell line IPLB-Ld652Y with the baculovirus Autographa californica multinucleocapsid nucleopolyhedrovirus (AcMNPV) results in global translation arrest, which correlates with the presence of the AcMNPV apoptotic suppressor, p35. In this study, we investigated the role of apoptotic suppression on AcMNPV-induced translation arrest. Infecting cells with AcMNPV bearing nonfunctional mutant p35 did not result in global translation arrest. In contrast, global translation arrest was observed in cells infected with AcMNPV in which p35 was replaced with Opiap, Cpiap, or p49, baculovirus apoptotic suppressors that block apoptosis by different mechanisms than p35. These results indicated that suppressing apoptosis triggered translation arrest in AcMNPV-infected Ld652Y cells. Experiments using the DNA synthesis inhibitor aphidicolin and temperature shift experiments, using the AcMNPV replication mutants ts8 and ts8Δp35, indicated that translation arrest initiated during the early phase of infection, but events during the late phase were required for global translation arrest. Peptide caspase inhibitors could not substitute for baculovirus apoptotic suppressors to induce translation arrest in Ld652Y cells infected with a p35-null virus. However, if the p35-null-AcMNPV also carried hrf-1, a novel baculovirus host range gene, progeny virus was produced and treatment with peptide caspase inhibitors enhanced translation of a late viral gene transcript. Together, these results indicate that translation arrest in AcMNPV-infected Ld652Y cells is due to the anti-apoptotic function of p35, but suggests that rather than simply preventing caspase activation, its activity enhances signaling to a separate translation arrest pathway, possibly by stimulating the late stages of the baculovirus infection cycle

Insecticidal activity of two proteases against Spodoptera frugiperda larvae infected with recombinant baculoviruses

Science.gov (United States)

2010-01-01

Background Baculovirus comprise the largest group of insect viruses most studied worldwide, mainly because they efficiently kill agricutural insect pests. In this study, two recombinant baculoviruses containing the ScathL gene from Sarcophaga peregrina (vSynScathL), and the Keratinase gene from the fungus Aspergillus fumigatus (vSynKerat), were constructed. and their insecticidal properties analysed against Spodoptera frugiperda larvae. Results Bioassays of third-instar and neonate S. frugiperda larvae with vSynScathL and vSynKerat showed a decrease in the time needed to kill the infected insects when compared to the wild type virus. We have also shown that both recombinants were able to increase phenoloxidase activity in the hemolymph of S. frugiperda larvae. The expression of proteases in infected larvae resulted in destruction of internal tissues late in infection, which could be the reason for the increased viral speed of kill. Conclusions Baculoviruses and their recombinant forms constitute viable alternatives to chemical insecticides. Recombinant baculoviruses containing protease genes can be added to the list of engineered baculoviruses with great potential to be used in integrated pest management programs. PMID:20587066

Baculovirus Genomics

NARCIS (Netherlands)

Oers, van M.M.; Vlak, J.M.

2007-01-01

Baculovirus genomes are covalently closed circles of double stranded-DNA varying in size between 80 and 180 kilobase-pair. The genomes of more than fourty-one baculoviruses have been sequenced to date. The majority of these (37) are pathogenic to lepidopteran hosts; three infect sawflies

Construction of occluded recombinant baculoviruses containing the full-length cry1Ab and cry1Ac genes from Bacillus thuringiensis

Directory of Open Access Journals (Sweden)

B.M. Ribeiro

1998-06-01

Full Text Available The administration of baculoviruses to insects for bioassay purposes is carried out, in most cases, by contamination of food surfaces with a known amount of occlusion bodies (OBs. Since per os infection is the natural route of infection, occluded recombinant viruses containing crystal protein genes (cry1Ab and cry1Ac from Bacillus thuringiensis were constructed for comparison with the baculovirus prototype Autographa californica nucleopolyhedrovirus (AcNPV. The transfer vector pAcUW2B was used for construction of occluded recombinant viruses. The transfer vector containing the crystal protein genes was cotransfected with linearized DNA from a non-occluded recombinant virus. The isolation of recombinant viruses was greatly facilitated by the reduction of background "wild type" virus and the increased proportion of recombinant viruses. Since the recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve the pathogenicity of the recombinant viruses when compared with the wild type AcNPV, and in order to compare expression levels of the full-length crystal proteins produced by non-occluded and occluded recombinant viruses the full-length cry1Ab and cry1Ac genes were chosen for construction of occluded recombinant viruses. The recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve its pathogenicity but the size of the larvae infected with the recombinant viruses was significantly smaller than that of larvae infected with the wild type virus.

Quantitative proteomics of Spodoptera frugiperda cells during growth and baculovirus infection.

Directory of Open Access Journals (Sweden)

Nuno Carinhas

Full Text Available Baculovirus infection of Spodoptera frugiperda cells is a system of choice to produce a range of recombinant proteins, vaccines and, potentially, gene therapy vectors. While baculovirus genomes are well characterized, the genome of S. frugiperda is not sequenced and the virus-host molecular interplay is sparsely known. Herein, we describe the application of stable isotope labeling by amino acids in cell culture (SILAC to obtain the first comparative proteome quantitation of S. frugiperda cells during growth and early baculovirus infection. The proteome coverage was maximized by compiling a search database with protein annotations from insect species. Of interest were differentially proteins related to energy metabolism, endoplasmic reticulum and oxidative stress, yet not investigated in the scope of baculovirus infection. Further, the reduced expression of key viral-encoded proteins early in the infection cycle is suggested to be related with decreased viral replication at high cell density culture. These findings have implications for virological research and improvement of baculovirus-based bioprocesses.

The Influence of SV40 polyA on Gene Expression of Baculovirus Expression Vector Systems.

Directory of Open Access Journals (Sweden)

Tamer Z Salem

Full Text Available The simian virus 40 polyadenylation signal (SV40 polyA has been routinely inserted downstream of the polyhedrin promoter in many baculovirus expression vector systems (BEVS. In the baculovirus prototype Autographa californica multiple nucleopolyhedrovirus (AcMNPV, the polyhedrin promoter (very late promoter transcribes its gene by a viral RNA polymerase therefore there is no supporting evidence that SV40 polyA is required for the proper gene expression under the polyhedrin promoter. Moreover, the effect of the SV40 polyA sequence on the polyhedrin promoter activity has not been tested either at its natural polyhedrin locus or in other loci in the viral genome. In order to test the significance of adding the SV40 polyA sequence on gene expression, the expression of the enhanced green fluorescent protein (egfp was evaluated with and without the presence of SV40 polyA under the control of the polyhedrin promoter at different genomic loci (polyherin, ecdysteroid UDP-glucosyltransferase (egt, and gp37. In this study, spectrofluorometry and western blot showed reduction of EGFP protein for all recombinant viruses with SV40 polyA, whereas qPCR showed an increase in the egfp mRNA levels. Therefore, we conclude that SV40 polyA increases mRNA levels but decreases protein production in the BEVS when the polyhedrin promoter is used at different loci. This work suggests that SV40 polyA in BEVSs should be replaced by an AcMNPV late gene polyA for optimal protein production or left untouched for optimal RNA production (RNA interference applications.

The Influence of SV40 polyA on Gene Expression of Baculovirus Expression Vector Systems

Science.gov (United States)

Salem, Tamer Z.; Seaborn, Craig P.; Turney, Colin M.; Xue, Jianli; Shang, Hui; Cheng, Xiao-Wen

2015-01-01

The simian virus 40 polyadenylation signal (SV40 polyA) has been routinely inserted downstream of the polyhedrin promoter in many baculovirus expression vector systems (BEVS). In the baculovirus prototype Autographa californica multiple nucleopolyhedrovirus (AcMNPV), the polyhedrin promoter (very late promoter) transcribes its gene by a viral RNA polymerase therefore there is no supporting evidence that SV40 polyA is required for the proper gene expression under the polyhedrin promoter. Moreover, the effect of the SV40 polyA sequence on the polyhedrin promoter activity has not been tested either at its natural polyhedrin locus or in other loci in the viral genome. In order to test the significance of adding the SV40 polyA sequence on gene expression, the expression of the enhanced green fluorescent protein (egfp) was evaluated with and without the presence of SV40 polyA under the control of the polyhedrin promoter at different genomic loci (polyherin, ecdysteroid UDP-glucosyltransferase (egt), and gp37). In this study, spectrofluorometry and western blot showed reduction of EGFP protein for all recombinant viruses with SV40 polyA, whereas qPCR showed an increase in the egfp mRNA levels. Therefore, we conclude that SV40 polyA increases mRNA levels but decreases protein production in the BEVS when the polyhedrin promoter is used at different loci. This work suggests that SV40 polyA in BEVSs should be replaced by an AcMNPV late gene polyA for optimal protein production or left untouched for optimal RNA production (RNA interference applications). PMID:26659470

Characterization of canine herpesvirus glycoprotein C expressed by a recombinant baculovirus in insect cells.

Science.gov (United States)

Xuan, X; Maeda, K; Mikami, T; Otsuka, H

1996-12-01

The gene encoding the canine herpesvirus (CHV) glycoprotein C (gC) homologue has been identified by sequence homology analyses with other well studied herpesviruses. Previously, we have identified three CHV glycoproteins, gp145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gC, a recombinant baculovirus which contains the putative CHV gC structural gene under the baculovirus polyhedrin promoter was constructed. The recombinant baculovirus expressed gC-related polypeptides (44-62 kDa), which reacted only with MAbs against CHV gp80, indicating that the previously identified CHV gp80 is the translation product of the gC gene. The baculovirus expressed gC was glycosylated and transported to the surface of infected cells. At least seven neutralizing epitopes were conserved on the gC produced in insect cells. It was found that the recombinant baculovirus infected cells adsorbed murine erythrocytes as is the case for CHV-infected cells. The hemadsorption activity was inhibited by heparin, indicating that the CHV gC binds to heparan sulfate on the surface of murine erythrocytes. Mice immunized with the recombinant gC produced strong neutralizing antibodies. Our results suggest that CHV gC produced in insect cells may be useful as a subunit vaccine to control CHV infections.

Baculovirus virions displaying Plasmodium berghei circumsporozoite protein protect mice against malaria sporozoite infection

International Nuclear Information System (INIS)

Yoshida, Shigeto; Kondoh, Daisuke; Arai, Eriko; Matsuoka, Hiroyuki; Seki, Chisato; Tanaka, Takao; Okada, Masaji; Ishii, Akira

2003-01-01

The display of foreign proteins on the surface of baculovirus virions has provided a tool for the analysis of protein-protein interactions and for cell-specific targeting in gene transfer applications. To evaluate the baculovirus display system as a vaccine vehicle, we have generated a recombinant baculovirus (AcNPV-CSPsurf) that displays rodent malaria Plasmodium berghei circumsporozoite protein (PbCSP) on the virion surface as a fusion protein with the major baculovirus envelope glycoprotein gp64. The PbCSP-gp64 fusion protein was incorporated and oligomerized on the virion surface and led to a 12-fold increase in the binding activity of AcNPV-CSPsurf virions to HepG2 cells. Immunization with adjuvant-free AcNPV-CSPsurf virions induced high levels of antibodies and gamma interferon-secreting cells against PbCSP and protected 60% of mice against sporozoite challenge. These data demonstrate that AcNPV-CSPsurf displays sporozoite-like PbCSP on the virion surface and possesses dual potentials as a malaria vaccine candidate and a liver-directed gene delivery vehicle

Baculoviruses and nucleosome management

International Nuclear Information System (INIS)

Volkman, Loy E.

2015-01-01

Negatively-supercoiled-ds DNA molecules, including the genomes of baculoviruses, spontaneously wrap around cores of histones to form nucleosomes when present within eukaryotic nuclei. Hence, nucleosome management should be essential for baculovirus genome replication and temporal regulation of transcription, but this has not been documented. Nucleosome mobilization is the dominion of ATP-dependent chromatin-remodeling complexes. SWI/SNF and INO80, two of the best-studied complexes, as well as chromatin modifier TIP60, all contain actin as a subunit. Retrospective analysis of results of AcMNPV time course experiments wherein actin polymerization was blocked by cytochalasin D drug treatment implicate actin-containing chromatin modifying complexes in decatenating baculovirus genomes, shutting down host transcription, and regulating late and very late phases of viral transcription. Moreover, virus-mediated nuclear localization of actin early during infection may contribute to nucleosome management. - Highlights: • Baculoviruses have negatively-supercoiled, circular ds DNA. • Negatively-supercoiled DNA spontaneously forms nucleosomes in the nucleus. • Nucleosomes must be mobilized for replication and transcription to proceed. • Actin-containing chromatin modifiers participate in baculovirus replication

Baculoviruses and nucleosome management

Energy Technology Data Exchange (ETDEWEB)

Volkman, Loy E., E-mail: lvolkman@berkeley.edu

2015-02-15

Negatively-supercoiled-ds DNA molecules, including the genomes of baculoviruses, spontaneously wrap around cores of histones to form nucleosomes when present within eukaryotic nuclei. Hence, nucleosome management should be essential for baculovirus genome replication and temporal regulation of transcription, but this has not been documented. Nucleosome mobilization is the dominion of ATP-dependent chromatin-remodeling complexes. SWI/SNF and INO80, two of the best-studied complexes, as well as chromatin modifier TIP60, all contain actin as a subunit. Retrospective analysis of results of AcMNPV time course experiments wherein actin polymerization was blocked by cytochalasin D drug treatment implicate actin-containing chromatin modifying complexes in decatenating baculovirus genomes, shutting down host transcription, and regulating late and very late phases of viral transcription. Moreover, virus-mediated nuclear localization of actin early during infection may contribute to nucleosome management. - Highlights: • Baculoviruses have negatively-supercoiled, circular ds DNA. • Negatively-supercoiled DNA spontaneously forms nucleosomes in the nucleus. • Nucleosomes must be mobilized for replication and transcription to proceed. • Actin-containing chromatin modifiers participate in baculovirus replication.

DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

Science.gov (United States)

Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

2003-03-01

We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.

Science.gov (United States)

Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui

2017-06-15

Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

Baculovirus-mediated gene transfer and recombinant protein expression do not interfere with insulin dependent phosphorylation of PKB/Akt in human SHSY-5Y and C3A cells

Directory of Open Access Journals (Sweden)

Selander Martin

2007-02-01

Full Text Available Abstract Background Recombinant adenovirus vectors and transfection agents comprising cationic lipids are widely used as gene delivery vehicles for functional expression in cultured cells. Consequently, these tools are utilized to investigate the effects of functional over-expression of proteins on insulin mediated events. However, we have previously reported that cationic lipid reagents cause a state of insulin unresponsiveness in cell cultures. In addition, we have found that cultured cells often do not respond to insulin stimulation following adenovirus treatment. Infection with adenovirus compromises vital functions of the host cell leading to the activation of protein kinases central to insulin signalling, such as protein kinase B/Akt. Therefore, we investigated the effect of adenovirus infection on insulin unresponsiveness by means of Akt activation in cultured cells. Moreover, we investigated the use of baculovirus as a heterologous viral gene delivery vehicle to circumvent these phenomena. Since the finding that baculovirus can efficiently transduce mammalian cells, the applications of this viral system in gene delivery has greatly expanded and one advantage is the virtual absence of cytotoxicity in mammalian cells. Results We show that infection of human neuroblastoma SHSY-5Y and liver C3A cells with recombinant adenovirus results in the activation of Akt in a dose dependent manner. In addition, this activation makes treated cells unresponsive to insulin stimulation as determined by an apparent lack of differential phosphorylation of Akt on serine-473. Our data further indicate that the use of recombinant baculovirus does not increase the phosphorylation of Akt in SHSY-5Y and C3A cells. Moreover, following infection with baculovirus, SHSY-5Y and C3A cells respond to insulin by means of phosphorylation of Akt on serine-473 in the same manner as uninfected cells. Conclusion Widely-used adenovirus vectors for gene delivery cause a state of

Towards a molecular identification and classification system of lepidopteran-specific baculoviruses

International Nuclear Information System (INIS)

Lange, Martin; Wang Hualin; Hu Zhihong; Jehle, Johannes A.

2004-01-01

Virus genomics provides novel approaches for virus identification and classification. Based on the comparative analyses of sequenced lepidopteran-specific baculovirus genomes, degenerate oligonucleotides were developed that allow the specific amplification of several regions of the genome using polymerase chain reaction (PCR) followed by DNA sequencing. The DNA sequences within the coding regions of three highly conserved genes, namely polyhedrin/granulin (polh/gran), late expression factor 8 (lef-8), and late expression factor 9 (lef-9), were targeted for amplification. The oligonucleotides were tested on viral DNAs isolated from historical field samples, and amplification products were generated from 12 isolated nucleopolyhedrovirus (NPV) and 8 granulovirus (GV) DNAs. The PCR products were cloned or directly sequenced, and phylogenetic trees were inferred from individual and combined data sets of these three genes and compared to a phylogeny, which includes 22 baculoviruses using a combined data set of 30 core genes. This method allows a fast and reliable detection and identification of lepidopteran-specific NPVs and GVs. Furthermore, a strong correlation of the base composition of these three genome areas with that of the complete virus genome was observed and used to predict the base composition of uncharacterized baculovirus genomes. These analyses suggested that GVs have a significantly higher AT content than NPVs

Budded baculovirus particle structure revisited

NARCIS (Netherlands)

Wang, Qiushi; Bosch, Berend Jan; Vlak, J.M.; Oers, van M.M.; Rottier, P.J.; Lent, van J.W.M.

2016-01-01

<p>Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

Cloning of fusion protein gene of Newcastle disease virus into a baculovirus derived bacmid shuttle vector, in order to express it in insect cell line

Directory of Open Access Journals (Sweden)

Hashemzadeh MS

2015-05-01

Full Text Available Abstract Background: Newcastle disease virus (NDV is one of the major pathogens in poultry and vaccination is intended to control the disease, as an effective solution, yet. Fusion protein (F on surface of NDV, has a fundamental role in virus pathogenicity and can induce protective immunity, alone. With this background, here our aim was to construct a baculovirus derived recombinant bacmid shuttle vector (encoding F-protein in order to express it in insect cell line. Materials and Methods: In this experimental study, at first complete F gene from avirulent strain La Sota of NDV was amplified by RT-PCR to produce F cDNA. The amplicon was cloned into T/A cloning vector and afterwards into pFastBac Dual donor plasmid. After the verification of cloning process by two methods, PCR and enzymatic digestion analysis, the accuracy of F gene sequence was confirmed by sequencing. Finally, F-containing recombinant bacmid was subsequently generated in DH10Bac cell and the construct production was confirmed by a special PCR panel, using F specific primers and M13 universal primers. Results: Analysis of confirmatory tests showed that the recombinant bacmid, expressing of F-protein gene in correct sequence and framework, has been constructed successfully. Conclusion: The product of this F-containing recombinant bacmid, in addition to its independent application in the induction of protective immunity, can be used with the other individual recombinant baculoviruses, expressing HN and NP genes to produce NDV-VLPs in insect cell line.

Baculovirus display of functional antibody Fab fragments.

Science.gov (United States)

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

Crystallization and preliminary crystallographic studies of the metalloglycoprotein esterase A4 using a baculovirus expression system

Energy Technology Data Exchange (ETDEWEB)

Hiraki, Toshiki [Protein Design Laboratory, Yokohama City University, 1-7-29 Suehiro, Tsurumi, Yokohama 230-0045 (Japan); Shibayama, Naoya [Department of Physiology, Division of Biophysics, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke, Tochigi 329-0498 (Japan); Yoon, Young-Ho [Protein Design Laboratory, Yokohama City University, 1-7-29 Suehiro, Tsurumi, Yokohama 230-0045 (Japan); Yun, Kyung-Mook [Department of Physiology, Division of Biophysics, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke, Tochigi 329-0498 (Japan); Hamamoto, Toshiro [Department of Biochemistry, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke, Tochigi 329-0498 (Japan); Tame, Jeremy R. H.; Park, Sam-Yong, E-mail: park@tsurumi.yokohama-cu.ac.jp [Protein Design Laboratory, Yokohama City University, 1-7-29 Suehiro, Tsurumi, Yokohama 230-0045 (Japan)

2007-09-01

Esterase A4 (EA4) is a timer protein found in diapause eggs of the silkworm Bombyx mori. The gene for this metalloglycoprotein was cloned from B. mori eggs and expressed using a baculovirus expression system in silkworm pupae. Crystals of the purified protein have been grown that diffract to beyond 2.1 Å resolution at 100 K using synchrotron radiation. Esterase A4 (EA4) is a timer protein found in diapause eggs of the silkworm Bombyx mori. The gene for this metalloglycoprotein was cloned from B. mori eggs and expressed using a baculovirus expression system in silkworm pupae. Crystals of the purified protein have been grown that diffract to beyond 2.1 Å resolution at 100 K using synchrotron radiation. The protein crystals belong to space group P2{sub 1}, with unit-cell parameters a = 47.1, b = 73.9, c = 47.4 Å, β = 104.1°. With one dimer per asymmetric unit, the crystal volume per unit protein weight (V{sub M}) is 2.3 Å{sup 3} Da{sup −1} and the solvent content is 47%.

Baculovirus proteins IE-1, LEF-3, and P143 interact with DNA in vivo: a formaldehyde cross-linking study

International Nuclear Information System (INIS)

Ito, Emma; Sahri, Daniela; Knippers, Rolf; Carstens, Eric B.

2004-01-01

IE-1, LEF-3, and P143 are three of six proteins encoded by Autographa californica nucleopolyhedrovirus (AcMNPV) essential for baculovirus DNA replication in transient replication assays. IE-1 is the major baculovirus immediate early transcription regulator. LEF-3 is a single-stranded DNA binding protein (SSB) and P143 is a DNA helicase protein. To investigate their interactions in vivo, we treated AcMNPV-infected Spodoptera frugiperda cells with formaldehyde and separated soluble proteins from chromatin by cell fractionation and cesium chloride equilibrium centrifugation. Up to 70% of the total LEF-3 appeared in the fraction of soluble, probably nucleoplasmic proteins, while almost all P143 and IE-1 were associated with viral chromatin in the nucleus. This suggests that LEF-3 is produced in quantities that are higher than needed for the coverage of single stranded regions that arise during viral DNA replication and is consistent with the hypothesis that LEF-3 has other functions such as the localization of P143 to the nucleus. Using a chromatin immunoprecipitation procedure, we present the first direct evidence of LEF-3, P143, and IE-1 proteins binding to closely linked sites on viral chromatin in vivo, suggesting that they may form replication complexes on viral DNA in infected cells

Properties of Oryctes Baculovirus Isolated in Indonesia

Directory of Open Access Journals (Sweden)

Jun Kobayashi

1995-12-01

Full Text Available An Indonesian isolate of Oryctes baculovirus was purified from infected midguts of the rhinoceros beetle (Oryctes rhinoceros by centrifugation on a 10–40% (w/v sucroese gradient. Morphological features of  nucleocapsid including a tail-like projection were very same as those previously reported. Both protein components of purified particles and restriction fragment electrophoresis profiles of viral DNA were similar to those of their isolates of Oryctes baculovirus, although there were some differences. Key words: Baculovirus oryctes, electrophoresis

A pseudotype baculovirus expressing the capsid protein of foot-and-mouth disease virus and a T-Cell immunogen shows enhanced immunogenicity in mice

Directory of Open Access Journals (Sweden)

Liu Xiangtao

2011-02-01

Full Text Available Abstract Background Foot-and-mouth disease (FMD is a highly contagious disease of livestock which causes severe economic loss in cloven-hoofed animals. Vaccination is still a major strategy in developing countries to control FMD. Currently, inactivated vaccine of FMDV has been used in many countries with limited success and safety concerns. Development of a novel effective vaccine is must. Methods In the present study, two recombinant pseudotype baculoviruses, one expressing the capsid of foot-and-mouth disease virus (FMDV under the control of a cytomegalovirus immediate early enhancer/promoter (CMV-IE, and the other the caspid plus a T-cell immunogen coding region under a CAG promoter were constructed, and their expression was characterized in mammalian cells. In addition, their immunogenicity in a mouse model was investigated. The humoral and cell-mediated immune responses induced by pseudotype baculovirus were compared with those of inactivated vaccine. Results Indirect immunofluorescence assay (IFA and indirect sandwich-ELISA (IS-ELISA showed both recombinant baculoviruses (with or without T-cell epitopes were transduced efficiently and expressed target proteins in BHK-21 cells. In mice, intramuscular inoculation of recombinants with 1 × 109 or 1 × 1010 PFU/mouse induced the production of FMDV-specific neutralizing antibodies and gamma interferon (IFN-γ. Furthermore, recombinant baculovirus with T-cell epitopes had better immunogenicity than the recombinant without T-cell epitopes as demonstrated by significantly enhanced IFN-γ production (P P Conclusions These results indicate that pseudotype baculovirus-mediated gene delivery could be a alternative strategy to develop a new generation of vaccines against FMDV infection.

Pathogenesis induced by (recombinant) baculoviruses in insects

NARCIS (Netherlands)

Flipsen, H.

1995-01-01

<p>Infection of insect larvae by a baculovirus leads to cessation of feeding and finally to the death of the larva. Under optimal conditions this process may take as little as five days during which the virus multiplies approximately a billion times and transforms 30% of the larval weight into

A baculovirus (Bombyx mori nuclear polyhedrosis virus) repeat element functions as a powerful constitutive enhancer in transfected insect cells.

Science.gov (United States)

Lu, M; Farrell, P J; Johnson, R; Iatrou, K

1997-12-05

It has been previously reported that baculovirus homologous regions, the regions of baculovirus genomes that contain the origins of DNA replication, can augment the expression of a small number of baculovirus genes in vitro. We are now reporting that a region of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) containing the homologous region 3 (HR3) acts as an enhancer for the promoter of a nonviral gene, the cytoplasmic actin gene of the silkmoth B. mori. Incorporation of the HR3 sequences of BmNPV into an actin promoter-based expression cassette results in an augmentation of transgene expression in transfected cells by two orders of magnitude relative to the control recombinant expression cassette. This increase is due to a corresponding increase in the rate of transcription from the actin promoter and not to replication of the expression cassette and occurs only when the HR3 element is linked to the expression cassette in cis. A comparable degree of enhancement in the activity of the silkworm actin promoter occurs also in heterologous lepidopteran cells. Concomitant supplementation of transfected cells with the BmIE1 trans-activator, which was previously shown to be capable of functioning in vitro as a transcriptional co-activator of the cytoplasmic actin gene promoter, results in more than a 1,000-fold increase in the level of expression of recombinant proteins placed under the control of the actin gene promoter. These findings provide the foundation for the development of a nonlytic insect cell expression system for continuous high-level expression of recombinant proteins. Such a system should provide levels of expression of recombinant proteins comparable to those obtained from baculovirus expression systems and should also have the additional advantage of continuous production in a cellular environment that, in contrast to that generated by a baculovirus infection, supports continuously proper posttranslational modifications of recombinant

Probability to produce animal vaccines in insect baculovirus ...

African Journals Online (AJOL)

Administrator

2011-09-07

Sep 7, 2011 ... The insect baculovirus expression system is a valuable tool for the production of vaccine. .... vaccine expression/delivery vehicle (Yu-Chen et al., ... baculoviruses are applied in cell-based assays for drug ... Intramuscular.

Genomic support for speciation and specificity of baculoviruses

NARCIS (Netherlands)

Jakubowska, A.K.

2010-01-01

Keywords: baculovirus, insects, speciation, genomics, phylogeny, host specificity

The Baculoviridae comprise a large family of double-stranded DNA viruses infecting
arthropods. In this thesis two baculoviruses, Leucoma salicis nucleopolyhedrovirus
(LesaNPV) and Agrotis

Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

Science.gov (United States)

Graham, L A; Bendena, W G; Walker, V K

1996-02-01

The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

Baculovirus enhancins and their role in viral pathogenicity. Chapter 9

Science.gov (United States)

James M. Slavicek

2012-01-01

Baculoviruses are a large group of viruses pathogenic to arthropods, primarily insects from the order Lepidoptera and also insects in the orders Hymenoptera and Diptera. Baculoviruses have been used to control insect pests on agricultural crops and forests around the world. Efforts have been ongoing for the last two decades to develop strains of baculoviruses with...

Production of mink enteritis parvovirus empty capsids by expression in a baculovirus vector system: a recombinant vaccine for mink enteritis parvovirus in mink

DEFF Research Database (Denmark)

Christensen, J; Alexandersen, Søren; Bloch, B.

1994-01-01

The VP-2 gene of mink enteritis parvovirus (MEV) was amplified by the polymerase chain reaction using MEV DNA isolated from the faeces of a naturally infected mink. Subsequently the VP-2 gene was cloned into a baculovirus expression vector. Recombinant baculo-viruses were isolated and the MEV VP-2...... protein was able to form parvovirus-like particles, which had haemagglutinating properties comparable with the wild-type MEV. The cloned VP-2 gene was sequenced and only five nucleotide differences were found after alignment with the known sequences of the MEV type 1 and type 2 isolates. Surprisingly...

Baculovirus IE2 Stimulates the Expression of Heat Shock Proteins in Insect and Mammalian Cells to Facilitate Its Proper Functioning.

Science.gov (United States)

Tung, Hsuan; Wei, Sung-Chan; Lo, Huei-Ru; Chao, Yu-Chan

2016-01-01

Baculoviruses have gained popularity as pest control agents and for protein production in insect systems. These viruses are also becoming popular for gene expression, tissue engineering and gene therapy in mammalian systems. Baculovirus infection triggers a heat shock response, and this response is crucial for its successful infection of host insect cells. However, the viral protein(s) or factor(s) that trigger this response are not yet clear. Previously, we revealed that IE2-an early gene product of the baculovirus-could form unique nuclear bodies for the strong trans-activation of various promoters in mammalian cells. Here, we purified IE2 nuclear bodies from Vero E6 cells and investigated the associated proteins by using mass spectrometry. Heat shock proteins (HSPs) were found to be one of the major IE2-associated proteins. Our experiments show that HSPs are greatly induced by IE2 and are crucial for the trans-activation function of IE2. Interestingly, blocking both heat shock protein expression and the proteasome pathway preserved the IE2 protein and its nuclear body structure, and revived its function. These observations reveal that HSPs do not function directly to assist the formation of the nuclear body structure, but may rather protect IE2 from proteasome degradation. Aside from functional studies in mammalian cells, we also show that HSPs were stimulated and required to determine IE2 protein levels, in insect cells infected with baculovirus. Upon inhibiting the expression of heat shock proteins, baculovirus IE2 was substantially suppressed, resulting in a significantly suppressed viral titer. Thus, we demonstrate a unique feature in that IE2 can function in both insect and non-host mammalian cells to stimulate HSPs, which may be associated with IE2 stabilization and lead to the protection of the its strong gene activation function in mammalian cells. On the other hand, during viral infection in insect cells, IE2 could also strongly stimulate HSPs and

A new theraphosid spider toxin causes early insect cell death by necrosis when expressed in vitro during recombinant baculovirus infection.

Directory of Open Access Journals (Sweden)

Daniel Mendes Pereira Ardisson-Araújo

Full Text Available Baculoviruses are the most studied insect viruses in the world and are used for biological control of agricultural and forest insect pests. They are also used as versatile vectors for expression of heterologous proteins. One of the major problems of their use as biopesticides is their slow speed to kill insects. Thus, to address this shortcoming, insect-specific neurotoxins from arachnids have been introduced into the baculovirus genome solely aiming to improve its virulence. In this work, an insecticide-like toxin gene was obtained from a cDNA derived from the venom glands of the theraphosid spider Brachypelma albiceps. The mature form of the peptide toxin (called Ba3 has a high content of basic amino acid residues, potential for three possible disulfide bonds, and a predicted three-stranded β-sheetDifferent constructions of the gene were engineered for recombinant baculovirus Autographa californica multiple nuclepolyhedrovirus (AcMNPV expression. Five different forms of Ba3 were assessed; (1 the full-length sequence, (2 the pro-peptide and mature region, (3 only the mature region, and the mature region fused to an (4 insect or a (5 virus-derived signal peptide were inserted separately into the genome of the baculovirus. All the recombinant viruses induced cell death by necrosis earlier in infection relative to a control virus lacking the toxin gene. However, the recombinant virus containing the mature portion of the toxin gene induced a faster cell death than the other recombinants. We found that the toxin construct with the signal peptide and/or pro-peptide regions delayed the necrosis phenotype. When infected cells were subjected to ultrastructural analysis, the cells showed loss of plasma membrane integrity and structural changes in mitochondria before death. Our results suggest this use of baculovirus is a potential tool to help understand or to identify the effect of insect-specific toxic peptides when produced during infection of insect

Induction of antigen-specific immune responses in mice by recombinant baculovirus expressing premembrane and envelope proteins of West Nile virus

Directory of Open Access Journals (Sweden)

Zhu Bibo

2012-07-01

Full Text Available Abstract Background West Nile Virus (WNV is an emerging arthropod-born flavivirus with increasing distribution worldwide that is responsible for a large proportion of viral encephalitis in humans and horses. Given that there are no effective antiviral drugs available for treatment of the disease, efforts have been directed to develop vaccines to prevent WNV infection. Recently baculovirus has emerged as a novel and attractive gene delivery vehicle for mammalian cells. Results In the present study, recombinant baculoviruses expressing WNV premembrane (prM and envelope (E proteins under the cytomegalovirus (CMV promoter with or without vesicular stomatitis virus glycoprotein (VSV/G were constructed. The recombinant baculoviruses designated Bac-G-prM/E and Bac-prM/E, efficiently express E protein in mammalian cells. Intramuscular injection of the two recombinant baculoviruses (at doses of 108 or 109 PFU/mouse induced the production of WNV-specific antibodies, neutralizing antibodies as well as gamma interferon (IFN-γ in a dose-dependent pattern. Interestingly, the recombinant baculovirus Bac-G-prM/E was found to be a more efficient immunogen than Bac-prM/E to elicit a robust immune response upon intramuscular injection. In addition, inoculation of baculovirus resulted in the secretion of inflammatory cytokines, such as TNF-α, IL-2 and IL-6. Conclusions These recombinant baculoviruses are capable of eliciting robust humoral and cellular immune responses in mice, and may be considered as novel vaccine candidates for West Nile Virus.

The Current Status of Baculovirus and Their Implication for Insect Pest Control

Directory of Open Access Journals (Sweden)

Arman Wijonarko

2001-07-01

Full Text Available Baculovirus have been promoted as the promising bioinsecticides for their pest control potential for more than half a century. But only a few have been successful as biological control agent, and almost none has been proven as commercial success, or widely used for large-scale insect pest control. The bioinsecticides currently represent only a small fraction of the world pesticide market. The successful of the Bt crop marked a special achievement in the bioinsecticide market growth. How about the baculoviruses? The main hurdle for baculovirus to be developed as bioinsecticide is its poor performance compare to synthetic chemical ones, include the speed of kill, and host range. It is important to understand the nature of baculovirus, and explore the possibilities to develop new way in applying the baculovirus as bioinsecticides. Key words: current status, baculovirus, insect control

Propagation and Purification of Baculovirus oryctes Huger

Directory of Open Access Journals (Sweden)

Susamto Somowiyarjo

1995-12-01

Full Text Available An isolate of Baculovirus oryctes, a possible biological control agent for coconut beetle (Oryctes rhinoceros Huger from East Java was propagated and purified. The virus could be transmitted by feeding the imago with 10% sucrose containing virus from homogenate of infected beetles. Effectivity of virus to 9 healthy females by sexual copulation. Virus be succesfully purified by a method of Payne. Key words: Baculovirus oryctes, transmission, purification

Sunlight stability and rain-fastness of formulations of Baculovirus heliothis

International Nuclear Information System (INIS)

Ignoffo, C.M.; Garcia, C.; Saathoff, S.G.

1997-01-01

Sunlight-Ultraviolet, with an activity spectrum from 290 to 400 nm, is the most destructive factor affecting the persistence of baculoviruses. Benzopurpurin (a disazo dye) and carbon provided the best protection when polyhedral inclusion bodies (PIB) of Baculovirus heliothis were exposed to an artificial spectrum simulating sunlight-UV (UV). Greater than 75% of the original PIB activity was still present after 48 h of sunlight-UV. When sprayed on soybeans and exposed to natural sunlight, only formulations with carbon provided significant protection of PIB. The half-life of formulations were PIB-only 4.9 +/- 1.4 h (mean +/- SE), PIB + polymer (pyrrolidone-based sticker) 3.3 +/- 0.6 h, PIB + polymer + benzopurpurin 3.4 +/- 0.7 h, and PIB + polymer + carbon 27.7 +/- 5.2 h. PIB of B. heliothis tenaciously adhere to soybean, Glycine max (L.) Merrill, leaflets after spraying and drying. Less than 6% of the PIB activity of nonformulated PIB was lost after a drenching, simulated rainfall. More than 97% of the original PIB activity of carbon formulations was still present on soybean leaflets after 10 h of exposure to sunlight-UV. In contrast, 20% was present for formulations without carbon

Baculovirus expression vector system: An efficient tool for the ...

African Journals Online (AJOL)

Baculovirus expression vector system is considered one of the most successful and widely acceptable means for the production of recombinant proteins in extremely large quantities. Proper posttranslational modifications of the expressed proteins in insect cells, the usual host of baculoviruses, get them soluble, correctly ...

