WorldWideScience

Sample records for bacterium thermoanaerobacter bg1l1

  1. Ethanol production from wet-exploded wheat straw hydrolysate by thermophilic anaerobic bacterium Thermoanaerobacter BG1L1 in a continuous immobilized reactor

    DEFF Research Database (Denmark)

    Georgieva, Tania I.; Mikkelsen, Marie Just; Ahring, Birgitte Kiær

    2008-01-01

    was not detoxified, ethanol yield in a range of 0.39-0.42 g/g was obtained. Overall, sugar efficiency to ethanol was 68-76%. The reactor was operated continuously for approximately 143 days, and no contamination was seen without the use of any agent for preventing bacterial infections. The tested microorganism has......Thermophilic ethanol fermentation of wet-exploded wheat straw hydrolysate was investigated in a continuous immobilized reactor system. The experiments were carried out in a lab-scale fluidized bed reactor (FBR) at 70C. Undetoxified wheat straw hydrolysate was used (3-12% dry matter), corresponding...... to sugar mixtures of glucose and xylose ranging from 12 to 41 g/l. The organism, thermophilic anaerobic bacterium Thermoanaerobacter BG1L1, exhibited significant resistance to high levels of acetic acid (up to 10 g/l) and other metabolic inhibitors present in the hydrolysate. Although the hydrolysate...

  2. High ethanol tolerance of the thermophilic anaerobic ethanol producer Thermoanaerobacter BG1L1

    DEFF Research Database (Denmark)

    Georgieva, Tania I.; Mikkelsen, Marie Just; Ahring, Birgitte Kiær

    2007-01-01

    The low ethanol tolerance of thermophilic anaerobic bacteria, generally less than 2% (v/v) ethanol, is one of the main limiting factors for their potential use for second generation fuel ethanol production. In this work, the tolerance of thermophilic anaerobic bacterium Thermoanaerobacter BG 1L1...... to exogenously added ethanol was studied in a continuous immobilized reactor system at a growth temperature of 70 degrees C. Ethanol tolerance was evaluated based on inhibition of fermentative performance e.g.. inhibition of substrate conversion. At the highest ethanol concentration tested (8.3% v/v), the strain...... was able to convert 42% of the xylose initially present, indicating that this ethanol concentration is not the upper limit tolerated by the strain. Long-term strain adaptation to high ethanol concentrations (6 - 8.3%) resulted in an improvement of xylose conversion by 25% at an ethanol concentration of 5...

  3. Metabolic engineering of ethanol production in Thermoanaerobacter mathranii

    Energy Technology Data Exchange (ETDEWEB)

    Shou Yao

    2010-11-15

    Strain BG1 is a xylanolytic, thermophilic, anaerobic, Gram-positive bacterium originally isolated from an Icelandic hot spring. The strain belongs to the species Thermoanaerobacter mathranii. The strain ferments glucose, xylose, arabinose, galactose and mannose simultaneously and produces ethanol, acetate, lactate, CO{sub 2}, and H2 as fermentation end-products. As a potential ethanol producer from lignocellulosic biomass, tailor-made BG1 strain with the metabolism redirected to produce ethanol is needed. Metabolic engineering of T. mathranii BG1 is therefore necessary to improve ethanol production. Strain BG1 contains four alcohol dehydrogenase (ADH) encoding genes. They are adhA, adhB, bdhA and adhE encoding primary alcohol dehydrogenase, secondary alcohol dehydrogenase, butanol dehydrogenase and bifunctional alcohol/acetaldehyde dehydrogenase, respectively. The presence in an organism of multiple alcohol dehydrogenases with overlapping specificities makes the determination of the specific role of each ADH difficult. Deletion of each individual adh gene in the strain revealed that the adhE deficient mutant strain fails to produce ethanol as the fermentation product. The bifunctional alcohol/acetaldehyde dehydrogenase, AdhE, is therefore proposed responsible for ethanol production in T. mathranii BG1, by catalyzing sequential NADH-dependent reductions of acetyl-CoA to acetaldehyde and then to ethanol under fermentative conditions. Moreover, AdhE was conditionally expressed from a xylose-induced promoter in a recombinant strain (BG1E1) with a concomitant deletion of a lactate dehydrogenase. Over-expression of AdhE in strain BG1E1 with xylose as a substrate facilitates the production of ethanol at an increased yield. With a cofactor-dependent ethanol production pathway in T. mathranii BG1, it may become crucial to regenerate cofactor to increase the ethanol yield. Feeding the cells with a more reduced carbon source, such as mannitol, was shown to increase ethanol

  4. Continuous Ethanol Fermentation of Pretreated Lignocellulosic Biomasses, Waste Biomasses, Molasses and Syrup Using the Anaerobic, Thermophilic Bacterium Thermoanaerobacter italicus Pentocrobe 411

    Science.gov (United States)

    Andersen, Rasmus Lund; Jensen, Karen Møller; Mikkelsen, Marie Just

    2015-01-01

    Lignocellosic ethanol production is now at a stage where commercial or semi-commercial plants are coming online and, provided cost effective production can be achieved, lignocellulosic ethanol will become an important part of the world bio economy. However, challenges are still to be overcome throughout the process and particularly for the fermentation of the complex sugar mixtures resulting from the hydrolysis of hemicellulose. Here we describe the continuous fermentation of glucose, xylose and arabinose from non-detoxified pretreated wheat straw, birch, corn cob, sugar cane bagasse, cardboard, mixed bio waste, oil palm empty fruit bunch and frond, sugar cane syrup and sugar cane molasses using the anaerobic, thermophilic bacterium Thermoanaerobacter Pentocrobe 411. All fermentations resulted in close to maximum theoretical ethanol yields of 0.47–0.49 g/g (based on glucose, xylose, and arabinose), volumetric ethanol productivities of 1.2–2.7 g/L/h and a total sugar conversion of 90–99% including glucose, xylose and arabinose. The results solidify the potential of Thermoanaerobacter strains as candidates for lignocellulose bioconversion. PMID:26295944

  5. Isolation and characterization of a new CO-utilizing strain, Thermoanaerobacter thermohydrosulfuricus subsp. carboxydovorans, isolated from a geothermal spring in Turkey.

    KAUST Repository

    Balk, Melike

    2009-08-23

    A novel anaerobic, thermophilic, Gram-positive, spore-forming, and sugar-fermenting bacterium (strain TLO) was isolated from a geothermal spring in Ayaş, Turkey. The cells were straight to curved rods, 0.4-0.6 microm in diameter and 3.5-10 microm in length. Spores were terminal and round. The temperature range for growth was 40-80 degrees C, with an optimum at 70 degrees C. The pH optimum was between 6.3 and 6.8. Strain TLO has the capability to ferment a wide variety of mono-, di-, and polysaccharides and proteinaceous substrates, producing mainly lactate, next to acetate, ethanol, alanine, H(2), and CO(2). Remarkably, the bacterium was able to grow in an atmosphere of up to 25% of CO as sole electron donor. CO oxidation was coupled to H(2) and CO(2) formation. The G + C content of the genomic DNA was 35.1 mol%. Based on 16S rRNA gene sequence analysis and the DNA-DNA hybridization data, this bacterium is most closely related to Thermoanaerobacter thermohydrosulfuricus and Thermoanaerobacter siderophilus (99% similarity for both). However, strain TLO differs from Thermoanaerobacter thermohydrosulfuricus in important aspects, such as CO-utilization and lipid composition. These differences led us to propose that strain TLO represents a subspecies of Thermoanaerobacter thermohydrosulfuricus, and we therefore name it Thermoanaerobacter thermohydrosulfuricus subsp. carboxydovorans.

  6. Isolation and characterization of a new CO-utilizing strain, Thermoanaerobacter thermohydrosulfuricus subsp. carboxydovorans, isolated from a geothermal spring in Turkey.

    KAUST Repository

    Balk, Melike; Heilig, Hans G H J; van Eekert, Miriam H A; Stams, Alfons J M; Rijpstra, Irene C; Sinninghe-Damsté , Jaap S; de Vos, Willem M; Kengen, Servé W M

    2009-01-01

    A novel anaerobic, thermophilic, Gram-positive, spore-forming, and sugar-fermenting bacterium (strain TLO) was isolated from a geothermal spring in Ayaş, Turkey. The cells were straight to curved rods, 0.4-0.6 microm in diameter and 3.5-10 microm in length. Spores were terminal and round. The temperature range for growth was 40-80 degrees C, with an optimum at 70 degrees C. The pH optimum was between 6.3 and 6.8. Strain TLO has the capability to ferment a wide variety of mono-, di-, and polysaccharides and proteinaceous substrates, producing mainly lactate, next to acetate, ethanol, alanine, H(2), and CO(2). Remarkably, the bacterium was able to grow in an atmosphere of up to 25% of CO as sole electron donor. CO oxidation was coupled to H(2) and CO(2) formation. The G + C content of the genomic DNA was 35.1 mol%. Based on 16S rRNA gene sequence analysis and the DNA-DNA hybridization data, this bacterium is most closely related to Thermoanaerobacter thermohydrosulfuricus and Thermoanaerobacter siderophilus (99% similarity for both). However, strain TLO differs from Thermoanaerobacter thermohydrosulfuricus in important aspects, such as CO-utilization and lipid composition. These differences led us to propose that strain TLO represents a subspecies of Thermoanaerobacter thermohydrosulfuricus, and we therefore name it Thermoanaerobacter thermohydrosulfuricus subsp. carboxydovorans.

  7. A Genetic System for the Thermophilic Acetogenic Bacterium Thermoanaerobacter kivui.

    Science.gov (United States)

    Basen, Mirko; Geiger, Irina; Henke, Laura; Müller, Volker

    2018-02-01

    Thermoanaerobacter kivui is one of the very few thermophilic acetogenic microorganisms. It grows optimally at 66°C on sugars but also lithotrophically with H 2 + CO 2 or with CO, producing acetate as the major product. While a genome-derived model of acetogenesis has been developed, only a few physiological or biochemical experiments regarding the function of important enzymes in carbon and energy metabolism have been carried out. To address this issue, we developed a method for targeted markerless gene deletions and for integration of genes into the genome of T. kivui The strain naturally took up plasmid DNA in the exponential growth phase, with a transformation frequency of up to 3.9 × 10 -6 A nonreplicating plasmid and selection with 5-fluoroorotate was used to delete the gene encoding the orotate phosphoribosyltransferase ( pyrE ), resulting in a Δ pyrE uracil-auxotrophic strain, TKV002. Reintroduction of pyrE on a plasmid or insertion of pyrE into different loci within the genome restored growth without uracil. We subsequently studied fructose metabolism in T. kivui The gene fruK (TKV_c23150) encoding 1-phosphofructosekinase (1-PFK) was deleted, using pyrE as a selective marker via two single homologous recombination events. The resulting Δ fruK strain, TKV003, did not grow on fructose; however, growth on glucose (or on mannose) was unaffected. The combination of pyrE as a selective marker and the natural competence of the strain for DNA uptake will be the basis for future studies on CO 2 reduction and energy conservation and their regulation in this thermophilic acetogenic bacterium. IMPORTANCE Acetogenic bacteria are currently the focus of research toward biotechnological applications due to their potential for de novo synthesis of carbon compounds such as acetate, butyrate, or ethanol from H 2 + CO 2 or from synthesis gas. Based on available genome sequences and on biochemical experiments, acetogens differ in their energy metabolism. Thus, there is an

  8. Identification and Overexpression of a Bifunctional Aldehyde/Alcohol Dehydrogenase Responsible for Ethanol Production in Thermoanaerobacter mathranii

    DEFF Research Database (Denmark)

    Yao, Shuo; Just Mikkelsen, Marie

    2010-01-01

    Thermoanaerobacter mathranii contains four genes, adhA, adhB, bdhA and adhE, predicted to code for alcohol dehydrogenases involved in ethanol metabolism. These alcohol dehydrogenases were characterized as NADP(H)-dependent primary alcohol dehydrogenase (AdhA), secondary alcohol dehydrogenase (Adh....... Overexpressions of AdhE in strain BG1E1 with xylose as a substrate facilitate the production of ethanol at an increased yield. Copyright © 2010 S. Karger AG, Basel...

  9. Potential inhibitors from wet oxidation of wheat straw and their effect on growth and ethanol production by Thermoanaerobacter mathranii

    DEFF Research Database (Denmark)

    Klinke, Helene Bendstrup; Thomsen, A.B.; Ahring, Birgitte Kiær

    2001-01-01

    Alkaline wet oxidation (WO) (using water, 6.5 g/l sodium carbonate, and 12 bar oxygen at 195 degreesC) was used for pre-treating wheat straw (60 g/l), resulting in a hemicellulose-rich hydrolysate and a cellulose-rich solid fraction. The hydrolysate consisted of soluble hemicellulose (9 g....../l), aliphatic carboxylic acids (6 g/l), phenols (0.27 g/l or 1.7 mM), and 2-furoic acid (0.007 g/l). The wet-oxidized wheat straw hydrolysate caused no inhibition of ethanol yield by the anaerobic thermophilic bacterium Thermoanaerobacter mathranii. Nine phenols and 2-furoic acid, identified to be present...

  10. Overexpression of cytochrome P450 CYP6BG1 may contribute to chlorantraniliprole resistance in Plutella xylostella (L.).

    Science.gov (United States)

    Li, Xiuxia; Li, Ran; Zhu, Bin; Gao, Xiwu; Liang, Pei

    2018-06-01

    The diamondback moth Plutella xylostella (L.) is the most widely distributed pest of cruciferous crops and has developed resistance to most commonly used insecticides, including chlorantraniliprole. Resistance to chlorantraniliprole is likely caused by mutations of the target, the ryanodine receptor, and/or mediated by an increase in detoxification enzyme activities. Although target-site resistance is documented in detail, resistance mediated by increased metabolism has rarely been reported. The activity of cytochrome P450 was significantly higher in two resistant P. xylostella populations than in a susceptible one. Among ten detected cytochrome P450 genes, CYP6BG1 was significantly overexpressed (over 80-fold) in a field-resistant population compared with expression in a susceptible one. Knockdown of CYP6BG1 by RNA interference dramatically reduced the 7-ethoxycoumarin-O-deethylase (7-ECOD) activity of P450 by 45.5% and increased the toxicity of chlorantraniliprole toward P. xylostella by 26.8% at 48 h postinjection of double-stranded RNA. By contrast, overexpression of CYP6BG1 in a transgenic Drosophila melanogaster line significantly decreased the toxicity of the insecticide to the transgenic flies. Overexpression of CYP6BG1 may contribute to chlorantraniliprole resistance in P. xylostella. Our findings will provide new insights into the mechanisms of resistance to diamide insecticides in other insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  11. Potential inhibitors from wet oxidation of wheat straw and their effect on growth and ethanol production by ¤Thermoanaerobacter mathranii¤

    DEFF Research Database (Denmark)

    Klinke, H.B.; Thomsen, A.B.; Ahring, B.K.

    2001-01-01

    Alkaline wet oxidation (WO) (using water, 6.5 g/l sodium carbonate, and 12 bar oxygen at 195 degreesC) was used for pre-treating wheat straw (60 g/l), resulting in a hemicellulose-rich hydrolysate and a cellulose-rich solid fraction. The hydrolysate consisted of soluble hemicellulose (9 g....../l), aliphatic carboxylic acids (6 g/l), phenols (0.27 g/l or 1.7 mM), and 2-furoic acid (0.007 g/l). The wet-oxidized wheat straw hydrolysate caused no inhibition of ethanol yield by the anaerobic thermophilic bacterium Thermoanaerobacter mathranii. Nine phenols and 2-furoic acid, identified to be present...

  12. Biodegradation pathway of L-glutamatediacetate by Rhizobium radiobacter strain BG-1

    NARCIS (Netherlands)

    Ginkel, van C.G.; Geerts, R.; Nguyen, P.D.; Plugge, C.M.

    2008-01-01

    An aerobic bacterium was isolated from activated sludge in a medium containing l-glutamate-N,N-diacetate (l-GLDA) as sole carbon and energy source. The isolate was identified as a Rhizobium radiobacter species. Besides l-GLDA, the strain utilized nitrilotriacetate (NTA) and proposed intermediates in

  13. Evaluation of continuous ethanol fermentation of dilute-acid corn stover hydrolysate using thermophilic anaerobic bacterium Thermoanaerobacter BG1L1

    DEFF Research Database (Denmark)

    Georgieva, Tania I.; Ahring, Birgitte Kiær

    2007-01-01

    Dilute sulfuric acid pretreated corn stover is potential feedstock of industrial interest for second generation fuel ethanol production. However, the toxicity of corn stover hydrolysate (PCS) has been a challenge for fermentation by recombinant xylose fermenting organisms. In this work...

  14. High ethanol producing derivatives of Thermoanaerobacter ethanolicus

    Science.gov (United States)

    Ljungdahl, L.G.; Carriera, L.H.

    1983-05-24

    Derivatives of the newly discovered microorganism Thermoanaerobacter ethanolicus which under anaerobic and thermophilic conditions continuously ferment substrates such as starch, cellobiose, glucose, xylose and other sugars to produce recoverable amounts of ethanol solving the problem of fermentations yielding low concentrations of ethanol using the parent strain of the microorganism Thermoanaerobacter ethanolicus are disclosed. These new derivatives are ethanol tolerant up to 10% (v/v) ethanol during fermentation. The process includes the use of an aqueous fermentation medium, containing the substrate at a substrate concentration greater than 1% (w/v).

  15. Identification of Multiple Soluble Fe(III Reductases in Gram-Positive Thermophilic Bacterium Thermoanaerobacter indiensis BSB-33

    Directory of Open Access Journals (Sweden)

    Subrata Pal

    2014-01-01

    Full Text Available Thermoanaerobacter indiensis BSB-33 has been earlier shown to reduce Fe(III and Cr(VI anaerobically at 60°C optimally. Further, the Gram-positive thermophilic bacterium contains Cr(VI reduction activity in both the membrane and cytoplasm. The soluble fraction prepared from T. indiensis cells grown at 60°C was found to contain the majority of Fe(III reduction activity of the microorganism and produced four distinct bands in nondenaturing Fe(III reductase activity gel. Proteins from each of these bands were partially purified by chromatography and identified by mass spectrometry (MS with the help of T. indiensis proteome sequences. Two paralogous dihydrolipoamide dehydrogenases (LPDs, thioredoxin reductase (Trx, NADP(H-nitrite reductase (Ntr, and thioredoxin disulfide reductase (Tdr were determined to be responsible for Fe(III reductase activity. Amino acid sequence and three-dimensional (3D structural similarity analyses of the T. indiensis Fe(III reductases were carried out with Cr(VI reducing proteins from other bacteria. The two LPDs and Tdr showed very significant sequence and structural identity, respectively, with Cr(VI reducing dihydrolipoamide dehydrogenase from Thermus scotoductus and thioredoxin disulfide reductase from Desulfovibrio desulfuricans. It appears that in addition to their iron reducing activity T. indiensis LPDs and Tdr are possibly involved in Cr(VI reduction as well.

  16. Enzymatic conversion of D-galactose to D-tagatose: heterologous expression and characterisation of a thermostable L-arabinose isomerase from Thermoanaerobacter mathranii.

    Science.gov (United States)

    Jørgensen, F; Hansen, O C; Stougaard, P

    2004-06-01

    The ability to convert D-galactose into D-tagatose was compared among a number of bacterial L-arabinose isomerases ( araA). One of the most efficient enzymes, from the anaerobic thermophilic bacterium Thermoanaerobacter mathranii, was produced heterologously in Escherichia coli and characterised. Amino acid sequence comparisons indicated that this enzyme is only distantly related to the group of previously known araA sequences in which the sequence similarity is evident. The substrate specificity and the Michaelis-Menten constants of the enzyme determined with L-arabinose, D-galactose and D-fucose also indicated that this enzyme is an unusual, versatile L-arabinose isomerase which is able to isomerise structurally related sugars. The enzyme was immobilised and used for production of D-tagatose at 65 degrees C. Starting from a 30% solution of D-galactose, the yield of D-tagatose was 42% and no sugars other than D-tagatose and D-galactose were detected. Direct conversion of lactose to D-tagatose in a single reactor was demonstrated using a thermostable beta-galactosidase together with the thermostable L-arabinose isomerase. The two enzymes were also successfully combined with a commercially available glucose isomerase for conversion of lactose into a sweetening mixture comprising lactose, glucose, galactose, fructose and tagatose.

  17. Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients

    International Nuclear Information System (INIS)

    Tian, Mei; Cui, Ya-Zhou; Song, Guan-Hua; Zong, Mei-Juan; Zhou, Xiao-Yan; Chen, Yu; Han, Jin-Xiang

    2008-01-01

    There is an urgent need to discover more sensitive and specific biomarkers to improve early diagnosis and screen high-risk patients for pancreatic ductal adenocarcinoma (PDAC). Pancreatic juice is an ideal specimen for PDAC biomarkers discovery, because it is an exceptionally rich source of proteins released from pancreatic cancer cells. To identify novel potential biomarkers for PDAC from pancreatic juice, we carried out difference gel electrophoresis (DIGE) and tandem mass spectrometry (MS/MS) to compare the pancreatic juice profiling from 9 PDAC patients and 9 cancer-free controls. Of the identified differently expressed proteins, three up-regulated proteins in pancreatic cancer juice, matrix metalloproteinase-9 (MMP-9), oncogene DJ1 (DJ-1) and alpha-1B-glycoprotein precursor (A1BG), were selected for validation by Western blot and immunohistochemistry. Serum MMP-9 levels were also detected by enzyme linked immunosorbent assay (ELISA). Fourteen proteins were up-regulated and ten proteins were down-regulated in cancerous pancreatic juice compared with cancer-free controls. Increased MMP-9, DJ-1 and A1BG expression in cancerous pancreatic juice were confirmed by Western blot. Immunohistochemical study showed MMP-9, DJ-1 and A1BG positively expressed in 82.4%, 72.5% and 86.3% of pancreatic cancer tissues, significantly higher than that in normal pancreas tissues. Up-regulation of DJ-1 was associated with better differentiation (p < 0.05). Serum MMP-9 levels were significantly higher in PDAC (255.14 ng/ml) than those in chronic pancreatitis (210.22 ng/ml, p = 0.009) and healthy control (203.77 ng/ml, p = 0.027). The present proteome analysis revealed MMP-9, DJ-1 and A1BG proteins as elevated in pancreatic juice from PDAC, which suggest their further utility in PDAC diagnosis and screening. This is the first time A1BG was identified as a potential biomarker in pancreatic cancer associated samples. The measurement of serum MMP-9 might be clinically useful for PDAC

  18. Production of ethanol from sugars and lignocellulosic biomass by Thermoanaerobacter J1 isolated from a hot spring in Iceland.

    Science.gov (United States)

    Jessen, Jan Eric; Orlygsson, Johann

    2012-01-01

    Thermophilic bacteria have gained increased attention as candidates for bioethanol production from lignocellulosic biomass. This study investigated ethanol production by Thermoanaerobacter strain J1 from hydrolysates made from lignocellulosic biomass in batch cultures. The effect of increased initial glucose concentration and the partial pressure of hydrogen on end product formation were examined. The strain showed a broad substrate spectrum, and high ethanol yields were observed on glucose (1.70 mol/mol) and xylose (1.25 mol/mol). Ethanol yields were, however, dramatically lowered by adding thiosulfate or by cocultivating strain J1 with a hydrogenotrophic methanogen with acetate becoming the major end product. Ethanol production from 4.5 g/L of lignocellulosic biomass hydrolysates (grass, hemp stem, wheat straw, newspaper, and cellulose) pretreated with acid or alkali and the enzymes Celluclast and Novozymes 188 was investigated. The highest ethanol yields were obtained on cellulose (7.5 mM·g(-1)) but the lowest on straw (0.8 mM·g(-1)). Chemical pretreatment increased ethanol yields substantially from lignocellulosic biomass but not from cellulose. The largest increase was on straw hydrolysates where ethanol production increased from 0.8 mM·g(-1) to 3.3 mM·g(-1) using alkali-pretreated biomass. The highest ethanol yields on lignocellulosic hydrolysates were observed with hemp hydrolysates pretreated with acid, 4.2 mM·g(-1).

  19. Production of Bioethanol From Lignocellulosic Biomass Using Thermophilic Anaerobic Bacteria

    DEFF Research Database (Denmark)

    Georgieva, Tania I.

    2006-01-01

    and xylose and to tolerate the inhibitory compounds present in lignocellulosic hydrolysates is therefore apparent. Several thermophilic anaerobic xylan degrading bacteria from our culture collection (EMB group at BioCentrum-DTU) have been screened for a potential ethanol producer from hemicellulose...... hydrolysates, and out of the screening test, one particular strain (A10) was selected for the best performance. The strain was morphologically and physiologically characterized as Thermoanaerobacter mathranii strain A10. Unlike other thermophilic anaerobic bacteria, the wild-type strain Thermoanaerobacter...... Thermoanaerobacter BG1L1 was further studied. The experiments were carried out in a continuous immobilized reactor system (a fluidized bed reactor), which is likely to be the process design configuration for xylose fermentation in a Danish biorefinery concept for production of fuel ethanol. The immobilization...

  20. Production of Ethanol from Sugars and Lignocellulosic Biomass by Thermoanaerobacter J1 Isolated from a Hot Spring in Iceland

    Directory of Open Access Journals (Sweden)

    Jan Eric Jessen

    2012-01-01

    Full Text Available Thermophilic bacteria have gained increased attention as candidates for bioethanol production from lignocellulosic biomass. This study investigated ethanol production by Thermoanaerobacter strain J1 from hydrolysates made from lignocellulosic biomass in batch cultures. The effect of increased initial glucose concentration and the partial pressure of hydrogen on end product formation were examined. The strain showed a broad substrate spectrum, and high ethanol yields were observed on glucose (1.70 mol/mol and xylose (1.25 mol/mol. Ethanol yields were, however, dramatically lowered by adding thiosulfate or by cocultivating strain J1 with a hydrogenotrophic methanogen with acetate becoming the major end product. Ethanol production from 4.5 g/L of lignocellulosic biomass hydrolysates (grass, hemp stem, wheat straw, newspaper, and cellulose pretreated with acid or alkali and the enzymes Celluclast and Novozymes 188 was investigated. The highest ethanol yields were obtained on cellulose (7.5 mM·g−1 but the lowest on straw (0.8 mM·g−1. Chemical pretreatment increased ethanol yields substantially from lignocellulosic biomass but not from cellulose. The largest increase was on straw hydrolysates where ethanol production increased from 0.8 mM·g−1 to 3.3 mM·g−1 using alkali-pretreated biomass. The highest ethanol yields on lignocellulosic hydrolysates were observed with hemp hydrolysates pretreated with acid, 4.2 mM·g−1.

  1. BG1 has a major role in MHC-linked resistance to malignant lymphoma in the chicken.

    Science.gov (United States)

    Goto, Ronald M; Wang, Yujun; Taylor, Robert L; Wakenell, Patricia S; Hosomichi, Kazuyoshi; Shiina, Takashi; Blackmore, Craig S; Briles, W Elwood; Miller, Marcia M

    2009-09-29

    Pathogen selection is postulated to drive MHC allelic diversity at loci for antigen presentation. However, readily apparent MHC infectious disease associations are rare in most species. The strong link between MHC-B haplotype and the occurrence of virally induced tumors in the chicken provides a means for defining the relationship between pathogen selection and MHC polymorphism. Here, we verified a significant difference in resistance to gallid herpesvirus-2 (GaHV-2)-induced lymphomas (Marek's disease) conferred by two closely-related recombinant MHC-B haplotypes. We mapped the crossover breakpoints that distinguish these haplotypes to the highly polymorphic BG1 locus. BG1 encodes an Ig-superfamily type I transmembrane receptor-like protein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM), which undergoes phosphorylation and is recognized by Src homology 2 domain-containing protein tyrosine phosphatase (SHP-2). The recombinant haplotypes are identical, except for differences within the BG1 3'-untranslated region (3'-UTR). The 3'-UTR of the BG1 allele associated with increased lymphoma contains a 225-bp insert of retroviral origin and showed greater inhibition of luciferase reporter gene translation compared to the other allele. These findings suggest that BG1 could affect the outcome of GaHV-2 infection through modulation of the lymphoid cell responsiveness to infection, a condition that is critical for GaHV-2 replication and in which the MHC-B haplotype has been previously implicated. This work provides a mechanism by which MHC-B region genetics contributes to the incidence of GaHV-2-induced malignant lymphoma in the chicken and invites consideration of the possibility that similar mechanisms might affect the incidence of lymphomas associated with other oncogenic viral infections.