Review of Vaccinia Virus and Baculovirus Viability Versus Virucides

Science.gov (United States)

2008-03-01

25 6.4 Lignin ......................................................................................... 25 6.5...a lower pH (4.83 - 5.22), the virus rapidly inactivated over a month (Tomas et al., 1973). 16 The effects of alkalis on baculoviruses are important...of antioxidant and oxidative enzymes on UV inactivation by inhibiting the generation of highly reactive free radicals within HzSNPV. Water suspensions

Comparison of the Protective Efficacy of DNA and Baculovirus-Derived Protein Vaccines for EBOLA Virus in Guinea Pigs

National Research Council Canada - National Science Library

Mellquist-Riemenschneider, Jenny L; Garrison, Aura R; Geisbert, Joan B; Saikh, Kamal U; Heidebrink, Kelli D

2003-01-01

.... Previously, a priming dose of a DNA vaccine expressing the glycoprotein (GP) gene of MARV followed by boosting with recombinant baculovirus-derived GP protein was found to confer protective immunity to guinea pigs (Hevey et al., 2001...

Evaluation of the Insecticidal Efficacy of Wild Type and Recombinant Baculoviruses.

Science.gov (United States)

Popham, Holly J R; Ellersieck, Mark R; Li, Huarong; Bonning, Bryony C

2016-01-01

A considerable amount of work has been undertaken to genetically enhance the efficacy of baculovirus insecticides. Following construction of a genetically altered baculovirus, laboratory bioassays are used to quantify various parameters of insecticidal activity such as the median lethal concentration (or dose) required to kill 50 % of infected larvae (LC50 or LD50), median survival of larvae infected (ST50), and feeding damage incurred by infected larvae. In this chapter, protocols are described for a variety of bioassays and the corresponding data analyses for assessment of the insecticidal activity of baculovirus insecticides.

寨卡病毒E蛋白在重组杆状病毒中的表达%Expression of envelope protein of Zika virus in baculovirus expression system

Institute of Scientific and Technical Information of China (English)

高寒春; 姚立红; 王超; 郑丽舒

2017-01-01

目的 在杆状病毒中表达寨卡病毒(Zika virus,ZIKV)包膜蛋白(Envelope protein,E蛋白).方法 人工合成ZIKV E基因全长序列(1 518 bp),并克隆到pFastBac1载体上,得到重组杆状病毒转移载体pFB1-E,转化含DH10Bac感受态细胞,获得骨架质粒rBacmid-E,转染sf9细胞,得到重组杆状病毒rBac-E.检测病毒滴度,PCR法检测E基因的插入,间接免疫荧光和Western blot法检测E蛋白的表达.结果 经PCR方法鉴定,重组杆状病毒骨架质粒构建成功,重组病毒rBac-E(第3代)病毒滴度为2.58×105pfu/ml.提取感染rBac-E的sf9细胞基因组,经PCR扩增得到3 830 bp的条带,间接免疫荧光检测出现特异性绿色荧光.Western blot鉴定可见感染重组杆状病毒rBac-E的细胞沉淀中在相对分子质量55×103处有特异性条带.结论 在杆状病毒表达系统中重组表达了ZIKV E蛋白,为ZIKV E蛋白功能研究及疫苗的开发奠定了基础.%Objective To express envelope protein of ZIKA virus in baculovirus expression system.Methods Full-length E gene of ZIKA virus was obtained by DNA synthesis and inserted into vector pFastBac1.The constructed recombinant baculovirus transfer vector pFB1-E was transformed to competent DH10Bac cells.The obtained skeleton plasmid rBacmid-E was transfected to sf9 cells,and the constructed recombinant baculovirus rBac-E was determined for titer,for insertion of E gene by PCR,and for expression of E protein by IFA and Western blotting.Results PCR proved that skeleton plasmid rBacmid-E was constructed correctly.The titer of rBac-E of passage 3 was 2.58 × 105 pfu/ ml.The genome of infected cells virus was extracted,the gene band at length of 3 830 bp was observed after PCR amplification.Indirect immunofluorescence of the infected cells showed the specific green fluorescence,55 × 103 specific band was determined by Western blotting identification in the cell pellet of the infected recombinant baculovirus rBacE.Conclusions The recombinant

Budded baculovirus particle structure revisited

NARCIS (Netherlands)

Wang, Qiushi; Bosch, Berend-Jan; Vlak, Just M; van Oers, Monique M; Rottier, Peter J; van Lent, Jan W M

2015-01-01

Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

Co-expression of human cytochrome P4501A1 (CYP1A1) variants and human NADPH-cytochrome P450 reductase in the baculovirus/insect cell system.

Science.gov (United States)

Schwarz, D; Kisselev, P; Honeck, H; Cascorbi, I; Schunck, W H; Roots, I

2001-06-01

1. Three human cytochrome P4501A1 (CYP1A1) variants, wild-type (CYP1A1.1), CYP1A1.2 (1462V) and CYP1A1.4 (T461N), were co-expressed with human NADPH-P450 reductase (OR) in Spodoptera frugiperda (Sf9) insect cells by baculovirus co-infection to elaborate a suitable system for studying the role of CYPA1 polymorphism in the metabolism of exogenous and endogenous substrates. 2. A wide range of conditions was examined to optimize co-expression with regard to such parameters as relative multiplicity of infection (MOI), time of harvest, haem precursor supplementation and post-translational stabilization. tinder optimized conditions, almost identical expression levels and molar OR/CYP1A1 ratios (20:1) were attained for all CYP1A1 variants. 3. Microsomes isolated from co-infected cells demonstrated ethoxyresorufin deethlylase activities (nmol/min(-1) nmol(-1) CYP1A1) of 16.0 (CYP1A1.1), 20.5 (CYP1A1.2) and 22.5 (CYP1A1.4). Pentoxyresorufin was dealkylated approximately 10-20 times slower with all enzyme variants. 4. All three CYP1A1 variants were active in metabolizing the precarcinogen benzo[a]pyrene (B[a]P), with wild-type enzyme showing the highest activity, followed by CYP1A1.4 (60%) and CYP1A1.2 (40%). Each variant produced all major metabolites including B[a]P-7,8-dihydrodiol, the precursor of the ultimate carcinogenic species. 5. These studies demonstrate that the baculovirus-mediated co-expression-by-co-infection approach all CYP1A1 variants yields functionally active enzyme systems with similar molar OR/CYP1A1 ratios, thus providing suitable preconditions to examine the metabolism of and environmental chemicals by the different CY1A1 variants.

MicroRNAome of Spodoptera frugiperda cells (Sf9) and its alteration following baculovirus infection.

Science.gov (United States)

Mehrabadi, Mohammad; Hussain, Mazhar; Asgari, Sassan

2013-06-01

MicroRNAs (miRNAs) as small non-coding RNAs play important roles in many biological processes such as development, cell signalling and immune response. Studies also suggest that miRNAs are important in host-virus interactions where the host limits virus infection by differentially expressing miRNAs that target essential viral genes. Here, we identified conserved and new miRNAs from Spodoptera frugiperda cells (Sf9) using a combination of deep sequencing and bioinformatics as well as experimental approaches. S. frugiperda miRNAs share common features of miRNAs in other organisms, such as uracil (U) at the 5' end of miRNA. The 5' ends of the miRNAs were more conserved than the 3' ends, revealing evolutionary protection of the seed region in miRNAs. The predominant miRNAs were found to be conserved among arthropods. The majority of homologous miRNAs were found in Bombyx mori, with 76 of the 90 identified miRNAs. We found that seed shifting and arm switching have happened in this insect's miRNAs. Expression levels of the majority of miRNAs changed following baculovirus infection. Results revealed that baculovirus infection mainly led to an overall suppression of cellular miRNAs. We found four different genes being regulated by sfr-miR-184 at the post-transcriptional level. The data presented here further support conservation of miRNAs in insects and other organisms. In addition, the results reveal a differential expression of host miRNAs upon baculovirus infection, suggesting their potential roles in host-virus interactions. Seed shifting and arm switching happened during evolution of miRNAs in different insects and caused miRNA diversification, which led to changes in the target repository of miRNAs.

Elektron Mikroskopi dan Imunogenisitas Baculovirus oryctes Isolat Yogyakarta

Directory of Open Access Journals (Sweden)

YB Sumardiyono

1995-12-01

Full Text Available Palm rhinoceros beetle (Oryctes rhinoceros was infected per os with Yogyakarta isolate of Baculovirus oryctes in laboratory condition. Midguts of infected beetle obtained were then extracted for further nucleoprotein purification by centrifugation method. Electron microscopy studies on purified nucleoprotein revealed rod-shape viruses with rounded end measured 190×94 nm in average. One end of the particle showed tail-like structure. Antibodies against the virus were obtained by immunization to rabbit, and reacted against either purified virus or extract of infected beetle, but not against extract of healthy beetle. Key words: Baculovirus oryctes, polyclonal antibody

Display of a Maize cDNA library on baculovirus infected insect cells

Directory of Open Access Journals (Sweden)

Jones Ian M

2008-08-01

Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

Construction of a recombinant baculovirus expressing swine hepatitis E Virus ORF2 and preliminary research on its immune effect.

Science.gov (United States)

Yang, Z; Hu, Y; Yuan, P; Yang, Y; Wang, K; Xie, L Y; Huang, S L; Liu, J; Ran, L; Song, Z H

2018-03-01

In the swine hepatitis E virus (HEV), open reading frame 2 (ORF2) is rich in antigenic determinants and neutralizing epitopes that could induce immune protection. We chose the Bac-to-Bac® Baculovirus Expression System to express fragments containing the critical neutralizing antigenic sites within the HEV ORF2 protein of pigs to obtain a recombinant baculovirus. The fragment of swine HEV ORF2 region (1198-1881bp) was cloned into vector pFastBacTM. A recombinant baculovirus, rBacmid-ORF2, was obtained after transposition and transfection. The molecular mass of the recombinant protein was 26 kDa. Mice were immunized by the intraperitoneal and oral routes with cell lysates of recombinant baculovirus rBacmid-ORF2. Serum and feces of the mice were collected separately at 0, 14, 28, and 42 d after immunization and the antibody levels of IgG and secretory IgA against swine HEV were determined using an enzyme-linked immunosorbent assay. The results suggested that rBacmid-ORF2 induced antibodies of the humoral and mucosal immune responses in mice and that the oral route was significantly superior to the intraperitoneal route. This is the first study to demonstrate that that recombinant baculovirus swine HEV ORF2 could induce humoral and mucosal immune responses in mice. Copyright© by the Polish Academy of Sciences.

Error assessment in recombinant baculovirus titration: evaluation of different methods.

Science.gov (United States)

Roldão, António; Oliveira, Rui; Carrondo, Manuel J T; Alves, Paula M

2009-07-01

The success of baculovirus/insect cells system in heterologous protein expression depends on the robustness and efficiency of the production workflow. It is essential that process parameters are controlled and include as little variability as possible. The multiplicity of infection (MOI) is the most critical factor since irreproducible MOIs caused by inaccurate estimation of viral titers hinder batch consistency and process optimization. This lack of accuracy is related to intrinsic characteristics of the method such as the inability to distinguish between infectious and non-infectious baculovirus. In this study, several methods for baculovirus titration were compared. The most critical issues identified were the incubation time and cell concentration at the time of infection. These variables influence strongly the accuracy of titers and must be defined for optimal performance of the titration method. Although the standard errors of the methods varied significantly (7-36%), titers were within the same order of magnitude; thus, viral titers can be considered independent of the method of titration. A cost analysis of the baculovirus titration methods used in this study showed that the alamarblue, real time Q-PCR and plaque assays were the most expensive techniques. The remaining methods cost on average 75% less than the former methods. Based on the cost, time and error analysis undertaken in this study, the end-point dilution assay, microculture tetrazolium assay and flow cytometric assay were found to be the techniques that combine all these three main factors better. Nevertheless, it is always recommended to confirm the accuracy of the titration either by comparison with a well characterized baculovirus reference stock or by titration using two different methods and verification of the variability of results.

Utilizing the virus-induced blocking of apoptosis in an easy baculovirus titration method.

Science.gov (United States)

Niarchos, Athanasios; Lagoumintzis, George; Poulas, Konstantinos

2015-10-22

Baculovirus-mediated protein expression is a robust experimental technique for producing recombinant higher-eukaryotic proteins because it combines high yields with considerable post-translational modification capabilities. In this expression system, the determination of the titer of recombinant baculovirus stocks is important to achieve the correct multiplicity of infection for effective amplification of the virus and high expression of the target protein. To overcome the drawbacks of existing titration methods (e.g., plaque assay, real-time PCR), we present a simple and reliable assay that uses the ability of baculoviruses to block apoptosis in their host cells to accurately titrate virus samples. Briefly, after incubation with serial dilutions of baculovirus samples, Sf9 cells were UV irradiated and, after apoptosis induction, they were viewed via microscopy; the presence of cluster(s) of infected cells as islets indicated blocked apoptosis. Subsequently, baculovirus titers were calculated through the determination of the 50% endpoint dilution. The method is simple, inexpensive, and does not require unique laboratory equipment, consumables or expertise; moreover, it is versatile enough to be adapted for the titration of every virus species that can block apoptosis in any culturable host cells which undergo apoptosis under specific conditions.

A Role for the Anti-Viral Host Defense Mechanism in the Phylogenetic Divergence in Baculovirus Evolution.

Directory of Open Access Journals (Sweden)

Toshihiro Nagamine

Full Text Available Although phylogenic analysis often suggests co-evolutionary relationships between viruses and host organisms, few examples have been reported at the microevolutionary level. Here, we show a possible example in which a species-specific anti-viral response may drive phylogenic divergence in insect virus evolution. Two baculoviruses, Autographa californica multiple nucleopolyhedrovirus (AcMNPV and Bombyx mori nucleopolyhedrovirus (BmNPV, have a high degree of DNA sequence similarity, but exhibit non-overlapping host specificity. In our study of their host-range determination, we found that BmNPV replication in B. mori cells was prevented by AcMNPV-P143 (AcP143, but not BmNPV-P143 (BmP143 or a hybrid P143 protein from a host-range expanded phenotype. This suggests that AcMNPV resistance in B. mori cells depends on AcP143 recognition and that BmNPV uses BmP143 to escapes this recognition. Based on these data, we propose an insect-baculovirus co-evolution scenario in which an ancestor of silkworms exploited an AcMNPV-resistant mechanism; AcMNPV counteracted this resistance via P143 mutations, resulting in the birth of BmNPV.

Characterization of viral proteins of Oryctes baculovirus and comparison between two geographical isolates.

Science.gov (United States)

Mohan, K S; Gopinathan, K P

1989-01-01

Bacilliform Oryctes baculovirus particles have been visualized in electron micrographs of midgut sections from virus infected Oryctes rhinoceros beetles. Morphologically the Indian isolate (Oryctes baculovirus, KI) resembled the previously reported Oryctes baculovirus, isolate PV505. The constituent proteins of baculovirus KI have been analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and by Western blots using polyclonal antibodies raised against the complete viral particles, as probes. A total of forty eight viral proteins have been identified. Fourteen viral proteins were located on the viral envelope. Among the proteins constituting the nucleocapsid, three were located internally within the capsid. A 23.5 kDa protein was tightly associated with viral DNA in the nucleocapsid core. Two envelope and seven capsid proteins of KI and PV505 revealed differences in SDS-PAGE profiles and glycosylation patterns. Immunoblotting of KI and PV505 proteins with anti KI antiserum demonstrated antigenic differences between the two viral isolates.

BACULOVIRUS REPLICATION ALTERS HORMONE-REGULATED HOST DEVELOPMENT.

Science.gov (United States)

The baculovirus Lymantria dispar nuclear polyhedrosis virus interferes with insect larval development by altering the host's hormonal system. The level of haemolymph ecdysteroids, the insect moulting hormone, was found to be higher in virus-infected larvae than in uninfected cont...

Baculovirus Insecticides in Latin America: Historical Overview, Current Status and Future Perspectives

Directory of Open Access Journals (Sweden)

Santiago Haase

2015-04-01

Full Text Available Baculoviruses are known to regulate many insect populations in nature. Their host-specificity is very high, usually restricted to a single or a few closely related insect species. They are amongst the safest pesticides, with no or negligible effects on non-target organisms, including beneficial insects, vertebrates and plants. Baculovirus-based pesticides are compatible with integrated pest management strategies and the expansion of their application will significantly reduce the risks associated with the use of synthetic chemical insecticides. Several successful baculovirus-based pest control programs have taken place in Latin American countries. Sustainable agriculture (a trend promoted by state authorities in most Latin American countries will benefit from the wider use of registered viral pesticides and new viral products that are in the process of registration and others in the applied research pipeline. The success of baculovirus-based control programs depends upon collaborative efforts among government and research institutions, growers associations, and private companies, which realize the importance of using strategies that protect human health and the environment at large. Initiatives to develop new regulations that promote the use of this type of ecological alternatives tailored to different local conditions and farming systems are underway.

In vivo study of immunogenicity and kinetic characteristics of a quantum dot-labelled baculovirus.

Science.gov (United States)

Wang, Meng; Zheng, Zhenhua; Meng, Jin; Wang, Han; He, Man; Zhang, Fuxian; Liu, Yan; Hu, Bin; He, Zike; Hu, Qinxue; Wang, Hanzhong

2015-09-01

Nanomaterials conjugated with biomacromolecules, including viruses, have great potential for in vivo applications. Therefore, it is important to evaluate the safety of nanoparticle-conjugated macromolecule biomaterials (Nano-mbio). Although a number of studies have assessed the risks of nanoparticles and macromolecule biomaterials in living bodies, only a few of them investigated Nano-mbios. Here we evaluated the in vivo safety profile of a quantum dot-conjugated baculovirus (Bq), a promising new Nano-mbio, in mice. Each animal was injected twice intraperitoneally with 50 μg virus protein labelled with around 3*10(-5)nmol conjugated qds. Control animals were injected with PBS, quantum dots, baculovirus, or a mixture of quantum dots and baculovirus. Blood, tissues and body weight were analysed at a series of time points following both the first and the second injections. It turned out that the appearance and behaviour of the mice injected with Bq were similar to those injected with baculovirus alone. However, combination of baculovirus and quantum dot (conjugated or simply mixed) significantly induced stronger adaptive immune responses, and lead to a faster accumulation and longer existence of Cd in the kidneys. Thus, despite the fact that both quantum dot and baculovirus have been claimed to be safe in vivo, applications of Bq in vivo should be cautious. To our knowledge, this is the first study examining the interaction between a nanoparticle-conjugated virus and a living body from a safety perspective, providing a basis for in vivo application of other Nano-mbios. Copyright © 2015 Elsevier Ltd. All rights reserved.

Experiment study with baculovirus-mediated transfer of the thyroid sodium/iodide symporter gene into thyroid cancer for a targeted radiotherapy

International Nuclear Information System (INIS)

Zhang Yifan; Li Biao; Zhao Long; You Bei; Yin Guizhi; Zhu Chengmo

2004-01-01

Objective: To explore the feasibility of thyroid cancers for radiotherapy by using baculoviral vector to deliver the NIS gene into the tumor cells. Method: Constructed a recombinant baculovirus encoding the human NIS gene under the control of the cytomegalovirus promoter. Using a mouse monoclonal antibody and a FITC-labeled antimouse antibody to confirm expression of the NIS protein of infected tumor cells by immunofluorescence. In vitro iodide uptake experiments were carded out on BacNIS-infected tumor cells to further characterize the BacNIS virus, and cell killing with 131I and clonogenic assay were performed on BacNIS-infected cell to observe the selective killing effect of 1311 on NIS-expressing cells. Results: Infection of thyroidcancer cells (FTC-133, W3) with BacNIS resulted in perchlorate-sensitive 125I uptake by these cells to a higher level than that in noninfected cells. But 1251 uptake of 8505C is very low. Demonstrating that the BacNIS vector can function in tumor cells. In addition, AdNIS-infected tumor cells were selectively killed by exposure to 1311, as revealed by clonogenicassays, higher than that in nontreated tumors. Conclusions: AdNIS is very efficient in triggering iodide uptake by infected tumor cell, outlining the potential of this novel cancer gene therapy approach for a targeted radiotherapy. (authors)

Expression of Na,K-ATPase and H,K-ATPase Isoforms with the Baculovirus Expression System

NARCIS (Netherlands)

Koenderink, J.B.; Swarts, H.G.

2016-01-01

P-type ATPases can be expressed in several cell systems. The baculovirus expressions system uses an insect virus to enter and express proteins in Sf9 insect cells. This expression system is a lytic system in which the cells will die a few days after viral infection. Subsequently, the expressed

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

Science.gov (United States)

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

AcMNPV ac143 (odv-e18) is essential for mediating budded virus production and is the 30th baculovirus core gene

International Nuclear Information System (INIS)

McCarthy, Christina B.; Theilmann, David A.

2008-01-01

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) ac143 (odv-e18) is a late gene that encodes for a predicted 9.6 kDa structural protein that locates to the occlusion derived viral envelope and viral induced intranuclear microvesicles [Braunagel, S.C., He, H., Ramamurthy, P., and Summers, M.D. (1996). Transcription, translation, and cellular localization of three Autographa californica nuclear polyhedrosis virus structural proteins: ODV-E18, ODV-E35, and ODV-EC27. Virology 222, 100-114.]. In this study we demonstrate that ac143 is actually a previously unrecognized core gene and that it is essential for mediating budded virus production. To examine the role of ac143 in the baculovirus life cycle, we used the AcMNPV bacmid system to generate an ac143 knockout (KO) virus (AcBAC ac142REP-ac143KO ). Fluorescence and light microscopy showed that infection by AcBAC ac142REP-ac143KO is limited to a single cell and titration assays confirmed that AcBAC ac142REP-ac143KO was unable to produce budded virus (BV). Progression to very late phases of the viral infection was evidenced by the development of occlusion bodies in the nuclei of transfected cells. This correlated with the fact that viral DNA replication was unaffected in AcBAC ac142REP-ac143KO transfected cells. The entire ac143 promoter, which includes three late promoter motifs, is contained within the ac142 open reading frame. Different deletion mutants of this region showed that the integrity of the ac142-ac143 core gene cluster was required for the bacmids to display wild-type patterns of viral replication, BV production and RNA transcription

Future vital prospect of gene expression factors of lef-7 (baculovirus expression: Old body, young cherub

Directory of Open Access Journals (Sweden)

Md. Reyad-ul-ferdous

2018-04-01

Full Text Available Background Baculovirus; late expression factors (Lef-7 have potential roles for protein expression in insect and mammalian cells; Efficient expression of recombinant proteins to facilitate the practical and structural investigation. Aims Lef-7 might play crucial roles in transcription and translation reactions of insect cell lines. Methods Materials and Methods: All required information regards Lef-7 was generated by exploring the internet search engine like as (PubMed, Wiley, ScienceDirect, CNKI, ACS, Google Scholar, Web of Science, SciFinder, and Baidu Scholar and libraries. Results These properties issue crucial scope for DNA cloning and act as a vital vector for insect and mammalian cells. Left-7 could be the significant site in the development of the vaccine for a couple of chronic diseases. Further investigation needs to study on therapeutic vaccines with few immunologic advantages over proteins derived from mammalian sources, and animal sources. Lef-7 demonstrates the significant impact in the fields of DNA immunology research to insight into the mechanistic and utilitarian link between autoimmunity, infectious diseases, and cancer. Conclusion This review reveals Lef-7 gene function offers a workable strategy for the expression of whole viral protomers as the future prospect of Lef-7.

On the role of baculovirus photolyases in DNA repair upon UV damage of occlusion bodies

NARCIS (Netherlands)

Biernat, M.A.; Caballero, P.; Vlak, J.M.; Oers, van M.M.

2013-01-01

The use of baculoviruses in insect biocontrol is hampered by their sensitivity to ultraviolet (UV) light. This irradiation induces cyclobutane pyrimidine dimers (CPDs) in DNA. CPD-photolyases repair CPDs using visible light. Plusiine baculoviruses encode photolyases, which could potentially repair

Radioimmunoassay analysis of baculovirus granulins and polyhedrins

International Nuclear Information System (INIS)

Summers, M.D.; Hoops, P.

1980-01-01

Granulin and polyhedrin proteins were purified by preparative sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis from the baculoviruses Autographa californica, Rachiplusia ou, Heliothis zea, Heliothis armigera. Trichoplusia ni, and Spodoptera frugiperda. Antisera were raised against Autographa californica (Ac) polyhedrin and Trichoplusia ni (Tn) granulin and analyzed for homologous and heterologous immunoreactivity by immunodiffusion and radioimmunoassay (RIA). Ac polyhedrin and Tn granulin antisera recognized antigenic determinants on several baculovirus polyhedrin and granulin proteins even though the heterologous proteins had different immunoreactivities when compared by competition radioimmunoassay. Antigenic differences among granulin and polyhedrin proteins were also detected by altered slopes of the competition reaction curves. Antiserum raised against Ac polyhedrin which was purified in the presence of SDS was tested by competition RIA for its ability to detect and react with native polyhedrin produced in the infected TN-368 cells. Ac polyhedrin antiserum had similar if not identical ability to bind to native polyhedrin and to polyhedrin purified in the presence of SDS

Antigenic evaluation of a recombinant baculovirus-expressed Sarcocystis neurona SAG1 antigen.

Science.gov (United States)

Gupta, G D; Lakritz, J; Saville, W J; Livingston, R S; Dubey, J P; Middleton, J R; Marsh, A E

2004-10-01

Sarcocystis neurona is the primary parasite associated with equine protozoal myeloencephalitis (EPM). This is a commonly diagnosed neurological disorder in the Americas that infects the central nervous system of horses. Current serologic assays utilize culture-derived parasites as antigen. This method requires large numbers of parasites to be grown in culture, which is labor intensive and time consuming. Also, a culture-derived whole-parasite preparation contains conserved antigens that could cross-react with antibodies against other Sarcocystis species and members of Sarcocystidae such as Neospora spp., Hammondia spp., and Toxoplasma gondii. Therefore, there is a need to develop an improved method for the detection of S. neurona-specific antibodies. The sera of infected horses react strongly to surface antigen 1 (SnSAG1), an approximately 29-kDa protein, in immunoblot analysis, suggesting that it is an immunodominant antigen. The SnSAG1 gene of S. neurona was cloned, and recombinant S. neurona SAG1 protein (rSnSAG1-Bac) was expressed with the use of a baculovirus system. By immunoblot analysis, the rSnSAG1-Bac antigen detected antibodies to S. neurona from naturally infected and experimentally inoculated equids, cats, rabbit, mice, and skunk. This is the first report of a baculovirus-expressed recombinant S. neurona antigen being used to detect anti-S. neurona antibodies in a variety of host species.

A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines.

Science.gov (United States)

Oliveira, Virgínia Carla; Bartasson, Lorrainy; de Castro, Maria Elita Batista; Corrêa, José Raimundo; Ribeiro, Bergmann Morais; Resende, Renato Oliveira

2011-01-01

The nonstructural protein (NSs) of the Tomato spotted wilt virus (TSWV) has been identified as an RNAi suppressor in plant cells. A recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) designated vAcNSs, containing the NSs gene under the control of the viral polyhedrin (polh) gene promoter, was constructed and the effects of NSs in permissive, semipermissive and nonpermissive insect cells to vAcNSs infection were evaluated. vAcNSs produced more budded virus when compared to wild type in semipermissive cells. Co-infection of vAcNSs with wild type baculoviruses clearly enhanced polyhedra production in all host cells. Confocal microscopy analysis showed that NSs accumulated in abundance in the cytoplasm of permissive and semipermissive cells. In contrast, high amounts of NSs were detected in the nuclei of nonpermissive cells. Co-infection of vAcNSs with a recombinant AcMNPV containing the enhanced green fluorescent protein (egfp) gene, significantly increased EGFP expression in semipermissive cells and in Anticarsia gemmatalis-hemocytes. Absence of small RNA molecules of egfp transcripts in this cell line and in a permissive cell line indicates the suppression of gene silencing activity. On the other hand, vAcNSs was not able to suppress RNAi in a nonpermissive cell line. Our data showed that NSs protein of TSWV facilitates baculovirus replication in different lepidopteran cell lines, and these results indicate that NSs could play a similar role during TSWV-infection in its thrips vector. Copyright © 2010 Elsevier B.V. All rights reserved.

Characterization of A Baculovirus of Spodoptera litura (Lepidoptera : Noctuidae Isolated from Yogyakarta

Directory of Open Access Journals (Sweden)

Arman Wijonarko

2007-07-01

Full Text Available A Baculovirus has been isolated from cadaver of larvae of Spodoptera litura, a Noctuidae of agricultural pest, importance due to its wide-range hosts and the damage to their respective host. Phase contrast light microscopy observation from infected larvae showed that the fat body, hemocyte cells, and cells surrounding the trachea or tracheolus were the most tissue invaded by polyhedra. Transmission electron microscopy analysis of the occlusion body purified from diseased larva showed that the baculovirus envelope containing multiple nucleocapsid. Digestion of viral DNA with three restriction enzymes showed that the genome pattern of baculovirus isolated from Bantul were close to SpliNPV isolated from Japan and those of Spodoptera littoralis and quite distinct from those isolated from Southeast Asia region. Bioassay test performed on first to fifth instar larvae showed that the virus effectively control the young larvae, but showed some level of resistance against older larvae of Spodoptera litura.

How baculovirus polyhedra fit square pegs into round holes to robustly package viruses.

Science.gov (United States)

Ji, Xiaoyun; Sutton, Geoff; Evans, Gwyndaf; Axford, Danny; Owen, Robin; Stuart, David I

2010-01-20

Natural protein crystals (polyhedra) armour certain viruses, allowing them to survive for years under hostile conditions. We have determined the structure of polyhedra of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), revealing a highly symmetrical covalently cross-braced robust lattice, the subunits of which possess a flexible adaptor enabling this supra-molecular assembly to specifically entrap massive baculoviruses. Inter-subunit chemical switches modulate the controlled release of virus particles in the unusual high pH environment of the target insect's gut. Surprisingly, the polyhedrin subunits are more similar to picornavirus coat proteins than to the polyhedrin of cytoplasmic polyhedrosis virus (CPV). It is, therefore, remarkable that both AcMNPV and CPV polyhedra possess identical crystal lattices and crystal symmetry. This crystalline arrangement must be particularly well suited to the functional requirements of the polyhedra and has been either preserved or re-selected during evolution. The use of flexible adaptors to generate a powerful system for packaging irregular particles is characteristic of the AcMNPV polyhedrin and may provide a vehicle to sequester a wide range of objects such as biological nano-particles.

The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

Science.gov (United States)

Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

1998-03-01

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

Effect of spray drying processing parameters on the insecticidal activity of two encapsulated formulations of baculovirus

Science.gov (United States)

The aim of this work was to evaluate the effect of spray dryer processing parameters on the process yield and insecticidal activity of baculovirus to support the development of this beneficial group of microbes as biopesticides. For each of two baculoviruses [granulovirus (GV) from Pieris rapae (L....

Baculovirus PTP2 functions as a pro-apoptotic protein

NARCIS (Netherlands)

Han, Yue; Houte, van Stineke; Oers, van Monique M.; Ros, Vera I.D.

2018-01-01

The family Baculoviridae encompasses a large number of invertebrate viruses, mainly infecting caterpillars of the order Lepidoptera. The baculovirus Spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) induces physiological and behavioral changes in its host Spodoptera exigua, as well as

Baculovirus potential for agricultural pests management in Cuba

Directory of Open Access Journals (Sweden)

Jorge Luis Ayala Sifontes

2017-10-01

Full Text Available Cuba has an international reputation for implementing widespread biological control of pests, and microbial biocontrol is an integral component of most pest management programs. One class of microbial pesticides however, has not been developed in Cuba, bio-insecticides based on the Baculoviridae. This class of safe and environmentally protective microbial pesticides is used ever more commonly worldwide as an alternative to chemical pesticides. The characteristics of the viruses of this family, particularly their high host specificity, safety to non-target organisms, capacity to persist in nature and create epizootics, and the economy with which they can be produced "in vivo", all make them attractive for incorporation into pest management programs along with other pesticides developed in Cuba. The mass production technology is well understood in Cuba and biofactories already exist for a number of microbial biocontrol products. In the province of Sancti Spíritus, the Plant Protection Laboratory of the Ministry of Agriculture, with the cooperation of the Institute for Sustainable Horticulture, Kwantlen Polytechnic University, are resuming the work which began in the 90´s to develop baculovirus products in support of sustainable agriculture in Cuba. This work is being carried out with the participation of young Canadian and Cuban students and professionals. The program includes research with the multicapsid nuclear polyhedrosis viruses of Spodoptera frugiperda (SfMNPV and S. exigua (SeMNPV and the search for native isolates of Baculovirus in Plutella xylostella, three priority pests in Cuba. In other jurisdictions they are well controlled by baculoviruses, and the expectation is that this same result is possible in Cuba.

Functional role of the cytoplasmic tail domain of the major envelope fusion protein of group II baculoviruses

NARCIS (Netherlands)

Long, G.; Pan, M.; Westenberg, M.; Vlak, J.M.

2006-01-01

F proteins from baculovirus nucleopolyhedrovirus (NPV) group II members are the major budded virus (BV) viral envelope fusion proteins. They undergo furin-like proteolysis processing in order to be functional. F proteins from different baculovirus species have a long cytoplasmic tail domain (CTD),

Genetically-engineered baculovirus pesticides and their environmental safety

Science.gov (United States)

H. Alan Wood; Yu Zailin

1991-01-01

Baculoviruses such as the Lymantria dispar nuclear polyhedrosis virus (LdMNPV) are ecologically attractive alternatives to chemical insect pesticides but have a slow rate of control. To overcome this we have developed and are field testing an environmentally acceptable strategy which can be used for the introduction and expression of pesticide-...

Roles of silkworm endoplasmic reticulum chaperones in the secretion of recombinant proteins expressed by baculovirus system.

Science.gov (United States)

Imai, Saki; Kusakabe, Takahiro; Xu, Jian; Li, Zhiqing; Shirai, Shintaro; Mon, Hiroaki; Morokuma, Daisuke; Lee, Jae Man

2015-11-01

Baculovirus expression vector system (BEVS) is widely used for production of recombinant eukaryotic proteins in insect larvae or cultured cells. BEVS has advantages over bacterial expression system in producing post-translationally modified secreted proteins. However, for some unknown reason, it is very difficult for insects to secrete sufficiently for certain proteins of interest. To understand the reasons why insect cells fail to secrete some kinds of recombinant proteins, we here employed three mammalian proteins as targets, EPO, HGF, and Wnt3A, with different secretion levels in BEVS and investigated their mRNA transcriptions from the viral genome, subcellular localizations, and interactions with silkworm ER chaperones. Moreover, we observed that no significantly influence on the secretion amounts of all three proteins when depleting or overexpressing most endogenous ER chaperone genes in cultured silkworm cells. However, among all detected ER chaperones, the depletion of BiP severely decreased the recombinant protein secretion in BEVS, indicating the possible central role of Bip in silkworm secretion pathway.

The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus.

Science.gov (United States)

Shi, Yingli; Xiang, Jianhai; Zhou, Guangzhou; Ron, Tetsuzan Benny; Tong, Hsin-I; Kang, Wen; Sun, Si; Lu, Yuanan

2016-06-01

A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

Probability to produce animal vaccines in insect baculovirus ...

African Journals Online (AJOL)

The insect baculovirus expression system is a valuable tool for the production of vaccine. Many subunit vaccines have been expressed in this system. The first vaccine produced in insect cells for animal use is now in the market. In this study, we reviewed recent progress of animal's vaccine production for different expression ...

High-yield production of canine parvovirus virus-like particles in a baculovirus expression system.

Science.gov (United States)

Jin, Hongli; Xia, Xiaohong; Liu, Bing; Fu, Yu; Chen, Xianping; Wang, Huihui; Xia, Zhenqiang

2016-03-01

An optimized VP2 gene from the current prevalent CPV strain (new CPV-2a) in China was expressed in a baculovirus expression system. It was found that the VP2 proteins assembled into virus-like particles (VLPs) with antigenic properties similar to those of natural CPV and with an especially high hemagglutination (HA) titer (1:2(20)). Dogs intramuscularly or orally immunized with VLPs produced antibodies against CPV with >1:80 hemagglutination inhibition (HI) units for at least 3 months. The CPV VLPs could be considered for use as a vaccine against CPV or as a platform for research on chimeric VLP vaccines against other diseases.

Analysis of expression and glycosylation of avian metapneumovirus attachment glycoprotein from recombinant baculoviruses.

Science.gov (United States)

Luo, Lizhong; Nishi, Krista; MacLeod, Erin; Sabara, Marta I; Li, Yan

2010-11-01

Recently, we reported the expression and glycosylation of avian metapneumovirus attachment glycoprotein (AMPV/C G protein) in eukaryotic cell lines by a transient-expression method. In the present study, we investigated the biosynthesis and O-linked glycosylation of the AMPV/C G protein in a baculovirus expression system. The results showed that the insect cell-produced G protein migrated more rapidly in SDS-PAGE as compared to LLC-MK2 cell-derived G proteins owing to glycosylation differences. The fully processed, mature form of G protein migrated between 78 and 86 kDa, which is smaller than the 110 kDa mature form of G expressed in LLC-MK2 cells. In addition, several immature G gene products migrating at 40-48 and 60-70 kDa were also detected by SDS-PAGE and represented glycosylated intermediates. The addition of the antibiotic tunicamycin, which blocks early steps of glycosylation, to insect cell culture resulted in the disappearance of two glycosylated forms of the G protein and identified a 38 kDa unglycosylated precursor. The maturation of the G protein was completely blocked by monensin, suggesting that the O-linked glycosylation of G initiated in the trans-Golgi compartment. The presence of O-linked sugars on the mature protein was further confirmed by lectin Arachis hypogaea binding assay. Furthermore, antigenic features of the G protein expressed in insect cells were evaluated by ELISA. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Ultra Deep Sequencing of a Baculovirus Population Reveals Widespread Genomic Variations

Directory of Open Access Journals (Sweden)

Aurélien Chateigner

2015-07-01

Full Text Available Viruses rely on widespread genetic variation and large population size for adaptation. Large DNA virus populations are thought to harbor little variation though natural populations may be polymorphic. To measure the genetic variation present in a dsDNA virus population, we deep sequenced a natural strain of the baculovirus Autographa californica multiple nucleopolyhedrovirus. With 124,221X average genome coverage of our 133,926 bp long consensus, we could detect low frequency mutations (0.025%. K-means clustering was used to classify the mutations in four categories according to their frequency in the population. We found 60 high frequency non-synonymous mutations under balancing selection distributed in all functional classes. These mutants could alter viral adaptation dynamics, either through competitive or synergistic processes. Lastly, we developed a technique for the delimitation of large deletions in next generation sequencing data. We found that large deletions occur along the entire viral genome, with hotspots located in homologous repeat regions (hrs. Present in 25.4% of the genomes, these deletion mutants presumably require functional complementation to complete their infection cycle. They might thus have a large impact on the fitness of the baculovirus population. Altogether, we found a wide breadth of genomic variation in the baculovirus population, suggesting it has high adaptive potential.