  2. Differences in maintenance of mean blood glucose (BG and their association with response to “recognizing hunger”

    Directory of Open Access Journals (Sweden)

    Ciampolini M

    2011-05-01

    Full Text Available Mario Ciampolini1, Massimiliano Sifone21Preventive Gastroenterology Unit, Department of Paediatrics, Università di Firenze, Florence, Italy; 2Department of Statistics, Università di Firenze, Florence, ItalyBackground: Meals begin and end subjectively. We trained healthy subjects to recognize initial hunger as a preprandial target for meal consumption, and to create a “recognizing hunger” or initial hunger meal pattern.Objective: Training subjects to “recognize hunger” lowers blood glucose (BG and improves energy balance, and lowers metabolic risks and bodyweight. A minority may have low BG and low metabolic risks at recruitment, but the others may recover this favorable condition by training.Methods: In a 7-day food diary, subjects reported their preprandial BG measurements; BG and energy availability by blood were assessed at the lowest BG during the day, and diary-mean BG thus characterized the individual meal pattern (daily energy intake. We analyzed the same diaries of a recent paper on a global, randomized comparison of subjects trained in “recognizing hunger” with control subjects. This time, we checked whether subjects who had maintained low BG (LBG subgroup at recruitment were able to decrease mean BG and metabolic risk factors during “hunger recognition” like those who presented high BG (HBG subgroup.Results: At recruitment, the BG means of 120 investigated subjects were within mean confidence limits of ± 3.84 mg/dL, and we could stratify subjects in ten small strata of which each significantly differed by mean BG. Mean BG was stable in each control subject over five months; the mean absolute change being 6.0 ± 4.6 mg/dL. Only three out of 34 trained subjects who had lower mean BG than 81.8 mg/dL significantly decreased mean BG, whereas 41 out of 55 subjects whose mean BG was greater than 81.8 mg/dL significantly decreased mean BG after training (P < 0.0001. At recruitment, the LBG subgroup showed significantly lower

  3. Recombinant thermostable AP exonuclease from Thermoanaerobacter tengcongensis: cloning, expression, purification, properties and PCR application

    DEFF Research Database (Denmark)

    Dabrowski, Slawomir; Brillowska-Dabrowska, Anna; Ahring, Birgitte Kiær

    2013-01-01

    Apurinic/apyrimidinic (AP) sites in DNA are considered to be highly mutagenic and must be corrected to preserve genetic integrity, especially at high temperatures. The gene encoding a homologue of AP exonuclease was cloned from the thermophilic anaerobic bacterium Thermoanaerobacter tengcongensis......) of fully active and soluble His6-tagged Tte AP enzyme with His6-tag on C-terminal end was obtained in Escherichia coli Rosetta (DE3) pLysS. The active enzyme was purified up to 98% homogeneity in one chromatographic step using metal-affinity chromatography on Ni(2+)-IDA-Sepharose resin. The yield was 90 mg......, pH 8.0 and at low Mg2+ concentration (0.5 mM). Higher Mg2+ concentration (> 1 mM) enhanced 3'-5' exonuclease activity and at Mg2+ concentration > 2.0 mM 3' nuclease activity was observed. Because of the endonuclease activity of Tte AP exonuclease, the enzyme was applied in PCR amplification of long...

  4. Benzophenone-1 stimulated the growth of BG-1 ovarian cancer cells by cell cycle regulation via an estrogen receptor alpha-mediated signaling pathway in cellular and xenograft mouse models

    International Nuclear Information System (INIS)

    Park, Min-Ah; Hwang, Kyung-A; Lee, Hye-Rim; Yi, Bo-Rim; Jeung, Eui-Bae; Choi, Kyung-Chul

    2013-01-01

    Highlights: ► BP-1 induced cell growth was reversed by an ER antagonist in BG-1 cells. ► BP-1 up-regulated the mRNA expression of cyclin D1. ► Up-regulation of cyclin D1 by BP-1 was reversed by an ER antagonist. ► BP-1 is a potential endocrine disruptor that exerts estrogenic effects. - Abstract: 2,4-Dihydroxybenzophenone (benzophenone-1; BP-1) is an UV stabilizer primarily used to prevent polymer degradation and deterioration in quality due to UV irradiation. Recently, BP-1 has been reported to bioaccumulate in human bodies by absorption through the skin and has the potential to induce health problems including endocrine disruption. In the present study, we examined the xenoestrogenic effect of BP-1 on BG-1 human ovarian cancer cells expressing estrogen receptors (ERs) and relevant xenografted animal models in comparison with 17-β estradiol (E2). In in vitro cell viability assay, BP-1 (10 −8 –10 −5 M) significantly increased BG-1 cell growth the way E2 did. The mechanism underlying the BG-1 cell proliferation was proved to be related with the up-regulation of cyclin D1, a cell cycle progressor, by E2 or BP-1. Both BP-1 and E2 induced cell growth and up-regulation of cyclin D1 were reversed by co-treatment with ICI 182,780, an ER antagonist, suggesting that BP-1 may mediate the cancer cell proliferation via an ER-dependent pathway like E2. On the other hand, the expression of p21, a regulator of cell cycle progression at G 1 phase, was not altered by BP-1 though it was down-regulated by E2. In xenograft mouse models transplanted with BG-1 cells, BP-1 or E2 treatment significantly increased the tumor mass formation compared to a vehicle (corn oil) within 8 weeks. In histopathological analysis, the tumor sections of E2 or BP-1 group displayed extensive cell formations with high density and disordered arrangement, which were supported by the increased number of BrdUrd positive nuclei and the over-expression of cyclin D1 protein. Taken together, these

  5. Clinical application of l-123 MlBG cardiac imaging

    International Nuclear Information System (INIS)

    Kang, Do Young

    2004-01-01

    Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy

  6. Clinical application of l-123 MlBG cardiac imaging

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Do Young [College of Medicine, Donga Univ., Busan (Korea, Republic of)

    2004-10-01

    Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy.

  7. Dimeric structure of the N-terminal domain of PriB protein from Thermoanaerobacter tengcongensis solved ab initio

    Energy Technology Data Exchange (ETDEWEB)

    Liebschner, Dorothee [National Cancer Institute, Argonne National Laboratory, Argonne, IL 60439 (United States); Brzezinski, Krzysztof [National Cancer Institute, Argonne National Laboratory, Argonne, IL 60439 (United States); University of Bialystok, 15-399 Bialystok (Poland); Dauter, Miroslawa [Argonne National Laboratory, Argonne, IL 60439 (United States); Dauter, Zbigniew, E-mail: dauter@anl.gov [National Cancer Institute, Argonne National Laboratory, Argonne, IL 60439 (United States); Nowak, Marta; Kur, Józef; Olszewski, Marcin, E-mail: dauter@anl.gov [Gdansk University of Technology, 80-952 Gdansk (Poland); National Cancer Institute, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2012-12-01

    The N-terminal domain of the PriB protein from the thermophilic bacterium T. tengcongensis (TtePriB) was expressed and its crystal structure has been solved at the atomic resolution of 1.09 Å by direct methods. PriB is one of the components of the bacterial primosome, which catalyzes the reactivation of stalled replication forks at sites of DNA damage. The N-terminal domain of the PriB protein from the thermophilic bacterium Thermoanaerobacter tengcongensis (TtePriB) was expressed and its crystal structure was solved at the atomic resolution of 1.09 Å by direct methods. The protein chain, which encompasses the first 104 residues of the full 220-residue protein, adopts the characteristic oligonucleotide/oligosaccharide-binding (OB) structure consisting of a five-stranded β-barrel filled with hydrophobic residues and equipped with four loops extending from the barrel. In the crystal two protomers dimerize, forming a six-stranded antiparallel β-sheet. The structure of the N-terminal OB domain of T. tengcongensis shows significant differences compared with mesophile PriBs. While in all other known structures of PriB a dimer is formed by two identical OB domains in separate chains, TtePriB contains two consecutive OB domains in one chain. However, sequence comparison of both the N-terminal and the C-terminal domains of TtePriB suggests that they have analogous structures and that the natural protein possesses a structure similar to a dimer of two N-terminal domains.

  8. Bg1II polymorphism of the epidermal growth factor receptor (EGF-R) gene

    Energy Technology Data Exchange (ETDEWEB)

    Biunno, I; Pozzi, M R; Radice, P; Mondini, P; Pierotti, M A; Porta, G D [Istituto Nazionale Tumori, Milan (Italy); Haley, J; Waterfield, M D [Ludwig Institute for Cancer Research, London (England)

    1988-08-11

    A 770 bp cDNA fragment was derived from the cytoplasmic portion of the EGF-R (ref. Libermann et al., 1985). Bg1II identifies 4 invariant bands of 7.0, 5.0, 3.5 and 1.2 kb and a two allele polymorphism with a band of either 10.6 kb (lane 1) or 9.4 kb (lane 3). An heterozygote individual is represented. The frequency was analyzed in 78 unrelated European Caucasians. Its chromosomal location was determined. Co-dominant segregation was demonstrated in three families of 12 individuals. A rare variant of 8.3 kb was seen in one chromosome out of the 144 examined. This allelic form has not yet been fully characterized.

  9. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Gary [Los Alamos National Laboratory (LANL); Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  10. Early diagnostic value of plasma PCT and BG assay for CRBSI after OLT.

    Science.gov (United States)

    Chen, J; Wang, Y; Shen, Z; Zhu, Z; Song, Y; Han, R

    2011-06-01

    The aim was to evaluate the role of procalcitonin (PCT) and (1-3)-β-D-glucan (BG) tests for early detection or exclusion of central venous catheter-related bloodstream infections (CRBSI) in patients after orthotopic liver transplantation (OLT). Fifty-five patients with clinically suspected CRBSI were assessed after OLT in this prospective study. On the day of clinical suspicion of CRBSI, blood samples were obtained from central venous catheters and a peripheral vein for blood cultures and from a peripheral vein for PCT and BG tests. Plasma PCT and BG values were measured by using an immunoluminometric assay and Fungitell BG assay, respectively. No prisoners or organs from prisoners were used in this study. Twenty-five patients (45%) were diagnosed with CRBIS. Among them, 13 (52%) displayed gram-positive bacteriemia, 11 (44%) gram-negative bacteriemia, and 1 (4%) fungemia. The PCT values were higher in CRBSI than in non-CRBSI patients (P = .003). CRBSI patients did not show significant increases in plasma BG values compared with non-CRBSI subjects (P = .051). PCT and BG area under receiver operating characteristic curves were 0.840 and 0.486, respectively. Sensitivity, specificity, and positive and negative predictive values of a PCT of ≥ 3.1 ng/mL for the diagnosis of CRBSI were 0.72, 0.87, 0.82, and 0.79, respectively. The figures for a BG of ≥ 83 pg/mL were 0.32, 0.90, 0.73, and 0.61, respectively. Among the 24 patients with bacteria infections, PCT was higher in patients with gram-negative than those with gram-positive bacterial infections (P = .022). We concluded that the PCT assay may be a useful rapid diagnostic adjunct for the diagnosis of suspected CRBSI in OLT patients. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Mun Su [University of Florida, Gainesville; Moritz, Brelan E. [University of Florida, Gainesville; Xie, Gary [Los Alamos National Laboratory (LANL); Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chertkov, Olga [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Patel, Milind [University of Florida, Gainesville; Ou, Mark [University of Florida, Gainesville; Harbrucker, Roberta [University of Florida, Gainesville; Ingram, Lonnie O. [University of Florida; Shanmugam, Keelnathan T. [University of Florida

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  12. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Science.gov (United States)

    Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583

  13. High-temperature crystallization of the secondary alcohol dehydrogenase from the extreme thermophilic bacteria Thermoanaerobacter ethanolicus, a bifunctional alcohol dehydrogenase-acetyl-CoA thio esterase

    International Nuclear Information System (INIS)

    Watanabe, L.; Arni, R.K.