Localization of VP28 on the baculovirus envelope and its immunogenicity against white spot syndrome virus in Penaeus monodon

International Nuclear Information System (INIS)

Syed Musthaq, S.; Madhan, Selvaraj; Sahul Hameed, A.S.; Kwang, Jimmy

2009-01-01

White spot syndrome virus (WSSV) is a large dsDNA virus responsible for white spot disease in shrimp and other crustaceans. VP28 is one of the major envelope proteins of WSSV and plays a crucial role in viral infection. In an effort to develop a vaccine against WSSV, we have constructed a recombinant baculovirus with an immediate early promoter 1 which expresses VP28 at an early stage of infection in insect cells. Baculovirus expressed rVP28 was able to maintain its structural and antigenic conformity as indicated by immunofluorescence assay and western blot analysis. Interestingly, our results with confocal microscopy revealed that rVP28 was able to localize on the plasma membrane of insect cells infected with recombinant baculovirus. In addition, we demonstrated with transmission electron microscopy that baculovirus successfully acquired rVP28 from the insect cell membrane via the budding process. Using this baculovirus displaying VP28 as a vaccine against WSSV, we observed a significantly higher survival rate of 86.3% and 73.5% of WSSV-infected shrimp at 3 and 15 days post vaccination respectively. Quantitative real-time PCR also indicated that the WSSV viral load in vaccinated shrimp was significantly reduced at 7 days post challenge. Furthermore, our RT-PCR and immunohistochemistry results demonstrated that the recombinant baculovirus was able to express VP28 in vivo in shrimp tissues. This study will be of considerable significance in elucidating the morphogenesis of WSSV and will pave the way for new generation vaccines against WSSV.

Arbovirus vaccines: opportunities for the baculovirus-insect cell expression system

NARCIS (Netherlands)

Metz, S.W.H.; Pijlman, G.P.

2011-01-01

The baculovirus-insect cell expression system is a well-established technology for the production of heterologous viral (glyco)proteins in cultured cells, applicable for basic scientific research as well as for the development and production of vaccines and diagnostics. Arboviruses form an emerging

The spread of bla OXA-48 and bla OXA-244 carbapenemase genes among Klebsiella pneumoniae, Proteus mirabilis and Enterobacter spp. isolated in Moscow, Russia.

Science.gov (United States)

Fursova, Nadezhda K; Astashkin, Eugeny I; Knyazeva, Anastasia I; Kartsev, Nikolay N; Leonova, Ekaterina S; Ershova, Olga N; Alexandrova, Irina A; Kurdyumova, Natalia V; Sazikina, Svetlana Yu; Volozhantsev, Nikolay V; Svetoch, Edward A; Dyatlov, Ivan A

2015-11-02

The spread of carbapenemase-producing Enterobacteriaceae (CPE) is a great problem of healthcare worldwide. Study of the spread for bla OXA-48-like genes coding epidemically significant carbapenemases among hospital pathogens is important for the regional and global epidemiology of antimicrobial resistance. Antibacterial resistant isolates of Klebsiella pneumoniae (n = 95) from 54 patients, P. mirabilis (n = 32) from 20 patients, Enterobacter aerogenes (n = 6) from four patients, and Enterobacter cloacae (n = 4) from four patients were collected from January, 2013 to October, 2014 in neurosurgical intensive care unit (ICU) of the Burdenko Neurosurgery Institute, Moscow. Characteristics of the isolates were done using susceptibility tests, PCR detection of the resistance genes, genotyping, conjugation, DNA sequencing, and bioinformatic analysis. Major strains under study were multi drug resistant (MDR), resistant to three or more functional classes of drugs simultaneously-98.9 % K. pneumoniae, 100 % P. mirabilis, one E. aerogenes isolate, and one E. cloacae isolate. Molecular-genetic mechanism of MDR in K. pneumoniae and P. mirabilis isolates were based on carrying of epidemic extended-spectrum beta-lactamase bla CTX-M-15 gene (87.2 and 90.6 % accordingly), carbapenemase bla OXA-48-like gene (55.3 and 23.3 % accordingly), and class 1 (54.8 and 31.3 % accordingly) and class 2 (90.6 % P. mirabilis) integrons. The bla OXA-48-like-positive K. pneumoniae were collected during whole two-year surveillance period, while P. mirabilis and Enterobacter spp. carrying bla OXA-48-like genes were detected only after four and 18 months after the research start, respectively. The bla OXA-48-like gene acquisition was shown for P. mirabilis isolates collected from five patients and for E. cloacae isolate collected from one patient during their stay in the ICU, presumably from bla OXA-48-like-positive K. pneumoniae. The source of the bla OXA-244 gene acquired by E

Vaccines for viral and parasitic diseases produced with baculovirus vectors

NARCIS (Netherlands)

Oers, van M.M.

2006-01-01

The baculovirus¿insect cell expression system is an approved system for the production of viral antigens with vaccine potential for humans and animals and has been used for production of subunit vaccines against parasitic diseases as well. Many candidate subunit vaccines have been expressed in this

Structure and function of the AAA+ ATPase p97/Cdc48p.

Science.gov (United States)

Xia, Di; Tang, Wai Kwan; Ye, Yihong

2016-05-25

p97 (also known as valosin-containing protein (VCP) in mammals or Cdc48p in Saccharomyces cerevisiae) is an evolutionarily conserved ATPase present in all eukaryotes and archaebacteria. In conjunction with a collection of cofactors and adaptors, p97/Cdc48p performs an array of biological functions mostly through modulating the stability of 'client' proteins. Using energy from ATP hydrolysis, p97/Cdc48p segregates these molecules from immobile cellular structures such as protein assemblies, membrane organelles, and chromatin. Consequently, the released polypeptides can be efficiently degraded by the ubiquitin proteasome system or recycled. This review summarizes our current understanding of the structure and function of this essential cellular chaperoning system. Published by Elsevier B.V.

Recombinant, catalytically inactive juvenile hormone esterase enhances efficacy of baculovirus insecticides

NARCIS (Netherlands)

Meer, van M.M.M.; Bonning, B.C.; Ward, V.K.; Vlak, J.M.; Hammock, B.D.

2000-01-01

The insecticidal efficacy of baculoviruses can be enhanced by engineering the viral genome to express proteins that disrupt the physiology of the host insect. Here we describe the development of a genetically engineered Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) which expresses

Maximum Gene-Support Tree

Directory of Open Access Journals (Sweden)

Yunfeng Shan

2008-01-01

Full Text Available Genomes and genes diversify during evolution; however, it is unclear to what extent genes still retain the relationship among species. Model species for molecular phylogenetic studies include yeasts and viruses whose genomes were sequenced as well as plants that have the fossil-supported true phylogenetic trees available. In this study, we generated single gene trees of seven yeast species as well as single gene trees of nine baculovirus species using all the orthologous genes among the species compared. Homologous genes among seven known plants were used for validation of the finding. Four algorithms—maximum parsimony (MP, minimum evolution (ME, maximum likelihood (ML, and neighbor-joining (NJ—were used. Trees were reconstructed before and after weighting the DNA and protein sequence lengths among genes. Rarely a gene can always generate the “true tree” by all the four algorithms. However, the most frequent gene tree, termed “maximum gene-support tree” (MGS tree, or WMGS tree for the weighted one, in yeasts, baculoviruses, or plants was consistently found to be the “true tree” among the species. The results provide insights into the overall degree of divergence of orthologous genes of the genomes analyzed and suggest the following: 1 The true tree relationship among the species studied is still maintained by the largest group of orthologous genes; 2 There are usually more orthologous genes with higher similarities between genetically closer species than between genetically more distant ones; and 3 The maximum gene-support tree reflects the phylogenetic relationship among species in comparison.

New baculovirus recombinants expressing Pseudorabies virus (PRV) glycoproteins protect mice against lethal challenge infection.

Science.gov (United States)

Grabowska, Agnieszka K; Lipińska, Andrea D; Rohde, Jörg; Szewczyk, Boguslaw; Bienkowska-Szewczyk, Krystyna; Rziha, Hanns-Joachim

2009-06-02

The present study demonstrates the protective potential of novel baculovirus recombinants, which express the glycoproteins gB, gC, or gD of Pseudorabies virus (PRV; Alphaherpesvirus of swine) and additionally contain the glycoprotein G of Vesicular Stomatitis Virus (VSV-G) in the virion (Bac-G-PRV). To evaluate the protective capacity, mixtures of equal amounts of the PRV gB-, gC-, and gD-expressing baculoviruses were used for immunization. Three intramuscular immunizations with that Bac-G-PRV mixture could protect mice against a lethal PRV challenge infection. To achieve complete protection high titers of Bac-G-PRV and three immunizations were necessary. This immunization with Bac-G-PRV resulted in the induction of high titers of PRV-specific serum antibodies of the IgG2a subclass and of interferon (IFN)-gamma, indicating a Th1-type immune response. Moreover, splenocytes of immunized mice exhibited natural killer cell activity accompanied by the production of IFN-alpha and IFN-gamma. Collectively, the presented data demonstrate for the first time that co-expression of VSV-G in baculovirus recombinant vaccines can improve the induction of a protective immune response against foreign antigens.

Pemanfaatan Antibodi Monoklonal dalam Immunoassay untuk Deteksi Baculovirus oryctes

Directory of Open Access Journals (Sweden)

Susamto Somowiyarjo

2000-12-01

Full Text Available The application of non-precoated Indirect Enzyme-Linked Immunosorbent Assay (ELISA and Dot Immunobinding Assay (DIBA employing monoclonal antibodies (MCA against Yogyakarta isolate of Baculovirus oryctes Huger. was described. The MCA-Bv-4 having subclass of IgG2a and titer in vitro of 10^4 - 10^5 proved to be useful antibody for virus detection. The great potential of I-ELISA using MCA-Bv-4 has been it's specificity being able to discriminate between healthy an virus-infected coconut beetle (Oryctes rhinoceros L.. The assay could also differentiate between B. oryctes and Monodon baculovirus, the pathogen of shrimp disease. The best tissue for preparing virus antigen from crude extract was found to be the midgut of the beetle. Head, thorax, abdomen and tibia were not suitable for preparing the test antigen. The crude extract of beetle showed high endogenous enzyme activity to the substrate of DIBA, which precluded the detection of B. oryctes using DIBA. The MCA-Bv-4 could be used to improve the monitoring of the virus to support the program of biological control of coconut beetle using B. oryctes.

Vaccination with Recombinant Baculovirus Expressing Ranavirus Major Capsid Protein Induces Protective Immunity in Chinese Giant Salamander, Andrias davidianus

Directory of Open Access Journals (Sweden)

Xiaoyuan Zhou

2017-07-01

Full Text Available The Chinese giant salamander iridovirus (CGSIV, belonging to the genus Ranavirus in the family Iridoviridae, is the causative agent of an emerging infectious disease causing high mortality of more than 90% and economic losses in Chinese giant salamanders in China. In this study, a recombinant baculovirus-based vaccine expressing the CGSIV major capsid protein (MCP was developed and its protective immunity in Chinese giant salamanders was evaluated. The recombinant Autographa californica nucleopolyhedrosis virus (AcNPV, expressing CGSIV MCP, designated as AcNPV-MCP, was generated with the highest titers of 1 × 108 plaque forming units/mL (PFU/mL and confirmed by Western blot and indirect immunofluorescence (IIF assays. Western blot analysis revealed that the expressed MCP reacted with mouse anti-MCP monoclonal antibodies at the band of about 53 kDa. The results of IIF indicated that the MCP was expressed in the infected Spodoptera frugiperda 9 (Sf9 cells with the recombinant baculovirus, and the Chinese giant salamander muscle cells also transduced with the AcNPV-MCP. Immunization with the recombinant baculovirus of AcNPV-MCP elicited robust specific humoral immune responses detected by ELISA and neutralization assays and potent cellular immune responses in Chinese giant salamanders. Importantly, the effective immunization conferred highly protective immunity for Chinese giant salamanders against CGSIV challenge and produced a relative percent of survival rate of 84%. Thus, the recombinant baculovirus expressing CGSIV MCP can induce significant immune responses involving both humoral and cell-mediated immunity in Chinese giant salamanders and might represent a potential baculovirus based vaccine candidate for Chinese giant salamanders against CGSIV.

Isospin excitation of nucleus in 42,44,48Ca (p,n)42,44,48Sc

International Nuclear Information System (INIS)

Suzuki, Keiji

2002-01-01

To obtain information of (p,n) reaction of heavy nucleus in 100 MeV or less, 42,44,48 Ca(p,n) 42,44,48 Sc was observed on the Cyclotron Radio Isotope Center in Tohoku University. The experimental results showed that 7, 8 and 10 spin parities were determined for 42 Sc, 44 Sc and 48 SC, respectively. It was the first determination of one and two negative parity transition of 42 Sc and 48 Sc,respectively, by (p,n) reaction. The full space wave function made by 0f1p shell effective interaction by Richter,et al is good accuracy and reliability. On the (p,n) reaction at E p =35 MeV, the transition matrix elements of 42 Ca, 44 Ca and 48 Ca were derived. On the experiment of 42 Ca(p,n) 42 Sc at E p 2 on energy was agreed with the calculation results by Franey and Love. The nuclear structure of 42 Ca was thought to show more stronger U(4) symmetry, because strong GT transition at T=1 was not observed, which was expected by j-j bonding shell model calculation. (S.Y.)

Genomic sequence, organization and characteristics of a new nucleopolyhedrovirus isolated from Clanis bilineata larva

Directory of Open Access Journals (Sweden)

Wang Yong

2009-02-01

Full Text Available Abstract Background Baculoviruses are well known for their potential as biological agents for controlling agricultural and forest pests. They are also widely used as expression vectors in molecular cloning studies. The genome sequences of 48 baculoviruses are currently available in NCBI databases. As the number of sequenced viral genomes increases, it is important for the authors to present sufficiently detailed analyses and annotations to advance understanding of them. In this study, the complete genome of Clanis bilineata nucleopolyhedrovirus (ClbiNPV has been sequenced and analyzed in order to understand this virus better. Results The genome of ClbiNPV contains 135,454 base pairs (bp with a G+C content of 37%, and 139 putative open reading frames (ORFs of at least 150 nucleotides. One hundred and twenty-six of these ORFs have homologues with other baculovirus genes while the other 13 are unique to ClbiNPV. The 30 baculovirus core genes are all present in ClbiNPV. Phylogenetic analysis based on the combined pif-2 and lef-8 sequences places ClbiNPV in the Group II Alphabaculoviruses. This result is consistent with the absence of gp64 from the ClbiNPV genome and the presence instead of a fusion protein gene, characteristic of Group II. Blast searches revealed that ClbiNPV encodes a photolyase-like gene sequence, which has a 1-bp deletion when compared with photolyases of other baculoviruses. This deletion disrupts the sequence into two small photolyase ORFs, designated Clbiphr-1 and Clbiphr-2, which correspond to the CPD-DNA photolyase and FAD-binding domains of photolyases, respectively. Conclusion ClbiNPV belongs to the Group II Alphabaculoviruses and is most closely related to OrleNPV, LdMNPV, TnSNPV, EcobNPV and ChchNPV. It contains a variant DNA photolyase gene, which only exists in ChchNPV, TnSNPV and SpltGV among the baculoviruses.

Meiotic and pedigree segregation analyses in carriers of t(4;8)(p16;p23.1) differing in localization of breakpoint positions at 4p subband 4p16.3 and 4p16.1.

Science.gov (United States)

Midro, Alina T; Zollino, Marcella; Wiland, Ewa; Panasiuk, Barbara; Iwanowski, Piotr S; Murdolo, Marina; Śmigiel, Robert; Sąsiadek, Maria; Pilch, Jacek; Kurpisz, Maciej

2016-02-01

The purpose of this study was to compare meiotic segregation in sperm cells from two carriers with t(4;8)(p16;p23.1) reciprocal chromosome translocations (RCTs), differing in localization of the breakpoint positions at the 4p subband-namely, 4p16.3 (carrier 1) and 4p16.1 (carrier 2)-and to compare data of the pedigree analyses performed by direct method. Three-color fluorescent in situ hybridization (FISH) on sperm cells and FISH mapping for the evaluation of the breakpoint positions, data from pedigrees, and direct segregation analysis of the pedigrees were performed. Similar proportions of normal/balanced and unbalanced sperm cells were found in both carriers. The most common was an alternate type of segregation (about 52 % and about 48 %, respectively). Unbalanced adjacent I and adjacent II karyotypes were found in similar proportions about 15 %. The direct segregation analysis (following Stengel-Rutkowski) of the pedigree of carriers of t(4;8)(p16.1;p23.1) was performed and results were compared with the data of the pedigree segregation analysis obtained earlier through the indirect method. The probability of live-born progeny with unbalanced karyotype for carriers of t(4;8)(p16.1;p23.1) was moderately high at 18.8 %-comparable to the value obtained using the indirect method for the same carriership, which was 12 %. This was, however, markedly lower than the value of 41.2 % obtained through the pedigree segregation indirect analysis estimated for carriers of t(4;8)(p16.3;p23.1), perhaps due to the unique composition of genes present within the 4p16.1-4p 16.3 region. Revealed differences in pedigree segregation analysis did not correspond to the very similar profile of meiotic segregation patterns presented by carrier 1 and carrier 2. Most probably, such discordances may be due to differences in embryo survival rates arising from different genetic backgrounds.

Expression of the human multidrug transporter in insect cells by a recombinant baculovirus

International Nuclear Information System (INIS)

Germann, U.A.; Willingham, M.C.; Pastan, I.; Gottesman, M.M.

1990-01-01

The plasma membrane associated human multidrug resistance (MDR1) gene product, known as the 170-kDa P-glycoprotein or the multidrug transporter, acts as an ATP-dependent efflux pump for various cytotoxic agents. The authors expressed recombinant human multidrug transporter in a baculovirus expression system to obtain large quantities and further investigate its structure and mechanism of action. MDR1 cDNA was inserted into the genome of the Autographa californica nuclear polyhedrosis virus under the control of the polyhedrin promoter. Spodoptera frugiperda insect cells synthesized high levels of recombinant multidrug transporter 2-3 days after infection. The transporter was localized by immunocytochemical methods on the external surface of the plasma membranes, in the Golgi apparatus, and within the nuclear envelope. The human multidrug transporter expressed in insect cells is not susceptible to endoglycosidase F treatment and has a lower apparent molecular weight of 140,000, corresponding to the nonglycosylated precursor of its authentic counterpart expressed in multidrug-resistant cells. Labeling experiments showed that the recombinant multidrug transporter is phosphorylated and can be photoaffinity labeled by [ 3 H]azidopine, presumably at the same two sites as the native protein. Various drugs and reversing agents compete with the [ 3 H]azidopine binding reaction when added in excess, indicating that the recombinant human multidrug transporter expressed in insect cells is functionally similar to its authentic counterpart

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

Science.gov (United States)

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

Science.gov (United States)

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

Proteomics computational analyses suggest that baculovirus GP64 superfamily proteins are class III penetrenes

Directory of Open Access Journals (Sweden)

Garry Robert F

2008-02-01

Full Text Available Abstract Background Members of the Baculoviridae encode two types of proteins that mediate virus:cell membrane fusion and penetration into the host cell. Alignments of primary amino acid sequences indicate that baculovirus fusion proteins of group I nucleopolyhedroviruses (NPV form the GP64 superfamily. The structure of these viral penetrenes has not been determined. The GP64 superfamily includes the glycoprotein (GP encoded by members of the Thogotovirus genus of the Orthomyxoviridae. The entry proteins of other baculoviruses, group II NPV and granuloviruses, are class I penetrenes. Results Class III penetrenes encoded by members of the Rhabdoviridae and Herpesviridae have an internal fusion domain comprised of beta sheets, other beta sheet domains, an extended alpha helical domain, a membrane proximal stem domain and a carboxyl terminal anchor. Similar sequences and structural/functional motifs that characterize class III penetrenes are located collinearly in GP64 of group I baculoviruses and related glycoproteins encoded by thogotoviruses. Structural models based on a prototypic class III penetrene, vesicular stomatitis virus glycoprotein (VSV G, were established for Thogoto virus (THOV GP and Autographa california multiple NPV (AcMNPV GP64 demonstrating feasible cysteine linkages. Glycosylation sites in THOV GP and AcMNPV GP64 appear in similar model locations to the two glycosylation sites of VSV G. Conclusion These results suggest that proteins in the GP64 superfamily are class III penetrenes.

Characterization of a heavy metal translocating P-type ATPase gene from an environmental heavy metal resistance Enterobacter sp. isolate.

Science.gov (United States)

Chien, Chih-Ching; Huang, Chia-Hsuan; Lin, Yi-Wei

2013-03-01

Heavy metals are common contaminants found in polluted areas. We have identified a heavy metal translocating P-type ATPase gene (hmtp) via fosmid library and in vitro transposon mutagenesis from an Enterobacter sp. isolate. This gene is believed to participate in the bacterium's heavy metal resistance traits. The complete gene was identified, cloned, and expressed in a suitable Escherichia coli host cell. E. coli W3110, RW3110 (zntA::Km), GG48 (ΔzitB::Cm zntA::Km), and GG51 (ΔzitB::Cm) were used to study the possible effects of this gene for heavy metal (cadmium and zinc in particular) resistance. Among the E. coli strains tested, RW3110 and GG48 showed more sensitivity to cadmium and zinc compared to the wild-type E. coli W3110 and strain GG51. Therefore, strains RW3110 and GG48 were chosen for the reference hosts for further evaluation of the gene's effect. The results showed that expression of this heavy metal translocating P-type ATPase gene could increase the ability for zinc and cadmium resistance in the tested microorganisms.

The baculovirus core gene ac83 is required for nucleocapsid assembly and per os infectivity of Autographa californica nucleopolyhedrovirus.

Science.gov (United States)

Zhu, Shimao; Wang, Wei; Wang, Yan; Yuan, Meijin; Yang, Kai

2013-10-01

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) ac83 is a baculovirus core gene whose function in the AcMNPV life cycle is unknown. In the present study, an ac83-knockout AcMNPV (vAc83KO) was constructed to investigate the function of ac83 through homologous recombination in Escherichia coli. No budded virions were produced in vAc83KO-transfected Sf9 cells, although viral DNA replication was unaffected. Electron microscopy revealed that nucleocapsid assembly was aborted due to the ac83 deletion. Domain-mapping studies revealed that the expression of Ac83 amino acid residues 451 to 600 partially rescued the ability of AcMNPV to produce infectious budded virions. Bioassays indicated that deletion of the chitin-binding domain of Ac83 resulted in the failure of oral infection of Trichoplusia ni larvae by AcMNPV, but AcMNPV remained infectious following intrahemocoelic injection, suggesting that the domain is involved in the binding of occlusion-derived virions to the peritrophic membrane and/or to other chitin-containing insect tissues. It has been demonstrated that Ac83 is the only component with a chitin-binding domain in the per os infectivity factor complex on the occlusion-derived virion envelope. Interestingly, a functional inner nuclear membrane sorting motif, which may facilitate the localization of Ac83 to the envelopes of occlusion-derived virions, was identified by immunofluorescence analysis. Taken together, these results demonstrate that Ac83 plays an important role in nucleocapsid assembly and the establishment of oral infection.

In vivo production of recombinant proteins using occluded recombinant AcMNPV-derived baculovirus vectors.

Science.gov (United States)

Guijarro-Pardo, Eva; Gómez-Sebastián, Silvia; Escribano, José M

2017-12-01

Trichoplusia ni insect larvae infected with vectors derived from the Autographa californica multiple nucleopolyhedrovirus (AcMNPV), are an excellent alternative to insect cells cultured in conventional bioreactors to produce recombinant proteins because productivity and cost-efficiency reasons. However, there is still a lot of work to do to reduce the manual procedures commonly required in this production platform that limit its scalability. To increase the scalability of this platform technology, a current bottleneck to be circumvented in the future is the need of injection for the inoculation of larvae with polyhedrin negative baculovirus vectors (Polh-) because of the lack of oral infectivity of these viruses, which are commonly used for production in insect cell cultures. In this work we have developed a straightforward alternative to obtain orally infective vectors derived from AcMNPV and expressing recombinant proteins that can be administered to the insect larvae (Trichoplusia ni) by feeding, formulated in the insect diet. The approach developed was based on the use of a recombinant polyhedrin protein expressed by a recombinant vector (Polh+), able to co-occlude any recombinant Polh- baculovirus vector expressing a recombinant protein. A second alternative was developed by the generation of a dual vector co-expressing the recombinant polyhedrin protein and the foreign gene of interest to obtain the occluded viruses. Additionally, by the incorporation of a reporter gene into the helper Polh+ vector, it was possible the follow-up visualization of the co-occluded viruses infection in insect larvae and will help to homogenize infection conditions. By using these methodologies, the production of recombinant proteins in per os infected larvae, without manual infection procedures, was very similar in yield to that obtained by manual injection of recombinant Polh- AcMNPV-based vectors expressing the same proteins. However, further analyses will be required for a

Expression of tomato yellow leaf curl virus coat protein using baculovirus expression system and evaluation of its utility as a viral antigen.

Science.gov (United States)

Elgaied, Lamiaa; Salem, Reda; Elmenofy, Wael

2017-08-01

DNA encoding the coat protein (CP) of an Egyptian isolate of tomato yellow leaf curl virus (TYLCV) was inserted into the genome of Autographa californica nucleopolyhedrovirus (AcNPV) under the control of polyhedrin promoter. The generated recombinant baculovirus construct harboring the coat protein gene was characterized using PCR analysis. The recombinant coat protein expressed in infected insect cells was used as a coating antigen in an indirect Enzyme-linked immunosorbent assay (ELISA) and dot blot to test its utility for the detection of antibody generated against TYLCV virus particles. The results of ELISA and dot blot showed that the TYLCV-antibodies reacted positively with extracts of infected cells using the recombinant virus as a coating antigen with strong signals as well as the TYLCV infected tomato and beat plant extracts as positive samples. Scanning electron microscope examination showed that the expressed TYLCV coat protein was self-assembled into virus-like particles (VLPs) similar in size and morphology to TYLCV virus particles. These results concluded that, the expressed coat protein of TYLCV using baculovirus vector system is a reliable candidate for generation of anti-CP antibody for inexpensive detection of TYLCV-infected plants using indirect CP-ELISA or dot blot with high specificity.

Analysis of the promoters involved in enterocin AS-48 expression.

Science.gov (United States)

Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel

2014-01-01

The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

Analysis of the promoters involved in enterocin AS-48 expression.

Directory of Open Access Journals (Sweden)

Rubén Cebrián

Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

A Gene for an Extended Phenotype

Science.gov (United States)

K. Hoover; M. Grove; M. Gardner; D. P. Hughes; J. McNeil; J. Slavicek

2011-01-01

Manipulation of host behavior by parasites and pathogens has been widely observed, but the basis for these behaviors has remained elusive. Gypsy moths infected by a baculovirus climb to the top of trees to die, liquefy, and "rain" virus on the foliage below to infect new hosts. The viral gene that manipulates climbing behavior of the host was identified,...

Contributions of immune responses to developmental resistance in Lymantria dispar challenged with baculovirus

Science.gov (United States)

James McNeil; Diana Cox-Foster; James Slavicek; Kelli. Hoover

2010-01-01

How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...

Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

International Nuclear Information System (INIS)

Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

2005-01-01

Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

Aberrant Methylation of Preproenkephalin and p16 Genes in Pancreatic Intraepithelial Neoplasia and Pancreatic Ductal Adenocarcinoma

OpenAIRE

Fukushima, Noriyoshi; Sato, Norihiro; Ueki, Takashi; Rosty, Christophe; Walter, Kimberly M.; Wilentz, Robb E.; Yeo, Charles J.; Hruban, Ralph H.; Goggins, Michael

2002-01-01

Pancreatic intraductal neoplasia (PanIN) is thought to be the precursor to infiltrating pancreatic ductal adenocarcinoma. We have previously shown that the preproenkephalin (ppENK) and p16 genes are aberrantly methylated in pancreatic adenocarcinoma. In this study we define the methylation status of the ppENK and p16 genes in various grades of PanINs. One hundred seventy-four samples (28 nonneoplastic pancreatic epithelia, 7 reactive epithelia, 29 PanIN-1A, 48 PanIN-1B, 27 PanIN-2, 14 PanIN-3...

Alterations in the K-ras and p53 genes in rat lung tumors

Energy Technology Data Exchange (ETDEWEB)

Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

1997-06-01

Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

[Use of the recombinant baculovirus BacVP6C for the construction of an internal positive control of rotavirus C].

Science.gov (United States)

Abid-Ayadi, I; Guix, S; Pintó, R M; Bosch, A

2011-06-01

Unlike group A, a few studies have interested other groups of the rotavirus, especially in Tunisia. The role of rotavirus C (RVC) infection is underestimated because of its sporadic nature. The aim of our study was to develop rapid diagnostic procedures of RVC by using an internal positive control of reverse transcription PCR (RT-PCR). The internal positive control (386pb) was designed from the recombinant baculovirus BacVP6C containing the full length cDNA of the Cowden strain gene 5 (1353pb). A fragment of 596pb was amplified by PCR using the BacVP6C DNA ds as template. Then, a central part of 210pb was deleted and the remaining fragment (386pb) was cloned into pGEM-3Zf(+) plasmid between SP6 and T7 RNA polymerase promoters. The obtained recombinant plasmid "pIAM1" was then used for the generation of the internal positive control by in vitro transcription. The sensibility of the RT-PCR was about 3.66×10(5) molecules of RNA/μl. The use of a shorter positive control, as compared to the wild type, allows increased specificity of the RT-PCR reaction, and could be used for efficient diagnostic and surveillance of RVC-caused diseases. Copyright © 2009 Elsevier Masson SAS. All rights reserved.

Diversity of bacteria and glycosyl hydrolase family 48 genes in cellulolytic consortia enriched from thermophilic biocompost.

Science.gov (United States)

Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R

2010-06-01

The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.

Modelling biological control with wild-type and genetically modified baculoviruses in the Helicoverpa armigera-cotton system

NARCIS (Netherlands)

Sun, X.; Werf, van der W.; Bianchi, F.J.J.A.; Hu, Z.; Vlak, J.M.

2006-01-01

A comprehensive model was developed to simulate virus epizootics in a stage structured insect population and analyse scenarios for the biological control of cotton bollworm (CBW), Helicoverpa armigera, in cotton, using wild-type or genetically modified baculoviruses. In simulations on dosage and

A Herpes Simplex Virus Type 1 Mutant Expressing a Baculovirus Inhibitor of Apoptosis Gene in Place of Latency-Associated Transcript Has a Wild-Type Reactivation Phenotype in the Mouse

Science.gov (United States)

Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.

2005-01-01

The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155

Molecular biology of baculovirus and its use in biological control in Brazil Biologia molecular de baculovírus e seu uso no controle biológico de pragas no Brasil

Directory of Open Access Journals (Sweden)

Maria Elita Batista de Castro

1999-10-01

Full Text Available Baculoviruses are insect viruses found mainly in Lepidoptera. The family Baculoviridae is taxonomically divided in two genera, Nucleopolyhedrovirus and Granulovirus, which differ by occlusion body morphology. NPVs (Nucleopolyhedroviruses have polyhedrical inclusion bodies (PIBs containing multiple viral particles, while GVs (Granuloviruses appear to be generally single particles occluded in oval shaped occlusion bodies. During the life cycle, two different viral progenies are produced: BV (Budded Virus and PDV (Polyhedra Derived Virus, which are essential for the infectious process and virus propagation in host cells. Baculoviruses are being used for pest control and they are especially safe due to their specificity and invertebrate-restricted host range. Baculoviruses have been used as vectors for high level protein expression ofheterologous genes from prokaryotic and eukaryotic organisms. Also, recombinant DNA techniques have allowed the production of genetically modified viral insecticides. This study is a review on the taxonomy, structure, replication and molecular biology of baculoviruses, as well as their use as bioinsecticides in Brazil.Os baculovírus são vírus patogênicos a insetos, encontrados principalmente na ordem Lepidoptera. A família Baculoviridae é taxonomicamente dividida em dois gêneros: Nucleopolyhedrovirus e Granulovirus, que diferem pela morfologia do corpo de oclusão. Os nucleopoliedrovírus (NPV possuem corpos de inclusão poliédrica (PIB, contendo múltiplas partículas virais, enquanto os granulovírus (GV contêm, em geral, partículas únicas, ocluídas em corpos protéicos de forma ovóide. Durante o ciclo de vida são produzidos dois tipos de progênies virais: BV ("Budded Virus" e PDV ("Polyhedra Derived Virus", que são essenciais para o processo de infecção e propagação do vírus. Os baculovírus têm sido empregados no controle de pragas e, por serem específicos e restritos a invertebrados, s

Developing baculovirus-insect cell expression systems for humanized recombinant glycoprotein production

International Nuclear Information System (INIS)

Jarvis, Donald L.

2003-01-01

The baculovirus-insect cell expression system is widely used to produce recombinant glycoproteins for many different biomedical applications. However, due to the fundamental nature of insect glycoprotein processing pathways, this system is typically unable to produce recombinant mammalian glycoproteins with authentic oligosaccharide side chains. This minireview summarizes our current understanding of insect protein glycosylation pathways and our recent efforts to address this problem. These efforts have yielded new insect cell lines and baculoviral vectors that can produce recombinant glycoproteins with humanized oligosaccharide side chains

Comparative effects of DHEA and DHT on gene expression in human LNCaP prostate cancer cells.

Science.gov (United States)

Steele, Vernon E; Arnold, Julia T; Lei, Hanh; Izmirlian, Grant; Blackman, Marc R

2006-01-01

DHEA is widely used as a dietary supplement in older men. Because DHEA can be converted to androgens or estrogens, such use may promote prostate cancer. In this study, the effects of DHEA were compared with those of DHT using gene expression array profiles in human LNCaP prostate cancer cells. LNCaP cells were exposed to DHEA (300 nM), DHT (300 nM), or vehicle for 48 h, and mRNA expression was measured using Affymetrix HU-95 gene chips. Gene expression values were sorted in ascending order on the p-values corresponding to the extent of differential RNA expression between control and either hormone treatment. S100 calcium binding protein, neurotensin, 24-dehydrocholesterol reductase, and anterior-gradient 2 homologue were the four most differentially expressed genes (p-values all DHT treatment (p DHT were used for pathway analysis. DHT decreased expression of more genes involved in intercellular communication, signal transduction, nucleic acid binding and transport, and in structural components, such as myosin and golgin, than DHEA. These data revealed consistent, measurable changes in gene expression patterns following treatment of LNCaP prostate cancer cells with DHEA and DHT. Understanding the mechanisms of DHEA versus DHT actions in the prostate may help clarify the separate and interactive effects of androgenic and estrogenic actions in prostate cancer progression.

Development of an influenza virus vaccine using the baculovirus-insect cell expression system : implications for pandemic preparedness

NARCIS (Netherlands)

Cox, M.M.J.

2009-01-01

Key word

Influenza, rHA, vaccine, baculovirus, insect cells, production, pandemic preparedness

Influenza (or flu) is a highly contagious, acute viral respiratory disease that occurs seasonally in most parts of the world and is caused by influenza viruses. Influenza

Incorporation of adenylate cyclase into membranes of giant liposomes using membrane fusion with recombinant baculovirus-budded virus particles.

Science.gov (United States)

Mori, Takaaki; Kamiya, Koki; Tomita, Masahiro; Yoshimura, Tetsuro; Tsumoto, Kanta

2014-06-01

Recombinant transmembrane adenylate cyclase (AC) was incorporated into membranes of giant liposomes using membrane fusion between liposomes and baculovirus-budded virus (BV). AC genes were constructed into transfer vectors in a form fused with fluorescent protein or polyhistidine at the C-terminus. The recombinant BVs were collected by ultracentrifugation and AC expression was verified using western blotting. The BVs and giant liposomes generated using gentle hydration were fused under acidic conditions; the incorporation of AC into giant liposomes was demonstrated by confocal laser scanning microscopy through the emission of fluorescence from their membranes. The AC-expressing BVs were also fused with liposomes containing the substrate (ATP) with/without a specific inhibitor (SQ 22536). An enzyme immunoassay on extracts of the sample demonstrated that cAMP was produced inside the liposomes. This procedure facilitates direct introduction of large transmembrane proteins into artificial membranes without solubilization.