    1996-01-01

    Full text. Ethanol fermentations from Saccharomyces sp. are used in industrial ethanol production and are performed at mesophilic temperatures where final ethanol concentrations must exceed 4% (v/v) to make the process industrially economic. In addition, distillation is required to recover ethanol. Thermophilic fermentations are very attractive since they enable separation of ethanol from continuous cultures at process temperature and reduced pressure. Two different ethanol-production pathways have been identified for thermophilic bacteria; type I from Clostridium thermocellum, which contains only NADH-linked primary-alcohol dehydrogeneases, and type II from Thermoanaerobacter brockii which in addition include NADPH-linked secondary-alcohol dehydrogenases. The thermophilic anaerobic bacterium T ethanolicus 39E produces ethanol as the major end product from starch, pentose and herose substrates. The 2 Adh has a lower catalytic efficiency for the oxidation of 1 alcohols, including ethanol, than for the oxidation of secondary (2) alcohols or the reduction of ketones or aldehydes and possesses a significant acetyl-CoA reductive thioesterase activity. Large single crystals (0.7 x 0.3 x 0.3 mn) of this enzyme have been obtained at 40 0 C and diffraction data to 2.7 A resolution has been collected (R merge = 10.44%). Attempts are currently underway to obtain higher resolution data and a search for heavy atom derivatives is currently underway. The crystals belong to the space group P2 1 2 1 2 with cell constants of a a= 170.0 A, b=125.7 A and c=80.5 A. The asymmetric unit contains a tetramer as in the case of the crystals of the secondary alcohol dehydrogenase from Thermoanaerobacter brockii with a V M of 2.85 A 3 /Da. (author)

  14. Occurrence and Detection of Thermoanaerobacterium and Thermoanaerobacter in Canned Food

    Directory of Open Access Journals (Sweden)

    Christian Dotzauer

    2002-01-01

    Full Text Available In order to determine the reason for loss of vacuum in canned food, obligately anaerobic, spore forming thermophilic organisms were isolated from shelf-stable canned food containing vegetables, noodles and potatoes as main ingredients. Thermophilic bacteria from 44 canned food samples that had been stored under anaerobic conditions at 37 °C for at least 7 days were isolated. In addition, organic fertilizer used for the cultivation of some of the foods’ ingredients was examined and anaerobic, thermophilic bacteria could also be isolated from this source. Identification of bacterial strains was carried out by partial and complete 16S-rRNA-gene sequencing. Some of the obtained gene sequences showed a high level of similarity to existing 16S-rRNA gene sequences towards strains of the genera Thermoanaerobacter, Thermoanaerobium and Thermoanaerobacterium respectively, which have not yet been reported to be of importance as food spoilers. In the course of identification of these thermophilic bacteria we developed genera specific PCR-based approaches for detecting isolates belonging to the genera Thermoanaeroacterium and Thermoanaerobacter. Direct capturing of free DNA from contaminated samples using oligonucleotides coupled with paramagentic beads allowed the reduction of the detection time to six hours with a lower limit of 104 cells/mL.

  15. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk

    OpenAIRE

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Fran?oise; Loux, Valentin; Vidal, Marie; Passot, St?phanie; B?al, Catherine; Layec, S?verine; Fonseca, Fernanda

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes.

  16. Empirically establishing blood glucose targets to achieve HbA1c goals.

    Science.gov (United States)

    Wei, Nancy; Zheng, Hui; Nathan, David M

    2014-04-01

    OBJECTIVE To determine the average fasting, postprandial, and bedtime self-monitored blood glucose (SMBG) concentrations associated with specified HbA1c levels using data from the A1c-Derived Average Glucose (ADAG) study. RESEARCH DESIGN AND METHODS The ADAG study was a multicenter observational study that used continuous glucose monitoring and SMBG testing to determine the relationship between mean average glucose and HbA1c. We used the SMBG data from 470 of the ADAG study participants (237 with type 1 diabetes and 147 with type 2 diabetes) to determine the average fasting, premeal, 90-min postmeal, and bedtime blood glucose (BG) for predefined target HbA1c groups between 5.5 and 8.5% (37-69 mmol/mol). t Tests were used to compare mean BG values between type 1 and type 2 diabetes groups. RESULTS The average fasting BG needed to achieve predefined HbA1c target levels of 5.5-6.49% (37-47 mmol/mol), 6.5-6.99% (48-52 mmol/mol), 7.0-7.49% (52-58 mmol/mol), 7.5-7.99% (58-64 mmol/mol), and 8.0-8.5% (64-69 mmol/mol) were 122 mg/dL with 95% CI 117-127, 142 mg/dL (135-150), 152 mg/dL (143-162), 167 mg/dL (157-177), and 178 mg/dL (164-192), respectively. Postmeal BG to achieve the HbA1c level of 6.5-6.99% (48-52 mmol/mol) and 7.0-7.49% (52-58 mmol/mol) were 139 mg/dL (134-144) and 152 mg/dL (147-157), respectively. Bedtime BG was 153 mg/dL (145-161) and 177 mg/dL (166-188), respectively. CONCLUSIONS We have determined the average BG at premeal, postmeal, and bedtime to achieve a variety of HbA1c targets. These results, based on empirical data, will help patients and providers set realistic day-to-day SMBG targets to achieve individualized HbA1c goals.

  17. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    Science.gov (United States)

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-03-03

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. Copyright © 2016 Meneghel et al.

  18. Heterologous production of human papillomavirus type-16 L1 protein by a lactic acid bacterium

    Directory of Open Access Journals (Sweden)

    Bermúdez-Humarán Luis G

    2009-08-01

    Full Text Available Abstract Background The expression of vaccine antigens in lactic acid bacteria (LAB is a safe and cost-effective alternative to traditional expression systems. In this study, we investigated i the expression of Human papillomavirus type 16 (HPV-16 L1 major capsid protein in the model LAB Lactococcus lactis and ii the ability of the resulting recombinant strain to produce either capsomer-or virus-like particles (VLPs. Results and conclusion HPV-16 L1 gene was cloned into two vectors, pCYT and pSEC, designed for controlled intra- or extracellular heterologous expression in L. lactis, respectively. The capacity of L. lactis harboring either pCYT:L1 or pSEC:L1 plasmid to accumulate L1 in the cytoplasm and supernatant samples was confirmed by Western blot assays. Electron microscopy analysis suggests that, L1 protein produced by recombinant lactococci can self-assemble into structures morphologically similar to VLPs intracellularly. The presence of conformational epitopes on the L. lactis-derived VLPs was confirmed by ELISA using an anti-HPV16 L1 capsid antigen antibody. Our results support the feasibility of using recombinant food-grade LAB, such as L. lactis, for the production of L1-based VLPs and open the possibility for the development of a new safe mucosal vector for HPV-16 prophylactic vaccination.

  19. New crystal forms of NTPDase1 from the bacterium Legionella pneumophila

    International Nuclear Information System (INIS)

    Zebisch, Matthias; Schäfer, Petra; Lauble, Peter; Sträter, Norbert

    2013-01-01

    The soluble NTPDase1 from L. pneumophila was crystallized in six crystal forms and the structure was solved using a sulfur SAD approach. Nucleoside triphosphate diphosphohydrolases (NTPDases) are a large class of nucleotidases that hydrolyze the (γ/β)- and (β/α)-anhydride bonds of nucleoside triphosphates and diphosphates, respectively. NTPDases are found throughout the eukaryotic domain. In addition, a very small number of members can be found in bacteria, most of which live as parasites of eukaryotic hosts. NTPDases of intracellular and extracellular parasites are emerging as important regulators for the survival of the parasite. To deepen the knowledge of the structure and function of this enzyme class, recombinant production of the NTPDase1 from the bacterium Legionella pneumophila has been established. The protein could be crystallized in six crystal forms, of which one has been described previously. The crystals diffracted to resolutions of between 1.4 and 2.5 Å. Experimental phases determined by a sulfur SAD experiment using an orthorhombic crystal form produced an interpretable electron-density map

  20. Complete Genome Sequence of Bacillus velezensis L-1, Which Has Antagonistic Activity against Pear Diseases

    OpenAIRE

    Sun, Pingping; Cui, Jianchao; Jia, Xiaohui; Wang, Wenhui

    2017-01-01

    ABSTRACT Bacillus velezensis L-1 is an effective biocontrol agent against pear diseases. Here, we report the complete genome sequence of B. velezensis L-1 in which clusters related to the biosynthesis of secondary metabolites were predicted. This genome provides insights into the possible biocontrol mechanisms and furthers application of this specific bacterium.

  1. Antioxidant and DNA Damage Protecting Activity of Exopolysaccharides from the Endophytic Bacterium Bacillus cereus SZ1

    Directory of Open Access Journals (Sweden)

    Li Ping Zheng

    2016-02-01

    Full Text Available An endophytic bacterium was isolated from the Chinese medicinal plant Artemisia annua L. The phylogenetic and physiological characterization indicated that the isolate, strain SZ-1, was Bacillus cereus. The endophyte could produce an exopolysaccharide (EPS at 46 mg/L. The 1,1-diphenyl-2-picrylhydracyl (DPPH radical scavenging activity of the EPS reached more than 50% at 3–5 mg/mL. The EPS was also effective in scavenging superoxide radical in a concentration dependent fashion with an EC50 value of 2.6 mg/mL. The corresponding EC50 for scavenging hydroxyl radical was 3.1 mg/mL. Moreover, phenanthroline-copper complex-mediated chemiluminescent emission of DNA damage was both inhibited and delayed by EPS. The EPS at 0.7–1.7 mg/mL also protected supercoiled DNA strands in plasmid pBR322 against scission induced by Fenton-mediated hydroxyl radical. The preincubation of PC12 cells with the EPS prior to H2O2 exposure increased the cell survival and glutathione (GSH level and catalase (CAT activities, and decreased the level of malondialdehyde (MDA and lactate dehydrogenase (LDH activity in a dose-dependent manner, suggesting a pronounced protective effect against H2O2-induced cytotoxicity. Our study indicated that the EPS could be useful for preventing oxidative DNA damage and cellular oxidation in pharmaceutical and food industries.

  2. RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

    Directory of Open Access Journals (Sweden)

    Bo Liu

    Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

  3. Complete Genome Sequence of Bacillus velezensis L-1, Which Has Antagonistic Activity against Pear Diseases.

    Science.gov (United States)

    Sun, Pingping; Cui, Jianchao; Jia, Xiaohui; Wang, Wenhui

    2017-11-30

    Bacillus velezensis L-1 is an effective biocontrol agent against pear diseases. Here, we report the complete genome sequence of B. velezensis L-1 in which clusters related to the biosynthesis of secondary metabolites were predicted. This genome provides insights into the possible biocontrol mechanisms and furthers application of this specific bacterium. Copyright © 2017 Sun et al.

  4. [Isolation and identification of Mn oxidizing bacterium Aminobacter sp. H1 and its oxidation mechanism].

    Science.gov (United States)

    Yan, Ping; Jiang, Li-Ying; Chen, Jian-Meng; He, Zhi-Min; Xiao, Shao-Dan; Jiang, Yi-Feng

    2014-04-01

    A bacterium with high manganese oxidizing activity was isolated from a biological manganese removal filter and named as H1. Based on its characteristics and the analysis of 16S rDNA sequence, the strain H1 belonged to the genus Aminobacter sp. and its manganese oxidizing ability had never been reported. In this paper, the microbiologic properties of the strain H1, the manganese oxidation mechanisms and characteristics of biogenic manganese oxides were investigated. The results showed that the maximal tolerant Mn concentration of strain H1 was 50 mmol x L(-1), and Mn(II) could be completely removed by strain H1 when the concentration was lower than 10 mmol x L(-1). Strain H1 could oxidize Mn2+ by both the production of manganese oxidizing activity factor and alkaline metabolites during growth, which were synthesized in the cell and then secreted into extracellular culture medium. During the oxidation process, the intermediate of soluble Mn(III) was detected. SEM showed that the biogenic manganese oxides were amorphous and poorly-crystalline, and it closely combined with bacteria. The components of the biogenic manganese oxides produced by strain H1 were identified as MnCO3, MnOOH, Mn3O4 and MnO2 by XRD, XPS and SEM-EDX.

  5. The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

    Science.gov (United States)

    Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

    2013-12-01

    The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0

  6. Ethanol production from glucose and xylose by immobilized Thermoanaerobacter pentosaceus at 70 °C in an up-flow anaerobic sludge blanket (UASB) reactor

    DEFF Research Database (Denmark)

    Sittijunda, Sureewan; Tomás, Ana Faria; Reungsang, Alissara

    2013-01-01

    The newly isolated extreme thermophilic ethanologen Thermoanaerobacter pentosaceus was immobilized in different support materials in order to improve its ethanol production ability. In batch fermentation, a maximum ethanol yield of 1.36 mol mol-1 consumed sugars was obtained by T. pentosaceus...... occurred at an HRT of 6 h. The maximum ethanol yield and concentration, 1.50 mol mol-1 consumed sugars and 12.4 g l-1, were obtained with an HRT of 12 h. The latter represented an improvement of 60 % in relation to previously obtained results. This indicates that immobilization of T. pentosaceus...... immobilized on rapeseed straw. Additionally, immobilized T. pentosaceus’ ethanol production was improved by 11 % in comparison to free cells. In continuous mode, it was shown that hydraulic retention time (HRT) affected ethanol yield, and a dramatic shift from ethanol to acetate and lactate production...

  7. Induction and regeneration of autoplasts from Clostridium thermohydrosulfuricum JW102 and Thermoanaerobacter ethanolicus JW200

    Energy Technology Data Exchange (ETDEWEB)

    Peteranderl, R.; Canganella, F.; Holzenburg, A.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States)

    1993-10-01

    Autolysis was induced to form stable, cell wall-free cells of Clostridium thermohydrosulfuricum JW102 and Thermoanaerobacter ethanolicus JW200, using a complex medium containing glycine (0.4% wt/vol) and/or sucrose or glycerol (10% wt/vol) at an optimum temperature of 64{degrees}C. Autoplasts of both bacteria were grown as L-phase colonies on solid medium; more than 50% of these colonies regenerated to the walled form during prolonged incubation. The removal of the cell wall was confirmed by electron microscopy.

  8. 5-Acetamido-3,5-dideoxy-L-glycero-L-manno-non-2-ulosonic acid-containing O-polysaccharide from marine bacterium Pseudomonas glareae KMM 9500T.

    Science.gov (United States)

    Kokoulin, Maxim S; Kalinovsky, Anatoly I; Romanenko, Lyudmila A; Mikhailov, Valery V

    2018-05-22

    The O-polysaccharide was isolated from the lipopolysaccharide of a marine bacterium Pseudomonas glareae KMM 9500 T and studied by chemical methods along with 1D and 2D 1 H and 13 C NMR spectroscopy including 1 H, 1 H-TOCSY, 1 H, 1 H-COSY, 1 H, 1 H-ROESY, 1 H, 13 C-HSQC and 1 H, 13 C-HMBC experiments. The O-polysaccharide was found to consist of linear tetrasaccharide repeating units constituted by D-glucuronic acid (D-GlcA), L-rhamnose (L-Rha), D-glucose (D-Glc) and 5-acetamido-7,9-O-[(S)-1-carboxyethylidene]-3,5-dideoxy-L-glycero-L-manno-non-2-ulosonic acid (Sug7,9(S-Pyr)), partially O-acetylated at position 8 (∼70%): →4)-α-D-GlcpA-(1→3)-β-L-Rhap-(1→4)-β-D-Glcp-(1→4)-β-Sugp8Ac(∼70%)7,9(S-Pyr)-(2→. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. The novel oleaginous bacterium Sphingomonas sp. EGY1 DSM 29616: a value added platform for renewable biodiesel.