Feasibility of a novel positive feedback effect of 131I-promoted Bac-Egr1-hNIS expression in malignant glioma via baculovirus

International Nuclear Information System (INIS)

Guo Rui; Tian Lipeng; Han Bing; Xu Haoping; Zhang Miao; Li Biao

2011-01-01

Purpose: As intracellular iodine is released rapidly, increased expression of sodium/iodide symporter (NIS) is required for effective radioiodine treatment of tumor. As Egr1 promoter is activated by 131 I and may promote human NIS (hNIS) expression, hNIS also induces 131 I uptake and activates Egr1, so the existence of a positive feedback effect of 131 I-promoted Egr1-hNIS expression is possible. Our purpose was to investigate the possible existence of this positive feedback effect through a series of in vitro pioneer studies. Method: Recombinant baculovirus (Bac-Egr1-hNIS) encoding the hNIS gene under the control of a radiation-inducible Egrl promoter was constructed. To test 131 I-promoted hNIS expression, human malignant glioma U87 cells were transfected with Bac-Egr1-hNIS, stimulated with or without 131 I; the expression of hNIS protein was detected by immunofluorescence and flow cytometry test. In addition, the uptake and efflux of 131 I were determined after the incubation of Bac-Egr1-hNIS-transfected U87 cells with or without 131 I. Results: Immunocytochemical staining and flow cytometry test showed a higher hNIS protein expression in Bac-Egr1-hNIS-transfected U87 cells with 131 I stimulation than in cells without stimulation. Bac-Egr1-hNIS-transfected U87 cells accumulated up to about 4.05 times of 131 I after 131 I stimulation. The amount of 131 I uptake in both groups showed a baculovirus dose-dependent manner. However, rapid efflux of radioactivity was observed in both groups, with 50% lost during the first 2 min after the 131 I-containing medium had been replaced by a nonradioactive medium. Conclusion: Our results indicated that an improved transgene expression of 131 I-stimulated hNIS in U87 cells using a baculovirus vector containing the Egr1 promoter is possible, and the increased expression of hNIS is responsible for a higher 131 I uptake. It might provide a reference for the existence of a positive feedback effect in 131 I-promoted Bac-Egr1-h

Behaviour of wild-type and genetically modified baculoviruses in the Helicoverpa armigera - cotton system: a simulation approach

NARCIS (Netherlands)

Sun, X.

2005-01-01

Keywords:   Helicoverpa armigera , baculovirus, genetic modification, cotton,transmission

Characterization of an Sf-rhabdovirus-negative Spodoptera frugiperda cell line as an alternative host for recombinant protein production in the baculovirus-insect cell system.

Science.gov (United States)

Maghodia, Ajay B; Geisler, Christoph; Jarvis, Donald L

2016-06-01

Cell lines derived from the fall armyworm, Spodoptera frugiperda (Sf), are widely used as hosts for recombinant protein production in the baculovirus-insect cell system (BICS). However, it was recently discovered that these cell lines are contaminated with a virus, now known as Sf-rhabdovirus [1]. The detection of this adventitious agent raised a potential safety issue that could adversely impact the BICS as a commercial recombinant protein production platform. Thus, we examined the properties of Sf-RVN, an Sf-rhabdovirus-negative Sf cell line, as a potential alternative host. Nested RT-PCR assays showed Sf-RVN cells had no detectable Sf-rhabdovirus over the course of 60 passages in continuous culture. The general properties of Sf-RVN cells, including their average growth rates, diameters, morphologies, and viabilities after baculovirus infection, were virtually identical to those of Sf9 cells. Baculovirus-infected Sf-RVN and Sf9 cells produced equivalent levels of three recombinant proteins, including an intracellular prokaryotic protein and two secreted eukaryotic glycoproteins, and provided similar N-glycosylation patterns. In fact, except for the absence of Sf-rhabdovirus, the only difference between Sf-RVN and Sf9 cells was SF-RVN produced higher levels of infectious baculovirus progeny. These results show Sf-RVN cells can be used as improved, alternative hosts to circumvent the potential safety hazard associated with the use of Sf-rhabdovirus-contaminated Sf cells for recombinant protein manufacturing with the BICS. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolution in Oryctes baculovirus: rate and types of genomic change.

Science.gov (United States)

Crawford, A M; Zelazny, B

1990-01-01

Three cloned strains of Oryctes baculovirus were released into a previously unexposed population of the host insect, the coconut palm rhinoceros beetle, Oryctes rhinoceros. The experiment was conducted on Meemu Atoll in the Maldive Islands. Viruses were isolated from the beetle population at 1 year, 1.75 years, and 4 years after release. No changes in genotype were observed in viruses isolated after 1 and 1.75 years. After 4 years, however, three types of genomic change had occurred. A recombinant derived from two of the released strains, an isolate containing a 100-bp insert, and one example of a point mutation were found in the 22 isolates examined.

Cloning and Molecular Characterization of the Schistosoma mansoni Genes RbAp48 and Histone H4

Directory of Open Access Journals (Sweden)

Patrícia P Souza

2002-10-01

Full Text Available The human nuclear protein RbAp48 is a member of the tryptophan/aspartate (WD repeat family, which binds to the retinoblastoma (Rb protein. It also corresponds to the smallest subunit of the chromatin assembly factor and is able to bind to the helix 1 of histone H4, taking it to the DNA in replication. A cDNA homologous to the human gene RbAp48 was isolated from a Schistosoma mansoni adult worm library and named SmRbAp48. The full length sequence of SmRbAp48 cDNA is 1036 bp long, encoding a protein of 308 amino acids. The transcript of SmRbAp48 was detected in egg, cercariae and schistosomulum stages. The protein shows 84% similarity with the human RbAp48, possessing four WD repeats on its C-terminus. A hypothetical tridimensional structure for the SmRbAp48 C-terminal domain was constructed by computational molecular modeling using the b-subunit of the G protein as a model. To further verify a possible interaction between SmRbAp48 and S. mansoni histone H4, the histone H4 gene was amplified from adult worm genomic DNA using degenerated primers. The gene fragment of SmH4 is 294 bp long, encoding a protein of 98 amino acids which is 100% identical to histone H4 from Drosophila melanogaster.

Abundance of carbapenemase genes (blaKPC, blaNDM and blaOXA-48) in wastewater effluents from Tunisian hospitals.

Science.gov (United States)

Nasri, Emna; Subirats, Jessica; Sànchez-Melsió, Alexandre; Mansour, Hedi Ben; Borrego, Carles M; Balcázar, José Luis

2017-10-01

Carbapenems are β-lactam antibiotics with a broad spectrum of activity and are usually considered the last resort for the treatment of severe infections caused by multidrug-resistant pathogens. The clinically most significant carbapenemases are KPC, NDM, and OXA-48-like enzymes, whose genes have been increasingly reported worldwide in members of the family Enterobacteriaceae. In this study, we quantified the abundance of these genes in wastewater effluents from different Tunisian hospitals. The bla NDM and bla OXA-48 -like genes were detected at similar concentrations in all hospital wastewater effluents. In contrast, the bla KPC gene was detected at lower concentration than other genes and it was only detected in three of the seven effluents analyzed. To the best of our knowledge, this study quantified for the first time the abundance of bla KPC , bla NDM , and bla OXA-48 -like genes in wastewater effluents from Tunisian hospitals, highlighting the widespread distribution of these carbapenemase genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Complete Genome of a New Betabaculovirus from Clostera anastomosis.

Directory of Open Access Journals (Sweden)

Feifei Yin

Full Text Available Clostera anastomosis (Lepidoptera: Notodontidae is a defoliating forest insect pest. Clostera anastomosis granulovirus-B (ClasGV-B belonging to the genus Betabaculovirus of family Baculoviridae has been used for biological control of the pest. Here we reported the full genome sequence of ClasGV-B and compared it to other previously sequenced baculoviruses. The circular double-stranded DNA genome is 107,439 bp in length, with a G+C content of 37.8% and contains 123 open reading frames (ORFs representing 93% of the genome. ClasGV-B contains 37 baculovirus core genes, 25 lepidopteran baculovirus specific genes, 19 betabaculovirus specific genes, 39 other genes with homologues to baculoviruses and 3 ORFs unique to ClasGV-B. Hrs appear to be absent from the ClasGV-B genome, however, two non-hr repeats were found. Phylogenetic tree based on 37 core genes from 73 baculovirus genomes placed ClasGV-B in the clade b of betabaculoviruses and was most closely related to Erinnyis ello GV (ErelGV. The gene arrangement of ClasGV-B also shared the strongest collinearity with ErelGV but differed from Clostera anachoreta GV (ClanGV, Clostera anastomosis GV-A (ClasGV-A, previously also called CaLGV and Epinotia aporema GV (EpapGV with a 20 kb inversion. ClasGV-B genome contains three copies of polyhedron envelope protein gene (pep and phylogenetic tree divides the PEPs of betabaculoviruses into three major clades: PEP-1, PEP-2 and PEP/P10. ClasGV-B also contains three homologues of P10 which all harbor an N-terminal coiled-coil domain and a C-terminal basic sequence. ClasGV-B encodes three fibroblast growth factor (FGF homologues which are conserved in all sequenced betabaculoviruses. Phylogenetic analysis placed these three FGFs into different groups and suggested that the FGFs were evolved at the early stage of the betabaculovirus expansion. ClasGV-B is different from previously reported ClasGV-A and ClanGV isolated from Notodontidae in sequence and gene

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose

International Nuclear Information System (INIS)

Ju, Huanyu; Wei, Na; Wang, Qian; Wang, Chunyuan; Jing, Zhiqiang; Guo, Lu; Liu, Dapeng; Gao, Mingchun; Ma, Bo; Wang, Junwei

2011-01-01

Highlights: → All three capsid proteins can be expressed in insect cells in baculovirus expression system. → All three recombinant proteins were spontaneously self-assemble into virus-like particles whose size and appearance were similar to those of native purified GPV virions. → The immunogenicity of GPV-VLPs was better than commercial inactivated vaccine and attenuated vaccine. -- Abstract: Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particles (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs.

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose

Energy Technology Data Exchange (ETDEWEB)

Ju, Huanyu; Wei, Na; Wang, Qian; Wang, Chunyuan; Jing, Zhiqiang; Guo, Lu; Liu, Dapeng; Gao, Mingchun; Ma, Bo [College of Veterinary Medicine, Northeast Agricultural University, Harbin, Heilongjiang 150030 (China); Wang, Junwei, E-mail: jwwang@neau.edu.cn [College of Veterinary Medicine, Northeast Agricultural University, Harbin, Heilongjiang 150030 (China)

2011-05-27

Highlights: {yields} All three capsid proteins can be expressed in insect cells in baculovirus expression system. {yields} All three recombinant proteins were spontaneously self-assemble into virus-like particles whose size and appearance were similar to those of native purified GPV virions. {yields} The immunogenicity of GPV-VLPs was better than commercial inactivated vaccine and attenuated vaccine. -- Abstract: Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particles (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs.

ION-EXCHANGE IMMUNOAFFINITY PURIFICATION OF A RECOMBINANT BACULOVIRUS PLASMODIUM-FALCIPARUM APICAL MEMBRANE ANTIGEN, PF83/AMA-1

NARCIS (Netherlands)

NARUM, DL; WELLING, GW; THOMAS, AW

1993-01-01

A two-step purification regime has been developed for a quantitatively minor, putatively transmembrane, M(r) 83 000, apical membrane blood stage vaccine candidate antigen of Plasmodium falciparum (PF83/AMA-1), that has been expressed as a full-length baculovirus recombinant protein, PF83-FG8-1. The

Expressão dos genes nodC, nodW e nopP em Bradyrhizobium japonicum estirpe CPAC 15 avaliada por RT-qPCR Expression of nodC, nodW and nopP genes in Bradyrhizobium japonicum CPAC 15 strain evaluated by RT-qPCR

Directory of Open Access Journals (Sweden)

Simone Bortolan

2009-11-01

Full Text Available O objetivo deste trabalho foi avaliar a expressão, por RT-qPCR, dos genes de nodulação nodC e nodW e do gene nopP da estirpe CPAC 15, que provavelmente atuam na infecção das raízes da soja. Foram realizados dois experimentos. No primeiro, a expressão dos genes foi avaliada nas células após a incubação com genisteína por 15 min, 1, 4 e 8 horas. Os resultados revelaram que os três genes apresentaram maior expressão imediatamente após o contato com o indutor (15 min. No segundo experimento, a bactéria foi cultivada na presença de indutores (genisteína ou exsudatos de sementes de soja por 48 horas. A expressão dos três genes foi maior na presença de genisteína, com valores de expressão para nodC, nodW e nopP superiores ao controle. Os resultados obtidos confirmam a funcionalidade dos três genes na estirpe CPAC 15, com ênfase para o nopP, cuja funcionalidade em Bradyrhizobium japonicum foi descrita pela primeira vez.The objective of this work was to evaluate, by RT-qPCR, the expression of the nodC and nodW nodulation genes and of the nopP gene of the CPAC 15 strain, which probably play a role in the infection of soybean roots. Two experiments were done. In the first, the gene expression was evaluated in cells after incubation with genistein for 15 min, 1, 4 and 8 hours. Results showed that the three genes showed higher expression immediately after contact with the inducer (15 min. In the second experiment, the bacterium was grown in the presence of inducers (genistein or soybean seed exudates for 48 hours. The expression of the three genes was greater when induced by genistein, and the expression of nodC, nodW and nopP had higher values than the control. The results confirm the functionality of the three genes in the CPAC 15 strain, with an emphasis on the nopP, whose functionality in Bradyrhizobium japonicum was described for the first time.

Evaluated (n,p) cross sections of 46Ti, 47Ti and 48Ti

International Nuclear Information System (INIS)

Philis, C.; Bersillon, O.; Smith, D.; Smith, A.

1977-01-01

Microscopic evaluated neutron cross sections for the reactions 46 Ti(n;p) 46 Sc, 47 Ti(n;p) 47 Sc and 48 Ti(n;p) 48 Sc are obtained from threshold (or zero energy) to 20 MeV. The results are presented in graphical and numerical (ENDF format) form. The microscopic evaluated cross sections are compared with measured fission-spectrum-averaged values

Evidence of recent interspecies horizontal gene transfer regarding nucleopolyhedrovirus infection of Spodoptera frugiperda.

Science.gov (United States)

Barrera, Gloria Patricia; Belaich, Mariano Nicolás; Patarroyo, Manuel Alfonso; Villamizar, Laura Fernanda; Ghiringhelli, Pablo Daniel

2015-11-25

Baculoviruses are insect-associated viruses carrying large, circular double-stranded-DNA genomes with significant biotechnological applications such as biological pest control, recombinant protein production, gene delivery in mammals and as a model of DNA genome evolution. These pathogens infect insects from the orders Lepidoptera, Hymenoptera and Diptera, and have high species diversity which is expressed in their diverse biological properties including morphology, virulence or pathogenicity. Spodoptera frugiperda (Lepidoptera: Noctuidae), the fall armyworm, represents a significant pest for agriculture in America; it is a host for baculoviruses such as the Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) (Colombia strain, genotype A) having been classified as a Group II alphabaculovirus making it a very attractive target for bioinsecticidal use. Genome analysis by pyrosequencing revealed that SfMNPV ColA has 145 ORFs, 2 of which were not present in the other sequenced genotypes of the virus (SfMNPV-NicB, SfMNPV-NicG, SfMNPV-19 and SfMNPV-3AP2). An in-depth bioinformatics study showed that ORF023 and ORF024 were acquired by a recent homologous recombination process between Spodoptera frugiperda and Spodoptera litura (the Oriental leafworm moth) nucleopolyhedroviruses. Auxiliary genes are numerous in the affected locus which has a homologous region (hr3), a repetitive sequence associated with genome replication which became lost in SfColA along with 1 ORF. Besides, the mRNAs associated with two acquired genes appeared in the virus' life-cycle during the larval stage. Predictive studies concerning the theoretical proteins identified that ORF023 protein would be a phosphatase involved in DNA repair and that the ORF024 protein would be a membrane polypeptide associated with cell transport. The SfColA genome was thus revealed to be a natural recombinant virus showing evidence of recent horizontal gene transfer between different baculovirus species occurring

Polymorphism of the cytochrome P450 CYP2D6 gene in a European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution.

Science.gov (United States)

Marez, D; Legrand, M; Sabbagh, N; Lo Guidice, J M; Spire, C; Lafitte, J J; Meyer, U A; Broly, F

1997-06-01

The polymorphic cytochrome P450 CYP2D6 is involved in the metabolism of various drugs of wide therapeutic use and is a presumed susceptibility factor for certain environmentally-induced diseases. Our aim was to define the mutations and alleles of the CYP2D6 gene and to evaluate their frequencies in the European population. Using polymerase chain reaction-single strand conformation polymorphism analysis, 672 unrelated subjects were screened for mutations in the 9 exons of the gene and their exon-intron boundaries. A total of 48 point mutations were identified, of which 29 were novel. Mutations 1749 G-->C, 2938 C-->T and 4268 G-->C represented 52.6%, 34.3% and 52.9% of the mutations in the total population, respectively. Of the eight detrimental mutations detected, the 1934 G-->A, the 1795 Tdel and the 2637 Adel accounted for 65.8%, 6.2% and 4.8% respectively, within the poor metabolizer subgroup. Fifty-three different alleles were characterized from the mutation pattern and by allele-specific sequencing. They are derived from three major alleles, namely the wild-type CYP2D6*1A, the functional CYP2D6*2 and the null CYP2D6*4A. Five allelic variants (CYP2D6*1A, *2, *2B, *4A and *5) account for about 87% of all alleles, while the remaining alleles occur with a frequency of 0.1%-2.7%. These data provide a solid basis for future epidemiological, clinical as well as interethnic studies of the CYP2D6 polymorphism and highlight that the described single strand conformation polymorphism method can be successfully used in designing such studies.

Electrical dipole polarizability and spin M1 strength from {sup 48}Ca(p,p') data under 0; Elektrische Dipol-Polarisierbarkeit und Spin-M1-Staerke aus {sup 48}Ca(p,p')-Daten unter 0

Energy Technology Data Exchange (ETDEWEB)

Birkhan, Jonny Hubertus

2016-07-01

In this thesis, proton scattering data on the nucleus {sup 48}Ca at very forward angles had been analysed. The data stem from a measurement campaign which was launched at the Research Centre of Nuclear Physics at Osaka, Japan, in the past. One of the two objectives of this analysis was to extract a value for the static electric dipole polarisability from the isovector giant dipole resonance (IVGDR). The second objective was to extract the total electromagnetic M1 strength B(M1) of the spin-flip transition which excites the prominent 1{sup +} state at an excitation energy of E{sub x}=10.22 MeV. The polarisability was calculated from the distribution of photo-absorption cross sections within an energy range from E{sub x}=11 MeV to E{sub x}=26 MeV. The photo-absorption cross sections had been deduced from the distribution of E1 cross sections by the method of virtual photons. For this purpose the experimental cross sections had been deconvoluted by a multipole deconvolution into an E1 part and a background part. Then, the best estimate of the polarisability is given by α{sub D}=(1.36±0.14) fm{sup 3}. If a E3 model was included into the multipole decomposition of the (p,p') data the result increased up to α{sub D}=(1.50±0.09) fm{sup 3}. The deviation between these two results is mainly due to the fact that the multipole decomposition is very sensitive on the background function. Assuming that the the IVGDR of the nuclei {sup 48}Ca and {sup 40}Ca have approximately the same structure, estimates for the polarisability of the nucleus {sup 48}Ca could be drawn from {sup 40}Ca(γ,abs) data. Additionally, data from a {sup 48}Ca(e,e'n) measurement were used to estimate the polarisability of the nucleus {sup 48}Ca. Its polarisability seems to fall within the range of α{sub D}=(1.50±0.09) fm{sup 3} and α{sub D}=(1.69±0.03) fm{sup 3}. Beside this, it could be shown by the {sup 40}Ca data that a significant contribution to the polarisability has to be expected

Ultrastructural and pathogenesis of Monodon baculovirus in SPF shrimp, Litopenaeus vannamei imported to Iran

OpenAIRE

Bahari-Meimandi, S.A.; Afsharnasab, M.; Motallebi Moghanjoghi, A.A.; Azaritakami, G.; Sharifrohani, M.

2014-01-01

Viral pathogens are major causes of outbreaks in shrimp farms throughout the world. Monodon baculovirus has been known to be invasive in 85-100% of the shrimp hatcheries, in early or late stages of shrimp. Three-hundred and sixty juvenile of Litopenaeus vannamei with average (±SD) size of 7.99±0.54 g and 3600 post larvae 10-15 were prepared from Shrimp Research Station located in Helleh and 3 hatcheries from Bushehr Province, southern part of Iran, respectively. They were allocated to 9 glass...

Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

International Nuclear Information System (INIS)

Salem, Tamer Z.; Zhang, Fengrui; Thiem, Suzanne M.

2013-01-01

Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

Energy Technology Data Exchange (ETDEWEB)

Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: smthiem@msu.edu [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)

2013-01-20

Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

P63 gene mutations and human developmental syndromes.

NARCIS (Netherlands)

Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

2002-01-01

The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

Retinoic acid induces signal transducer and activator of transcription (STAT) 1, STAT2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons.

Science.gov (United States)

Matikainen, S; Ronni, T; Lehtonen, A; Sareneva, T; Melén, K; Nordling, S; Levy, D E; Julkunen, I

1997-06-01

IFNs are antiproliferative cytokines that have growth-inhibitory effects on various normal and malignant cells. Therefore, they have been used in the treatment of certain forms of cancer, such as chronic myelogenous leukemia and hairy cell leukemia. However, there is little evidence that IFNs would be effective in the treatment of acute myelogenous leukemia, and molecular mechanisms underlying IFN unresponsiveness have not been clarified. Here we have studied the activation and induction of IFN-specific transcription factors signal transducer and activator of transcription (STAT) 1, STAT2, and p48 in all-trans-retinoic acid (ATRA)-differentiated myeloid leukemia cells using promyelocytic NB4, myeloblastic HL-60, and monoblastic U937 cells as model systems. These cells respond to ATRA by growth inhibition and differentiation. We show that in undifferentiated NB4 cells, 2',5'-oligoadenylate synthetase and MxB gene expression is not activated by IFN-alpha, possibly due to a relative lack of signaling molecules, especially p48 protein. However, during ATRA-induced differentiation, steady-state STAT1, STAT2, and especially p48 mRNA and corresponding protein levels were elevated both in NB4 and U937 cells, apparently correlating to an enhanced responsiveness of these cells to IFNs. ATRA treatment of NB4 cells sensitized them to IFN action as seen by increased IFN-gamma activation site DNA-binding activity or by efficient formation of IFN-alpha-specific ISGF3 complex and subsequent oligoadenylate synthetase and MxB gene expression. Lack of p48 expression could be one of the mechanisms of promyelocytic leukemia cell escape from growth-inhibitory effects of IFN-alpha.

Characterization of a baculovirus nuclear localization signal domain in the late expression factor 3 protein

International Nuclear Information System (INIS)

Au, Victoria; Yu Mei; Carstens, Eric B.

2009-01-01

The baculovirus Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) single-stranded DNA binding protein LEF-3 is a multi-functional protein that is required to transport the helicase protein P143 into the nucleus of infected cells where they function to replicate viral DNA. The N-terminal 56 amino acid region of LEF-3 is required for nuclear transport. In this report, we analyzed the effect of site-specific mutagenesis of LEF-3 on its intracellular distribution. Fluorescence microscopy of expression plasmid-transfected cells demonstrated that the residues 28 to 32 formed the core nuclear localization signal, but other adjacent positively-charged residues augmented these sequences. Comparison with other group I Alphabaculoviruses suggested that this core region functionally duplicated residues including 18 and 19. This was demonstrated by the loss of nuclear localization when the equivalent residues (18 to 20) in Choristoneura fumiferana nucleopolyhedrovirus (CfMNPV) LEF-3 were mutated. The AcMNPV LEF-3 nuclear localization domain was also shown to drive nuclear transport in mammalian cells indicating that the protein nuclear import systems in insect and mammalian cells are conserved. We also demonstrated by mutagenesis that two conserved cysteine residues located at 82 and 106 were not essential for nuclear localization or for interaction with P143. However, by using a modified construct of P143 that localized on its own to the nucleus, we demonstrated that a functional nuclear localization domain on LEF-3 was required for interaction between LEF-3 and P143

N-glycan sialylation in a silkworm-baculovirus expression system.

Science.gov (United States)

Suganuma, Masatoshi; Nomura, Tsuyoshi; Higa, Yukiko; Kataoka, Yukiko; Funaguma, Shunsuke; Okazaki, Hironobu; Suzuki, Takeo; Fujiyama, Kazuhito; Sezutsu, Hideki; Tatematsu, Ken-Ichiro; Tamura, Toshiki

2018-02-09

A silkworm-baculovirus system is particularly effective for producing recombinant proteins, including glycoproteins. However, N-glycan structures in silkworm differ from those in mammals. Glycoproteins in silkworm are secreted as pauci-mannose type N-glycans without sialic acid or galactose residues. Sialic acid on N-glycans plays important roles in protein functions. Therefore, we developed pathways for galactosylation and sialylation in silkworm. Sialylated N-glycans on proteins were successfully produced in silkworm by co-expressing galactosyltransferase and sialyltransferase and providing an external supply of a sialylation-related substrate. α2,3/α2,6 Sialylation to N-glycans was controlled by changing the type of sialyltransferase expressed in silkworm. Furthermore, the co-expression of N-acetylglucosaminyltransferase II facilitated the formation of additional di-sialylated N-glycan structures. Our results provide new information on the control of N-glycosylation in silkworm. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

The Clinical Implications of Methylated p15 and p73 Genes in Adult Acute Lymphoblastic Leukemia

International Nuclear Information System (INIS)

ABD EL-HAMID, Th.M.; SHERISHER, M.A.; MOSSALLAM, Gh.I.

2010-01-01

Aberrant methylation of promoter associated CpG islands is an epigenetic modification of DNA which is associated with gene silencing. It plays an important role in the leukemia pathogenesis. This phenomenon is frequently observed in acute lymphoblastic leukemia (ALL) and results in the functional inactivation of its associated genes. The aim of this study is to investigate the frequency and the prognostic impact of p15 and p73 genes methylation in adult acute lymphoblastic leukemia patients. Patients and Methods: Methylation-specific polymerase chain reaction (PCR) was used to analyze methylation of the p15 and p73 genes in 51 newly diagnosed adult ALL patients. Results: The methylation frequencies of p15 and p73 genes at diagnosis were 41.2% and 27.5% respectively, while concomitant methylation was detected in 14% of the patients. Concomitant methylation of p15 and p73 genes was associated with significant lower rate of CR compared to patients without methylation (57% versus 90%), p=0.008. Overall survival (OS) was not affected by p15 methylation, but was poorer with p73 methylation and the difference was near significant (p=0.059). For patients without meyhylation, the survival benefit was significant when compared to patients with p15, p73 or both genes methylation (p=0.047). The leukemia free survival was not affected by the methylation status of single gene p15 or p73, but tended to be worse in patients with methylated p15, p73 or both genes when compared to patients without methylation (p= 0.08). Conclusion: Aberrant p73 promoter methylation is a potential prognostic factor in adult ALL patients. P15 methylation is frequent in Egyptian adult ALL patients, its concomitant methylation with p73 is of poor prognostic significance. Identification of these molecular targets improve risk assessment and selection of appropriate therapy.

Functional characterization of Bombyx mori nucleopolyhedrovirus late gene transcription and genome replication factors in the non-permissive insect cell line SF-21

International Nuclear Information System (INIS)

Berretta, Marcelo F.; Deshpande, Mandar; Crouch, Erin A.; Passarelli, A. Lorena

2006-01-01

We compared the abilities of late gene transcription and DNA replication machineries of the baculoviruses Autographa californica nucleopolyhedrovirus (AcMNPV) and Bombyx mori NPV (BmNPV) in SF-21 cells, an insect-derived cell line permissive for AcMNPV infection. It has been well established that 19 AcMNPV late expression factors (lefs) stimulate substantial levels of late gene promoter activity in SF-21 cells. Thus, we constructed a set of clones containing the BmNPV homologs of the AcMNPV lefs under control of the constitutive Drosophila heat shock 70 protein promoter and tested their ability to activate an AcMNPV late promoter-reporter gene cassette in SF-21 cells. We tested the potential of individual or predicted functional groups of BmNPV lefs to successfully replace the corresponding AcMNPV gene(s) in transient late gene expression assays. We found that most, but not all, BmNPV lefs were able to either fully or partially substitute for the corresponding AcMNPV homolog in the context of the remaining AcMNPV lefs with the exception of BmNPV p143, ie-2, and p35. BmNPV p143 was unable to support late gene expression or be imported into the nucleus of cells in the presence of the AcMNPV or the BmNPV LEF-3, a P143 nuclear shuttling factor. Our results suggest that host-specific factors may affect the function of homologous proteins

Generation and characterization of P gene-deficient rabies virus

International Nuclear Information System (INIS)

Shoji, Youko; Inoue, Satoshi; Nakamichi, Kazuo; Kurane, Ichiro; Sakai, Takeo; Morimoto, Kinjiro

2004-01-01

Rabies virus (RV) deficient in the P gene was generated by reverse genetics from cDNA of HEP-Flury strain lacking the entire P gene. The defective virus was propagated and amplified by rescue of virus, using a cell line that complemented the functions of the deficient gene. The P gene-deficient (def-P) virus replicated its genome and produced progeny viruses in the cell lines that constitutively expressed the P protein, although it grew at a slightly retarded rate compared to the parental strain. In contrast, no progeny virus was produced in the infected host when the def-P virus-infected cells that did not express the P protein. However, we found that the def-P virus had the ability to perform primary transcription (by the virion-associated polymerase) in the infected host without de novo P protein synthesis. The def-P virus was apathogenic in adult and suckling mice, even when inoculated intracranially. Inoculation of def-P virus in mice induced high levels of virus-neutralizing antibody (VNA) and conferred protective immunity against a lethal rabies infection. These results demonstrate the potential utility of gene-deficient virus as a novel live attenuated rabies vaccine

Aromatic/heterocyclic amino acids and the simulated sunlight-ultraviolet inactivation of the Heliothis/Helicoverpa baculovirus

International Nuclear Information System (INIS)

Ignoffo, C.M.; Garcia, C.

1995-01-01

Tryptophan, of five aromatic/heterocyclic amino acids (tyrosine, phenylalanine, proline, histidine) provided significant protection of the Heliothis baculovirus (HzSNPV) from inactivation by simulated ultraviolet (SUV). Fifty percent of SUV protection of HzSNPV with tryptophan or tyrosine was obtained at 0.03 mg/ml and 0.5 mg/ml, respectively. Rates as high as 100.0 mg/ml of phenylalanine, histidine, or proline provided <50% protection. The extent of tryptophan protection was correlated with its absorption in the sunlight UV-B spectra. 16 refs., 2 tabs

Immune responses to baculovirus-displayed enterovirus 71 VP1 antigen.

Science.gov (United States)

Kiener, Tanja K; Premanand, Balraj; Kwang, Jimmy

2013-04-01

The increased distribution and neurovirulence of enterovirus 71 is an important health threat for young children in Asia Pacific. Vaccine design has concentrated on inactivated virus with the most advanced undergoing Phase III clinical trials. By using a subunit vaccine approach, production costs could be reduced by lowering the need for biocontainment. In addition, novel mutations could be rapidly incorporated to reflect the emergence of new enterovirus 71 subgenogroups. To circumvent the problems associated with conventional subunit vaccines, the antigen can be displayed on a viral vector that conveys stability and facilitates purification. Additional advantages of viral-vectored subunit vaccines are their ability to stimulate the innate immune system by transducing cells and the possibility of oral or nasal delivery, which dispenses with the need for syringes and medical personnel. Baculovirus-displayed VP1 combines all these benefits with protection that is as efficient as inactivated virus.

Proteolytic Processing and Assembly of gag and gag-pol Proteins of TED, a Baculovirus-Associated Retrotransposon of the Gypsy Family

Science.gov (United States)

Hajek, Kathryn L.; Friesen, Paul D.

1998-01-01

TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55gag) is cleaved to produce a single VLP structural protein, p37gag. Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55gag cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195gag-pol. The PR cleavage site within Pr55gag was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55gag truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55gag abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37gag provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging. PMID:9765414

Temporal expression of HIV-1 envelope proteins in baculovirus-infected insect cells: Implications for glycosylation and CD4 binding

International Nuclear Information System (INIS)

Murphy, C.I.; Lennick, M.; Lehar, S.M.; Beltz, G.A.; Young, E.

1990-01-01

Three different human immunodeficiency virus type I (HIV-1) envelope derived recombinant proteins and the full length human CD4 polypeptide were expressed in Spodoptera frugiperda (Sf9) cells. DNA constructs encoding CD4, gp120, gp160, and gp160 delta were cloned into the baculovirus expression vector pVL941 or a derivative and used to generate recombinant viruses in a cotransfection with DNA from Autographa californica nuclear polyhedrosis virus (AcMNPV). Western blotting of cell extracts of the recombinant HIV-1 proteins showed that for each construct two major bands specifically reacted with anti-HIV-1 envelope antiserum. These bands corresponded to glycosylated and nonglycosylated versions of the HIV proteins as determined by 3H-mannose labeling and tunicamycin treatment of infected cells. A time course of HIV envelope expression revealed that at early times post-infection (24 hours) the proteins were fully glycosylated and soluble in nonionic detergents. However, at later times postinfection (48 hours), expression levels of recombinant protein reached a maximum but most of the increase was due to a rise in the level of the nonglycosylated species, which was largely insoluble in nonionic detergents. Thus, it appears that Sf9 cells cannot process large amounts of glycosylated recombinant proteins efficiently. As a measure of biological activity, the CD4 binding ability of both glycosylated and nonglycosylated recombinant HIV envelope proteins was tested in a coimmunoprecipitation assay. The results showed that CD4 and the glycosylated versions of recombinant gp120 or gp160 delta specifically associated with one another in this analysis. Nonglycosylated gp120 or gp160 delta proteins from tunicamycin-treated cultures did immunoprecipitate with anti-HIV-1 antiserum but did not interact with CD4

Vertical transmission of sublethal granulovirus infection in the Indian meal moth, Plodia interpunctella.

Science.gov (United States)

Burden, J P; Griffiths, C M; Cory, J S; Smith, P; Sait, S M

2002-03-01

Knowledge of the mechanisms of pathogen persistence in relation to fluctuations in host density is crucial to our understanding of disease dynamics. In the case of insect baculoviruses, which are typically transmitted horizontally via a lifestage that can persist outside the host, a key issue that remains to be elucidated is whether the virus can also be transmitted vertically as a sublethal infection. We show that RNA transcripts for the Plodia interpunctella GV granulin gene are present in a high proportion of P. interpunctella insects that survive virus challenge. Granulin is a late-expressed gene that is only transcribed after viral genome replication, its presence thus strongly indicates that viral genome replication has occurred. Almost all insects surviving the virus challenge tested positive for viral RNA in the larval and pupal stage. However, this proportion declined in the emerging adults. Granulin mRNA was also detected in both the ovaries and testes, which may represent a putative mechanism by which reduced fecundity in sublethally affected hosts might be manifested. RNA transcripts were also detected in 60-80% of second-generation larvae that were derived from mating surviving adults, but there was no difference between the sexes, with both males and females capable of transmitting a sublethal infection to their offspring. The data indicate that low-level persistent infection, with at least limited gene expression, can occur in P. interpunctella following survival of a granulovirus challenge. We believe that this is the first demonstration of a persistent, sublethal infection by a baculovirus to be initiated by a sublethal virus dose. We hypothesize that the 'latent' baculovirus infections frequently referred to in the literature may also be low level persistent, sublethal infections resulting from survival from initial baculovirus exposure.

CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

Science.gov (United States)

Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

2015-10-01

A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

Inhibition of HBV replication by delivering the dual-gene expression vector pHsa-miR16-siRNA in HepG2.2.15 cells.

Science.gov (United States)

Wei, Wei; Wang, Su-Fei; Yu, Bing; Ni, Ming

2017-12-01

This study aimed to construct the dual-gene expression vector pHsa-miR16-siRNA which can express human miR-16 and HBV X siRNA, and examine its regulatory effect on HBV gene expression in the HepG2.2.15 cell line. The expression vectors siR-1583 and pHsa-miR16-siRNA were designed and constructed. HepG2.2.15 cells were transfected with the empty vector, siR-1583, pmiR-16 and pHsa-miR16-siRNA, respectively. ELISA was performed to measure the expression of HBsAg and HBeAg in the culture supernatant 48 and72 h post transfection. Fluorescence quantitative PCR was used to measure the HBV mRNA degradation efficiency and HBV DNA copy number. The results showed that the expression of HBV genes was significantly inhibited in HepG2.2.15 cells transfected with siR-1583, pmiR-16 and pHsa-miR16-siRNA, respectively, when compared with that in cells transfected with the empty vectors, with the inhibitory effect of pHsa-miR16-siRNA being the most significant. ELISA showed that the inhibitory rates of HBsAg and HBeAg in pHsa-miR16-siRNA transfected cells were correspondingly 87.3% and 85.0% at 48 h, and 88.6% and 86.5% at 72 h post transfection (PHBV mRNA decreased by 80.2% (t=-99.22, PHBV DNA by 92.8% (t=-73.06, PHBV DNA copy number by 89.8% (t=-47.13, PHBV more efficiently than a single-gene expression vector.

Triglyceride-rich lipoprotein regulates APOB48 receptor gene expression in human THP-1 monocytes and macrophages.