    Science.gov (United States)

    Amer, Nehad N; Elbahloul, Yasser; Embaby, Amira M; Hussein, Ahmed

    2017-07-01

    Oleaginous microorganisms are regarded as efficient, renewable cell factories for lipid biosynthesis, a biodiesel precursor, to overwhelm the cosmopolitan energy crisis with affordable investment capital costs. Present research highlights production and characterization of lipids by a newly isolated oleaginous bacterium, Sphingomonas sp. EGY1 DSM 29616 through an eco-friendly approach. Only sweet whey [42.1% (v/v)] in tap water was efficiently used as a growth medium and lipid production medium to encourage cell growth and trigger lipid accumulation simultaneously. Cultivation of Sphingomonas sp. EGY1 DSM 29616 in shake flasks resulted in the accumulation of 8.5 g L -1 lipids inside the cells after 36 h at 30 °C. Triglycerides of C16:C18 saturated and unsaturated fatty acids showed a similar pattern to tripalmitin or triolein; deduced from gas chromatography (GC), thin layer chromatography (TLC), and Matrix-assisted laser desorption/ionization time-of-flight-mass spectra analysis (MALDI-TOF-MS) analyses. Batch cultivation 2.5 L in a laboratory scale fermenter led to 13.8 g L -1 accumulated lipids after 34 h at 30 °C. Present data would underpin the potential of Sphingomonas sp. EGY1 DSM 29616 as a novel renewable cell factory for biosynthesis of biodiesel.

  10. Anticancer effect of genistein on BG-1 ovarian cancer growth induced by 17 β-estradiol or bisphenol A via the suppression of the crosstalk between estrogen receptor alpha and insulin-like growth factor-1 receptor signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul, E-mail: kchoi@cbu.ac.kr

    2013-11-01

    The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2.

  11. Anticancer effect of genistein on BG-1 ovarian cancer growth induced by 17 β-estradiol or bisphenol A via the suppression of the crosstalk between estrogen receptor alpha and insulin-like growth factor-1 receptor signaling pathways

    International Nuclear Information System (INIS)

    Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul

    2013-01-01

    The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2

  12. Characterization of a Novel Alginate Lyase from Marine Bacterium Vibrio furnissii H1

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhu

    2018-01-01

    Full Text Available Alginate lyases show great potential for industrial and medicinal applications, especially as an attractive biocatalyst for the production of oligosaccharides with special bioactivities. A novel alginate lyase, AlyH1, from the marine bacterium Vibrio furnissii H1, which has been newly isolated from rotten seaweed, was purified and characterized. The purified enzyme showed the specific activity of 2.40 U/mg. Its molecular mass was 35.8 kDa. The optimal temperature and pH were 40 °C and pH 7.5, respectively. AlyH1 maintained stability at neutral pH (7.0–8.0 and temperatures below 30 °C. Metal ions Na+, Mg2+, and K+ increased the activity of the enzyme. With sodium alginate as the substrate, the Km and Vmax values of AlyH1 were 2.28 mg/mL and 2.81 U/mg, respectively. AlyH1 exhibited activities towards both polyguluronate and polymannuronate, and preferentially degraded polyguluronate. Products prepared from sodium alginate by AlyH1 were displayed to be di-, tri-, and tetra-alginate oligosaccharides. A partial amino acid sequence (190 aa of AlyH1 analysis suggested that AlyH1 was an alginate lyase of polysaccharide lyase family 7. The sequence showed less than 77% identity to the reported alginate lyases. These data demonstrated that AlyH1 could be as a novel and potential candidate in application of alginate oligosaccharides production with low polymerization degrees.

  13. Carboxydobrachium pacificum gen. nov., sp. nov., a new anaerobic, thermophilic, CO-utilizing marine bacterium from Okinawa Trough.

    Science.gov (United States)

    Sokolova, T G; González, J M; Kostrikina, N A; Chernyh, N A; Tourova, T P; Kato, C; Bonch-Osmolovskaya, E A; Robb, F T

    2001-01-01

    A new anaerobic, thermophilic, CO-utilizing marine bacterium, strain JMT, was isolated from a submarine hot vent in Okinawa Trough. Cells of strain JMT were non-motile thin straight rods, sometimes branching, with a cell wall of the Gram-positive type, surrounded with an S-layer. Chains of three to five cells were often observed. The isolate grew chemolithotrophically on CO, producing equimolar quantities of H2 and CO2 (according to the equation CO+H2O-->CO2+H2) and organotrophically on peptone, yeast extract, starch, cellobiose, glucose, galactose, fructose and pyruvate, producing H2, acetate and CO2. Growth was observed from 50 to 80 degrees C with an optimum at 70 degrees C. The optimum pH was 6.8-7.1. The optimum concentration of sea salts in the medium was 20.5-25.5 g l(-1). The generation time under optimal conditions was 7.1 h. The DNA G+C content was 33 mol %. Growth of isolate JMT was not inhibited by penicillin, but ampicillin, streptomycin, kanamycin and neomycin completely inhibited growth. The results of 16S rDNA sequence analysis revealed that strain JMT belongs to the Thermoanaerobacter phylogenetic group within the Bacillus-Clostridium subphylum of Gram-positive bacteria but represents a separate branch of this group. On the basis of morphological and physiological features and phylogenetic data, this isolate should be assigned to a new genus, for which the name Carboxydobrachium is proposed. The type species is Carboxydobrachium pacificum; the type strain is JMT (= DSM 12653T).

  14. Isolation, Identification, and Optimization of Culture Conditions of a Bioflocculant-Producing Bacterium Bacillus megaterium SP1 and Its Application in Aquaculture Wastewater Treatment.

    Science.gov (United States)

    Luo, Liang; Zhao, Zhigang; Huang, Xiaoli; Du, Xue; Wang, Chang'an; Li, Jinnan; Wang, Liansheng; Xu, Qiyou

    2016-01-01

    A bioflocculant-producing bacterium, Bacillus megaterium SP1, was isolated from biofloc in pond water and identified by using both 16S rDNA sequencing analysis and a Biolog GEN III MicroStation System. The optimal carbon and nitrogen sources for Bacillus megaterium SP1 were 20 g L -1 of glucose and 0.5 g L -1 of beef extract at 30°C and pH 7. The bioflocculant produced by strain SP1 under optimal culture conditions was applied into aquaculture wastewater treatment. The removal rates of chemical oxygen demand (COD), total ammonia nitrogen (TAN), and suspended solids (SS) in aquaculture wastewater reached 64, 63.61, and 83.8%, respectively. The volume of biofloc (FV) increased from 4.93 to 25.97 mL L -1 . The addition of Bacillus megaterium SP1 in aquaculture wastewater could effectively improve aquaculture water quality, promote the formation of biofloc, and then form an efficient and healthy aquaculture model based on biofloc technology.

  15. L = ± 1 stellarator

    International Nuclear Information System (INIS)

    Kikuchi, T.; Shiina, S.; Saito, K.; Gesso, H.; Aizawa, M.; Kawakami, I.

    1985-01-01

    We report the magnetic field configuration of helical magnetic axis stellarator. The magnetic field configuration is composed of large l=1 field and small l=-1 and l=0(bumpy) fields. The large l=1 field (combined with the small l=-1 field) is used to form helical magnetic axis with the helical curvature much larger than the toroidal curvature, which provides the high limiting values of β. The small l=-1 field, furthermore, as well as the large l=1 field reduces the Pfirsch-Schlueter currents by combining with l=0 field. Therefore, the large l=1 field and the combination of three field components may be favourable for the increase of limiting β value

  16. Bergmann glia and the recognition molecule CHL1 organize GABAergic axons and direct innervation of Purkinje cell dendrites.

    Directory of Open Access Journals (Sweden)

    Fabrice Ango

    2008-04-01

    Full Text Available The geometric and subcellular organization of axon arbors distributes and regulates electrical signaling in neurons and networks, but the underlying mechanisms have remained elusive. In rodent cerebellar cortex, stellate interneurons elaborate characteristic axon arbors that selectively innervate Purkinje cell dendrites and likely regulate dendritic integration. We used GFP BAC transgenic reporter mice to examine the cellular processes and molecular mechanisms underlying the development of stellate cell axons and their innervation pattern. We show that stellate axons are organized and guided towards Purkinje cell dendrites by an intermediate scaffold of Bergmann glial (BG fibers. The L1 family immunoglobulin protein Close Homologue of L1 (CHL1 is localized to apical BG fibers and stellate cells during the development of stellate axon arbors. In the absence of CHL1, stellate axons deviate from BG fibers and show aberrant branching and orientation. Furthermore, synapse formation between aberrant stellate axons and Purkinje dendrites is reduced and cannot be maintained, leading to progressive atrophy of axon terminals. These results establish BG fibers as a guiding scaffold and CHL1 a molecular signal in the organization of stellate axon arbors and in directing their dendritic innervation.

  17. Molecular mechanism of PD-1/PD-L1 blockade via anti-PD-L1 antibodies atezolizumab and durvalumab.

    Science.gov (United States)

    Lee, Hyun Tae; Lee, Ju Yeon; Lim, Heejin; Lee, Sang Hyung; Moon, Yu Jeong; Pyo, Hyo Jeong; Ryu, Seong Eon; Shin, Woori; Heo, Yong-Seok

    2017-07-17

    In 2016 and 2017, monoclonal antibodies targeting PD-L1, including atezolizumab, durvalumab, and avelumab, were approved by the FDA for the treatment of multiple advanced cancers. And many other anti-PD-L1 antibodies are under clinical trials. Recently, the crystal structures of PD-L1 in complex with BMS-936559 and avelumab have been determined, revealing details of the antigen-antibody interactions. However, it is still unknown how atezolizumab and durvalumab specifically recognize PD-L1, although this is important for investigating novel binding sites on PD-L1 targeted by other therapeutic antibodies for the design and improvement of anti-PD-L1 agents. Here, we report the crystal structures of PD-L1 in complex with atezolizumab and durvalumab to elucidate the precise epitopes involved and the structural basis for PD-1/PD-L1 blockade by these antibodies. A comprehensive comparison of PD-L1 interactions with anti-PD-L1 antibodies provides a better understanding of the mechanism of PD-L1 blockade as well as new insights into the rational design of improved anti-PD-L1 therapeutics.

  18. BG-4, a novel anticancer peptide from bitter gourd (Momordica charantia), promotes apoptosis in human colon cancer cells.

    Science.gov (United States)

    Dia, Vermont P; Krishnan, Hari B

    2016-09-15

    Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity of BG-4 may be responsible for its capability to cause cytotoxicity to HCT-116 and HT-29 human colon cancer cells with ED50 values of 134.4 and 217.0 μg/mL after 48 h of treatment, respectively. The mechanism involved in the cytotoxic effect may be associated with induction of apoptosis as evidenced by increased percentage of HCT-116 and HT-29 colon cancer cells undergoing apoptosis from 5.4% (untreated) to 24.8% (BG-4 treated, 125 μg/mL for 16 h) and 8.5% (untreated) to 31.9% (BG-4 treated, 125 μg/mL for 16 h), respectively. The molecular mechanistic explanation in the apoptosis inducing property of BG-4 is due to reduced expression of Bcl-2 and increased expression of Bax leading to increased expression of caspase-3 and affecting the expression of cell cycle proteins p21 and CDK2. This is the first report on the anti-cancer potential of a novel bioactive peptide isolated from Momordica charantia in vitro supporting the potential therapeutic property of BG-4 against colon cancer that must be addressed using in vivo models of colon carcinogenesis.

  19. Biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl) ethane (DDT) by using Serratia marcescens NCIM 2919.

    Science.gov (United States)

    Grewal, Jasneet; Bhattacharya, Amrik; Kumar, Sumit; Singh, Dileep K; Khare, Sunil K

    2016-12-01

    A solvent tolerant bacterium Serratia marcescens NCIM 2919 has been evaluated for degradation of DDT (1,1,1-trichloro-2,2-bis (4-chlorophenyl) ethane). The bacterium was able to degrade up to 42% of initial 50 mg L -1 of DDT within 10 days of incubation. The highlight of the work was the elucidation of DDT degradation pathway in S. marcescens. A total of four intermediates metabolites viz. 2,2-bis (chlorophenyl)-1,1-dichloroethane (DDD), 2,2-bis (chlorophenyl)-1,1-dichloroethylene (DDE), 2,2-bis (chlorophenyl)-1-chloroethylene (DDMU), and 4-chlorobenzoic acid (4-CBA) were identified by GC-Mass and FTIR. 4-CBA was found to be the stable product of DDT degradation. Metabolites preceding 4-CBA were not toxic to strain as reveled through luxuriant growth in presence of varying concentrations of exogenous DDD and DDE. However, 4-CBA was observed to inhibit the growth of bacterium. The DDT degrading efficiency of S. marcescens NCIM 2919 hence could be used in combination with 4-CBA utilizing strains either as binary culture or consortia for mineralization of DDT. Application of S. marcescens NCIM 2919 to DDT contaminated soil, showed 74.7% reduction of initial 12.0 mg kg -1 of DDT after 18-days of treatment.

  20. Dual enzymatic dynamic kinetic resolution by Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase and Candida antarctica lipase B

    KAUST Repository

    Karume, Ibrahim; Musa, Musa M.; Bsharat, Odey; Takahashi, Masateru; Hamdan, Samir; El Ali, Bassam

    2016-01-01

    The immobilization of Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase (TeSADH) using sol–gel method enables its use to racemize enantiopure alcohols in organic media. Here, we report the racemization of enantiopure phenyl

  1. Monoclonal Antibody L1Mab-13 Detected Human PD-L1 in Lung Cancers.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Yanaka, Miyuki; Chang, Yao-Wen; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2018-04-01

    Programmed cell death ligand-1 (PD-L1) is a type I transmembrane glycoprotein expressed on antigen-presenting cells. It is also expressed in several tumor cells such as melanoma and lung cancer cells. A strong correlation has been reported between human PD-L1 (hPD-L1) expression in tumor cells and negative prognosis in cancer patients. Here, a novel anti-hPD-L1 monoclonal antibody (mAb) L 1 Mab-13 (IgG 1 , kappa) was produced using a cell-based immunization and screening (CBIS) method. We investigated hPD-L1 expression in lung cancer using flow cytometry, Western blot, and immunohistochemical analyses. L 1 Mab-13 specifically reacted hPD-L1 of hPD-L1-overexpressed Chinese hamster ovary (CHO)-K1 cells and endogenous hPD-L1 of KMST-6 (human fibroblast) in flow cytometry and Western blot. Furthermore, L 1 Mab-13 reacted with lung cancer cell lines (EBC-1, Lu65, and Lu99) in flow cytometry and stained lung cancer tissues in a membrane-staining pattern in immunohistochemical analysis. These results indicate that a novel anti-hPD-L1 mAb, L 1 Mab-13, is very useful for detecting hPD-L1 of lung cancers in flow cytometry, Western blot, and immunohistochemical analyses.

  2. Lactobacillus diolivorans sp nov., a 1,2-propanediol-degrading bacterium isolated from aerobically stable maize silage

    NARCIS (Netherlands)

    Krooneman, J; Faber, F; Alderkamp, AC; Elferink, SJHWO; Driehuis, F; Cleenwerck, [No Value; Swings, J; Gottschal, JC; Vancanneyt, M

    Inoculation of maize silage with Lactobacillus buchneri (5 x 10(5) c.f.u. g(-1) of maize silage) prior to ensiling results in the formation of aerobically stable silage. After 9 months, lactic acid bacterium counts are approximately 10(10) c.f.u. g(-1) in these treated silages. An important

  3. Correlation between pre-ramadan glycemic control and subsequent glucose fluctuation during fasting in adolescents with Type 1 diabetes.

    Science.gov (United States)

    Afandi, B; Kaplan, W; Al Hassani, N; Hadi, S; Mohamed, A

    2017-07-01

    Even though patients with type 1 diabetes mellitus (T1DM) are exempted from fasting, the vast majority elect to fast against the advice of their healthcare providers. We have previously reported the incidence of wide fluctuations in blood glucose (BG) along with "unrecognized" severe hypoglycemia during Ramadan fasting in adolescents with T1DM. This report compares the continuous glucose monitoring (CGM) data during fasting in adolescents with T1DM according to their Pre-Ramadan diabetes control. Children and adolescents with T1DM who intended to fast the month of Ramadan were asked to wear the CGM during fasting for a minimum of 3 days. Hypoglycemia, hyperglycemia, and severe hyperglycemia were identified as BG 300 mg/dL (16.7 mmol/L) respectively, while normoglycemia was identified as BG 70-200 mg/dL (3.9-11.1 mmol/L). Patients were categorized as well-controlled (Group 1) and poorly controlled (Group 2) if the pre-fasting HbA1C was ≤8% (64 mmol/mol) and >8%, respectively. We compared the mean BG and the percentages of time spent in hypoglycemia, hyperglycemia, and severe hyperglycemia between the two groups using Chi-square (significant difference when P value was fasting. Our data suggest that optimal glycemic control before Ramadan may reduce the potential risks associated with fasting and minimize glucose fluctuation.

  4. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    Science.gov (United States)

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. A Sequential Statistical Approach towards an Optimized Production of a Broad Spectrum Bacteriocin Substance from a Soil Bacterium Bacillus sp. YAS 1 Strain

    Directory of Open Access Journals (Sweden)

    Amira M. Embaby

    2014-01-01

    Full Text Available Bacteriocins, ribosomally synthesized antimicrobial peptides, display potential applications in agriculture, medicine, and industry. The present study highlights integral statistical optimization and partial characterization of a bacteriocin substance from a soil bacterium taxonomically affiliated as Bacillus sp. YAS 1 after biochemical and molecular identifications. A sequential statistical approach (Plackett-Burman and Box-Behnken was employed to optimize bacteriocin (BAC YAS 1 production. Using optimal levels of three key determinants (yeast extract (0.48% (w/v, incubation time (62 hrs, and agitation speed (207 rpm in peptone yeast beef based production medium resulted in 1.6-fold enhancement in BAC YAS 1 level (470 AU/mL arbitrary units against Erwinia amylovora. BAC YAS 1 showed activity over a wide range of pH (1–13 and temperature (45–80°C. A wide spectrum antimicrobial activity of BAC YAS 1 against the human pathogens (Clostridium perfringens, Staphylococcus epidermidis, Campylobacter jejuni, Enterobacter aerogenes, Enterococcus sp., Proteus sp., Klebsiella sp., and Salmonella typhimurium, the plant pathogen (E. amylovora, and the food spoiler (Listeria innocua was demonstrated. On top and above, BAC YAS 1 showed no antimicrobial activity towards lactic acid bacteria (Lactobacillus bulgaricus, L. casei, L. lactis, and L. reuteri. Promising characteristics of BAC YAS 1 prompt its commercialization for efficient utilization in several industries.

  6. Proteomic Profiling of the Dioxin-Degrading Bacterium Sphingomonas wittichii RW1

    Directory of Open Access Journals (Sweden)

    David R. Colquhoun

    2012-01-01

    Full Text Available Sphingomonas wittichii RW1 is a bacterium of interest due to its ability to degrade polychlorinated dioxins, which represent priority pollutants in the USA and worldwide. Although its genome has been fully sequenced, many questions exist regarding changes in protein expression of S. wittichii RW1 in response to dioxin metabolism. We used difference gel electrophoresis (DIGE and matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS to identify proteomic changes induced by growth on dibenzofuran, a surrogate for dioxin, as compared to acetate. Approximately 10% of the entire putative proteome of RW1 could be observed. Several components of the dioxin and dibenzofuran degradation pathway were shown to be upregulated, thereby highlighting the utility of using proteomic analyses for studying bioremediation agents. This is the first global protein analysis of a microorganism capable of utilizing the carbon backbone of both polychlorinated dioxins and dibenzofurans as the sole source for carbon and energy.

  7. Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1.

    Science.gov (United States)

    Qing, Hui; Donde, Oscar Omondi; Tian, Cuicui; Wang, Chunbo; Wu, Xingqiang; Feng, Shanshan; Liu, Yao; Xiao, Bangding

    2018-04-18

    AD-1, an aerobic denitrifier, was isolated from activated sludge and identified as Pseudomonas stutzeri. AD-1 completely removed NO 3 - or NO 2 - and removed 99.5% of NH 4 + during individual culturing in a broth medium with an initial nitrogen concentration of approximately 50 mg L -1 . Results showed that larger amounts of nitrogen were removed through assimilation by the bacteria. And when NH 4 + was used as the sole nitrogen source in the culture medium, neither NO 2 - nor NO 3 - was detected, thus indicating that AD-1 may not be a heterotrophic nitrifier. Only trace amount of N 2 O was detected during the denitrification process. Single factor experiments indicated that the optimal culture conditions for AD-1 were: a carbon-nitrogen ratio (C/N) of 15, a temperature of 25°C and sodium succinate or glucose as a carbon source. In conclusion, due to the ability of AD-1 to utilize nitrogen of different forms with high efficiencies for its growth while producing only trace emissions of N 2 O, the bacterium had outstanding potential to use in the bioremediation of high-nitrogen-containing wastewaters. Meanwhile, it may also be a proper candidate for biotreatment of high concentration organic wastewater. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Characterization of BG28 and KG3 filter glass for Drive Diagnostic Attenuators

    Energy Technology Data Exchange (ETDEWEB)

    Page, R H; Weiland, T; Folta, J

    2007-11-30

    BG28 and KG3 filter glasses were tested for use as attenuators in the NIF drive diagnostic (DrD) systems. Tests were performed in the Optical Sciences Laser facility with a 351 nm, 2-step, 3-nsec pulse at fluences ranging up to {approx} 1 J/cm{sup 2}. Single-shot measurements showed no solarization when the samples were allowed to relax for a week after exposure. KG3 filters exhibited no luminescence and no transient pulse distortion. BG28 filters luminesced appreciably and imposed a 'droop' (similar to 'square-pulse distortion') on the signals. The droop parameter is estimated at 0.50 {+-} 0.11 cm{sup 2}/J. Droop is explained in terms of known copper-doped-glass spectroscopy and kinetics (buildup of triplet-state populations, with excited-state absorption). Simulation of the distortion ({approx}1.6%) expected on a 1.8 MJ Haan pulse led to a minor redesign of the Drive Diagnostic with reduced fluence on the BG28 filters to reduce the droop distortion to 0.5%.

  9. Study of US Army Libraries. Volume 1

    Science.gov (United States)

    1976-07-01

    single coovdinated admimis- tretion, wether ar rut the collactis are bossed oostiguoualy, should provide sepanated data for each type at library wherever...outlines "eNo Variations is the use of the O=i syste. by Perticipating PALMI~ libraries. 60. NoP sm, Judith , ’l1bg Obio Cllege Library Ceter." Lib -arz

  10. A Study Examining the Effect of a Short Bout of Postprandial Walking on the Glycemic Effect of a Meal: Type 1 Diabetes.

    Science.gov (United States)

    Hinojosa, Samantha L; Heiss, Cynthia J

    2017-01-01

    The purpose of this pilot study was to determine whether 15 minutes of postprandial walking has an effect on the glycemic response to a breakfast beverage in individuals with type 1 diabetes (T1DM). Seven participants, aged 22.3 ± 4.3 years, with T1DM using intensive insulin therapy completed 2 days of data collection. On day 1, participants measured baseline fasting blood glucose (BG) with a glucometer, consumed an 8-ounce Boost® beverage (41 grams carbohydrate), administered a bolus of insulin according to the carbohydrate load and fasting BG, and sat quietly, repeating BG measurements 15, 30, 60, 90, and 120 minutes after consumption. On day 2, participants repeated the protocol, but walked 15 minutes at 50% to 60% maximum heart rate immediately after beverage consumption. The difference between peak and baseline (peak - baseline) BG and incremental glucose area under the curve (iAUC) were lower in all but one participant on the walking compared to the sedentary day. Mean peak - baseline BG was significantly lower on the walking day compared to the sedentary day (6.4 ± 1.2 vs 14.4 ± 3.4 mmol/L, respectively, p = 0.016) as was the iAUC, (241.1 ± 155.8 vs 468.6 ± 94.5 mmol/L/120 min, respectively, p = 0.031). Fifteen minutes of postprandial walking can blunt the spike in BG and overall glycemic response to a breakfast beverage in young adults with T1DM and may be an effective and realistic component in the management of T1DM.

  11. Serpentine endophytic bacterium Pseudomonas azotoformans ASS1 accelerates phytoremediation of soil metals under drought stress.

    Science.gov (United States)

    Ma, Ying; Rajkumar, Mani; Moreno, António; Zhang, Chang; Freitas, Helena

    2017-10-01

    This study evaluates the potential of serpentine endophytic bacterium to foster phytoremediation efficiency of Trifolium arvense grown on multi-metal (Cu, Zn and Ni) contaminated soils under drought stress. A drought resistant endophytic bacterial strain ASS1 isolated from the leaves of Alyssum serpyllifolium grown in serpentine soils was identified as Pseudomonas azotoformans based on biochemical tests and partial 16S rRNA gene sequencing. P. azotoformans ASS1 possessed abiotic stress resistance (heavy metals, drought, salinity, antibiotics and extreme temperature) and plant growth promoting (PGP) properties (phosphate solubilization, nitrogen fixation, production of 1-aminocyclopropane-1-carboxylate deaminase, siderophore and ammonia). Inoculation of T. arvense with ASS1 considerably increased the plant biomass and leaf relative water content in both roll towel assay and pot experiments in the absence and presence of drought stress (DS). In the pot experiments, ASS1 greatly enhanced chlorophyll content, catalase, peroxidase, superoxide dismutase activities, and proline content (only in the absence of drought) in plant leaves, whereas they decreased the concentrations of malondialdehyde. Irrespective of water stress, ASS1 significantly improved accumulation, total removal, bio-concentration factor and biological accumulation coefficient of metals (Cu, Zn and Ni), while decreased translocation factors of Cu. The effective colonization and survival in the rhizosphere and tissue interior assured improved plant growth and successful metal phytoremediation under DS. These results demonstrate the potential of serpentine endophytic bacterium ASS1 for protecting plants against abiotic stresses and helping plants to thrive in semiarid ecosystems and accelerate phytoremediation process in metal polluted soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Enhanced Cadmium (Cd Phytoextraction from Contaminated Soil using Cd-Resistant Bacterium

    Directory of Open Access Journals (Sweden)

    Kunchaya Setkit

    2014-01-01

    Full Text Available A cadmium (Cd-resistant bacterium, Micrococcus sp. MU1, is able to produce indole-3-acetic acid and promotes root elongation and plant growth. The potential of this bacterium on enhancement of Cd uptake and bioaccumulation of Cd in Helianthus annuus L. planted in Cd-contaminated soil was evaluated in greenhouse condition. The results showed that Micrococcus sp. MU1promoted the growth of H. annuus L. by increasing the root length, stem height, dry biomass, root to shoot ratio and also significantly increased Cd accumulation in the root and above-ground tissues of H. annuus L. compared to uninoculated control. Re-inoculation with Micrococcus sp. MU1in contaminated soil helped in promoting plant growth and Cd phytoextraction throughout the cultivation period. In addition, phytoextraction coefficient and translocation factor (TF of H. annuus L. inoculated with Micrococcus sp. MU1were higher than that of uninoculated control and TF continuously increased with time. Our results suggested that Micrococcus sp. MU1 has an ability to enhance plant growth and Cd uptake in H. annuus L. Synergistic interaction between Micrococcus sp. MU1 and H. annuus L. could be further applied for Cd phytoextraction in polluted areas.