Science.gov (United States)

Bermudez, Beatriz; Lopez, Sergio; Varela, Lourdes M; Ortega, Almudena; Pacheco, Yolanda M; Moreda, Wenceslao; Moreno-Luna, Rafael; Abia, Rocio; Muriana, Francisco J G

2012-02-01

The postprandial metabolism of dietary fats implies that the production of TG-rich lipoproteins (TRL) contributes to the progression of plaque development. TRL and their remnants cause rapid receptor-mediated monocyte/macrophage lipid engorgement via the cell surface apoB48 receptor (apoB48R). However, the mechanistic basis for apoB48 receptor (APOB48R) regulation by postprandial TRL in monocytes and macrophages is not well established. In this study, we investigated the effects of postprandial TRL from healthy volunteers on the expression of APOB48R mRNA and lipid uptake in human THP-1 monocytes and THP-1-derived macrophages. The expression of APOB48R mRNA was upregulated in THP-1 monocytes, but downregulated in THP-1-derived macrophages when treated with postprandial TRL (P < 0.05), in a dose- and time-dependent manner. TG and free cholesterol were dramatically increased in THP-1-derived macrophages (140 and 50%, respectively; P < 0.05) and in THP-1 monocytes (160 and 95%, respectively; P < 0.05). This lipid accumulation was severely decreased (~50%; P < 0.05) in THP-1-derived macrophages by small interfering RNA (siRNA) targeting of APOB48R. Using PPAR and retinoid X receptor (RXR) agonists, antagonists, and siRNA, our data indicate that PPARα, PPARγ, and RXRα are involved in postprandial TRL-induced APOB48R transcriptional regulation. Co-incubation with acyl-CoA synthetase or acyl-CoA:cholesterol acyltransferase inhibitors potentiated the effects of postprandial TRL on the expression of APOB48R mRNA in THP-1 monocytes and THP-1-derived macrophages. Our findings collectively suggest that APOB48R represents a molecular target of postprandial TRL via PPAR-dependent pathways in human THP-1 monocytes and macrophages and advance a potentially important link between postprandial metabolism of dietary fats and atherogenesis.

Biology and genomics of viruses within the genus Gammabaculovirus.

Science.gov (United States)

Arif, Basil; Escasa, Shannon; Pavlik, Lillian

2011-11-01

Hymenoptera is a very large and ancient insect order encompassing bees, wasps, ants and sawflies. Fossil records indicate that they existed over 200 million years ago and about 100 million years before the appearance of Lepidoptera. Sawflies have been major pests in many parts of the world and some have caused serious forest defoliation in North America. All baculoviruses isolated from sawflies are of the single nucleocapsids phenotype and appear to replicate in midgut cells only. This group of viruses has been shown to be excellent pest control agents and three have been registered in Canada and Britain for this purpose. Sawfly baculoviruses contain the smallest genome of all baculoviruses sequenced so far. Gene orders among sequenced sawfly baculoviruses are co-linear but this is not shared with the genomes of lepidopteran baculoviruses. One distinguishing feature among all sequenced sawfly viruses is the lack of a gene encoding a membrane fusion protein, which brought into question the role of the budded virus phenotype in Gammabaculovirus biology.

Expression of polyhedrin-hEGF fusion protein in cultured cells and ...

African Journals Online (AJOL)

For mass production of human epidermal growth factor (hEGF), silkworm baculovirus expression vector system (BEVS) was adopted in this study. hEGF gene was in-frame fused with polyhedrin (Ph) gene under the control of Ph promoter and was used to co-transfect BmN cell with the modified. Bombyx mori baculovirus ...

Appendix 1：Upregulated genes in gene expression profile （P<0.05 ...

Indian Academy of Sciences (India)

lazi

Appendix 1: Upregulated genes in gene expression profile«P2）. Probe_s. Gene_Symbol pvalues foldchange. Probe_S. et_ID. Gene_Symbol pvalues foldchange. et_ID. 1370355. 1393751. Scd1. 1.35E-04. 25.77. Loc1009122508.06E-03. 2.55. -at at. 1398250. 1370870. Acot1. 2.43E-02. 12.18. Me1.

Genome sequence and organization of a nucleopolyhedrovirus isolated from the smaller tea tortrix, Adoxophyes honmai

International Nuclear Information System (INIS)

Nakai, Madoka; Goto, Chie; Kang, Won Kyung; Shikata, Masamitsu; Luque, Teresa; Kunimi, Yasuhisa

2003-01-01

Adoxophyes honmai nucleopolyhedrovirus (AdhoNPV) has a distinctive pathology in A. honmai larvae, killing the host more slowly than other NPVs. To further understand the pathology of AdhoNPV, its genome was completely sequenced and compared with those of other baculoviruses. The AdhoNPV genome is 113,220 bp, with a G + C content of 35.6%. It contains 125 putative open reading frames (ORFs), of which 8 are unique to AdhoNPV, and 4 homologous regions. The other 117 ORFs display similarity to previously characterized baculovirus genes involved in early and late gene expression, DNA replication, and structural and auxiliary functions. The phylogenetic position of AdhoNPV, in relation to 15 other baculoviruses whose genomes have been completely sequenced, was assessed by three different analyses: gene sequence, gene order, and gene content. Although gene content analysis failed to support the group II NPVs, phylogenetic trees based on gene sequence and gene order showed AdhoNPV to be closely related to the group II NPVs

Effect of RNAi p21 gene on uncoupling of EL-4 cells induced by X-irradiation

International Nuclear Information System (INIS)

Ju Guizhi; Yan Fengqin; Fu Shibo; Shen Bo; Sun Shilong; Yang Ying; Li Pengwu

2008-01-01

Objective: To investigate the effect of RNAi p21 gene on uncoupling of EL-4 cells induced by X-irradiation. Methods: Construction of RNAi p21 plasmid of pSileneer3.1-H1 neo-p21 was performed. Lipofectamine transfection assay was used to transfer the p21siBNA into EL-4 cells. Fluorescent staining and flow cytometry (FCM) analysis were employed for measurement of protein expression. Fluorescent staining of propidium iodide (PI) and FCM were used for measurement of potyploid cells. Results: In dose-effect experiment it was found that the expression of P21 protein of EL-4 cells increased significantly 24 h after X- irradiation with different doses compared with sham-inadiated control. In time course experiment it was found that the expression of P21 protein of EL-4 cells increased significantly at 8 h to 72 h after 4.0 Gy X-irradiation compared with sham-irradiated control. The results showed that the number of polyploid cells in EL-4 cells was not changed markedly after X-irradiation with doses of 0.5-6.0 Gy. After RNA interference with p21 gene, the expression of P21 protein of EL-4 cells decreased significantly 24 h and 48 h after 4.0 Gy X-irradiation in transfection of plasmid of pSilencer3.1-H1 neo-p21 compared with transfection of plasmid of pSilencer3.1-H1 nco control. And at the same time, the number of polyploid cells in EL-4 cells was increased significantly in transfection of plasmid of pSilencer3.1-H1 neo-p21 compared with transfection of plasmid of pSilencer3.1-H1 nco control. Conclusions: Uncoupling could be induced by X-irradiation in EL-4 cells following BNAi p21 gene, suggesting that P21 protein may play an important role in uncoupling induced by X-rays. (authors)

Effect of low dose radiation on expression of p16 gene in chronic myelogenous leukemia cells

International Nuclear Information System (INIS)

Zhang Longzhen; Ding Xin; Li Xiangyang; Cen Jiannong; Shen Hongjie; Chen Zixing

2010-01-01

Objective: To investigate the effect of low dose radiation on the expression on p16 gene in chronic myelogenous leukemia. Methods: Leukemic stem cells (LSCs) which expressed CD34 +, CD38 - and CD123 + were isolated from bone marrow cells obtained from twenty patients newly-diagnosedas chronic myeloid leukemia with EasySep TM magnet beads. Hematopoietic stem cells (HSCs) which expressed CD34 + and CD38 - were isolated from human cord blood cells obtained from twenty full-term deliveries with EasySep TM magnet beads as control. HSCs vs LSCs samples were further divided into three dose groups, including 0, 12.5 and 50 cGy, respectively. RT-PCR and real-time quantitative reverse transcription-polymerase chain reaction methods were used to detect mRNA expression of p16 gene in HSCs and LSCs after irradiation. Cells were harvested at different time for detection of cell cycle and apoptosis by flow cytometer. Results: p16 mRNA level in CML-LSCs was increased slightly at 12.5 cGy, and significantly increased at 50 cGy (Z=-3.39, P 0 /G 1 stagewas increased 48 h after 12.5 cGy irradiation, and 72 h post-irradiation with 50 cGy. The apoptosis rate of CML-LSCs was gradually raised after LDR, especially at 72 h post-irradiation of 50 cGy [(17.75±11.760% vs (6.13±4.71)%, Z=-2.37, P<0.01]. Conclusions: p16 gene transcription could be up-regulated by low dose radiation, which might provide a theoretical evidence for CML therapy and LDR in leukemic clinical application. (authors)

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

Science.gov (United States)

van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

2005-06-10

To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

Oxothiomolybdenum derivatives of the superlacunary crown heteropolyanion {P8W48}: structure of [K4{Mo4O4S4(H2O)3(OH)2}2(WO2)(P8W48O184)]30– and studies in solution.

Science.gov (United States)

Korenev, Vladimir S; Floquet, Sébastien; Marrot, Jérôme; Haouas, Mohamed; Mbomekallé, Israël-Martyr; Taulelle, Francis; Sokolov, Maxim N; Fedin, Vladimir P; Cadot, Emmanuel

2012-02-20

Reaction of the cyclic lacunary [H(7)P(8)W(48)O(184)](33-) anion (noted P(8)W(48)) with the [Mo(2)S(2)O(2)(H(2)O)(6)](2+) oxothiocation led to two compounds, namely, [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) (denoted 1) and [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) (denoted 2), which were characterized in the solid state and solution. In the solid state, the structure of [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) reveals the presence of two disordered {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) "handles" connected on both sides of the P(8)W(48) ring. Such a disorder is consistent with the presence of two geometrical isomers where the relative disposition of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles are arranged in a perpendicular or parallel mode. Such an interpretation is fully supported by (31)P and (183)W NMR solution studies. The relative stability of both geometrical isomers appears to be dependent upon the nature of the internal alkali cations, i.e., Na(+) vs K(+), and increased lability of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles, compared to the oxo analogous, was clearly identified by significant broadening of the (31)P and (183)W NMR lines. Solution studies carried out by UV-vis spectroscopy showed that formation of the adduct [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) occurs in the 1.5-4.7 pH range and corresponds to a fast and quantitative condensation process. Furthermore, (31)P NMR titrations in solution reveal formation of the "monohandle" derivative [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(P(8)W(48)O(184))](38-) as an intermediate prior to formation of the "bishandle" derivatives. Furthermore, the electrochemical behavior of [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) was studied in aqueous medium and compared with the parent anion P(8)W(48).

An OXA-48-producing Escherichia coli isolated from a Danish patient with no hospitalization abroad

DEFF Research Database (Denmark)

Gedebjerg, Anne; Hasman, Henrik; Sorensen, Christian Moller

2015-01-01

pOXA-48a carrying the bla(OXA-48) gene isolated from a Danish patient without history of hospitalization abroad. The patient reported tourist travel to Egypt and Turkey. The potential acquisition of carbapenemase-producing organisms by ingestion of contaminated food is discussed....

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

Effect of p53 genotype on gene expression profiles in murine liver

International Nuclear Information System (INIS)

Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

2008-01-01

The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

Growth and characterization of InP/In0.48Ga0.52P quantum dots optimized for single-photon emission

International Nuclear Information System (INIS)

Ugur, Asli

2012-01-01

In this work the growth of self-assembled InP/InGaP quantum dots, as well as their optical and structural properties are presented and discussed. The QDs were grown on In 0.48 Ga 0.52 P, lattice matched to GaAs. Self-assembled InP quantum dots are grown using gas-source molecular beam epitaxy over a wide range of InP deposition rates, using an ultra-low growth rate of about 0.01 atomic monolayers/s, a quantum-dot density of 1 dot/μm 2 is realized. The resulting isolated InP quantum dots are individually characterized without the need for lithographical patterning and masks on the substrate. Both excitonic and biexcitonic emissions are observed from single dots, appearing as doublets with a fine-structure splitting of 320 μeV. Hanbury Brown-Twiss correlation measurements for the excitonic emission under cw excitation show anti-bunching behavior with an autocorrelation value of g (2) (0)=0.2. This system is applicable as a single-photon source for applications such as quantum cryptography. The formation of well-ordered chains of InP quantum dots on GaAs (001) substrates by using self-organized In 0.48 Ga 0.52 P surface undulations as a template is also demonstrated. The ordering requires neither stacked layers of quantum dots nor substrate misorientation. The structures are investigated by polarization-dependent photoluminescence together with transmission electron microscopy. Luminescence from the In 0.48 Ga 0.52 P matrix is polarized in one crystallographic direction due to anisotropic strain arising from a lateral compositional modulation. The photoluminescence measurements show enhanced linear polarization in the alignment direction of quantum dots. A polarization degree of 66% is observed. The optical anisotropy is achieved with a straightforward heterostructure, requiring only a single layer of QDs.

pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

Science.gov (United States)

Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

2015-01-01

Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

Biology and Genomics of Viruses Within the Genus Gammabaculovirus

Directory of Open Access Journals (Sweden)

Shannon Escasa

2011-11-01

Full Text Available Hymenoptera is a very large and ancient insect order encompassing bees, wasps, ants and sawflies. Fossil records indicate that they existed over 200 million years ago and about 100 million years before the appearance of Lepidoptera. Sawflies have been major pests in many parts of the world and some have caused serious forest defoliation in North America. All baculoviruses isolated from sawflies are of the single nucleocapsids phenotype and appear to replicate in midgut cells only. This group of viruses has been shown to be excellent pest control agents and three have been registered in Canada and Britain for this purpose. Sawfly baculoviruses contain the smallest genome of all baculoviruses sequenced so far. Gene orders among sequenced sawfly baculoviruses are co-linear but this is not shared with the genomes of lepidopteran baculoviruses. One distinguishing feature among all sequenced sawfly viruses is the lack of a gene encoding a membrane fusion protein, which brought into question the role of the budded virus phenotype in Gammabaculovirus biology.

P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

Directory of Open Access Journals (Sweden)

Rejane Mattar

2004-01-01

Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

Systematic Search for Gene-Gene Interaction Effect on Prostate Cancer Risk

Science.gov (United States)

2013-07-01

Systematic Search for Gene-Gene Interaction 5a. CONTRACT NUMBER Effect on Prostate Cancer Risk 5b. GRANT NUMBER W81XWH-09-1-0488 5c. PROGRAM...Supported by this grant ) 1. Tao S, Wang Z, Feng J, Hsu FC, Jin G, Kin ST, Zhang Z, Gronberg H, Zheng, SL, Isaacs WB, XU J, Sun J. A Genome-Wide Search for...order interactions among estrogen- metabolism genes in sporadic breast cancer. Am J Hum Genet, 69, 138-47. 48. Marchini, J., Donnelly, P. and Cardon

Hardy–Weinberg equilibrium analysis of the 48 bp VNTR in the III exon of the DRD4 gene in a sample of parents of ADHD cases

Directory of Open Access Journals (Sweden)

Trejo S

2015-06-01

Full Text Available Salvador Trejo, José J Toscano-Flores, Esmeralda Matute, María de Lourdes Ramírez-Dueñas Laboratorio de Neuropsicología y Neurolingüística, Instituto de Neurociencias CUCBA, Guadalajara, Jalisco, Mexico Abstract: The aim of this study was to obtain the genotype and gene frequency from parents of children with attention-deficit/hyperactivity disorder (ADHD and then assess the Hardy–Weinberg equilibrium of genotype frequency of the variable number tandem repeat (VNTR III exon of the dopamine receptor D4 (DRD4 gene. The genotypes of the III exon of 48 bp VNTR repeats of the DRD4 gene were determined by polymerase chain reaction in a sample of 30 parents of ADHD cases. In the 60 chromosomes analyzed, the following frequencies of DRD4 gene polymorphisms were observed: six chromosomes (c with two repeat alleles (r (10%; 1c with 3r (1.5%; 36c with 4r (60%; 1c with 5r (1.5%; and 16c with 7r (27%. The genotypic distribution of the 30 parents was two parents (p with 2r/2r (6.67%; 1p with 2r/4r (3.33%; 1p with 2r/5r (3.33%; 1p with 3r/4r (3.33%; 15p with 4r/4r (50%; 4p with 4r/7r (13.33; and 6p with 7r/7r (20%. A Hardy–Weinberg disequilibrium (χ2=13.03, P<0.01 was found due to an over-representation of the 7r/7r genotype. These results suggest that the 7r polymorphism of the DRD4 gene is associated with the ADHD condition in a Mexican population. Keywords: ADHD, parents, DRD4, HWE

Characterisation of Al{sub 0.52}In{sub 0.48}P mesa p-i-n photodiodes for X-ray photon counting spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Butera, S., E-mail: S.Butera@sussex.ac.uk; Lioliou, G.; Barnett, A. M. [Semiconductor Materials and Device Laboratory, School of Engineering and Informatics, University of Sussex, Brighton BN1 9QT (United Kingdom); Krysa, A. B. [EPSRC National Centre for III-V Technologies, University of Sheffield, Mappin Street, Sheffield S1 3JD (United Kingdom)

2016-07-14

Results characterising the performance of thin (2 μm i-layer) Al{sub 0.52}In{sub 0.48}P p{sup +}-i-n{sup +} mesa photodiodes for X-ray photon counting spectroscopy are reported at room temperature. Two 200 μm diameter and two 400 μm diameter Al{sub 0.52}In{sub 0.48}P p{sup +}-i-n{sup +} mesa photodiodes were studied. Dark current results as a function of applied reverse bias are shown; dark current densities <3 nA/cm{sup 2} were observed at 30 V (150 kV/cm) for all the devices analysed. Capacitance measurements as a function of applied reverse bias are also reported. X-ray spectra were collected using 10 μs shaping time, with the device illuminated by an {sup 55}Fe radioisotope X-ray source. Experimental results showed that the best energy resolution (FWHM) achieved at 5.9 keV was 930 eV for the 200 μm Al{sub 0.52}In{sub 0.48}P diameter devices, when reverse biased at 15 V. System noise analysis was also carried out, and the different noise contributions were computed.

Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

International Nuclear Information System (INIS)

Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

2003-01-01

The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

Isolation of the alkane inducible cytochrome P450 (P450alk) gene from the yeast Candida tropicalis

Science.gov (United States)

The gene for the alkane-inducible cytochrome P450, P450alk, has been isolated from the yeast Candida tropicalis by immunoscreening a λgt11 library. Isolation of the gene has been identified on the basis of its inducibility and partial DNA sequence. Transcripts of this gene were i...

Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

Science.gov (United States)

Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

1993-10-01

A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

Use of a fragment of glycoprotein G-2 produced in the baculovirus expression system for detecting herpes simplex virus type 2-specific antibodies

NARCIS (Netherlands)

Ikoma, M; Liljeqvist, JA; Glazenburg, KL; The, TH; Welling-Wester, S; Groen, J.

Fragments of glycoprotein G (gG-2(281-594His)), comprising residues 281 to 594 of herpes simplex virus type 2 (HSV-2), glycoprotein G of HSV-1 (gG-1(t26-189His)), and glycoprotein D of HSV-1 (gD-1(1-313)), were expressed in the baculovirus expression system to develop an assay for the detection of

Continuous Influx of Genetic Material from Host to Virus Populations.

Directory of Open Access Journals (Sweden)

Clément Gilbert

2016-02-01

Full Text Available Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86 can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69 belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis

Directory of Open Access Journals (Sweden)

Hongyan eGuo

2015-05-01

Full Text Available Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid, a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice.

The molecular evolution of cytochrome P450 genes within and between drosophila species.

Science.gov (United States)

Good, Robert T; Gramzow, Lydia; Battlay, Paul; Sztal, Tamar; Batterham, Philip; Robin, Charles

2014-04-20

We map 114 gene gains and 74 gene losses in the P450 gene family across the phylogeny of 12 Drosophila species by examining the congruence of gene trees and species trees. Although the number of P450 genes varies from 74 to 94 in the species examined, we infer that there were at least 77 P450 genes in the ancestral Drosophila genome. One of the most striking observations in the data set is the elevated loss of P450 genes in the Drosophila sechellia lineage. The gain and loss events are not evenly distributed among the P450 genes-with 30 genes showing no gene gains or losses whereas others show as many as 20 copy number changes among the species examined. The P450 gene clades showing the fewest number of gene gain and loss events tend to be those evolving with the most purifying selection acting on the protein sequences, although there are exceptions, such as the rapid rate of amino acid replacement observed in the single copy phantom (Cyp306a1) gene. Within D. melanogaster, we observe gene copy number polymorphism in ten P450 genes including multiple cases of interparalog chimeras. Nonallelic homologous recombination (NAHR) has been associated with deleterious mutations in humans, but here we provide a second possible example of an NAHR event in insect P450s being adaptive. Specifically, we find that a polymorphic Cyp12a4/Cyp12a5 chimera correlates with resistance to an insecticide. Although we observe such interparalog exchange in our within-species data sets, we have little evidence of it between species, raising the possibility that such events may occur more frequently than appreciated but are masked by subsequent sequence change. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

DELETION AND 5'CPG ISLAND METHYLATION OF p15 GENE IN BRAIN GLIOMA

Institute of Scientific and Technical Information of China (English)

无

2000-01-01

Objective: To investigate the abnormality of p15 gene in brain glioma and the correlation of it with occurrence or malignant progression of brain glioma. Methods: Deletion and 5'CPG island methylation of p15 gene were detected by the methods of PCR and PCR-based methylation in 56 cases of brain glioma. Results: Out of 43 cases of high grade glioma, 14 cases were found to have homozygous deletion of p15E1, while none of the 13 cases of low grade glioma was found to have deletion of p15E1 (P<0.05). Methylation of 5'CPG Island of p15 gene was found only in four cases of glioma. Conclusion: Abnormality of p15 gene may involved in the occurrence and malignant progression of brain glioma. Homozygous deletion of gene is the major mechanism of inactivation for p15 gene in brain glioma.

Expression of feline immunodeficiency virus gag and env precursor proteins in Spodoptera frugiperda cells and their use in immunodiagnosis

NARCIS (Netherlands)

Horzinek, M.C.; Verschoor, E.J.; Vliet, A.L.W. van; Egberink, H.F.; Hesselink, W.; Ronde, A. de

1993-01-01

The gag and env genes of the feline immunodeficiency virus strain UT113 were cloned into a baculovirus transfer vector. The recombinant plasmids were used to create recombinant baculoviruses that expressed either the gag or the env precursor protein in insect cells (Sf9 cells). Leader sequence

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Baculovirus display of single chain antibody (scFv using a novel signal peptide

Directory of Open Access Journals (Sweden)

Gonzalez Gaëlle

2010-11-01

Full Text Available Abstract Background Cells permissive to virus can become refractory to viral replication upon intracellular expression of single chain fragment variable (scFv antibodies directed towards viral structural or regulatory proteins, or virus-coded enzymes. For example, an intrabody derived from MH-SVM33, a monoclonal antibody against a conserved C-terminal epitope of the HIV-1 matrix protein (MAp17, was found to exert an inhibitory effect on HIV-1 replication. Results Two versions of MH-SVM33-derived scFv were constructed in recombinant baculoviruses (BVs and expressed in BV-infected Sf9 cells, N-myristoylation-competent scFvG2/p17 and N-myristoylation-incompetent scFvE2/p17 protein, both carrying a C-terminal HA tag. ScFvG2/p17 expression resulted in an insoluble, membrane-associated protein, whereas scFvE2/p17 was recovered in both soluble and membrane-incorporated forms. When coexpressed with the HIV-1 Pr55Gag precursor, scFvG2/p17 and scFvE2/p17 did not show any detectable negative effect on virus-like particle (VLP assembly and egress, and both failed to be encapsidated in VLP. However, soluble scFvE2/p17 isolated from Sf9 cell lysates was capable of binding to its specific antigen, in the form of a synthetic p17 peptide or as Gag polyprotein-embedded epitope. Significant amounts of scFvE2/p17 were released in the extracellular medium of BV-infected cells in high-molecular weight, pelletable form. This particulate form corresponded to BV particles displaying scFvE2/p17 molecules, inserted into the BV envelope via the scFv N-terminal region. The BV-displayed scFvE2/p17 molecules were found to be immunologically functional, as they reacted with the C-terminal epitope of MAp17. Fusion of the N-terminal 18 amino acid residues from the scFvE2/p17 sequence (N18E2 to another scFv recognizing CD147 (scFv-M6-1B9 conferred the property of BV-display to the resulting chimeric scFv-N18E2/M6. Conclusion Expression of scFvE2/p17 in insect cells using a BV

Growth and characterization of InP/In{sub 0.48}Ga{sub 0.52}P quantum dots optimized for single-photon emission

Energy Technology Data Exchange (ETDEWEB)

Ugur, Asli

2012-08-28

In this work the growth of self-assembled InP/InGaP quantum dots, as well as their optical and structural properties are presented and discussed. The QDs were grown on In{sub 0.48}Ga{sub 0.52}P, lattice matched to GaAs. Self-assembled InP quantum dots are grown using gas-source molecular beam epitaxy over a wide range of InP deposition rates, using an ultra-low growth rate of about 0.01 atomic monolayers/s, a quantum-dot density of 1 dot/μm{sup 2} is realized. The resulting isolated InP quantum dots are individually characterized without the need for lithographical patterning and masks on the substrate. Both excitonic and biexcitonic emissions are observed from single dots, appearing as doublets with a fine-structure splitting of 320 μeV. Hanbury Brown-Twiss correlation measurements for the excitonic emission under cw excitation show anti-bunching behavior with an autocorrelation value of g{sup (2)}(0)=0.2. This system is applicable as a single-photon source for applications such as quantum cryptography. The formation of well-ordered chains of InP quantum dots on GaAs (001) substrates by using self-organized In{sub 0.48}Ga{sub 0.52}P surface undulations as a template is also demonstrated. The ordering requires neither stacked layers of quantum dots nor substrate misorientation. The structures are investigated by polarization-dependent photoluminescence together with transmission electron microscopy. Luminescence from the In{sub 0.48}Ga{sub 0.52}P matrix is polarized in one crystallographic direction due to anisotropic strain arising from a lateral compositional modulation. The photoluminescence measurements show enhanced linear polarization in the alignment direction of quantum dots. A polarization degree of 66% is observed. The optical anisotropy is achieved with a straightforward heterostructure, requiring only a single layer of QDs.

CHARACTERIZATION OF THE ALKANE-INDUCIBLE CYTOCHROME P450 (P450ALK) GENE FROM THE YEAST CANDIDA TROPICALIS: IDENTIFICATION OF A NEW P450 FAMILY

Science.gov (United States)

The P450alk gene, which is inducible by the assimilation of alkane in Candida tropicalis, was sequenced and characterized. Structural features described in promoter and terminator regions of Saccharomyces yeast genes are present in the P450alk gene and some particular structures ...

Characterization of the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome : a (phylo)genetic study

NARCIS (Netherlands)

Hu, Z.

1998-01-01

<p>Baculoviruses are attractive biological alternatives to chemical insecticides for insect pest control. So far, more than 600 baculoviruses have been isolated from different insect species which provide a rich resource for developing new viral insecticides. Most baculoviruses are host

Hsf1p and Msn2/4p cooperate in the expression of Saccharomyces cerevisiae genes HSP26 and HSP104 in a gene- and stress type-dependent manner.

Science.gov (United States)

Amorós, M; Estruch, F

2001-03-01

Saccharomyces cerevisiae possesses several transcription factors involved in the transcriptional activation of stress-induced genes. Among them, the heat shock factor (Hsf1p) and the zinc finger proteins of the general stress response (Msn2p and Msn4p) have been shown to play a major role in stress protection. Some heat shock protein (HSP) genes contain both heat shock elements (HSEs) and stress response elements (STREs), suggesting the involvement of both transcription factors in their regulation. Analysis of the stress-induced expression of two of these genes, HSP26 and HSP104, reveals that the contribution of Hsf1p and Msn2/4p is different depending on the gene and the stress condition.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

Influence of X-ray on the P53 gene in human peripheral blood lymphocytes

International Nuclear Information System (INIS)

Jin Wenwei; Cai Ting

2002-01-01

Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation

Identification of nucleopolyhedrovirus that infect Nymphalid butterflies Agraulis vanillae and Dione juno.

Science.gov (United States)

Rodríguez, Vanina Andrea; Belaich, Mariano Nicolás; Gómez, Diego Luis Mengual; Sciocco-Cap, Alicia; Ghiringhelli, Pablo Daniel

2011-02-01

Dione juno and Agraulis vanillae are very common butterflies in natural gardens in South America, and also bred worldwide. In addition, larvae of these butterflies are considered as pests in crops of Passiflora spp. For these reasons, it is important to identify and describe pathogens of these species, both for preservation purposes and for use in pest control. Baculoviridae is a family of insect viruses that predominantly infect species of Lepidoptera and are used as bioinsecticides. Larvae of D. juno and A. vanillae exhibiting symptoms of baculovirus infection were examined for the presence of baculoviruses by PCR and transmission electron microscopy. Degenerate primers were designed and used to amplify partial sequences from the baculovirus p74, cathepsin, and chitinase genes, along with previously designed primers for amplification of lef-8, lef-9, and polh. Sequence data from these six loci, along with ultrastructural observations on occlusion bodies isolated from the larvae, confirmed that the larvae were infected with nucleopolyhedroviruses from genus Alphabaculovirus. The NPVs from the two different larval hosts appear to be variants of the same, previously undescribed baculovirus species. Phylogenetic analysis of the sequence data placed these NPVs in Alphabaculovirus group I/clade 1b. Copyright © 2010 Elsevier Inc. All rights reserved.

MUTATION ON WD DIPEPTIDE MOTIFS OF THE p48 SUBUNIT OF CHROMATIN ASSEMBLY FACTOR-1 CAUSING VIABILITY AND GROWTH OF DT40 CHICKEN B CELL LINE

Directory of Open Access Journals (Sweden)

Ahyar Ahmad

2010-07-01

Full Text Available Chromatin assembly factor-1 (CAF-1, a protein complex consisting of three subunits, p150, p60, and p48, is highly conserved from yeast to humans and facilitated nucleosome assembly of newly replicated DNA. The p48 subunit, CAF-1p48 (p48, with seven WD (Trp-Asp repeat motifs, is a member of the WD protein family. The immunoprecipitation experiment revealed that ß-propeller structure of p48 was less stringent for it's binding to HDAC-1, but more stringent for its binding to both histones H4 and CAF-1p60 but not to ASF-1, indicating that the proper ß-propeller structure of p48 is essential for the binding to these two proteins histone H4 and CAF-1p60. Complementation experiments, involving missense and truncated mutants of FLAG-tagged p48, revealed that mutations of every of seven WD dipeptide motifs, like both the N-terminal and C-terminal truncated mutations, could not rescue for the tet-induced lethality. These results indicate not only that p48 is essential for the viability of vertebrate cells, although the yeast p48 homolog is nonessential, but also that all the seven WD dipeptide motifs are necessary for the maintenance of the proper structure of p48 that is fundamentally important for cell viability.   Keywords: Chromatin assembly factor-1, complementation experiments, viability

A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

Directory of Open Access Journals (Sweden)

Agnes C. Fett-Conte

2002-04-01

Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

Science.gov (United States)

Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

2018-01-11

Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Expression of major piroplasm protein (p33) of Theileria sergenti (Korean isolate) and its immunogenicity in guinea pigs

OpenAIRE

Kang, Seung-Won; Kweon, Chang-Hee; Choi, Eun-Jin; Yoon, Yong-Dhuk

1999-01-01

To investigate the development of a subunit vaccine against theileriosis in cattle, the DNA fragments encoding piroplasm surface protein (p33) of Theileria sergenti of a Korean isolate were expressed in baculoviruses. The expressed p33 was characterized by indirect fluorescent antibody (IFA) and western blotting analysis. The expression of p33 was mainly detected on the surface of infected Sf21 cells by IFA. The immunoblotting analysis revealed the presence of a same molecular weight protein ...

Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP

Science.gov (United States)

Sakudo, Akikazu; Onodera, Takashi

2015-01-01

Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp−/−) mice. So far, six types of Prnp−/− mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not fully reveal PrP functions. Recently, varieties of Prnp−/− cell lines established from Prnp−/− mice have contributed to the analysis of PrP functions. In this mini-review, we focus on Prnp−/− cell lines and summarize currently available Prnp−/− cell lines and their characterizations. In addition, we introduce the recent advances in the methodology of cell line generation with knockout or knockdown of the PrP gene. We also discuss how these cell lines have provided valuable insights into PrP functions and show future perspectives. PMID:25642423

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

Science.gov (United States)

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

p53 as the focus of gene therapy: past, present and future.

Science.gov (United States)

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

The gntP Gene of Escherichia coli Involved in Gluconate Uptake

DEFF Research Database (Denmark)

Klemm, Per; Tong, S.; Nielsen, Henrik

1996-01-01

The gntP gene, located between the fim and uxu loci in Escherichia coli K-12, has been cloned and characterized. Nucleotide sequencing of a region encompassing the gntP gene revealed an open reading frame of 447 codons with significant homology to the Bacillus subtilis gluconate permease. Northern...

Nano-sized calcium phosphate (CaP) carriers for non-viral gene deilvery

Energy Technology Data Exchange (ETDEWEB)

Lee, Donghyun, E-mail: dhlee@cau.ac.kr [Department of Biomedical Engineering, Division of Integrative Engineering, Chung-Ang University, 221 Heukseok-Dong, Dongjak-Gu, Seoul 156-756 (Korea, Republic of); Upadhye, Kalpesh [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Mechanical Engineering and Materials Sceince, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Chemical and Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States)

2012-02-25

Highlights: Black-Right-Pointing-Pointer Nanostructured calcium phosphates (NanoCaPs): comprehensive review. Black-Right-Pointing-Pointer Non viral gene delivery mechanisms: detailed mechanisms are outlined. Black-Right-Pointing-Pointer Barriers to non-viral gene delivery: detailed barriers are discussed. - Abstract: Gene therapy has garnered much interest due to the potential for curing multiple inherited and/or increases in the acquired diseases. As a result, there has been intense activity from multiple research groups for developing effective delivery methods and carriers, which is a critical step in advancing gene delivery technologies. In order for the carriers to effectively deliver the genetic payloads, multiple extracellular and intracellular barriers need to be overcome. Although overcoming these challenges to improve the effectiveness is critical, the development of safe gene delivery agents is even more vital to assure its use in clinical applications. The development of safe and effective strategies has therefore been a major challenge impeding gene therapy progress. In this regard, calcium phosphate (CaP) based nano-particles has been considered as one of the candidate non-viral gene delivery vehicles, but has been plagued by inconsistent and low transfection efficiencies limiting its progress. There has been major research effort to improve the consistency and effectiveness of CaP based vectors. Currently, it is therefore thought that by controlling the various synthesis factors such as Ca/P ratio, mode of mixing, and type of calcium phosphate phase, such variability and inefficiency could be modulated. This review attempts to provide a comprehensive analysis of the current research activity in the development of CaP based ceramic and polymer-ceramic hybrid systems for non-viral gene delivery. Preliminary transfection results of hydroxyapatite (HA or NanoCaPs), amorphous calcium phosphate (ACP) and brushite phases are also compared to assess the

Low pH induces co-ordinate regulation of gene expression in oesophageal cells.

Science.gov (United States)

Duggan, Shane P; Gallagher, William M; Fox, Edward J P; Abdel-Latif, Mohammed M; Reynolds, John V; Kelleher, Dermot

2006-02-01

The development of gastro-oesophageal reflux disease (GORD) is known to be a causative risk factor in the evolution of adenocarcinoma of the oesophagus. The major component of this reflux is gastric acid. However, the impact of low pH on gene expression has not been extensively studied in oesophageal cells. This study utilizes a transcriptomic and bioinformatic approach to assess regulation of gene expression in response to low pH. In more detail, oesophageal adenocarcinoma cell lines were exposed to a range of pH environments. Affymetrix microarrays were used for gene-expression analysis and results were validated using cycle limitation and real-time RT-PCR analysis, as well as northern and western blotting. Comparative promoter transcription factor binding site (TFBS) analysis (MatInspector) of hierarchically clustered gene-expression data was employed to identify the elements which may co-ordinately regulate individual gene clusters. Initial experiments demonstrated maximal induction of EGR1 gene expression at pH 6.5. Subsequent array experimentation revealed significant induction of gene expression from such functional categories as DNA damage response (EGR1-4, ATF3) and cell-cycle control (GADD34, GADD45, p57). Changes in expression of EGR1, EGR3, ATF3, MKP-1, FOSB, CTGF and CYR61 were verified in separate experiments and in a variety of oesophageal cell lines. TFBS analysis of promoters identified transcription factors that may co-ordinately regulate gene-expression clusters, Cluster 1: Oct-1, AP4R; Cluster 2: NF-kB, EGRF; Cluster 3: IKRS, AP-1F. Low pH has the ability to induce genes and pathways which can provide an environment suitable for the progression of malignancy. Further functional analysis of the genes and clusters identified in this low pH study is likely to lead to new insights into the pathogenesis and therapeutics of GORD and oesophageal cancer.

Alterations in tumour suppressor gene p53 in human gliomas from ...

Indian Academy of Sciences (India)

Unknown

Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

Computational identification of putative cytochrome P450 genes in ...

African Journals Online (AJOL)

In this work, a computational study of expressed sequence tags (ESTs) of soybean was performed by data mining methods and bio-informatics tools and as a result 78 putative P450 genes were identified, including 57 new ones. These genes were classified into five clans and 20 families by sequence similarities and among ...

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

The cross section measurement for the reactions of 48,46Ti(n,p) 48,46Sc, 50Ti(n, α)47Ca and 58Ni (n, 2n)57Ni, 58Ni(n,p)58m+gCo

International Nuclear Information System (INIS)

Yuan Junqian; Wang Yongchang; Kong Xiangzhong; Yang Jingkang

1992-01-01

The cross sections for the 50 Ti(n, α) 47 Ca, 46 Ti(n, p) 46 Sc, 48 Ti(n, p) 48 Sc and 58 Ni(n, 2n) 57 Ni, 58 Ni(n, p) 58m+g Co reactions have been measured by using the activation method relative to the cross sections of the 27 Al(n, α) 24 Na reaction in the neutron energy range of 13.50-14.81 MeV. The neutron energies were determined by the cross section ratios of the 90 Zr(n, 2n) 89m+g Zr and 93 Nb(n, 2n) 92m Nb reactions. The results obtained are compared with the published and to be published data of several authors

Bladder-like graphical representation of p53 gene alterations in some human cancers

International Nuclear Information System (INIS)

Helal, N.L.; Dorrah, M.; LI, C.

2005-01-01

the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

Science.gov (United States)

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Challenges in biotechnology at LLNL: from genes to proteins; TOPICAL

International Nuclear Information System (INIS)

Albala, J S

1999-01-01

This effort has undertaken the task of developing a link between the genomics, DNA repair and structural biology efforts within the Biology and Biotechnology Research Program at LLNL. Through the advent of the I.M.A.G.E. (Integrated Molecular Analysis of Genomes and their Expression) Consortium, a world-wide effort to catalog the largest public collection of genes, accepted and maintained within BBRP, it is now possible to systematically express the protein complement of these to further elucidate novel gene function and structure. The work has ensued in four phases, outlined as follows: (1) Gene and System selection; (2) Protein expression and purification; (3) Structural analysis; and (4) biological integration. Proteins to be expressed have been those of high programmatic interest. This includes, in particular, proteins involved in the maintenance of genome integrity, particularly those involved in the repair of DNA damage, including ERCC1, ERCC4, XRCC2, XRCC3, XRCC9, HEX1, APN1, p53, RAD51B, RAD51C, and RAD51. Full-length cDNA cognates of selected genes were isolated, and cloned into baculovirus-based expression vectors. The baculoviral expression system for protein over-expression is now well-established in the Albala laboratory. Procedures have been successfully optimized for full-length cDNA clining into expression vectors for protein expression from recombinant constructs. This includes the reagents, cell lines, techniques necessary for expression of recombinant baculoviral constructs in Spodoptera frugiperda (Sf9) cells. The laboratory has also generated a high-throughput baculoviral expression paradigm for large scale expression and purification of human recombinant proteins amenable to automation

Nine co-localized cytochrome P450 genes of the CYP2N, CYP2AD, and CYP2P gene families in the mangrove killifish Kryptolebias marmoratus genome: Identification and expression in response to B[α]P, BPA, OP, and NP.

Science.gov (United States)

Puthumana, Jayesh; Kim, Bo-Mi; Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Jung, Jee-Hyun; Kim, Il-Chan; Hwang, Un-Ki; Lee, Jae-Seong

2017-06-01

The CYP2 genes are the largest and most diverse cytochrome P450 (CYP) subfamily in vertebrates. We have identified nine co-localized CYP2 genes (∼55kb) in a new cluster in the genome of the highly resilient ecotoxicological fish model Kryptolebias marmoratus. Molecular characterization, temporal and tissue-specific expression pattern, and response to xenobiotics of these genes were examined. The CYP2 gene clusters were characterized and designated CYP2N22-23, CYP2AD12, and CYP2P16-20. Gene synteny analysis confirmed that the cluster in K. marmoratus is similar to that found in other teleost fishes, including zebrafish. A gene duplication event with diverged catalytic function was observed in CYP2AD12. Moreover, a high level of divergence in expression was observed among the co-localized genes. Phylogeny of the cluster suggested an orthologous relationship with similar genes in zebrafish and Japanese medaka. Gene expression analysis showed that CYP2P19 and CYP2N20 were consecutively expressed throughout embryonic development, whereas CYP2P18 was expressed in all adult tissues, suggesting that members of each CYP2 gene family have different physiological roles even though they are located in the same cluster. Among endocrine-disrupting chemicals (EDCs), benzo[α]pyrene (B[α]P) induced expression of CYP2N23, bisphenol A (BPA) induced CYP2P18 and CYP2P19, and 4-octylphenol (OP) induced CYP2AD12, but there was no significant response to 4-nonylphenol (NP), implying differential catalytic roles of the enzyme. In this paper, we identify and characterize a CYP2 gene cluster in the mangrove killifish K. marmoratus with differing catalytic roles toward EDCs. Our findings provide insights on the roles of nine co-localized CYP2 genes and their catalytic functions for better understanding of chemical-biological interactions in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

Antibacterial protection by enterocin AS-48 in sport and energy drinks with less acidic pH values.

Science.gov (United States)

Viedma, Pilar Martinez; Abriouel, Hikmate; Ben Omar, Nabil; López, Rosario Lucas; Valdivia, Eva; Gálvez, Antonio

2009-04-01

The low pH and acid content found in sports and energy drinks are a matter of concern in dental health. Raising the pH may solve this problem, but at the same time increase the risks of spoilage or presence of pathogenic bacteria. In the present study, commercial energy drinks were adjusted to pH 5.0 and challenged with Listeria monocytogenes (drinks A to F), Staphylococcus aureus, Bacillus cereus, and Bacillus licheniformis (drink A) during storage at 37 degrees C. L. monocytogenes was able to grow in drink A and survived in drinks D and F for at least 2 days. Addition of enterocin AS-48 (1 microg/ml final concentration) rapidly inactivated L. monocytogenes in all drinks tested. S. aureus and B. cereus also survived quite well in drink A, and were completely inactivated by 12.5 microg/ml enterocin AS-48 after 2 days of storage or by 25 microg/ml bacteriocin after 1 day. B. licheniformis was able to multiply in drink A, but it was completely inactivated by 5 microg/ml enterocin AS-48 after 2 days of storage or by 12.5 microg/ml bacteriocin after 1 day. Results from the present study suggest that enterocin AS-48 could be used as a natural preservative against these target bacteria in less acidic sport and energy drinks.

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose.

Science.gov (United States)

Ju, Huanyu; Wei, Na; Wang, Qian; Wang, Chunyuan; Jing, Zhiqiang; Guo, Lu; Liu, Dapeng; Gao, Mingchun; Ma, Bo; Wang, Junwei

2011-05-27

Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particles (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs. Copyright © 2011 Elsevier Inc. All rights reserved.

Genetical and functional investigation of fliC genes encoding flagellar serotype H4 in wildtype strains of Escherichia coli and in a laboratory E. coli K-12 strain expressing flagellar antigen type H48

Directory of Open Access Journals (Sweden)

Schaudinn Christoph

2005-01-01

Full Text Available Abstract Background Serotyping of O-(lipopolysaccharide and H-(flagellar antigens is a wideley used method for identification of pathogenic strains and clones of Escherichia coli. At present, 176 O- and 53 H-antigens are described for E. coli which occur in different combinations in the strains. The flagellar antigen H4 is widely present in E. coli strains of different O-serotypes and pathotypes and we have investigated the genetic relationship between H4 encoding fliC genes by PCR, nucleotide sequencing and expression studies. Results The complete nucleotide sequence of fliC genes present in E. coli reference strains U9-41 (O2:K1:H4 and P12b (O15:H17 was determined and both were found 99.3% (1043 of 1050 nucleotides identical in their coding sequence. A PCR/RFLP protocol was developed for typing of fliC-H4 strains and 88 E. coli strains reacting with H4 antiserum were investigated. Nucleotide sequencing of complete fliC genes of six E. coli strains which were selected based on serum agglutination titers, fliC-PCR genotyping and reference data revealed 96.6 to 100% identity on the amino acid level. The functional expression of flagellin encoded by fliC-H4 from strain U9-41 and from our strain P12b which is an H4 expressing variant type was investigated in the E. coli K-12 strain JM109 which encodes flagellar type H48. The fliC recombinant plasmid carrying JM109 strains reacted with both H4 and H48 specific antisera whereas JM109 reacted only with the H48 antiserum. By immunoelectron microscopy, we could show that the flagella made by the fliC-H4 recombinant plasmid carrying strain are constituted of H48 and H4 flagellins which are co-assembled into functional flagella. Conclusion The flagellar serotype H4 is encoded by closely related fliC genes present in serologically different types of E. coli strainswhich were isolated at different time periods and geographical locations. Our expression studies show for the first time, that flagellins of

Computational identification of putative cytochrome P450 genes in ...

African Journals Online (AJOL)

Chattha

Economically, legumes represent the second most important family of crop plants after Poacea (grass family), accounting for ... further characterization of P450 genes with both known and unknown functions. MATERIALS AND METHODS ..... Cytochrome P450. In: Somerville CR, Meyerowitz EM (eds) .The Arabidopsis book,.

Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

Science.gov (United States)

Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

2018-06-13

Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

Directory of Open Access Journals (Sweden)

Dinh Thi Bich Lan

2014-12-01

Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

Identification of Genes Induced in Lolium multiflorum by Bacterial Wilt Infection

DEFF Research Database (Denmark)

Wichmann, Fabienne; Asp, Torben; Widmer, Franco

2010-01-01

was hybridized to a cDNA microarray containing 10,000 unique genes from L. perenne. Comparisons and statistical analyses of the gene expression profiles revealed 0, 20, 52 and 124 differentially regulated genes 8, 48, 192 and 288 h after infection compared to non-infected controls and considering a p...

Expression of foot-and-mouth disease virus capsid proteins in silkworm-baculovirus expression system and its utilization as a subunit vaccine.

Directory of Open Access Journals (Sweden)

Zhiyong Li

Full Text Available BACKGROUND: Foot-and-mouth disease (FMD is a highly contagious disease of livestock that causes severe economic loss in susceptible cloven-hoofed animals. Although the traditional inactivated vaccine has been proved effective, it may lead to a new outbreak of FMD because of either incomplete inactivation of FMDV or the escape of live virus from vaccine production workshop. Thus, it is urgent to develop a novel FMDV vaccine that is safer, more effective and more economical than traditional vaccines. METHODOLOGY AND PRINCIPAL FINDINGS: A recombinant silkworm baculovirus Bm-P12A3C which contained the intact P1-2A and 3C protease coding regions of FMDV Asia 1/HNK/CHA/05 was developed. Indirect immunofluorescence test and sandwich-ELISA were used to verify that Bm-P12A3C could express the target cassette. Expression products from silkworm were diluted to 30 folds and used as antigen to immunize cattle. Specific antibody was induced in all vaccinated animals. After challenge with virulent homologous virus, four of the five animals were completely protected, and clinical symptoms were alleviated and delayed in the remaining one. Furthermore, a PD(50 (50% bovine protective dose test was performed to assess the bovine potency of the subunit vaccine. The result showed the subunit vaccine could achieve 6.34 PD(50 per dose. CONCLUSION: The results suggest that this strategy might be used to develop the new subunit FMDV vaccine.

Induction of P450 genes in Nilaparvata lugens and Sogatella furcifera by two neonicotinoid insecticides.

Science.gov (United States)

Yang, Yuan-Xue; Yu, Na; Zhang, Jian-Hua; Zhang, Yi-Xi; Liu, Ze-Wen

2018-06-01

Nilaparvata lugens and Sogatella furcifera are two primary planthoppers on rice throughout Asian countries and areas. Neonicotinoid insecticides, such as imidacloprid (IMI), have been extensively used to control rice planthoppers and IMI resistance consequently occurred with an important mechanism from the over-expression of P450 genes. The induction of P450 genes by IMI may increase the ability to metabolize this insecticide in planthoppers and increase the resistance risk. In this study, the induction of P450 genes was compared in S. furcifera treated with IMI and nitromethyleneimidazole (NMI), in two planthopper species by IMI lethal dose that kills 85% of the population (LD 85 ), and in N. lugens among three IMI doses (LD 15 , LD 50 and LD 85 ). When IMI and NMI at the LD 85 dose were applied to S. furcifera, the expression changes in most P450 genes were similar, including the up-regulation of nine genes and down-regulation of three genes. In terms of the expression changes in 12 homologous P450 genes between N. lugens and S. furcifera treated with IMI at the LD 85 dose, 10 genes had very similar patterns, such as up-regulation in seven genes, down-regulation in one gene and no significant changes in two genes. When three different IMI doses were applied to N. lugens, the changes in P450 gene expression were much different, such as up-regulation in four genes at all doses and dose-dependent regulation of the other nine genes. For example, CYP6AY1 could be induced by all IMI doses, while CYP6ER1 was only up-regulated by the LD 50 dose, although both genes were reported important in IMI resistance. In conclusion, P450 genes in two planthopper species showed similar regulation patterns in responding to IMI, and the two neonicotinoid insecticides had similar effects on P450 gene expression, although the regulation was often dose-dependent. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Introduction of OXA-48-producing Enterobacteriaceae to Israeli hospitals by medical tourism.

Science.gov (United States)

Adler, Amos; Shklyar, Maya; Schwaber, Mitchell J; Navon-Venezia, Shiri; Dhaher, Yacoub; Edgar, Rotem; Solter, Ester; Benenson, Shmuel; Masarwa, Samira; Carmeli, Yehuda

2011-12-01

The carbapenemase OXA-48 has been reported from different Mediterranean countries. It is mostly encoded on a single plasmid in various Enterobacteriaceae species. We characterized the epidemiological and molecular features of OXA-48-producing Enterobacteriaceae (OPE) in Israel. Epidemiological investigation was conducted by the National Center for Infection Control. Genotyping was performed using multilocus sequence typing. The bla(OXA-48)-carrying plasmids were investigated using S1 endonuclease and restriction fragment length polymorphism (RFLP). Conjugation efficiency of the bla(OXA-48)-carrying plasmids was studied in a filter mating experiment. Since 2007, four OPE-infected patients were identified, all non-Israeli (two Palestinian, one Jordanian and one Georgian). Three had prior hospitalization; two in Jordan and one in Georgia. The bla(OXA-48) gene was detected in three Escherichia coli strains belonging to different clonal complexes, one Klebsiella oxytoca and one Klebsiella pneumoniae sequence type 101, as previously reported from Tunisia and Spain. In all isolates, the bla(OXA-48) gene was located inside Tn1999.2 and was carried on a 60 kb plasmid with an identical RFLP pattern. The plasmid was able to conjugate from Klebsiella spp. to E. coli, and had a conjugation efficiency up to ~10000 times higher than that of pKpQIL. OPE, introduced mainly by medical tourism, are an emerging threat to patients from affected Mediterranean countries. The bla(OXA-48)-carrying plasmid demonstrated remarkable conjugation efficiency, which is probably important in the success of its dissemination.

Expression of multidrug resistance gene and P-glycoprotein in nasopharyngealcarcinoma cells after irradiation

International Nuclear Information System (INIS)

Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen

2007-01-01

Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)

Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP

OpenAIRE

Sakudo, Akikazu; Onodera, Takashi

2015-01-01

Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp ?/?) mice. So far, six types of Prnp ?/? mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not ...

Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus.

Science.gov (United States)

Gong, Youhui; Li, Ting; Zhang, Lee; Gao, Xiwu; Liu, Nannan

2013-01-01

The expression of some insect P450 genes can be induced by both exogenous and endogenous compounds and there is evidence to suggest that multiple constitutively overexpressed P450 genes are co-responsible for the development of resistance to permethrin in resistant mosquitoes. This study characterized the permethrin induction profiles of P450 genes known to be constitutively overexpressed in resistant mosquitoes, Culex quinquefasciatus. The gene expression in 7 of the 19 P450 genes CYP325K3v1, CYP4D42v2, CYP9J45, (CYP) CPIJ000926, CYP325G4, CYP4C38, CYP4H40 in the HAmCqG8 strain, increased more than 2-fold after exposure to permethrin at an LC50 concentration (10 ppm) compared to their acetone treated counterpart; no significant differences in the expression of these P450 genes in susceptible S-Lab mosquitoes were observed after permethrin treatment. Eleven of the fourteen P450 genes overexpressed in the MAmCqG6 strain, CYP9M10, CYP6Z12, CYP9J33, CYP9J43, CYP9J34, CYP306A1, CYP6Z15, CYP9J45, CYPPAL1, CYP4C52v1, CYP9J39, were also induced more than doubled after exposure to an LC50 (0.7 ppm) dose of permethrin. No significant induction in P450 gene expression was observed in the susceptible S-Lab mosquitoes after permethrin treatment except for CYP6Z15 and CYP9J39, suggesting that permethrin induction of these two P450 genes are common to both susceptible and resistant mosquitoes while the induction of the others are specific to insecticide resistant mosquitoes. These results demonstrate that multiple P450 genes are co-up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, providing additional support for their involvement in the detoxification of insecticides and the development of insecticide resistance.

Expression induction of P450 genes by imidacloprid in Nilaparvata lugens: A genome-scale analysis.

Science.gov (United States)

Zhang, Jianhua; Zhang, Yixi; Wang, Yunchao; Yang, Yuanxue; Cang, Xinzhu; Liu, Zewen

2016-09-01

The overexpression of P450 monooxygenase genes is a main mechanism for the resistance to imidacloprid, a representative neonicotinoid insecticide, in Nilaparvata lugens (brown planthopper, BPH). However, only two P450 genes (CYP6AY1 and CYP6ER1), among fifty-four P450 genes identified from BPH genome database, have been reported to play important roles in imidacloprid resistance until now. In this study, after the confirmation of important roles of P450s in imidacloprid resistance by the synergism analysis, the expression induction by imidacloprid was determined for all P450 genes. In the susceptible (Sus) strain, eight P450 genes in Clade4, eight in Clade3 and two in Clade2 were up-regulated by imidacloprid, among which three genes (CYP6CS1, CYP6CW1 and CYP6ER1, all in Clade3) were increased to above 4.0-fold and eight genes to above 2.0-fold. In contrast, no P450 genes were induced in Mito clade. Eight genes induced to above 2.0-fold were selected to determine their expression and induced levels in Huzhou population, in which piperonyl butoxide showed the biggest effects on imidacloprid toxicity among eight field populations. The expression levels of seven P450 genes were higher in Huzhou population than that in Sus strain, with the biggest differences for CYP6CS1 (9.8-fold), CYP6ER1 (7.7-fold) and CYP6AY1 (5.1-fold). The induction levels for all tested genes were bigger in Sus strain than that in Huzhou population except CYP425B1. Screening the induction of P450 genes by imidacloprid in the genome-scale will provide an overall view on the possible metabolic factors in the resistance to neonicotinoid insecticides. The further work, such as the functional study of recombinant proteins, will be performed to validate the roles of these P450s in imidacloprid resistance. Copyright © 2015 Elsevier B.V. All rights reserved.

Pathogenic mutation in the ALS/FTD gene, CCNF, causes elevated Lys48-linked ubiquitylation and defective autophagy.

Science.gov (United States)

Lee, Albert; Rayner, Stephanie L; Gwee, Serene S L; De Luca, Alana; Shahheydari, Hamideh; Sundaramoorthy, Vinod; Ragagnin, Audrey; Morsch, Marco; Radford, Rowan; Galper, Jasmin; Freckleton, Sarah; Shi, Bingyang; Walker, Adam K; Don, Emily K; Cole, Nicholas J; Yang, Shu; Williams, Kelly L; Yerbury, Justin J; Blair, Ian P; Atkin, Julie D; Molloy, Mark P; Chung, Roger S

2018-01-01

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are fatal neurodegenerative disorders that have common molecular and pathogenic characteristics, such as aberrant accumulation and ubiquitylation of TDP-43; however, the mechanisms that drive this process remain poorly understood. We have recently identified CCNF mutations in familial and sporadic ALS and FTD patients. CCNF encodes cyclin F, a component of an E3 ubiquitin-protein ligase (SCF cyclin F ) complex that is responsible for ubiquitylating proteins for degradation by the ubiquitin-proteasome system. In this study, we examined the ALS/FTD-causing p.Ser621Gly (p.S621G) mutation in cyclin F and its effect upon downstream Lys48-specific ubiquitylation in transfected Neuro-2A and SH-SY5Y cells. Expression of mutant cyclin F S621G caused increased Lys48-specific ubiquitylation of proteins in neuronal cells compared to cyclin F WT . Proteomic analysis of immunoprecipitated Lys48-ubiquitylated proteins from mutant cyclin F S621G -expressing cells identified proteins that clustered within the autophagy pathway, including sequestosome-1 (p62/SQSTM1), heat shock proteins, and chaperonin complex components. Examination of autophagy markers p62, LC3, and lysosome-associated membrane protein 2 (Lamp2) in cells expressing mutant cyclin F S621G revealed defects in the autophagy pathway specifically resulting in impairment in autophagosomal-lysosome fusion. This finding highlights a potential mechanism by which cyclin F interacts with p62, the receptor responsible for transporting ubiquitylated substrates for autophagic degradation. These findings demonstrate that ALS/FTD-causing mutant cyclin F S621G disrupts Lys48-specific ubiquitylation, leading to accumulation of substrates and defects in the autophagic machinery. This study also demonstrates that a single missense mutation in cyclin F causes hyper-ubiquitylation of proteins that can indirectly impair the autophagy degradation pathway, which is

Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

Directory of Open Access Journals (Sweden)

Per Erixon

Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

Energy Technology Data Exchange (ETDEWEB)

Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

2007-02-15

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

International Nuclear Information System (INIS)

Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

2007-01-01

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

Comparative analysis of Homo sapiens and Mus musculus cyclin-dependent kinase (CDK) inhibitor genes p16 (MTS1) and p15 (MTS2).

Science.gov (United States)

Jiang, P; Stone, S; Wagner, R; Wang, S; Dayananth, P; Kozak, C A; Wold, B; Kamb, A

1995-12-01

Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these molecules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-beta (TGF-beta). To investigate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison suggests that a gene conversion event is part of the evolution of the human p15 and p16 genes.

Induction of cytochrome P450 1 genes and stress response genes in developing zebrafish exposed to ultraviolet radiation

Energy Technology Data Exchange (ETDEWEB)

Behrendt, Lars [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Joensson, Maria E. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Department of Environmental Toxicology, Uppsala University (Sweden); Goldstone, Jared V. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States)

2010-06-01

Ultraviolet (UV) radiation damages cell molecules, and has been suggested to up-regulate mammalian cytochrome P4501 (CYP1) genes through an aryl hydrocarbon receptor (AHR) mediated mechanism. In this study, embryos and larvae of zebrafish (Danio rerio) were exposed to UV to determine the effects on expression of CYP1 and stress response genes in vivo in these fish. Zebrafish embryos were exposed for varying times to UV on two consecutive days, with exposure beginning at 24 and 48 h post-fertilization (hpf). Embryos exposed for 2, 4 or 6 h twice over 2 days to UVB (0.62 W/m{sup 2}; 8.9-26.7 kJ/m{sup 2}) plus UVA (2.05 W/m{sup 2}; 29.5-144.6 kJ/m{sup 2}) had moderately (2.4 {+-} 0.8-fold) but significantly up-regulated levels of CYP1A. UVA alone had no effect on CYP1A expression. Proliferating cellular nuclear antigen (PCNA) and Cu-Zn superoxide dismutase (SOD1) transcript levels were induced (2.1 {+-} 0.2 and 2.3 {+-} 0.5-fold, respectively) in embryos exposed to two 6-h pulses of 0.62 W/m{sup 2} UVB (26.8 kJ/m{sup 2}). CYP1A was induced also in embryos exposed to higher intensity UVB (0.93 W/m{sup 2}) for two 3-h or two 4-h pulses (20.1 or 26.8 kJ/m{sup 2}). CYP1B1, SOD1 and PCNA expression was induced by the two 3-h pulses of the higher intensity UVB, but not after two 4-h pulses of the higher intensity UVB, possibly due to impaired condition of surviving embryos, reflected in a mortality of 34% at that UVB dose. A single 8-h long exposure of zebrafish larvae (8 dpf) to UVB at 0.93 W/m{sup 2} (26.8 kJ/m{sup 2}) significantly induced CYP1A and CYP1B1 expression, but other CYP1 genes (CYP1C1, CYP1C2 and CYP1D1) showed no significant increase. The results show that UVB can induce expression of CYP1 genes as well stress response genes in developing zebrafish, and that UVB intensity and duration influence the responses.

Transcriptional regulation of pWW0 transfer genes in Pseudomonas putida KT2440

DEFF Research Database (Denmark)

Lambertsen, L.M.; Molin, Søren; Kroer, N.

2004-01-01

The conjugative IncP-9 plasmid pWW0 (TOL) carries transfer genes, many of whose functions can be predicted from sequence similarities to the well-studied IncW and IncP-1 plasmids, and that are clustered with the replication and maintenance genes of the plasmid core. In this study we show that the...

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

Energy Technology Data Exchange (ETDEWEB)

Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

2003-09-01

Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

Science.gov (United States)

Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

2015-03-10

Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Identification of target genes of the p16INK4A-pRB-E2F pathway

DEFF Research Database (Denmark)

Vernell, Richard; Helin, Kristian; Müller, Heiko

2003-01-01

as physiological targets of the pRB pathway, and the further characterization of these genes should provide insights into how this pathway controls proliferation. We show that Gibbs sampling detects enrichment of several sequence motifs, including E2F consensus binding sites, in the upstream regions of these genes...

The genetic alteration of p53 in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

1996-01-01

Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

Status and advances of p53-gene therapy and radiotherapy in malignant tumor

International Nuclear Information System (INIS)

Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

2006-01-01

Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

Normalization and gene p-value estimation: issues in microarray data processing.

Science.gov (United States)

Fundel, Katrin; Küffner, Robert; Aigner, Thomas; Zimmer, Ralf

2008-05-28

Numerous methods exist for basic processing, e.g. normalization, of microarray gene expression data. These methods have an important effect on the final analysis outcome. Therefore, it is crucial to select methods appropriate for a given dataset in order to assure the validity and reliability of expression data analysis. Furthermore, biological interpretation requires expression values for genes, which are often represented by several spots or probe sets on a microarray. How to best integrate spot/probe set values into gene values has so far been a somewhat neglected problem. We present a case study comparing different between-array normalization methods with respect to the identification of differentially expressed genes. Our results show that it is feasible and necessary to use prior knowledge on gene expression measurements to select an adequate normalization method for the given data. Furthermore, we provide evidence that combining spot/probe set p-values into gene p-values for detecting differentially expressed genes has advantages compared to combining expression values for spots/probe sets into gene expression values. The comparison of different methods suggests to use Stouffer's method for this purpose. The study has been conducted on gene expression experiments investigating human joint cartilage samples of osteoarthritis related groups: a cDNA microarray (83 samples, four groups) and an Affymetrix (26 samples, two groups) data set. The apparently straight forward steps of gene expression data analysis, e.g. between-array normalization and detection of differentially regulated genes, can be accomplished by numerous different methods. We analyzed multiple methods and the possible effects and thereby demonstrate the importance of the single decisions taken during data processing. We give guidelines for evaluating normalization outcomes. An overview of these effects via appropriate measures and plots compared to prior knowledge is essential for the biological

Protection against Amoebic Liver Abscess in Hamster by Intramuscular Immunization with an Autographa californica Baculovirus Driving the Expression of the Gal-Lectin LC3 Fragment

Directory of Open Access Journals (Sweden)

Dulce María Meneses-Ruiz

2015-01-01

Full Text Available In a previous study, we demonstrated that oral immunization using Autographa californica baculovirus driving the expression of the Gal-lectin LC3 fragment (AcNPV-LC3 of Entamoeba histolytica conferred protection against ALA development in hamsters. In this study, we determined the ability of AcNPV-LC3 to protect against ALA by the intramuscular route as well as the liver immune response associated with protection. Results showed that 55% of hamsters IM immunized with AcNPV-LC3 showed sterile protection against ALA, whereas other 20% showed reduction in the size and extent of abscesses, resulting in some protection in 75% of animals compared to the sham control group. Levels of protection showed a linear correlation with the development and intensity of specific antiamoeba cellular and humoral responses, evaluated in serum and spleen of hamsters, respectively. Evaluation of the Th1/Th2 cytokine patterns expressed in the liver of hamsters showed that sterile protection was associated with the production of high levels of IFNγ and IL-4. These results suggest that the baculovirus system is equally efficient by the intramuscular as well as the oral routes for ALA protection and that the Gal-lectin LC3 fragment is a highly protective antigen against hepatic amoebiasis through the local induction of IFNγ and IL-4.

In planta functions of cytochrome P450 monooxygenase genes in the phytocassane biosynthetic gene cluster on rice chromosome 2.

Science.gov (United States)

Ye, Zhongfeng; Yamazaki, Kohei; Minoda, Hiromi; Miyamoto, Koji; Miyazaki, Sho; Kawaide, Hiroshi; Yajima, Arata; Nojiri, Hideaki; Yamane, Hisakazu; Okada, Kazunori

2018-06-01

In response to environmental stressors such as blast fungal infections, rice produces phytoalexins, an antimicrobial diterpenoid compound. Together with momilactones, phytocassanes are among the major diterpenoid phytoalexins. The biosynthetic genes of diterpenoid phytoalexin are organized on the chromosome in functional gene clusters, comprising diterpene cyclase, dehydrogenase, and cytochrome P450 monooxygenase genes. Their functions have been studied extensively using in vitro enzyme assay systems. Specifically, P450 genes (CYP71Z6, Z7; CYP76M5, M6, M7, M8) on rice chromosome 2 have multifunctional activities associated with ent-copalyl diphosphate-related diterpene hydrocarbons, but the in planta contribution of these genes to diterpenoid phytoalexin production remains unknown. Here, we characterized cyp71z7 T-DNA mutant and CYP76M7/M8 RNAi lines to find that potential phytoalexin intermediates accumulated in these P450-suppressed rice plants. The results suggested that in planta, CYP71Z7 is responsible for C2-hydroxylation of phytocassanes and that CYP76M7/M8 is involved in C11α-hydroxylation of 3-hydroxy-cassadiene. Based on these results, we proposed potential routes of phytocassane biosynthesis in planta.

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

A Baculovirus immediate-early gene, ie1, promoter drives efficient expression of a transgene in both Drosophila melanogaster and Bombyx mori.

Directory of Open Access Journals (Sweden)

Mika Masumoto

Full Text Available Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively; however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus

Energy Technology Data Exchange (ETDEWEB)

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon, E-mail: jeonghoon@skku.edu; Lee, Jae-Seong, E-mail: jslee2@skku.edu

2017-03-15

Highlights: • Impaired effects of UV-B on the copepod Tigriopus japonicus were examined. • Modulation of entire CYP genes were analyzed in response to UV-B. • CYP inhibitor (PBO) confirmed the role of CYP in UV-B induced mortality. • Low-dose UV-B found induce developmental delays, and higher doses cause reproductive impairments. • Study predicted the mechanistic effects of UV-B in copepods through the AhR-mediated up-regulation of CYP genes. - Abstract: To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P < 0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48 h LD10 and LD50 were 1.35 and 1.84 kJ/m{sup 2}, and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5 kJ/m{sup 2}) induced developmental delays, and higher doses (6–18 kJ/m{sup 2}) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12 kJ/m{sup 2}) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus

International Nuclear Information System (INIS)

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

2017-01-01

Highlights: • Impaired effects of UV-B on the copepod Tigriopus japonicus were examined. • Modulation of entire CYP genes were analyzed in response to UV-B. • CYP inhibitor (PBO) confirmed the role of CYP in UV-B induced mortality. • Low-dose UV-B found induce developmental delays, and higher doses cause reproductive impairments. • Study predicted the mechanistic effects of UV-B in copepods through the AhR-mediated up-regulation of CYP genes. - Abstract: To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P < 0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48 h LD10 and LD50 were 1.35 and 1.84 kJ/m"2, and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5 kJ/m"2) induced developmental delays, and higher doses (6–18 kJ/m"2) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12 kJ/m"2) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes.

Stress induction of Bm1 RNA in silkworm larvae: SINEs, an unusual class of stress genes

Science.gov (United States)

Kimura, Richard H.; Choudary, Prabhakara V.; Stone, Koni K.; Schmid, Carl W.

2001-01-01

This study surveys the induction of RNA polymerase III (Pol III)–directed expression of short interspersed element (SINE) transcripts by various stresses in an animal model, silkworm larvae. Sublethal heat shock and exposure to several toxic compounds increase the level of Bm1 RNA, the silkworm SINE transcript, while also transiently increasing expression of a well-characterized stress-induced transcript, Hsp70 messenger RNA (mRNA). In certain cases, the Bm1 RNA response coincides with that of Hsp70 mRNA, but more often Bm1 RNA responds later in recovery. Baculovirus infection and exposure to certain toxic compounds increase Bm1 RNA but not Hsp70 mRNA, showing that SINE induction is not necessarily coupled to transcription of this particular heat shock gene. SINEs behave as an additional class of stress-inducible genes in living animals but are unusual as stress genes because of their high copy number, genomic dispersion, and Pol III–directed transcription. PMID:11599568

Effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue

Directory of Open Access Journals (Sweden)

Min-Er Tang

2016-09-01

Full Text Available Objective: To study the effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue. Methods: A total of 56 patients with cervical cancer, 94 cases of patients with cervical intraepithelial neoplasia and 48 cases of patients with chronic cervicitis who were treated in our hospital from May 2013 to December 2015 were selected for study and included in malignant group, precancerous lesion group and benign group respectively. hrHPV infection as well as the expression of anti-apoptotic genes and proapoptotic genes in cervical tissue were detected. Results: hrHPV infection rate and viral load in cervical tissue of malignant group were significantly higher than those of precancerous lesion group and benign group; P27 and p16 levels in cervical tissue of malignant group were significantly lower than those of precancerous lesion group and benign group, and K-ras, c-myc, Prdx4 and TNFAIP8 levels were significantly higher than those of precancerous lesion group and benign group; the greater the HPV virus load, the lower the p27 and p16 levels and the higher the K-ras, c-myc, Prdx4 and TNFAIP8 levels in cervical tissue. Conclusions: hrHPV infection can result in tumor suppressor genes p27 and p16 expression deletion and increase the expression of proto-oncogene and apoptosis-inhibiting genes, and it is associated with the occurrence and development of cervical cancer.

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

Science.gov (United States)

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

Genome-wide identification of 52 cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus and their B[α]P-induced expression patterns.

Science.gov (United States)

Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong

2017-09-01

Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.

Positive relationship between p42.3 gene and inflammation in chronic non-atrophic gastritis.

Science.gov (United States)

Chen, Ping; Cui, Yun; Fu, Qing Yan; Lu, You Yong; Fang, Jing Yuan; Chen, Xiao Yu

2015-10-01

Gastric cancer (GC) is a typical type of inflammation-related tumor. The p42.3 gene is shown to be highly expressed in GC, but its association with gastritis remains unknown. We aimed to explore the relationship between gastric inflammation and p42.3 gene in vitro and in vivo. Normal gastric epithelial cells (GES-1) were treated with Helicobacter pylori (H. pylori) and tumor necrosis factor (TNF)-α. Total cell mRNA and protein were extracted and collected, and polymerase chain reaction and Western blot were performed to determine the relative expression of p42.3 gene. In total, 291 biopsy samples from patients with chronic non-atrophic gastritis were collected and immunohistochemistry was used to measure the p42.3 protein expression. The association between p42.3 protein expression and the clinicopathological characteristics of these patients were analyzed. Both H. pylori and TNF-α significantly enhanced the p42.3 protein expression in GES-1 cells in a time and dose-dependent manner. In addition, p42.3 gene expression was positively associated with the severity of gastric mucosal inflammation and H. pylori infection (P = 0.000). Its expression was significantly more common in severe gastric inflammation and in H. pylori-infected cases. p42.3 gene expression is associated with gastric mucosal inflammation that can be upregulated by TNF-α and H. pylori infection. © 2015 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

Long-term wireless pH monitoring of the distal esophagus: prolonging the test beyond 48 hours is unnecessary and may be misleading.

Science.gov (United States)

Capovilla, G; Salvador, R; Spadotto, L; Voltarel, G; Pesenti, E; Perazzolo, A; Nicoletti, L; Merigliano, S; Costantini, M

2017-10-01

Wireless pH monitoring of the esophagus has been widely used to detect GERD for more than a decade. It is generally well tolerated and accepted by patients, but it is still unclear whether prolonging a recording beyond the usual 48 hours can improve the test's diagnostic value. The aim of this study is to examine the diagnostic yield of 96-hour pH monitoring vis-à-vis 24- and 48-hour tests, and to ascertain whether any gain in diagnostic terms was of genuine clinical utility. Patients with suspected GERD underwent 4-day PPI-off wireless pH monitoring of the distal esophagus. The capsule was inserted under endoscopic control, 6 cm above the squamocolumnar junction. Average acid exposure time was calculated after 24, 48, and 96 hours of recording. Ninety-nine patients completed the 96 hour test, and formed the study sample. The wireless test method was used in 42 patients (42.4%) unable to tolerate the traditional pH-monitoring catheter, and in 57 (57.6%) with a previous negative pH study despite symptoms suggestive of GERD. On complete analysis, 47 patients (47.5%) had a pathological test result: 19 patients within the first 24 hours (19.2%, 24 hour group); another 16 after 48 hours (+16.2%, 48 hour group), and a further 12 (+12.1%, 96 hour group) only after 96 hours of monitoring. All 47 patients with an abnormal acid exposure were offered and accepted surgery (10 patients) or medical therapy (37 patients). Clinical follow-up was obtained in all patients with a positive Bravo test result after a median 67 months (IQR: 38-98) using a validated symptom questionnaire. A good outcome after fundoplication or medical therapy was achieved in 73.7% of patients in the 24 hour group, in 62.5% of those in the 48 hour group, and in only 25% of those in the 96 hour group, P = 0.02. Long-term wireless pH monitoring enables an increase in the diagnostic yield over traditional 24- and 48-hour pH studies, but prolonging the test may constitute an unwanted bias and prompt the

pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

Science.gov (United States)

Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2016-07-15

Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

Naturally acquired antibody responses to recombinant Pfs230 and Pfs48/45 transmission blocking vaccine candidates.