  13. First Symmetry Tests in Polarized Z0 Decays to b anti-bg

    International Nuclear Information System (INIS)

    Burrows, Phil

    2000-01-01

    The authors have made the first direct symmetry tests in the decays of polarized Z 0 bosons into fully-identified b anti-bg states, collected in the SLD experiment at SLAC. The authors searched for evidence of parity violation at the b anti-bg vertex by studying the asymmetries in the b-quark polar- and azimuthal-angle distributions, and for evidence of T-odd, CP-even or odd, final-state interactions by measuring angular correlations between the three-jet plane and the Z 0 polarization. They found results consistent with Standard Model expectations and set 95% C.L. limits on anomalous contributions

  14. Removal of zinc from aqueous solution by metal resistant symbiotic bacterium Mesorhizobium amorphae

    DEFF Research Database (Denmark)

    Hao, Xiuli; Mohamad, Osama Abdalla; Xie, Pin

    2014-01-01

    Biosorption of zinc by living biomasses of metal resistant symbiotic bacterium Mesorhizobium amorphae CCNWGS0123 was investigated under optimal conditions at pH 5.0, initial metal concentrations of 100 mg L-1, and a dose of 1.0 g L-1. M. amorphae exhibited an efficient removal of Zn2+ from aqueous...

  15. BG-4, a novel bioactive peptide from Momordica charantia, inhibits lipopolysaccharide-induced inflammation in THP-1 human macrophages

    Science.gov (United States)

    Background: Bitter melon (Momordica charantia) is a commonly used food crop for management of a variety of diseases most notably for control of diabetes, a disease associated with aberrant inflammation. Purpose: To evaluate the anti-inflammatory property of BG-4, a novel bioactive peptide isolated f...

  16. Comparative Phenotype and Genome Analysis of Cellvibrio sp. PR1, a Xylanolytic and Agarolytic Bacterium from the Pearl River

    Directory of Open Access Journals (Sweden)

    Zhangzhang Xie

    2017-01-01

    Full Text Available Cellvibrio sp. PR1 is a xylanolytic and agarolytic bacterium isolated from the Pearl River. Strain PR1 is closely related to Cellvibrio fibrivorans and C. ostraviensis (identity > 98%. The xylanase and agarase contents of strain PR1 reach up to 15.4 and 25.9 U/mL, respectively. The major cellular fatty acids consisted of C16:0 (36.7%, C18:0 (8.8%, C20:0 (6.8%, C15:0 iso 2-OH or/and C16:1ω7c (17.4%, and C18:1ω7c or/and C18:1ω6c (6.7%. A total of 251 CAZyme modules (63 CBMs, 20 CEs, 128 GHs, 38 GTs, and 2 PLs were identified from 3,730 predicted proteins. Genomic analysis suggested that strain PR1 has a complete xylan-hydrolyzing (5 β-xylanases, 16 β-xylosidases, 17 α-arabinofuranosidases, 9 acetyl xylan esterases, 4 α-glucuronidases, and 2 ferulic acid esterases and agar-hydrolyzing enzyme system (2 β-agarases and 2 α-neoagarooligosaccharide hydrolases. In addition, the main metabolic pathways of xylose, arabinose, and galactose are established in the genome-wide analysis. This study shows that strain PR1 contains a large number of glycoside hydrolases.

  17. Complete genome sequence of the aerobically denitrifying thermophilic bacterium Chelatococcus daeguensis TAD1

    Directory of Open Access Journals (Sweden)

    Yunlong Yang

    Full Text Available ABSTRACT Chelatococcus daeguensis TAD1 is a themophilic bacterium isolated from a biotrickling filter used to treat NOx in Ruiming Power Plant, located in Guangzhou, China, which shows an excellent aerobic denitrification activity at high temperature. The complete genome sequence of this strain was reported in the present study. Genes related to the aerobic denitrification were identified through whole genome analysis. This work will facilitate the mechanism of aerobic denitrification and provide evidence for its potential application in the nitrogen removal.

  18. Accuracy of Continuous Glucose Monitoring (CGM during Continuous and High-Intensity Interval Exercise in Patients with Type 1 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Othmar Moser

    2016-08-01

    Full Text Available Continuous exercise (CON and high-intensity interval exercise (HIIE can be safely performed with type 1 diabetes mellitus (T1DM. Additionally, continuous glucose monitoring (CGM systems may serve as a tool to reduce the risk of exercise-induced hypoglycemia. It is unclear if CGM is accurate during CON and HIIE at different mean workloads. Seven T1DM patients performed CON and HIIE at 5% below (L and above (M the first lactate turn point (LTP1, and 5% below the second lactate turn point (LTP2 (H on a cycle ergometer. Glucose was measured via CGM and in capillary blood (BG. Differences were found in comparison of CGM vs. BG in three out of the six tests (p < 0.05. In CON, bias and levels of agreement for L, M, and H were found at: 0.85 (−3.44, 5.15 mmol·L−1, −0.45 (−3.95, 3.05 mmol·L−1, −0.31 (−8.83, 8.20 mmol·L−1 and at 1.17 (−2.06, 4.40 mmol·L−1, 0.11 (−5.79, 6.01 mmol·L−1, 1.48 (−2.60, 5.57 mmol·L−1 in HIIE for the same intensities. Clinically-acceptable results (except for CON H were found. CGM estimated BG to be clinically acceptable, except for CON H. Additionally, using CGM may increase avoidance of exercise-induced hypoglycemia, but usual BG control should be performed during intense exercise.

  19. 2005 USSOCOM Chemical, Biological, Radiological Conference and Exhibition

    Science.gov (United States)

    2005-12-08

    communicate with/through building control system ► Output compatible with most building HVAC communication/ control standards (LON, BACNet, etc...curves” indicated sensitivity ranges are expected: ► Bg spores : 1000-3000 cfu/l ► Erwinia cells: 100-1000 cfu/l ► Ovalbumin: 0.1-10 ng/l ► MS2 virus...anthrax, the most lethal form of illness in humans caused by the Bacillus anthracis bacterium Confidential PHARMATHENE, INC. Current Response Mark I

  20. Cleavage-Independent HIV-1 Trimers From CHO Cell Lines Elicit Robust Autologous Tier 2 Neutralizing Antibodies

    Directory of Open Access Journals (Sweden)

    Shridhar Bale

    2018-05-01

    Full Text Available Native flexibly linked (NFL HIV-1 envelope glycoprotein (Env trimers are cleavage-independent and display a native-like, well-folded conformation that preferentially displays broadly neutralizing determinants. The NFL platform simplifies large-scale production of Env by eliminating the need to co-transfect the precursor-cleaving protease, furin that is required by the cleavage-dependent SOSIP trimers. Here, we report the development of a CHO-M cell line that expressed BG505 NFL trimers at a high level of homogeneity and yields of ~1.8 g/l. BG505 NFL trimers purified by single-step lectin-affinity chromatography displayed a native-like closed structure, efficient recognition by trimer-preferring bNAbs, no recognition by non-neutralizing CD4 binding site-directed and V3-directed antibodies, long-term stability, and proper N-glycan processing. Following negative-selection, formulation in ISCOMATRIX adjuvant and inoculation into rabbits, the trimers rapidly elicited potent autologous tier 2 neutralizing antibodies. These antibodies targeted the N-glycan “hole” naturally present on the BG505 Env proximal to residues at positions 230, 241, and 289. The BG505 NFL trimers that did not expose V3 in vitro, elicited low-to-no tier 1 virus neutralization in vivo, indicating that they remained intact during the immunization process, not exposing V3. In addition, BG505 NFL and BG505 SOSIP trimers expressed from 293F cells, when formulated in Adjuplex adjuvant, elicited equivalent BG505 tier 2 autologous neutralizing titers. These titers were lower in potency when compared to the titers elicited by CHO-M cell derived trimers. In addition, increased neutralization of tier 1 viruses was detected. Taken together, these data indicate that both adjuvant and cell-type expression can affect the elicitation of tier 2 and tier 1 neutralizing responses in vivo.

  1. Quorum sensing activity of Citrobacter amalonaticus L8A, a bacterium isolated from dental plaque.

    Science.gov (United States)

    Goh, Share-Yuan; Khan, Saad Ahmed; Tee, Kok Keng; Abu Kasim, Noor Hayaty; Yin, Wai-Fong; Chan, Kok-Gan

    2016-02-10

    Cell-cell communication is also known as quorum sensing (QS) that happens in the bacterial cells with the aim to regulate their genes expression in response to increased cell density. In this study, a bacterium (L8A) isolated from dental plaque biofilm was identified as Citrobacter amalonaticus by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Its N-acylhomoserine-lactone (AHL) production was screened by using two types of AHL biosensors namely Chromobacterium violaceum CV026 and Escherichia coli [pSB401]. Citrobacter amalonaticus strain L8A was identified and confirmed producing numerous types of AHL namely N-butyryl-L-homoserine lactone (C4-HSL), N-hexanoyl-L-homoserine lactone (C6-HSL), N-octanoyl-L-homoserine lactone (C8-HSL) and N-hexadecanoyl-L-homoserine lactone (C16-HSL). We performed the whole genome sequence analysis of this oral isolate where its genome sequence reveals the presence of QS signal synthase gene and our work will pave the ways to study the function of the related QS genes in this bacterium.

  2. Helical magnetic axis configuration combined with l = 1 and weak l = -1 torsatron fields

    International Nuclear Information System (INIS)

    Kikuchi, Hitoshi; Saito, Katsunori; Gesso, Hirokazu; Shiina, Shoichi

    1989-01-01

    The superposition of a relatively weak l = -1 torsatron field on a main l = 1 torsatron field leads to the improvement of the confinement properties due to the formation of a local magnetic well, which results from the local curvature of the helical magnetic axis with a larger excursion in the major radius direction. This l±1 helical magnetic axis system has a comparatively simple, compact coil structure. Here the vacuum configuration properties of l = ±1 system are described. (author)

  3. Characterization of cytochrome P450 monooxygenase CYP154H1 from the thermophilic soil bacterium Thermobifida fusca

    NARCIS (Netherlands)

    Schallmey, Anett; den Besten, Gijs; Teune, Ite G. P.; Kembaren, Roga F.; Janssen, Dick B.

    Cytochrome P450 monooxygenases are valuable biocatalysts due to their ability to hydroxylate unactivated carbon atoms using molecular oxygen. We have cloned the gene for a new cytochrome P450 monooxygenase, named CYP154H1, from the moderately thermophilic soil bacterium Thermobifida fusca. The

  4. Mechanism for the decrease in the FIP1L1-PDGFRalpha protein level in EoL-1 cells by histone deacetylase inhibitors.

    Science.gov (United States)

    Ishihara, Kenji; Kaneko, Motoko; Kitamura, Hajime; Takahashi, Aki; Hong, Jang Ja; Seyama, Toshio; Iida, Koji; Wada, Hiroshi; Hirasawa, Noriyasu; Ohuchi, Kazuo

    2008-01-01

    Acetylation and deacetylation of proteins occur in cells in response to various stimuli, and are reversibly catalyzed by histone acetyltransferase and histone deacetylase (HDAC), respectively. EoL-1 cells have an FIP1L1-PDGFRA fusion gene that causes transformation of eosinophilic precursor cells into leukemia cells. The HDAC inhibitors apicidin and n-butyrate suppress the proliferation of EoL-1 cells and induce differentiation into eosinophils by a decrease in the protein level of FIP1L1-PDGFRalpha without affecting the mRNA level for FIP1L1-PDGFRA. In this study, we analyzed the mechanism by which the protein level of FIP1L1-PDGFRalpha is decreased by apicidin and n-butyrate. EoL-1 cells were incubated in the presence of the HDAC inhibitors apicidin, trichostatin A or n-butyrate. The protein levels of FIP1L1-PDGFRalpha and phosphorylated eIF-2alpha were determined by Western blotting. Actinomycin D and cycloheximide were used to block RNA synthesis and protein synthesis, respectively, in the chasing experiment of the amount of FIP1L1-PDGFRalpha protein. When apicidin- and n-butyrate-treated EoL-1 cells were incubated in the presence of actinomycin D, the decrease in the protein level of FIP1L1-PDGFRalpha was significantly enhanced when compared with controls. In contrast, the protein levels were not changed by cycloheximide among these groups. Apicidin and n-butyrate induced the continuous phosphorylation of eIF-2alpha for up to 8 days. The decrease in the level of FIP1L1-PDGFRalpha protein by continuous inhibition of HDAC may be due to the decrease in the translation rate of FIP1L1-PDGFRA. Copyright 2008 S. Karger AG, Basel.

  5. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria

    OpenAIRE

    da Silva, F?bio Daniel Flor?ncio; Lima, Alex Ranieri Jer?nimo; Moraes, Pablo Henrique Gon?alves; Siqueira, Andrei Santos; Dall?Agnol, Leonardo Teixeira; Bara?na, Anna Rafaella Ferreira; Martins, Luisa Car?cio; Oliveira, Karol Guimar?es; de Lima, Clayton Pereira Silva; Nunes, M?rcio Roberto Teixeira; Vianez-J?nior, Jo?o L?dio Silva Gon?alves; Gon?alves, Evonnildo Costa

    2016-01-01

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here.

  6. Complete genome sequence of Klebsiella pneumoniae J1, a protein-based microbial flocculant-producing bacterium.

    Science.gov (United States)

    Pang, Changlong; Li, Ang; Cui, Di; Yang, Jixian; Ma, Fang; Guo, Haijuan

    2016-02-20

    Klebsiella pneumoniae J1 is a Gram-negative strain, which belongs to a protein-based microbial flocculant-producing bacterium. However, little genetic information is known about this species. Here we carried out a whole-genome sequence analysis of this strain and report the complete genome sequence of this organism and its genetic basis for carbohydrate metabolism, capsule biosynthesis and transport system. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Clostridium geopurificans strain MJ1 sp. nov., a strictly anaerobic bacterium that grows via fermentation and reduces the cyclic nitramine explosive hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX).