Science.gov (United States)

Jones, Sophie; Grignard, Lynn; Nebie, Issa; Chilongola, Jaffu; Dodoo, Daniel; Sauerwein, Robert; Theisen, Michael; Roeffen, Will; Singh, Shrawan Kumar; Singh, Rajesh Kumar; Singh, Sanjay; Kyei-Baafour, Eric; Tetteh, Kevin; Drakeley, Chris; Bousema, Teun

2015-07-01

Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso. We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p < 0.001) and 230CMB (p = 0.031). Membrane feeding assays on a separate dataset demonstrated an association between functional transmission reducing activity and antibody prevalence for both 10C (p = 0.017) and 230CMB (p = 0.049). 17 single nucleotide polymorphisms were found in pfs48/45 (from 126 samples), with 5 non-synonymous SNPs in the Pfs48/45 10C region. We conclude there are naturally acquired antibody responses to both vaccine candidates which have functional relevance by reducing the transmissibility of infected individuals. We identified genetic polymorphisms, in pfs48/45 which exhibited geographical specificity. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Adenoviral delivery of pan-caspase inhibitor p35 enhances bystander killing by P450 gene-directed enzyme prodrug therapy using cyclophosphamide+

International Nuclear Information System (INIS)

Doloff, Joshua C; Su, Ting; Waxman, David J

2010-01-01

Cytochrome P450-based suicide gene therapy for cancer using prodrugs such as cyclophosphamide (CPA) increases anti-tumor activity, both directly and via a bystander killing mechanism. Bystander cell killing is essential for the clinical success of this treatment strategy, given the difficulty of achieving 100% efficient gene delivery in vivo using current technologies. Previous studies have shown that the pan-caspase inhibitor p35 significantly increases CPA-induced bystander killing by tumor cells that stably express P450 enzyme CYP2B6 (Schwartz et al, (2002) Cancer Res. 62: 6928-37). To further develop this approach, we constructed and characterized a replication-defective adenovirus, Adeno-2B6/p35, which expresses p35 in combination with CYP2B6 and its electron transfer partner, P450 reductase. The expression of p35 in Adeno-2B6/p35-infected tumor cells inhibited caspase activation, delaying the death of the CYP2B6 'factory' cells that produce active CPA metabolites, and increased bystander tumor cell killing compared to that achieved in the absence of p35. Tumor cells infected with Adeno-2B6/p35 were readily killed by cisplatin and doxorubicin, indicating that p35 expression is not associated with acquisition of general drug resistance. Finally, p35 did not inhibit viral release when the replication-competent adenovirus ONYX-017 was used as a helper virus to facilitate co-replication and spread of Adeno-2B6/p35 and further increase CPA-induced bystander cell killing. The introduction of p35 into gene therapeutic regimens constitutes an effective approach to increase bystander killing by cytochrome P450 gene therapy. This strategy may also be used to enhance other bystander cytotoxic therapies, including those involving the production of tumor cell toxic protein products

Naturally acquired antibody responses to recombinant Pfs230 and Pfs48/45 transmission blocking vaccine candidates

DEFF Research Database (Denmark)

Jones, Sophie; Grignard, Lynn; Nebie, Issa

2015-01-01

for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. METHODS: We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso......OBJECTIVES: Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences....... We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. RESULTS: Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p assays...

Isolation and Characterization of Pepper Genes Interacting with the CMV-P1 Helicase Domain.

Directory of Open Access Journals (Sweden)

Yoomi Choi

Full Text Available Cucumber mosaic virus (CMV is a destructive pathogen affecting Capsicum annuum (pepper production. The pepper Cmr1 gene confers resistance to most CMV strains, but is overcome by CMV-P1 in a process dependent on the CMV-P1 RNA1 helicase domain (P1 helicase. Here, to identify host factors involved in CMV-P1 infection in pepper, a yeast two-hybrid library derived from a C. annuum 'Bukang' cDNA library was screened, producing a total of 76 potential clones interacting with the P1 helicase. Beta-galactosidase filter lift assay, PCR screening, and sequencing analysis narrowed the candidates to 10 genes putatively involved in virus infection. The candidate host genes were silenced in Nicotiana benthamiana plants that were then inoculated with CMV-P1 tagged with the green fluorescent protein (GFP. Plants silenced for seven of the genes showed development comparable to N. benthamiana wild type, whereas plants silenced for the other three genes showed developmental defects including stunting and severe distortion. Silencing formate dehydrogenase and calreticulin-3 precursor led to reduced virus accumulation. Formate dehydrogenase-silenced plants showed local infection in inoculated leaves, but not in upper (systemic leaves. In the calreticulin-3 precursor-silenced plants, infection was not observed in either the inoculated or the upper leaves. Our results demonstrate that formate dehydrogenase and calreticulin-3 precursor are required for CMV-P1 infection.

Multiple BiP genes of Arabidopsis thaliana are required for male gametogenesis and pollen competitiveness.

Science.gov (United States)

Maruyama, Daisuke; Sugiyama, Tomoyuki; Endo, Toshiya; Nishikawa, Shuh-Ichi

2014-04-01

Immunoglobulin-binding protein (BiP) is a molecular chaperone of the heat shock protein 70 (Hsp70) family. BiP is localized in the endoplasmic reticulum (ER) and plays key roles in protein translocation, protein folding and quality control in the ER. The genomes of flowering plants contain multiple BiP genes. Arabidopsis thaliana has three BiP genes. BIP1 and BIP2 are ubiquitously expressed. BIP3 encodes a less well conserved BiP paralog, and it is expressed only under ER stress conditions in the majority of organs. Here, we report that all BiP genes are expressed and functional in pollen and pollen tubes. Although the bip1 bip2 double mutation does not affect pollen viability, the bip1 bip2 bip3 triple mutation is lethal in pollen. This result indicates that lethality of the bip1 bip2 double mutation is rescued by BiP3 expression. A decrease in the copy number of the ubiquitously expressed BiP genes correlates well with a decrease in pollen tube growth, which leads to reduced fitness of mutant pollen during fertilization. Because an increased protein secretion activity is expected to increase the protein folding demand in the ER, the multiple BiP genes probably cooperate with each other to ensure ER homeostasis in cells with active secretion such as rapidly growing pollen tubes.

In vitro Effects of Four Native Brazilian Medicinal Plants in CYP3A4 mRNA Gene Expression, Glutathione Levels, and P-Glycoprotein Activity.

Science.gov (United States)

Mazzari, Andre L D A; Milton, Flora; Frangos, Samantha; Carvalho, Ana C B; Silveira, Dâmaris; de Assis Rocha Neves, Francisco; Prieto, Jose M

2016-01-01

Erythrina mulungu Benth. (Fabaceae), Cordia verbenacea A. DC. (Boraginaceae), Solanum paniculatum L. (Solanaceae) and Lippia sidoides Cham. (Verbenaceae) are medicinal plant species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI). In this work, we assess non-toxic concentrations (100 μg/mL) of the plant infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp) activity in vincristine-resistant Caco-2 cells (Caco-2 VCR). Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR) in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT) in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (twofold decrease, p effect upon hPXR (EC50 = 0.38 mg/mL). Total intracellular glutathione levels were significantly depleted by exposure to Solanum paniculatum (-44%, p Cordia verbenacea (-47%, p activity (-48%, p active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum.

Additive estrogenic effects of mixtures of frequently used UV filters on pS2-gene transcription in MCF-7 cells

International Nuclear Information System (INIS)

Heneweer, Marjoke; Muusse, Martine; Berg, Martin van den; Sanderson, J. Thomas

2005-01-01

In order to protect consumers from ultraviolet (UV) radiation and enhance light stability of the product, three to eight UV filters are usually added to consumer sunscreen products. High lipophilicity of the UV filters has been shown to cause bioaccumulation in fish and humans, leading to environmental levels of UV filters that are similar to those of PCBs and DDT. In this paper, estrogen-regulated pS2 gene transcription in the human mammary tumor cell line MCF-7 was used as a measure of estrogenicity of four individual UV filters. Since humans are exposed to more than one UV filter at a time, an equipotent binary mixture of 2-hydroxy-4-methoxy-benzophenone (BP-3) and its metabolite 2,4-dihydroxy benzophenone (BP-1), as well as an equipotent multi-component mixture of BP-1, BP-3, octyl methoxy cinnamate (OMC) and 3-(4-methylbenzylidene) camphor (4-MBC), were also evaluated for their ability to induce pS2 gene transcription in order to examine additivity. An estrogen receptor-mediated mechanism of action was expected for all UV filters. Therefore, our null-hypothesis was that combined estrogenic responses, measured as increased pS2 gene transcription in MCF-7 cells after exposure to mixtures of UV filters, are additive, according to a concentration-addition model. Not all UV filters produced a full concentration-response curve within the concentration range tested (100 nM-1 μM). Therefore, instead of using EC 50 values for comparison, the concentration at which each compound caused a 50% increase of basal pS2 gene transcription was defined as the C50 value for that compound and used to calculate relative potencies. For comparison, the EC 50 value of a compound is the concentration at which the compound elicits an effect that is 50% of its maximal effect. Individual UV filters increased pS2 gene transcription concentration-dependently with C50 values of 0.12 μM, 0.5 μM, 1.9 μM, and 1.0 μM for BP-1, BP-3, 4-MBC and OMC, respectively. Estradiol (E2) had a C50

Characterization of a Bombyx mori nucleopolyhedrovirus with Bmvp80 disruption.

Science.gov (United States)

Tang, Xu-Dong; Xu, Yi-Peng; Yu, Lin-Lin; Lang, Guo-Jun; Tian, Cai-Hong; Zhao, Jin-Fang; Zhang, Chuan-Xi

2008-12-01

A BmNPV Bacmid with the Bmvp80 gene disrupted was constructed using the ET-recombination system in Escherichia coli to investigate the role of Bmvp80 during the baculovirus life cycle. Disruption of Bmvp80 resulted in single cell infection phenotype, whereas a rescue BmBacmid restored budded virus titers to wild type levels; however, the homologous gene Ac104 (Acvp80) from AcMNPV could not complement the BmBacmid lacking a functional Bmvp80 gene. Electron microscopy of cells transfected with BmNPV lacking functional Bmvp80 revealed that the number of nucleocapsids was markedly lower. These results suggest that Bmvp80 is essential for normal budded virus production and nucleocapsid maturation, and is functionally divergent between baculovirus species.

Thyrotoxic Periodic Paralysis and Polymorphisms of the , , and Genes in Men with Graves Disease

Directory of Open Access Journals (Sweden)

Suyeon Park

2016-03-01

Full Text Available BackgroundThyrotoxic periodic paralysis (TPP is a rare complication of thyrotoxicosis characterized by acute attacks of muscle weakness and hypokalemia. Recently, variation in several genes was suggested to be associated with TPP. This study evaluated the genetic predisposition to TPP in terms of the β2-adrenergic receptor (ADRB2, androgen receptor (AR, and γ-aminobutyric acid receptor α3 subunit (GABRA3 genes.MethodsThis study enrolled 48 men with Graves disease (GD and TPP, and 48 GD patients without TPP. We compared the frequencies of candidate polymorphisms between the two groups.ResultsThe frequency of the Gly16/Gly16 genotype in ADRB2 was not significantly associated with TPP (P=0.32. More CAG repeats (≥26 in the AR gene were not correlated with TPP (odds ratio [OR], 2.46; 95% confidence interval [CI], 0.81 to 8.09; P=0.08. The allele frequency of the TT genotype in the GABRA3 gene was not associated with TPP (OR, 1.83; 95% CI, 0.54 to 6.74; P=0.41.ConclusionThe polymorphisms in the ADRB2, AR, and GABRA3 genes could not explain the genetic susceptibility to TPP in Korean men with GD.

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

Analysis of P gene mutations in patients with type II (tyrosinase-positive) oculocutaneous albinism (OCA2)

Energy Technology Data Exchange (ETDEWEB)

Lee, S.T.; Nicholls, R.D.; Schnur, R. [Univ. of Wisconsin, Madison, WI (United States)]|[Case Western Reserve Univ., Cleveland, OH (United States)]|[Children`s Hospital of Philadelphia, PA (United States)] [and others

1994-09-01

OCA2 is an autosomal recessive disorder in which the biosynthesis of melanin pigment is greatly reduced in the skin, hair, and eyes. Recently, we showed that OCA2 results from mutations of the P gene, in chromosome segment 15q11-q13. In addition to OCA2, mutations of P account for OCA associated with the Prader-Willi syndrome and some cases of {open_quotes}autosomal recessive ocular albinism{close_quotes} (AROA). We have now studied 38 unrelated patients with various forms of OCA2 or AROA from a variety of different ethnic groups. None of these patients had detectable abnormalities of the tyrosinase (TYR) gene. Among 8 African-American patients with OCA2 we observed apparent locus homogeneity. We detected abnormalities of the P gene in all 8 patients, including 12 different mutations and deletions, most of which are unique to this group and none of which is predominant. In contrast, OCA2 in other populations appears to be genetically heterogeneous. Among 21 Caucasian patients we detected abnormalities of the P gene in only 8, comprising 9 different point mutations and deletions, some of which also occurred among the African-American patients. Among 3 Middle-Eastern, 3 Indo-Pakistani, and 3 Asian patients we detected mutations of the P gene in only one from each group. In a large Indo-Pakistani kindred with OCA2 we have excluded both the TYR and P genes on the basis of genetic linkage. The prevalence of mutations of the P gene thus appears to be much higher among African-Americans with OCA2 than among patients from other ethnic groups. The incidence of OCA2 in some parts of equatorial Africa is extremely high, as frequent as 1 per 1100, and the disease has been linked to P in South African Bantu. The eventual characterization of P gene mutations in Africans will be informative with regard to the origins of P gene mutations in African-American patients.

Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

Energy Technology Data Exchange (ETDEWEB)

Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.

1995-12-01

Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

Endogenous n-3 Polyunsaturated Fatty Acids Delay Progression of Pancreatic Ductal Adenocarcinoma in Fat-1-p48Cre/+-LSL-KrasG12D/+ Mice

Directory of Open Access Journals (Sweden)

Altaf Mohammed

2012-12-01

Full Text Available Preclinical studies suggest that diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs may be beneficial for prevention of pancreatic cancer. Nutritional intervention studies are often complex, and there is no clear evidence, without potential confounding factors, on whether conversion of n-6 PUFAs to n-3 PUFAs in pancreatic tissues would provide protection. Experiments were designed using n-3 fatty acid desaturase (Fat-1 transgenic mice, which can convert n-6 PUFA to n-3 FAs endogenously, to determine the impact of n-3 PUFAs on pancreatic intraepithelial neoplasms (PanINs and their progression to pancreatic ductal adenocarcinoma (PDAC. Six-weekold female p48Cre/+-LSL-KrasG12D/+ andcompoundFat-1-p48Cre/+-LSL-KrasG12D/+ mice were fed (AIN-76A diets containing 10% safflower oil for 35 weeks. Pancreata were evaluated histopathologically for PanINs and PDAC. Results showed a dramatic reduction in incidence of PDAC (84%; P 85%; P < .05–0.01 in pancreas of compound transgenic mice than in those of p48Cre/+-LSL-KrasG12D/+ mice. Molecular analysis of the pancreas showed a significant down-regulation of proliferating cell nuclear antigen, cyclooxygenase-2, 5-lipoxygenase (5-LOX, 5-LOX-activating protein, Bcl-2, and cyclin D1 expression levels in Fat-1-p48Cre/+-LSL-KrasG12D/+ mice compared to p48Cre/+-LSL-KrasG12D/+ mice. These data highlight the promise of dietary n-3 FAs for chemoprevention of pancreatic cancer in high-risk individuals.

Characterization of self-assembled virus-like particles of human polyomavirus BK generated by recombinant baculoviruses

International Nuclear Information System (INIS)

Li, T.-C.; Takeda, Naokazu; Kato, Kenzo; Nilsson, Josefina; Xing Li; Haag, Lars; Cheng, R. Holland; Miyamura, Tatsuo

2003-01-01

The major structural protein of the human polyomavirus BK (BKV), VP1, was expressed by using recombinant baculoviruses. A large amount of protein with a molecular mass of about 42 kDa was synthesized and identified by Western blotting. The protein was detected exclusively in the nuclei by immunofluorescent analysis and it was released into culture medium. The expressed BKV VP1 protein was self-assembled into virus-like particles (BK-VLPs) with two different sizes (50 and 26 nm in diameter), which migrated into four different bands in CsCl gradient with buoyant densities of 1.29, 1.30, 1.33, and 1.35 g/cm 3 . The immunological studies on the BK-VLPs suggested that they have similar antigenicity with those of authentic BKV particles. Cryoelectron microscopy and 3D image analysis further revealed that the larger BK-VLPs were composed of 72 capsomers which all were pentamers arranged in a T = 7 surface lattice. This system provides useful information for detailed studies of viral morphogenesis and the structural basis for the antigenicity of BKV

TAF6delta controls apoptosis and gene expression in the absence of p53.

Directory of Open Access Journals (Sweden)

Emmanuelle Wilhelm

Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

International Nuclear Information System (INIS)

Menaa, F.

2003-12-01

Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

The Schizosaccharomyces pombe map1 gene encodes an SRF/MCM1-related protein required for P-cell specific gene expression

DEFF Research Database (Denmark)

Nielsen, O; Friis, T; Kjaerulff, S

1996-01-01

Cells of Schizosaccharomyces pombe undergo mating and meiosis when starved for a nitrogen source. In this process a P and and M cell first mate to generate a diploid zygote, which subsequently enters meiosis and sporulates. The P mating type is controlled by the mat1-Pc gene at the mating type lo...... cerevisiae MCM1. The Mat1-Pc protein contains a motif characteristic for proteins that interact with MADS-box factors, suggesting that Mat-Pc and Map1 may form a heterodimer that activates the P-specific map3 gene....

Multispecies and Clonal Dissemination of OXA-48 Carbapenemase in Enterobacteriaceae From Companion Animals in Germany, 2009—2016

Directory of Open Access Journals (Sweden)

Sandra Pulss

2018-06-01

Full Text Available The increasing spread of carbapenemase-producing Enterobacteriaceae (CPE poses a serious threat to public health. Recent studies suggested animals as a putative source of such bacteria. We investigated 19,025 Escherichia coli, 1607 Klebsiella spp. and 570 Enterobacter spp. isolated from livestock, companion animal, horse, and pet samples between 2009 and 2016 in our routine diagnostic laboratory for reduced susceptibility to carbapenems (CP by using meropenem-containing media. Actively screened CP non-susceptible strains as well as 367 archived ESBL/AmpC-β-lactamase-producing Enterobacteriaceae were then tested for the presence of CP genes by PCRs. Among 21,569 isolates, OXA-48 could be identified as the sole carbapenemase type in 137 (0.64% strains. The blaOXA-48 gene was located on an ∼60-kb IncL plasmid and sequence analysis revealed high similarity to reference plasmid pOXA-48a, which has been involved in the global spread of the blaOXA-48 gene in humans for many years. Klebsiella pneumoniae was the predominant OXA-48 producer (n = 86; 6.6% of all K. pneumoniae isolates, followed by E. cloacae (n = 28; 5.0%, Klebsiella oxytoca (n = 1; 0.3%, and E. coli (n = 22, 0.1%. OXA-48 was not found in livestock, but in dogs (120/3182; 3.8%, cats (13/792; 1.6%, guinea pig (1/43; 2.3%, rat (1/23; 4.3%, mouse (1/180; 0.6%, and one rabbit (1/144; 0.7%. Genotyping identified few major clones among the different enterobacteria species, including sequence types ST11 and ST15 for K. pneumoniae, ST1196 for E. coli, and ST506 and ST78 for E. cloacae, most of which were previously involved in the dissemination of multidrug-resistant strains in humans. The majority of OXA-48 isolates (n = 112 originated from a university veterinary clinic (UVC, while animals from further 16 veterinary institutions were positive. Clonal analyses suggested nosocomial events related to different species and STs in two veterinary clinics and horizontal transfer of the pOXA-48-like

GPAW optimized for Blue Gene/P using hybrid programming

DEFF Research Database (Denmark)

Kristensen, Mads Ruben Burgdorff; Happe, Hans Henrik; Vinter, Brian

2009-01-01

In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses on optimi......In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses...... on optimizing a very time consuming operation in GPAW, the finite-different stencil operation, and different hybrid programming approaches are evaluated. The work succeeds in demonstrating a hybrid programming model which is clearly beneficial compared to the original flat programming model. In total...... an improvement of 1.94 compared to the original implementation is obtained. The results we demonstrate here are reasonably general and may be applied to other finite difference codes....

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

Science.gov (United States)

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

International Nuclear Information System (INIS)

Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

1996-01-01

Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Regulation of gene expression in roots of the pH-sensitive Vaccinium corymbosum and the pH-tolerant Vaccinium arboreum in response to near neutral pH stress using RNA-Seq.

Science.gov (United States)

Payá-Milans, Miriam; Nunez, Gerardo H; Olmstead, James W; Rinehart, Timothy A; Staton, Margaret

2017-08-07

Blueberries are one of the few horticultural crops adapted to grow in acidic soils. Neutral to basic soil pH is detrimental to all commonly cultivated blueberry species, including Vaccinium corymbosum (VC). In contrast, the wild species V. arboreum (VA) is able to tolerate a wider range of soil pH. To assess the molecular mechanisms involved in near neutral pH stress response, plants from pH-sensitive VC (tetraploid) and pH-tolerant VA (diploid) were grown at near neutral pH 6.5 and at the preferred pH of 4.5. Transcriptome sequencing of root RNA was performed for 4 biological replications per species x pH level interaction, for a total of 16 samples. Reads were mapped to the reference genome from diploid V. corymbosum, transforming ~55% of the reads to gene counts. A quasi-likelihood F test identified differential expression due to pH stress in 337 and 4867 genes in VA and VC, respectively. Both species shared regulation of genes involved in nutrient homeostasis and cell wall metabolism. VA and VC exhibited differential regulation of signaling pathways related to abiotic/biotic stress, cellulose and lignin biosynthesis, and nutrient uptake. The specific responses in VA likely facilitate tolerance to higher soil pH. In contrast, response in VC, despite affecting a greater number of genes, is not effective overcoming the stress induced by pH. Further inspection of those genes with differential expression that are specific in VA may provide insight on the mechanisms towards tolerance.

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

Prediction of target genes for miR-140-5p in pulmonary arterial hypertension using bioinformatics methods.

Science.gov (United States)

Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang

2017-12-01

The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

Science.gov (United States)

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

Science.gov (United States)

Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

2011-12-01

Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

Warm Spitzer and Palomar near-IR secondary eclipse photometry of two hot Jupiters: WASP-48b and HAT-P-23b

Energy Technology Data Exchange (ETDEWEB)

O' Rourke, Joseph G.; Knutson, Heather A.; Désert, Jean-Michel [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Zhao, Ming [Department of Astronomy and Astrophysics, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802 (United States); Fortney, Jonathan J. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Burrows, Adam [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 05844 (United States); Agol, Eric [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Deming, Drake [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Howard, Andrew W. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Lewis, Nikole K. [Department of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Showman, Adam P. [Lunar and Planetary Laboratory, University of Arizona, Tucson, AZ 85721 (United States); Todorov, Kamen O. [Institute for Astronomy, ETH Zürich, Wolfgang-Pauli-Strasse 27, 8093 Zürich (Switzerland)

2014-02-01

We report secondary eclipse photometry of two hot Jupiters, WASP-48b and HAT-P-23b, at 3.6 and 4.5 μm taken with the InfraRed Array Camera aboard the Spitzer Space Telescope during the warm Spitzer mission and in the H and K{sub S} bands with the Wide Field IR Camera at the Palomar 200 inch Hale Telescope. WASP-48b and HAT-P-23b are Jupiter-mass and twice Jupiter-mass objects orbiting an old, slightly evolved F star and an early G dwarf star, respectively. In the H, K{sub S} , 3.6 μm, and 4.5 μm bands, respectively, we measure secondary eclipse depths of 0.047% ± 0.016%, 0.109% ± 0.027%, 0.176% ± 0.013%, and 0.214% ± 0.020% for WASP-48b. In the K{sub S} , 3.6 μm, and 4.5 μm bands, respectively, we measure secondary eclipse depths of 0.234% ± 0.046%, 0.248% ± 0.019%, and 0.309% ± 0.026% for HAT-P-23b. For WASP-48b and HAT-P-23b, respectively, we measure delays of 2.6 ± 3.9 minutes and 4.0 ± 2.4 minutes relative to the predicted times of secondary eclipse for circular orbits, placing 2σ upper limits on |ecos ω| of 0.0053 and 0.0080, both of which are consistent with circular orbits. The dayside emission spectra of these planets are well-described by blackbodies with effective temperatures of 2158 ± 100 K (WASP-48b) and 2154 ± 90 K (HAT-P-23b), corresponding to moderate recirculation in the zero albedo case. Our measured eclipse depths are also consistent with one-dimensional radiative transfer models featuring varying degrees of recirculation and weak thermal inversions or no inversions at all. We discuss how the absence of strong temperature inversions on these planets may be related to the activity levels and metallicities of their host stars.

Adenoviral gene delivery to primary human cutaneous cells and burn wounds.

Science.gov (United States)

Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

2006-01-01

The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2x10(8) pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P>0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P=0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

Science.gov (United States)

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

p73 gene in dopaminergic neurons is highly susceptible to manganese neurotoxicity.

Science.gov (United States)

Kim, Dong-Suk; Jin, Huajun; Anantharam, Vellareddy; Gordon, Richard; Kanthasamy, Arthi; Kanthasamy, Anumantha G

2017-03-01

Chronic exposure to elevated levels of manganese (Mn) has been linked to a Parkinsonian-like movement disorder, resulting from dysfunction of the extrapyramidal motor system within the basal ganglia. However, the exact cellular and molecular mechanisms of Mn-induced neurotoxicity remain elusive. In this study, we treated C57BL/6J mice with 30mg/kg Mn via oral gavage for 30 days. Interestingly, in nigral tissues of Mn-exposed mice, we found a significant downregulation of the truncated isoform of p73 protein at the N-terminus (ΔNp73). To further determine the functional role of Mn-induced p73 downregulation in Mn neurotoxicity, we examined the interrelationship between the effect of Mn on p73 gene expression and apoptotic cell death in an N27 dopaminergic neuronal model. Consistent with our animal study, 300μM Mn treatment significantly suppressed p73 mRNA expression in N27 dopaminergic cells. We further determined that protein levels of the ΔNp73 isoform was also reduced in Mn-treated N27 cells and primary striatal cultures. Furthermore, overexpression of ΔNp73 conferred modest cellular protection against Mn-induced neurotoxicity. Taken together, our results demonstrate that Mn exposure downregulates p73 gene expression resulting in enhanced susceptibility to apoptotic cell death. Thus, further characterization of the cellular mechanism underlying p73 gene downregulation will improve our understanding of the molecular underpinnings of Mn neurotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

Directory of Open Access Journals (Sweden)

Lucie Kosinová

Full Text Available The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3 in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information

The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

International Nuclear Information System (INIS)

Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

2010-01-01

To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

Membrane fusion between baculovirus budded virus-enveloped particles and giant liposomes generated using a droplet-transfer method for the incorporation of recombinant membrane proteins.

Science.gov (United States)

Nishigami, Misako; Mori, Takaaki; Tomita, Masahiro; Takiguchi, Kingo; Tsumoto, Kanta

2017-07-01

Giant proteoliposomes are generally useful as artificial cell membranes in biochemical and biophysical studies, and various procedures for their preparation have been reported. We present here a novel preparation technique that involves the combination of i) cell-sized lipid vesicles (giant unilamellar vesicles, GUVs) that are generated using the droplet-transfer method, where lipid monolayer-coated water-in-oil microemulsion droplets interact with oil/water interfaces to form enclosed bilayer vesicles, and ii) budded viruses (BVs) of baculovirus (Autographa californica nucleopolyhedrovirus) that express recombinant transmembrane proteins on their envelopes. GP64, a fusogenic glycoprotein on viral envelopes, is activated by weak acids and is thought to cause membrane fusion with liposomes. Using confocal laser scanning microscopy (CLSM), we observed that the single giant liposomes fused with octadecyl rhodamine B chloride (R18)-labeled wild-type BV envelopes with moderate leakage of entrapped soluble compounds (calcein), and the fusion profile depended on the pH of the exterior solution: membrane fusion occurred at pH ∼4-5. We further demonstrated that recombinant transmembrane proteins, a red fluorescent protein (RFP)-tagged GPCR (corticotropin-releasing hormone receptor 1, CRHR1) and envelope protein GP64 could be partly incorporated into membranes of the individual giant liposomes with a reduction of the pH value, though there were also some immobile fluorescent spots observed on their circumferences. This combination may be useful for preparing giant proteoliposomes containing the desired membranes and inner phases. Copyright © 2017 Elsevier B.V. All rights reserved.

Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell

Directory of Open Access Journals (Sweden)

A.M. Al-Sulaiman

2017-11-01

Full Text Available Several prokaryotic and eukaryotic expression systems have been used for in vitro production of viruses’ proteins. However eukaryotic expression system was always the first choice for production of proteins that undergo post-translational modification such as glycosylation. Recombinant baculoviruses have been widely used as safe vectors to express heterologous genes in the culture of insect cells, but the manipulation involved in creating, titrating, and amplifying viral stocks make it time consuming and laborious. Therefore, to facilitate rapid expression in insect cell, a plasmid based expression system was used to express herpes simplex type 1 glycoprotein D (HSV-1 gD and varicella zoster glycoprotein E (VZV gE. Recombinant plasmids were generated, transfected into insect cells (SF9, and both glycoproteins were expressed 48 h post-infection. A protein with approximately molecular weight of 64-kDa and 98-kDa for HSV-1 gD and VZV gE respectively was expressed and confirmed by SDS. Proteins were detected in insect cells cytoplasm and outer membrane by immunofluorescence. The antigenicity and immunoreactivity of each protein were confirmed by immunoblot and ELISA. Results suggest that this system can be an alternative to the traditional baculovirus expression for small scale expression system in insect cells.

Amplification of the uvrA gene product of Escherichia coli to 7% of cellular protein by linkage to the p/sub L/ promoter of pKC30

International Nuclear Information System (INIS)

Yoakum, G.H.; Yeung, A.T.; Mattes, W.B.; Grossman, L.

1982-01-01

Researchers have constructed a hybrid pKC30-uvrA plasmid (pGHY5003) in which transcription of the uvrA gene can be induced under p/sub L/ control to amplify the uvrA gene product to 7% of cellular protein. To construct pGHY5003, researchers developed a genetic selection using the basal level of expression (30 0 C) from p/sub L/ in thermosensitive cI857 lysogens to isolate appropriately tailored repair genes inserted at the Hpa I site of pKC30 from recombinant DNA mixtures with a variety of products. In addition, a post-uv-irradiation radiolabeling method was adapted to screen inserts for temperature-inducible polypeptide synthesis directed by transcription under p/sub L/ control rapidly. This should prove generally useful for isolating genes inserted at the Hpa I site of plasmid pKC30 with the following characteristics: (1) genetically functional hybrid plasmids selected from a large population of exonucleolytically tailored fragments ligated into Hpa I of pKC30 and (2) production of high-level amplification for the gene product of interest by screening for post-uv-irradiation temperature inducibility of polypeptides synthesized from hybrid plasmids. The level of amplification obtained for the uvrA gene product from pGHY5003 is approximately 10,000-fold higher than estimates of the level of uvrA protein in logarithmic phase Escherichia coli

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

Science.gov (United States)

He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

2000-09-26

P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

Molecular characterisation of lumpy skin disease virus and sheeppox virus based on P32 gene

Directory of Open Access Journals (Sweden)

P.M.A.Rashid

2017-06-01

Full Text Available Lumpy skin disease virus (LSDV and sheeppox virus (SPV have a considerable economic impact on the cattle and small ruminant industry. They are listed in group A of contagious disease by the World Organization for Animal Health (OIE. This study addressed molecular characterisation of first LSDV outbreak and an endemic SPV in Kurdistan region of Iraq based on P32 gene. The results indicated that P32 gene can be successfully used for diagnosis of LSDV. The phylogenic and molecular analysis showed that there may be a new LSDV isolate circulating in Kurdistan which uniquely shared the same characteristic amino acid sequence with SPV and GPV, leucine at amino acid position 51 in P32 gene as well as few genetically distinct SPV causing pox disease in Kurdistan sheep. This study provided sequence information of P32 gene for several LSDV isolates, which positively affects the epidemiological study of Capripoxvirus

Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

International Nuclear Information System (INIS)

Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

2004-01-01

We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

Science.gov (United States)

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p

Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

Science.gov (United States)

Díaz, P; Cardenas, H; Orihuela, P A

2016-10-01

We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells. © 2016 Blackwell Verlag GmbH.

Three novel variants (p.Glu178Lys, p.Val245Met, p.Ser250Phe) of the phenylalanine hydroxylase (PAH) gene impair protein expression and function in vitro.

Science.gov (United States)

Zong, Yanan; Liu, Ning; Ma, Shanshan; Bai, Ying; Guan, Fangxia; Kong, Xiangdong

2018-08-20

Phenylketonuria (PKU) is the most common inherited metabolic disease, an autosomal recessive disorder affecting >10,000 newborns each year globally. It can be caused by over 1000 different naturally occurring mutations in the phenylalanine hydroxylase (PAH) gene. We analyzed three novel naturally occurring PAH gene variants: p.Glu178Lys (c.532G>A), p.Val245Met (c.733G>A) and p.Ser250Phe (c.749C>T). The mutant effect on the PAH enzyme structure and function was predicted by bioinformatics software. Vectors expressing the corresponding PAH variants were generated for expression in E. coli and in HEK293T cells. The RNA expression of the three PAH variants was measured by quantitative reverse transcription polymerase chain reaction (RT-qPCR). The mutant PAH protein levels were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), western blot and enzyme-linked immunosorbent assay (ELISA). All three variants were predicted to be pathogenic by bioinformatics analysis. The transcription of the three PAH variants was similar to the wild type PAH gene in HEK293T cells. In contrast, the levels of mutant PAH proteins decreased significantly compared to the wild type control, in both E. coli and HEK293T cells. Our results indicate that the three novel PAH gene variants (p.Glu178Lys, p.Val245Met, p.Ser250Phe) impair PAH protein expression and function in prokaryotic and eukaryotic cells. Copyright © 2018. Published by Elsevier B.V.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

Science.gov (United States)

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

DEFF Research Database (Denmark)

Nagasawa, T; Zhang, Q; Raghunath, P N

2006-01-01

To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

In vitro Effects of Four Native Brazilian Medicinal Plants in CYP3A4 mRNA Gene Expression, Glutathione Levels, and P-Glycoprotein Activity

Science.gov (United States)

Mazzari, Andre L. D. A.; Milton, Flora; Frangos, Samantha; Carvalho, Ana C. B.; Silveira, Dâmaris; de Assis Rocha Neves, Francisco; Prieto, Jose M.

2016-01-01

Erythrina mulungu Benth. (Fabaceae), Cordia verbenacea A. DC. (Boraginaceae), Solanum paniculatum L. (Solanaceae) and Lippia sidoides Cham. (Verbenaceae) are medicinal plant species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI). In this work, we assess non-toxic concentrations (100 μg/mL) of the plant infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp) activity in vincristine-resistant Caco-2 cells (Caco-2 VCR). Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR) in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT) in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (twofold decrease, p Cordia verbenacea (-47%, p < 0.001). The latter plant extract was able to decrease GGT activity (-48%, p < 0.01). In conclusion, this preclinical study shows that the administration of some of these herbal medicines may be able to cause disturbances to metabolic mechanisms in vitro. Although Erythrina mulungu appears safe in our tests, active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum. PMID:27594838

Simulation of vanadium-48 production using MCNPX code

Directory of Open Access Journals (Sweden)

Sadeghi Mahdi

2012-01-01

Full Text Available Vanadium-48 was produced through the irradiation of the natural titanium target via the natTi(p, xn48V reaction. The titanium target was irradiated at 1 mA current and by a 21 MeV proton beam for 4 hours. In this paper, the activity of 48V, 43Sc, and 46Sc radionuclides and the efficacy of the 47Ti(p, g, 48Ti(p, n, and 49Ti(p, 2n channel reactions to form 48V radionuclide were determined using MCNPX code. Furthermore, the experimental activity of 48V was compared with the estimated value for the thick target yield produced in the irradiation time according to MCNPX code. Good agreement between production yield of the 48V and the simulation yield was observed. In conclusion, MCNPX code can be used for the estimation of the production yield.

Role of AtCDC48 & the AtCDC48 Regulatory Protein Family, PUX, in Plant Cell Morphogenesis

Energy Technology Data Exchange (ETDEWEB)

Bednarek, Sebastian, Y.

2009-11-08

The long-term objective of this work is to understand the molecular events and mechanisms involved in secretory membrane trafficking and organelle biogenesis, which are crucial for normal plant growth and development. Our studies have suggested a vital role for the cytosolic chaperone Cdc48p/p97 during cytokinesis and cell expansion which are highly dependent upon secretory membrane trafficking. Localization studies have shown that the plant Cdc48p/p97, AtCDC48, and the Arabidopsis ortholog of the ER- and Golgi-associated SNARE, syntaxin 5, (referred to as SYP31) are targeted to the division plane during cytokinesis. In addition, AtCDC48 and SYP31 were shown to interact in vitro and in vivo. To characterize further the function of AtCDC48 and SYP31 we have utilized affinity chromatography and MALDI-MS to identify several plant-specific proteins that interact with SYP31 and/or modulate the activity of AtCDC48 including two UBX (i.e. ubiquitin-like) domain containing proteins, PUX1 and PUX2 (Proteins containing UBX domain). These proteins define a plant protein family consisting of 15 uncharacterized members that we postulate interact with AtCDC48. Biochemical studies have demonstrated that PUX2 is a novel membrane adapter for AtCDC48 that mediates AtCDC48/SYP31 interaction and is likely to control AtCDC48-dependent membrane fusion. In contrast, PUX1 negatively regulates AtCDC48 by inhibiting its ATPase activity and by promoting the disassembly of the active hexamer. These findings provide the first evidence that the assembly and disassembly of the CDC48/p97complex is actually a dynamic process. This new unexpected level of regulation for CDC48/p97 was demonstrated to be critical in vivo as pux1 loss-of-function mutants grow faster than wild-type plants. These studies suggest a role for AtCDC48 in plant cell cycle progression including cytokinesis and/or cell expansion. The proposed studies are designed to: 1) characterize further the localization and function of At

Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

Directory of Open Access Journals (Sweden)

Jacob Daniela

2005-06-01

Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

A comparative study of P450 gene expression in field and laboratory Musca domestica L. strains.

Science.gov (United States)

Højland, Dorte H; Vagn Jensen, Karl-Martin; Kristensen, Michael

2014-08-01

The housefly is a global pest that has developed resistance to most insecticides applied for its control. Resistance has been associated with cytochrome P450 monooxygenases (P450s). The authors compare the expression of six genes possibly associated with insecticide resistance in three unselected strains: a multiresistant strain (791a), a neonicotinoid-resistant strain (766b) and a new field strain (845b). CYP4G2 was highly expressed throughout the range of strains and proved to be the one of the most interesting expression profiles of all P450s analysed. CYP6G4 was expressed up to 11-fold higher in 766b than in WHO-SRS. Significant differences between expression of P450 genes between F1 flies from 845b and established laboratory strains were shown. In general, P450 gene expression in 845b was 2-14-fold higher than in the reference strain (P resistance. There is a strong indication that CYP6G4 is a major insecticide resistance gene involved in neonicotinoid resistance. © 2013 Society of Chemical Industry.

A second pectin lyase gene (pel2) from Aspergillus oryzae KBN616: its sequence analysis and overexpression, and characterization of the gene products.

Science.gov (United States)

Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

2001-01-01

A second pectin lyase gene, designated pel2, was isolated from a shoyu koji mold Aspergillus oryzae KBN616 and characterized. The structural gene comprised 1306 bp with three introns. The ORF encoded 375 amino acids with a signal peptide of 19 amino acids. The deduced amino acid sequence showed high similarity to those of A. oryzae Pel1, Aspergillus niger pectin lyases and Glomerella cingulata Pn1A. The pel2 gene was overexpressed under the control of the promoter of the A. oryzae TEF1 gene for purification and enzymatic characterization of its gene product. The gene product exhibited two molecular masses of 48 and 44 kDa due to different degrees of glycosylation. Both proteins had the same pH optimum of 6.0 and temperature optimum of 50 degrees C.

Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

Science.gov (United States)

Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

2010-09-20

KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer. 2009 Elsevier GmbH. All rights reserved.

DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.

Science.gov (United States)

Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E

2002-12-01

Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.

CYP3A4 allelic variants with amino acid substitutions in exons 7 and 12: evidence for an allelic variant with altered catalytic activity.

Science.gov (United States)

Sata, F; Sapone, A; Elizondo, G; Stocker, P; Miller, V P; Zheng, W; Raunio, H; Crespi, C L; Gonzalez, F J

2000-01-01

To determine the existence of mutant and variant CgammaP3A4 alleles in three racial groups and to assess functions of the variant alleles by complementary deoxyribonucleic acid (cDNA) expression. A bacterial artificial chromosome that contains the complete CgammaP3A4 gene was isolated and the exons and surrounding introns were directly sequenced to develop primers to polymerase chain reaction (PCR) amplify and sequence the gene from lymphocyte DNA. DNA samples from Chinese, black, and white subjects were screened. Mutating the affected amino acid in the wild-type cDNA and expressing the variant enzyme with use of the baculovirus system was used to functionally evaluate the variant allele having a missense mutation. To investigate the existence of mutant and variant CgammaP3A4 alleles in humans, all 13 exons and the 5'-flanking region of the human CgammaP3A4 gene in three racial groups were sequenced and four alleles were identified. An A-->G point mutation in the 5'-flanking region of the human CgammaP3A4 gene, designated CgammaP3A4*1B, was found in the three different racial groups. The frequency of this allele in a white population was 4.2%, whereas it was 66.7% in black subjects. The CgammaP3A4*1B allele was not found in Chinese subjects. A second variant allele, designated CgammaP3A4*2, having a Ser222Pro change, was found at a frequency of 2.7% in the white population and was absent in the black subjects and Chinese subjects analyzed. Baculovirus-directed cDNA expression revealed that the CYP3A4*2 P450 had a lower intrinsic clearance for the CYP3A4 substrate nifedipine compared with the wild-type enzyme but was not significantly different from the wild-type enzyme for testosterone 6beta-hydroxylation. Another rare allele, designated CgammaP3A4*3, was found in a single Chinese subject who had a Met445Thr change in the conserved heme-binding region of the P450. These are the first examples of potential function polymorphisms resulting from missense mutations in

p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

Science.gov (United States)

Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

2002-04-10

We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

Construction of pTM series plasmids for gene expression in Brucella species.

Science.gov (United States)

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Regulation of the cytochrome P450 2A genes

International Nuclear Information System (INIS)

Su Ting; Ding Xinxin

2004-01-01

Cytochrome P450 monooxygenases of the CYP2A subfamily play important roles in xenobiotic disposition in the liver and in metabolic activation in extrahepatic tissues. Many of the CYP2A transcripts and enzymes are inducible by xenobiotic compounds, and the expression of at least some of the CYP2A genes is influenced by physiological status, such as circadian rhythm, and pathological conditions, such as inflammation, microbial infection, and tumorigenesis. Variability in the expression of the CYP2A genes, which differs by species, animal strain, gender, and organ, may alter the risks of chemical toxicity for numerous compounds that are CYP2A substrates. The mechanistic bases of these variabilities are generally not well understood. However, recent studies have yielded interesting findings in several areas, such as the role of nuclear factor 1 in the tissue-selective expression of CYP2A genes in the olfactory mucosa (OM); the roles of constitutive androstane receptor, pregnane X receptor (PXR), and possibly, peroxisome proliferator-activated receptors in transcriptional regulation of the Cyp2a5 gene; and the involvement of heterogeneous nuclear ribonucleoprotein A1 in pyrazole-induced stabilization of CYP2A5 mRNA. The aims of this minireview are to summarize current knowledge of the regulation of the CYP2A genes in rodents and humans, and to stimulate further mechanistic studies that will ultimately improve our ability to determine, and to understand, these variabilities in humans

Claudin-1 is a p63 target gene with a crucial role in epithelial development.

Directory of Open Access Journals (Sweden)

Teresa Lopardo

2008-07-01

Full Text Available The epidermis of the skin is a self-renewing, stratified epithelium that functions as the interface between the human body and the outer environment, and acts as a barrier to water loss. Components of intercellular junctions, such as Claudins, are critical to maintain tissue integrity and water retention. p63 is a transcription factor essential for proliferation of stem cells and for stratification in epithelia, mutated in human hereditary syndromes characterized by ectodermal dysplasia. Both p63 and Claudin-1 null mice die within few hours from birth due to dehydration from severe skin abnormalities. These observations suggested the possibility that these two genes might be linked in one regulatory pathway with p63 possibly regulating Claudin-1 expression. Here we show that silencing of DeltaNp63 in primary mouse keratinocytes results in a marked down-regulation of Claudin-1 expression (-80%. DeltaNp63alpha binds in vivo to the Claudin-1 promoter and activates both the endogenous Claudin-1 gene and a reporter vector containing a -1.4 Kb promoter fragment of the Claudin-1 gene. Accordingly, Claudin-1 expression was absent in the skin of E15.5 p63 null mice and natural p63 mutant proteins, specifically those found in Ankyloblepharon-Ectodermal dysplasia-Clefting (AEC patients, were indeed altered in their capacity to regulate Claudin-1 transcription. This correlates with deficient Claudin-1 expression in the epidermis of an AEC patient carrying the I537T p63 mutation. Notably, AEC patients display skin fragility similar to what observed in the epidermis of Claudin-1 and p63 null mice. These findings reinforce the hypothesis that these two genes might be linked in a common regulatory pathway and that Claudin-1 may is an important p63 target gene involved in the pathogenesis of ectodermal dysplasias.

Isotope shift of 40,42,44,48Ca in the 4s 2S1/2 → 4p 2P3/2 transition

Science.gov (United States)

Gorges, C.; Blaum, K.; Frömmgen, N.; Geppert, Ch; Hammen, M.; Kaufmann, S.; Krämer, J.; Krieger, A.; Neugart, R.; Sánchez, R.; Nörtershäuser, W.

2015-12-01

We report on improved isotope shift measurements of the isotopes {}{40,42,{44,48}}Ca in the 4{{s}}{ }2{{{S}}}1/2\\to 4{{p}}{ }2{{{P}}}3/2 (D2) transition using collinear laser spectroscopy. Accurately known isotope shifts in the 4{{s}}{ }2{{{S}}}1/2\\to 4{{p}}{ }2{{{P}}}1/2(D1) transition were used to calibrate the ion beam energy with an uncertainty of {{Δ }}U≈ +/- 0.25 {{V}}. The accuracy in the D2 transition was improved by a factor of 5-10. A King-plot analysis of the two transitions revealed that the field shift factor in the D2 line is about 1.8(13)% larger than in the D1 transition which is ascribed to relativistic contributions of the 4{{{p}}}1/2 wave function.

Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2005-01-01

In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

Presence of quinolone resistance to qnrB1 genes and blaOXA-48 carbapenemase in clinical isolates of Klebsiella pneumoniae in Spain.

Science.gov (United States)

Rodríguez Martínez, J M; Díaz-de Alba, P; Lopez-Cerero; Ruiz-Carrascoso, G; Gomez-Gil, R; Pascual, A

2014-01-01

A study is presented on the presence of quinolone resistance qnrB1 genes in clinical isolates belonging to the largest series of infections caused by OXA-48-producing Klebsiella pneumoniae in a single-centre outbreak in Spain. Evidence is also provided, according to in vitro results, that there is a possibility of co-transfer of plasmid harbouring blaOXA-48 with an other plasmid harbouring qnrB1 in presence of low antibiotic concentrations of fluoroquinolones, showing the risk of multi-resistance screening. Copyright © 2013 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Oxidative Metabolism Genes Are Not Responsive to Oxidative Stress in Rodent Beta Cell Lines

Directory of Open Access Journals (Sweden)

Faer Morrison

2012-01-01

Full Text Available Altered expression of oxidative metabolism genes has been described in the skeletal muscle of individuals with type 2 diabetes. Pancreatic beta cells contain low levels of antioxidant enzymes and are particularly susceptible to oxidative stress. In this study, we explored the effect of hyperglycemia-induced oxidative stress on a panel of oxidative metabolism genes in a rodent beta cell line. We exposed INS-1 rodent beta cells to low (5.6 mmol/L, ambient (11 mmol/L, and high (28 mmol/L glucose conditions for 48 hours. Increases in oxidative stress were measured using the fluorescent probe dihydrorhodamine 123. We then measured the expression levels of a panel of 90 oxidative metabolism genes by real-time PCR. Elevated reactive oxygen species (ROS production was evident in INS-1 cells after 48 hours (P<0.05. TLDA analysis revealed a significant (P<0.05 upregulation of 16 of the 90 genes under hyperglycemic conditions, although these expression differences did not reflect differences in ROS. We conclude that although altered glycemia may influence the expression of some oxidative metabolism genes, this effect is probably not mediated by increased ROS production. The alterations to the expression of oxidative metabolism genes previously observed in human diabetic skeletal muscle do not appear to be mirrored in rodent pancreatic beta cells.

Time and flow-dependent changes in the p27(kip1) gene network drive maladaptive vascular remodeling.

Science.gov (United States)

DeSart, Kenneth M; Butler, Khayree; O'Malley, Kerri A; Jiang, Zhihua; Berceli, Scott A

2015-11-01

Although clinical studies have identified that a single nucleotide polymorphism in the p27(kip1) gene is associated with success or failure after vein bypass grafting, the underlying mechanisms for this difference are not well defined. Using a high-throughput approach in a flow-dependent vein graft model, we explored the differences in p27(kip1)-related genes that drive the enhanced hyperplastic response under low-flow conditions. Bilateral rabbit carotid artery interposition grafts with jugular vein were placed with a unilateral distal outflow branch ligation to create differential flow states. Grafts were harvested at 2 hours and at 1, 3, 7, 14, and 28 days after implantation, measured for neointimal area, and assayed for cell proliferation. Whole-vessel messenger RNA was isolated and analyzed using an Affymetrix (Santa Clara, Calif) gene array platform. Ingenuity Pathway Analysis (Ingenuity, Redwood City, Calif) was used to identify the gene networks surrounding p27(kip1). This gene set was then analyzed for temporal expression changes after graft placement and for differential expression in the alternate flow conditions. Outflow branch ligation resulted in an eightfold difference in mean flow rates throughout the 28-day perfusion period (P Flow reduction led to a robust hyperplastic response, resulting in a significant increase in intimal area by 7 days (0.13 ± 0.04 mm(2) vs 0.014 ± 0.006 mm(2); P flow grafts demonstrated a burst of actively dividing intimal cells (36.4 ± 9.4 cells/mm(2) vs 11.5 ± 1.9 cells/mm(2); P = .04). Sixty-five unique genes within the microarray were identified as components of the p27(kip1) network. At a false discovery rate of 0.05, 26 genes demonstrated significant temporal changes, and two dominant patterns of expression were identified. Class comparison analysis identified differential expression of 11 genes at 2 hours and seven genes and 14 days between the high-flow and low-flow grafts (P flow and shear stress result in

MicroRNA396a-5p and -3p induce tomato disease susceptibility by suppressing target genes and upregulating salicylic acid.

Science.gov (United States)

Chen, Lei; Meng, Jun; Zhai, Junmiao; Xu, Pinsan; Luan, Yushi

2017-12-01

Plants have evolved a variety of mechanisms to perceive and resist the assault of pathogens. The biotrophs, necrotrophs and hemibiotrophs are types of plant pathogens that activate diverse salicylic acid (SA) and jasmonic acid (JA) signaling pathways. In this study we showed that the expressions of miR396a-5p and -3p in Solanum lycopersicum (S. lycopersicum) were both down-regulated after infection by hemibiotroph Phytophthora infestans (P. infestans) and necrotroph Botrytis cinerea (B. cinerea) infection. Overexpression of miR396a-5p and -3p in transgenic tomato enhanced the susceptibility of S. lycopersicum to P. infestans and B. cinerea infection and the tendency to produce reactive oxygen species (ROS) under pathogen-related biotic stress. Additionally, miR396a regulated growth-regulating factor1 (GRF1), salicylic acid carboxyl methyltransferase (SAMT), glycosyl hydrolases (GH) and nucleotide-binding site-leucine-rich repeat (NBS-LRR) and down-regulated their levels. This ultimately led to inhibition of the expression of pathogenesis-related 1 (PR1), TGA transcription factors1 and 2 (TGA1 and TGA2) and JA-dependent proteinase inhibitors I and II (PI I and II), but enhanced the endogenous SA content and nonexpressor of pathogenesis-related genes 1 (NPR1) expression. Taken together, our results showed that negative regulation of target genes and their downstream genes expressions by miR396a-5p and -3p are critical for tomato abiotic stresses via affecting SA or JA signaling pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

A novel syndrome of paediatric cataract, dysmorphism, ectodermal features, and developmental delay in Australian Aboriginal family maps to 1p35.3-p36.32

Directory of Open Access Journals (Sweden)

Gecz Jozef

2010-11-01

Full Text Available Abstract Background A novel phenotype consisting of cataract, mental retardation, erythematous skin rash and facial dysmorphism was recently described in an extended pedigree of Australian Aboriginal descent. Large scale chromosomal re-arrangements had previously been ruled out. We have conducted a genome-wide scan to map the linkage region in this family. Methods Genome-wide linkage analysis using Single Nucleotide Polymorphism (SNP markers on the Affymetrix 10K SNP array was conducted and analysed using MERLIN. Three positional candidate genes (ZBTB17, EPHA2 and EPHB2 were sequenced to screen for segregating mutations. Results Under a fully penetrant, dominant model, the locus for this unique phenotype was mapped to chromosome 1p35.3-p36.32 with a maximum LOD score of 2.41. The critical region spans 48.7 cM between markers rs966321 and rs1441834 and encompasses 527 transcripts from 364 annotated genes. No coding mutations were identified in three positional candidate genes EPHA2, EPHB2 or ZBTB17. The region overlaps with a previously reported region for Volkmann cataract and the phenotype has similarity to that reported for 1p36 monosomy. Conclusions The gene for this syndrome is located in a 25.6 Mb region on 1p35.3-p36.32. The known cataract gene in this region (EPHA2 does not harbour mutations in this family, suggesting that at least one additional gene for cataract is present in this region.

Strain-specific variation in a soilborne phytopathogenic fungus for the expression of genes involved in pH signal transduction pathway, pathogenesis and saprophytic survival in response to environmental pH changes.

Science.gov (United States)

Daval, Stéphanie; Lebreton, Lionel; Gracianne, Cécile; Guillerm-Erckelboudt, Anne-Yvonne; Boutin, Morgane; Marchi, Muriel; Gazengel, Kévin; Sarniguet, Alain

2013-12-01

The soilborne fungus Gaeumannomyces graminis var. tritici (Ggt) causes take-all, a wheat root disease. In an original strain-specific way, a previous study indicates that inside the Ggt species, some strains grow preferentially at acidic pH and other strains at neutral/alkaline pH. The most important mechanism for a fungal response to the environmental pH is the Pal pathway which integrates the products of the six pal genes and the transcription factor PacC. To evaluate whether the Ggt strain-specific growth in function of the ambient pH is mediated via the Pal pathway, a transcriptional study of the genes encoding this pathway was carried out. This study provided the first evidence that the pH signalling pathway similar to those described in other fungi operated in Ggt. The pacC gene was induced at neutral pH whatever the strain. In an original way, the expression of Ggt genes coding for the different Pal proteins depended on the strain and on the ambient pH. In the strain growing better at acidic pH, few pal genes were pH-regulated, and some were overexpressed at neutral pH when regulated. In the strain growing better at neutral pH, underexpression of most of the pal genes at neutral pH occurred. The strains displayed higher gene expression in the ambient pH that unfavoured their growth as if it was a compensation system. All pH taken together, a globally weaker Pal transcript level occurred in the strains that were less sensitive to acidic pH, and on the contrary, the strain growing better on neutral pH showed higher Pal mRNA levels. The expression of genes involved in pathogenesis and saprophytic growth was also regulated by the ambient pH and the strain: each gene displayed a specific pH-regulation that was similar between strains. But all pH taken together, the global transcript levels of four out of six genes were higher in the strain growing better on neutral pH. Altogether, for the first time, the results show that inside a species, conditions affecting

Structural and functional organization of the HF.10 human zinc finger gene (ZNF35) located on chromosome 3p21-p22

DEFF Research Database (Denmark)

Lanfrancone, L; Pengue, G; Pandolfi, P P

1992-01-01

We report the structural and functional characterization of the HF.10 zinc finger gene (ZNF35) in normal human cells, as well as a processed pseudogene. The HF.10 gene spans about 13 kb and it is interrupted by three introns. All 11 zinc finger DNA-binding domains are contiguously encoded within...... and partial nucleotide sequencing of the HF.10 pseudogene indicated that it has arisen by retroposition of spliced HF.10 mRNA. In situ hybridization experiments revealed that both the functional locus and the pseudogene map to chromosome 3p21p22, a region that is frequently deleted in small cell lung...... and renal carcinomas. Hybridization of the HF.10 gene and the HF.10 pseudogene DNA probes to metaphases from a small cell lung carcinoma cell line with the 3p deletion revealed that both loci are part of the deleted chromosome region....

Effects of ionizing radiation on expression of P21 protein in Jurkat cell line and p21 gene in thymocytes and splenocytes of mice

International Nuclear Information System (INIS)

Ni Guanying; Wu Ning; Guo Haizhuo; Jin Shunzi

2011-01-01

Objective: To investigate the effects of ionizing radiation on the expression of P21 protein in Jurkat cell line and p21 gene in thymocytes and splenocytes of mice. Methods: Flow cytometry (FCM) was used to analyze the expression of P21 protein in Jurkat cells at 12 and 24 h after irradiation to 0, 0.5, 1.0, 2.0, 4.0, and 6.0 Gy. Real-time PCR was used to detect the expression of p21 gene in thymocytes and splenocytes of mice at 4 and 24 h after irradiation to 0, 0.5, 1.0, 2.0, 4.0, and 6.0 Gy. Multi-staining was used to analyze the micronucleus rates of Rct in bone marrow. Results: The expressions of P21 protein were increased in a dose-dependent manner during 0.5-4.0 Gy (t=-24.23 - -3.96, P<0.05), but decreased at 6.0 Gy at 12 and 24 h post-irradiation (t=-11.19, -14.50, P<0.05). The expressions of p21 gene in both thymocytes and splenocytes of mice were increased in dose-dependent manner in the range of 0-6.0 Gy (including 6.0 Gy) (t=-29.96-8.80, P<0.05), and reached to the peak at 6.0 Gy at 4 and 24 h post-irradiation (t=-11.84 - -3.42, P<0.05), except thymocytes at 4 h and 1.0 Gy post-irradiation (t=-3.42, P>0.05). Conclusions: The expressions of P21 protein and p21 gene could be increased by X-ray irradiation, which shows good dose-dependent manners in certain range of dose. (authors)

The (PrS/HGF-pDNA) multilayer films for gene-eluting stent coating: Gene-protecting, anticoagulation, antibacterial properties, and in vivo antirestenosis evaluation.

Science.gov (United States)

Chang, Hao; Ren, Ke-feng; Zhang, He; Wang, Jin-lei; Wang, Bai-liang; Ji, Jian

2015-02-01

Vascular gene-eluting stents (GES) is a promising strategy for treatment of cardiovascular disease. Very recently, we have proved that the (protamine sulfate/plasmid DNA encoding hepatocyte growth factor) (PrS/HGF-pDNA) multilayer can serve as a powerful tool for enhancing competitiveness of endothelial cell over smooth muscle cell, which opens perspectives for the regulation of intercellular competitiveness in the field of interventional therapy. However, before the gene multilayer films could be used in vascular stents for real clinical application, the preservation of gene bioactivity during the industrial sterilization and the hemocompatibility of film should be taken into account. Actually, both are long been ignored issues in the field of gene coating for GES. In this study, we demonstrate that the (PrS/HGF-pDNA) multilayer film exhibits the good gene-protecting abilities, which is confirmed by using the industrial sterilizations (gamma irradiation and ethylene oxide) and a routine storage condition (dry state at 4°C for 30 days). Furthermore, hemocompatible measurements (such as platelet adhesion and whole blood coagulation) and antibacterial assays (bacteria adhesion and growth inhibition) indicate the good anticoagulation and antibacterial properties of the (PrS/HGF-pDNA) multilayer film. The in vivo preliminary data of angiography and histological analysis suggest that the (PrS/HGF-pDNA) multilayer coated stent can reduce the in-stent restenosis. This work reveals that the (PrS/HGF-pDNA) multilayer film could be a promising candidate as coating for GES, which is of great potential in future clinic application. © 2014 Wiley Periodicals, Inc.

In vitro effects of four native Brazilian medicinal plants in CYP3A4 mRNA gene expression, glutathione levels and P-glycoprotein activity.

Directory of Open Access Journals (Sweden)

Andre Luis Dias Araujo Mazzari

2016-08-01

Full Text Available Erythrina mulungu Benth. (Fabaceae, Cordia verbenacea A. DC. (Boraginaceae, Solanum paniculatum L. (Solanaceae and Lippia sidoides Cham. (Verbenaceae are medicinal plants species native to Brazil shortlisted by the Brazilian National Health System for future clinical use. However, nothing is known about their effects in metabolic and transporter proteins, which could potentially lead to herb-drug interactions (HDI. In this work we assess non-toxic concentrations (100μg/mL of their infusions for their in vitro ability to modulate CYP3A4 mRNA gene expression and intracellular glutathione levels in HepG2 cells, as well as P-glycoprotein (P-gp activity in vincristine-resistant Caco-2 cells (Caco-2 VCR. Their mechanisms of action were further studied by measuring the activation of human pregnane X receptor (hPXR in transiently co-transfected HeLa cells and the inhibition of γ-glutamyl transferase (GGT in HepG2 cells. Our results show that P-gp activity was not affected in any case and that only Solanum paniculatum was able to significantly change CYP3A4 mRNA gene expression (two-fold decrease, p<0.05, this being correlated with an antagonist effect upon hPXR (EC50 = 0.38mg/mL. Total intracellular glutathione levels were significantly depleted by exposure to Solanum paniculatum (-44%, p<0.001, Lippia sidoides (-12%, p<0.05 and Cordia verbenacea (-47%, p<0.001. The later plant extract was able to decrease GGT activity (-48%, p<0.01. In conclusion, this preclinical study shows that the administration of some of these herbal medicines may be able to cause disturbances to metabolic mechanisms in vitro. Although Erythrina mulungu appears safe in our tests, active pharmacovigilance is recommended for the other three species, especially in the case of Solanum paniculatum.

Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2006-01-01

In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

pTRA - A reporter system for monitoring the intracellular dynamics of gene expression.

Science.gov (United States)

Wagner, Sabine G; Ziegler, Martin; Löwe, Hannes; Kremling, Andreas; Pflüger-Grau, Katharina

2018-01-01

The presence of standardised tools and methods to measure and represent accurately biological parts and functions is a prerequisite for successful metabolic engineering and crucial to understand and predict the behaviour of synthetic genetic circuits. Many synthetic gene networks are based on transcriptional circuits, thus information on transcriptional and translational activity is important for understanding and fine-tuning the synthetic function. To this end, we have developed a toolkit to analyse systematically the transcriptional and translational activity of a specific synthetic part in vivo. It is based on the plasmid pTRA and allows the assignment of specific transcriptional and translational outputs to the gene(s) of interest (GOI) and to compare different genetic setups. By this, the optimal combination of transcriptional strength and translational activity can be identified. The design is tested in a case study using the gene encoding the fluorescent mCherry protein as GOI. We show the intracellular dynamics of mRNA and protein formation and discuss the potential and shortcomings of the pTRA plasmid.

MacroBac: New Technologies for Robust and Efficient Large-Scale Production of Recombinant Multiprotein Complexes.

Science.gov (United States)

Gradia, Scott D; Ishida, Justin P; Tsai, Miaw-Sheue; Jeans, Chris; Tainer, John A; Fuss, Jill O

2017-01-01

Recombinant expression of large, multiprotein complexes is essential and often rate limiting for determining structural, biophysical, and biochemical properties of DNA repair, replication, transcription, and other key cellular processes. Baculovirus-infected insect cell expression systems are especially well suited for producing large, human proteins recombinantly, and multigene baculovirus systems have facilitated studies of multiprotein complexes. In this chapter, we describe a multigene baculovirus system called MacroBac that uses a Biobricks-type assembly method based on restriction and ligation (Series 11) or ligation-independent cloning (Series 438). MacroBac cloning and assembly is efficient and equally well suited for either single subcloning reactions or high-throughput cloning using 96-well plates and liquid handling robotics. MacroBac vectors are polypromoter with each gene flanked by a strong polyhedrin promoter and an SV40 poly(A) termination signal that minimize gene order expression level effects seen in many polycistronic assemblies. Large assemblies are robustly achievable, and we have successfully assembled as many as 10 genes into a single MacroBac vector. Importantly, we have observed significant increases in expression levels and quality of large, multiprotein complexes using a single, multigene, polypromoter virus rather than coinfection with multiple, single-gene viruses. Given the importance of characterizing functional complexes, we believe that MacroBac provides a critical enabling technology that may change the way that structural, biophysical, and biochemical research is done. © 2017 Elsevier Inc. All rights reserved.

Multiple Cytochrome P450 genes: their constitutive overexpression and permethrin induction in insecticide resistant mosquitoes, Culex quinquefasciatus.

Science.gov (United States)

Liu, Nannan; Li, Ting; Reid, William R; Yang, Ting; Zhang, Lee

2011-01-01

Four cytochrome P450 cDNAs, CYP6AA7, CYP9J40, CYP9J34, and CYP9M10, were isolated from mosquitoes, Culex quinquefasciatus. The P450 gene expression and induction by permethrin were compared for three different mosquito populations bearing different resistance phenotypes, ranging from susceptible (S-Lab), through intermediate (HAmCq(G0), the field parental population) to highly resistant (HAmCq(G8), the 8(th) generation of permethrin selected offspring of HAmCq(G0)). A strong correlation was found for P450 gene expression with the levels of resistance and following permethrin selection at the larval stage of mosquitoes, with the highest expression levels identified in HAmCq(G8), suggesting the importance of CYP6AA7, CYP9J40, CYP9J34, and CYP9M10 in the permethrin resistance of larva mosquitoes. Only CYP6AA7 showed a significant overexpression in HAmCq(G8) adult mosquitoes. Other P450 genes had similar expression levels among the mosquito populations tested, suggesting different P450 genes may be involved in the response to insecticide pressure in different developmental stages. The expression of CYP6AA7, CYP9J34, and CYP9M10 was further induced by permethrin in resistant mosquitoes. Taken together, these results indicate that multiple P450 genes are up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, thus increasing the overall expression levels of P450 genes.

Expression of xenobiotic metabolizing cytochrome P450 genes in a spinosad-resistant Musca domestica L. strain.

Directory of Open Access Journals (Sweden)

Dorte H Højland

Full Text Available Spinosad is important in pest management strategies of multiple insect pests. However, spinosad resistance is emerging in various pest species. Resistance has in some species been associated with alterations of the target-site receptor, but in others P450s seems to be involved. We test the possible importance of nine cytochrome P450 genes in the spinosad-resistant housefly strain 791spin and investigate the influence of spinosad on P450 expression in four other housefly strains.Significant differences in P450 expression of the nine P450 genes in the four strains after spinosad treatment were identified in 40% of cases, most of these as induction. The highly expressed CYP4G2 was induced 6.6-fold in the insecticide susceptible WHO-SRS females, but decreased 2-fold in resistant 791spin males. CYP6G4 was constitutively higher expressed in the resistant strain compared to the susceptible strain. Furthermore, CYP6G4 gene expression was increased in susceptible WHO-SRS flies by spinosad while the expression level did not alter significantly in resistant fly strains. Expression of CYP6A1 and male CYP6D3 was constitutively higher in the resistant strain compared to the susceptible. However, in both cases male expression was higher than female expression.CYP4G2, CYP6A1, CYP6D3 and CYP6G4 have expressions patterns approaching the expectations of a hypothesized sex specific spinosad resistance gene. CYP4G2 fit requirements of a spinosad resistance gene best, making it the most likely candidate. The overall high expression level of CYP4G2 throughout the strains also indicates importance of this gene. However, the data on 791spin are not conclusive concerning spinosad resistance and small contributions from multiple P450s with different enzymatic capabilities could be speculated to do the job in 791spin. Differential expression of P450s between sexes is more a rule than an exception. Noteworthy differences between spinosad influenced expression of P450 genes

Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

International Nuclear Information System (INIS)

Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

2008-01-01

Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

A comparative study of P450 gene expression in field and laboratory Musca domestica L. strains

DEFF Research Database (Denmark)

Højland, Dorte Heidi; Vagn Jensen, Karl-Martin; Kristensen, Michael

2014-01-01

BACKGROUND The housefly is a global pest that has developed resistance to most insecticides applied for its control. Resistance has been associated with cytochrome P450 monooxygenases (P450s). The authors compare the expression of six genes possibly associated with insecticide resistance in three...... unselected strains: a multiresistant strain (791a), a neonicotinoid-resistant strain (766b) and a new field strain (845b). RESULTS CYP4G2 was highly expressed throughout the range of strains and proved to be the one of the most interesting expression profiles of all P450s analysed. CYP6G4 was expressed up...... to 11-fold higher in 766b than in WHO-SRS. Significant differences between expression of P450 genes between F1 flies from 845b and established laboratory strains were shown. In general, P450 gene expression in 845b was 2–14-fold higher than in the reference strain (P

Molecular Characterization and Functional Analysis of Three Pathogenesis-Related Cytochrome P450 Genes from Bursaphelenchus xylophilus (Tylenchida: Aphelenchoidoidea

Directory of Open Access Journals (Sweden)

Xiao-Lu Xu

2015-03-01

Full Text Available Bursaphelenchus xylophilus, the causal agent of pine wilt disease, causes huge economic losses in pine forests. The high expression of cytochrome P450 genes in B. xylophilus during infection in P. thunbergii indicated that these genes had a certain relationship with the pathogenic process of B. xylophilus. Thus, we attempted to identify the molecular characterization and functions of cytochrome P450 genes in B. xylophilus. In this study, full-length cDNA of three cytochrome P450 genes, BxCYP33C9, BxCYP33C4 and BxCYP33D3 were first cloned from B. xylophilus using 3' and 5' RACE PCR amplification. Sequence analysis showed that all of them contained a highly-conserved cytochrome P450 domain. The characteristics of the three putative proteins were analyzed with bioinformatic methods. RNA interference (RNAi was used to assess the functions of BxCYP33C9, BxCYP33C4 and BxCYP33D3. The results revealed that these cytochrome P450 genes were likely to be associated with the vitality, dispersal ability, reproduction, pathogenicity and pesticide metabolism of B. xylophilus. This discovery confirmed the molecular characterization and functions of three cytochrome P450 genes from B. xylophilus and provided fundamental information in elucidating the molecular interaction mechanism between B. xylophilus and its host plant.

GLUCOCORTICOID RECEPTOR-RELATED GENES: GENOTYPE AND BRAIN GENE EXPRESSION RELATIONSHIPS TO SUICIDE AND MAJOR DEPRESSIVE DISORDER.

Science.gov (United States)

Yin, Honglei; Galfalvy, Hanga; Pantazatos, Spiro P; Huang, Yung-Yu; Rosoklija, Gorazd B; Dwork, Andrew J; Burke, Ainsley; Arango, Victoria; Oquendo, Maria A; Mann, J John

2016-06-01

We tested the relationship between genotype, gene expression and suicidal behavior and major depressive disorder (MDD) in live subjects and postmortem samples for three genes, associated with the hypothalamic-pituitary-adrenal axis, suicidal behavior, and MDD; FK506-binding protein 5 (FKBP5), Spindle and kinetochore-associated protein 2 (SKA2), and Glucocorticoid Receptor (NR3C1). Single-nucleotide polymorphisms (SNPs) and haplotypes were tested for association with suicidal behavior and MDD in a live (N = 277) and a postmortem sample (N = 209). RNA-seq was used to examine gene and isoform-level brain expression postmortem (Brodmann Area 9; N = 59). Expression quantitative trait loci (eQTL) relationships were examined using a public database (UK Brain Expression Consortium). We identified a haplotype within the FKBP5 gene, present in 47% of the live subjects, which was associated with increased risk of suicide attempt (OR = 1.58, t = 6.03, P = .014). Six SNPs on this gene, three SNPs on SKA2, and one near NR3C1 showed before-adjustment association with attempted suicide, and two SNPs of SKA2 with suicide death, but none stayed significant after adjustment for multiple testing. Only the SKA2 SNPs were related to expression in the prefrontal cortex (pFCTX). One NR3C1 transcript had lower expression in suicide relative to nonsuicide sudden death cases (b = -0.48, SE = 0.12, t = -4.02, adjusted P = .004). We have identified an association of FKBP5 haplotype with risk of suicide attempt and found an association between suicide and altered NR3C1 gene expression in the pFCTX. Our findings further implicate hypothalamic pituitary axis dysfunction in suicidal behavior. © 2016 Wiley Periodicals, Inc.

Gene dosage, expression, and ontology analysis identifies driver genes in the carcinogenesis and chemoradioresistance of cervical cancer.

Directory of Open Access Journals (Sweden)

Malin Lando

2009-11-01

Full Text Available Integrative analysis of gene dosage, expression, and ontology (GO data was performed to discover driver genes in the carcinogenesis and chemoradioresistance of cervical cancers. Gene dosage and expression profiles of 102 locally advanced cervical cancers were generated by microarray techniques. Fifty-two of these patients were also analyzed with the Illumina expression method to confirm the gene expression results. An independent cohort of 41 patients was used for validation of gene expressions associated with clinical outcome. Statistical analysis identified 29 recurrent gains and losses and 3 losses (on 3p, 13q, 21q associated with poor outcome after chemoradiotherapy. The intratumor heterogeneity, assessed from the gene dosage profiles, was low for these alterations, showing that they had emerged prior to many other alterations and probably were early events in carcinogenesis. Integration of the alterations with gene expression and GO data identified genes that were regulated by the alterations and revealed five biological processes that were significantly overrepresented among the affected genes: apoptosis, metabolism, macromolecule localization, translation, and transcription. Four genes on 3p (RYBP, GBE1 and 13q (FAM48A, MED4 correlated with outcome at both the gene dosage and expression level and were satisfactorily validated in the independent cohort. These integrated analyses yielded 57 candidate drivers of 24 genetic events, including novel loci responsible for chemoradioresistance. Further mapping of the connections among genetic events, drivers, and biological processes suggested that each individual event stimulates specific processes in carcinogenesis through the coordinated control of multiple genes. The present results may provide novel therapeutic opportunities of both early and advanced stage cervical cancers.