    Science.gov (United States)

    Kwon, Man Jae; Wei, Na; Millerick, Kayleigh; Popovic, Jovan; Finneran, Kevin

    2014-06-01

    A fermentative, non-spore forming, motile, rod-shaped bacterium, designated strain MJ1(T), was isolated from an RDX contaminated aquifer at a live-fire training site in Northwest NJ, United States. On the basis of 16S rRNA gene sequencing and DNA base composition, strain MJ1(T) was assigned to the Firmicutes. The DNA G+C content was 42.8 mol%. Fermentative growth was supported by glucose and citrate in a defined basal medium. The bacterium is a strict anaerobe that grows between at pH 6.0 and pH 8.0 and 18 and 37 °C. The culture did not grow with hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) as the electron acceptor or mineralize RDX under these conditions. However, MJ1(T) transformed RDX into MNX, methylenedinitramine, formaldehyde, formate, ammonium, nitrous oxide, and nitrate. The nearest phylogenetic relative with a validly published name was Desulfotomaculum guttoideum (95 % similarity). However, MJ1(T) was also related to Clostridium celerecrescens DSM 5628 (95 %), Clostridium indolis DSM 755 (94 %), and Clostridium sphenoides DSM 632 (94 %). DNA:DNA hybridization with these strains was between 6.7 and 58.7 percent. The dominant cellular fatty acids (greater than 5 % of the total, which was 99.0 % recovery) were 16:0 fatty acid methyl ester (FAME) (32.12 %), 18:1cis 11 dimethyl acetal (DMA) (16.47 %), 16:1cis 9 DMA (10.28 %), 16:1cis 9 FAME (8.10 %), and 18:1cis 9 DMA (5.36 %). On the basis of morphological, physiological, and phylogenetic data, Clostridium geopurificans is proposed as a new species in genus Clostridium, with strain MJ1(T) as the type strain.

  8. Technology in L1

    DEFF Research Database (Denmark)

    Elf, Nikolaj Frydensbjerg; Hanghøj, Thorkild; Skaar, Håvard

    2015-01-01

    In recent decades, several Scandinavian research projects have had an explicit focus on how technology intervenes in L1 (or so-called Mother Tongue Education) practices in Swedish, Norwegian and Danish educational contexts, and how this may impact on understanding of the subject. There is currently......-of-school literacy practices. A final finding is the emphasis on teacher uncertainty regarding how and why to integrate technology within existing paradigms of the subject. This calls for further research on how technology may be justified in L1 practice, including various forms of teacher education....... no systematic overview of the documented possibilities and challenges related to the use of technology in L1. At the same time, there is terminological confusion in use of ‘technology’ and related concepts in L1. Finally, there is a general lack of critical reflection on the relation between technological...

  9. Accuracy of Continuous Glucose Monitoring (CGM) during Continuous and High-Intensity Interval Exercise in Patients with Type 1 Diabetes Mellitus.

    Science.gov (United States)

    Moser, Othmar; Mader, Julia K; Tschakert, Gerhard; Mueller, Alexander; Groeschl, Werner; Pieber, Thomas R; Koehler, Gerd; Messerschmidt, Janin; Hofmann, Peter

    2016-08-10

    Continuous exercise (CON) and high-intensity interval exercise (HIIE) can be safely performed with type 1 diabetes mellitus (T1DM). Additionally, continuous glucose monitoring (CGM) systems may serve as a tool to reduce the risk of exercise-induced hypoglycemia. It is unclear if CGM is accurate during CON and HIIE at different mean workloads. Seven T1DM patients performed CON and HIIE at 5% below (L) and above (M) the first lactate turn point (LTP₁), and 5% below the second lactate turn point (LTP₂) (H) on a cycle ergometer. Glucose was measured via CGM and in capillary blood (BG). Differences were found in comparison of CGM vs. BG in three out of the six tests (p exercise-induced hypoglycemia, but usual BG control should be performed during intense exercise.

  10. Simulation of LOFT anticipated-transient experiments L6-1, L6-2, and L6-3 using TRAC-PF1/MOD1

    International Nuclear Information System (INIS)

    Sahota, M.S.

    1984-01-01

    Anticipated-transient experiments L6-1, L6-2, and L6-3, performed at the Loss-of-fluid Test (LOFT) facility, are analyzed using the latest released version of the Transient Reactor Analysis Code (TRAC-PF1/MOD1). The results are used to assess TRAC-PF1/MOD1 trip and control capabilities, and predictions of thermal-hydraulic phenomena during slow transients. Test L6-1 simulated a loss-of-stream load in a large pressurized-water reactor (PWR), and was initiated by closing the main steam-flow control valve (MSFCV) at its maximum rate, which reduced the heat removal from the secondary-coolant system and increased the primary-coolant system pressure that initiated a reactor scram. Test L6-2 simulated a loss-of-primary coolant flow in a large PWR, and was initiated by tripping the power to the primary-coolant pumps (PCPs) allowing the pumps to coast down. The reduced primary-coolant flow caused a reactor scram. Test L6-3 simulated an excessive-load increase incident in a large PWR, and was initiated by opening the MSFCV at its maximum rate, which increased the heat removal from the secondary-coolant system and decreased the primary-coolant system pressure that initiated a reactor scram. The TRAC calculations accurately predict most test events. The test data and the calculated results for most parameters of interest also agree well

  11. Adsorption capacity of Curcuma longa for the removal of basic green 1 dye--equilibrium, kinetics and thermodynamic study.

    Science.gov (United States)

    Roopavathi, K V; Shanthakumar, S

    2016-09-01

    In the present study, Curcuma longa (turmeric plant) was used as an adsorbent to remove Basic Green 1 (BG) dye. Batch study was carried out to evaluate the adsorption potential of C. longa and influencing factors such as pH (4-10), adsorbent dose (0.2-5 g l-1), initial dye concentration (50-250 mg l-1) and temperature (30-50°C) on dye removal were analysed. The characterisation of adsorbent was carried out using fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM) and Brunauer, Emmett and Teller (BET) method. Isotherm models that included Langmuir, Freundlich, Tempkin and Dubinin-Radushkevich, and kinetic models such as pseudo first order, pseudo second-order, Elovich and intraparticle diffusion models were studied. A maximum removal percentage (82.76%) of BG dye from aqueous solution was obtained with optimum conditions of pH 7, 1g l-1 adsorbent dose and 30°C temperature, for 100 mg l-1 initial dye concentration. The equilibrium and kinetic study revealed that the experimental data fitted suitably the Freundlich isotherm and Pseudo second order kinetic model. Thermodynamic analysis proved that adsorption system in this study was spontaneous, feasible and endothermic in nature.

  12. Menaquinone-7 in the reaction center complex of the green sulfur bacterium Chlorobium vibrioforme functions as the electron acceptor A1

    DEFF Research Database (Denmark)

    Kjaer, B; Frigaard, N-U; Yang, F

    1998-01-01

    Photosynthetically active reaction center complexes were prepared from the green sulfur bacterium Chlorobium vibrioforme NCIMB 8327, and the content of quinones was determined by extraction and high-performance liquid chromatography. The analysis showed a stoichiometry of 1.7 molecules of menaqui......Photosynthetically active reaction center complexes were prepared from the green sulfur bacterium Chlorobium vibrioforme NCIMB 8327, and the content of quinones was determined by extraction and high-performance liquid chromatography. The analysis showed a stoichiometry of 1.7 molecules...

  13. Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.

    Science.gov (United States)

    Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele

    2016-09-01

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries.

  14. Murine Efficacy and Pharmacokinetic Evaluation of the Flaviviral NS5 Capping Enzyme 2-Thioxothiazolidin-4-One Inhibitor BG-323.

    Science.gov (United States)

    Bullard, Kristen M; Gullberg, Rebekah C; Soltani, Elnaz; Steel, J Jordan; Geiss, Brian J; Keenan, Susan M

    2015-01-01

    likely to cause adverse drug interactions. However, the T1/2 of BG-323 was suboptimal and the percent of drug bound to plasma binding proteins was high. Future studies with BG-323 will be aimed at increasing the T1/2 and determining strategies for mitigating the effects of high plasma protein binding, which likely contribute to low in vivo efficacy.

  15. Murine Efficacy and Pharmacokinetic Evaluation of the Flaviviral NS5 Capping Enzyme 2-Thioxothiazolidin-4-One Inhibitor BG-323.

    Directory of Open Access Journals (Sweden)

    Kristen M Bullard

    may be less likely to cause adverse drug interactions. However, the T1/2 of BG-323 was suboptimal and the percent of drug bound to plasma binding proteins was high. Future studies with BG-323 will be aimed at increasing the T1/2 and determining strategies for mitigating the effects of high plasma protein binding, which likely contribute to low in vivo efficacy.

  16. Insight into the radiotolerance of the life support bacterium Rhodospirillum rubrum S1H by means of phenotypic and transcriptomic methods

    Science.gov (United States)

    Mastroleo, Felice; Monsieurs, Pieter; Leys, Natalie

    The MELiSSA life support system from the European Space Agency is targeting the produc-tion of oxygen, water and food by recycling organic waste. Among different types of pro-cesses, MELiSSA uses several interconnected bioreactors inhabited by microorganisms and higher plants (Hendrickx et al., 2006; Mergeay et al., 1988). Because this loop is foreseen to be functional in space where it will be exposed to higher doses and different spectra of ionizing radiation, it was decided to screen the radiotolerance of the organisms used. In this study, the radiotolerance (i.e. tolerance to ionizing radiation) of the photosynthetic bacterium Rho-dospirillum rubrum S1H was investigated. In this test, first the effect of low energy Cobalt-60 gamma rays, were tested. To assess the radiotolerance of bacterium S1H, the survival rate after increasing exposure was determined. R. rubrum S1H appeared relatively radiosensitive, as the radiation dose at which 90% of the population was killed (D10 value) was 4 times lower than the model bacterium Escherichia coli. It was demonstrate that the culture medium has an impact on radiation tolerance. This survival curve also permitted to select a number of sub-lethal ionizing radiation doses (¡ D10 ), that were used to analyze the gene expression response of R. rubrum S1H after gamma irradiation. The microarray transcriptome analysis results ob-tained from different doses and different culture medium showed a significant response of the bacterium to sublethal doses. Potential marker genes for ionizing radiation stress in R. rubrum S1H were identified. By quantitative PCR, it was shown that the expression of these marker genes increased with the recovery time after exposure to ionizing radiation. In other words, the radiation tolerance and the response of R. rubrum S1H to low energy Cobalt-60 gamma ionizing radiation was characterized. Therefore to ensure MELiSSA process robustness during extended space exploration mission, it is advised that

  17. Pharmacokinetics and pharmacodynamics of multiple doses of BG00010, a neurotrophic factor with anti-hyperalgesic effects, in patients with sciatica.

    Science.gov (United States)

    Okkerse, Pieter; Hay, Justin L; Versage, Eve; Tang, Yongqiang; Galluppi, Gerald; Ravina, Bernard; Verma, Ajay; Williams, Leslie; Aycardi, Ernesto; Groeneveld, Geert Jan

    2016-07-01

    BG00010 is a protein in the glial cell line-derived neurotrophic factor (GDNF) family. It is a selective ligand for the GDNF family receptor alpha-3 (GFRα3) co-receptor that normalizes cellular changes resulting from damage or disease, and potentially alleviates neuropathic pain. The main objectives of this study were to evaluate the pharmacokinetic and safety profiles and to determine the effects on pain of ascending doses of intravenous injections of BG00010 in patients with sciatica. This was a randomized, blinded, placebo-controlled multiple-dose study in subjects with sciatica. In Part I (16 patients), four IV dose levels were examined (50, 150, 400, 800 μg kg(-1) ) and in Part II (12 patients), three dose levels were examined (400, 600 and 1200 μg kg(-1) ). Safety and efficacy assessments were used as endpoints. The BG00010 concentration-time data indicated relatively low inter-patient variability and there was a dose-dependent (not dose-proportional) increase in serum exposure from 150 to 1200 μg kg(-1) . The effective half-life was between 40 and 60 h. The most frequently occurring adverse events (AEs) reported by patients receiving BG00010 were headache (67-83%), feeling hot (50-100%), and pruritus (42-67%). Most AEs were mild; no serious AEs or AEs leading to discontinuation occurred. Higher dose regimens of BG00010 resulted in greater pain reduction than placebo or lower dose regimens, although a clear dose-response relationship was not seen. The pharmacokinetic profile of BG00010 was characterized by low intra-patient variability. These data from a small sample suggest that BG00010 may have a benefit for patients with sciatica. © 2016 The British Pharmacological Society.

  18. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria.

    Science.gov (United States)

    da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall'Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves; Gonçalves, Evonnildo Costa

    2016-05-19

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. Copyright © 2016 da Silva et al.

  19. Molecular cloning and analysis of Myc modulator 1 (Mm-1 from Bufo gargarizans (Amphibia: Anura

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2010-02-01

    Full Text Available The protein of Myc modulator 1 (Mm-1 has been reported to repress the transcriptional activity of the proto-oncogene c-Myc in humans. Moreover, it was shown to be the subunit 5 of human prefoldin (PFD. So far, this gene and its homologs have been isolated and sequenced in many organisms, such as mammals and fish, but has not been sequenced for any amphibian or reptile. In order to better understand the function and evolution of Mm-1, we isolated a full-length Mm-1 cDNA (BgMm-1, GenBank accession no. EF211947 from Bufo gargarizans (Cantor, 1842 using RACE (rapid amplification of cDNA ends methods. Mm-1 in B. gargarizans is 755 bp long, comprising an open reading frame (ORF of 459 bp encoding 152 amino acids. The amino acid sequence had a prefoldin α-like domain, partially including a typical putative leucine zipper motif. BgMm-1 showed high similarity to its homolog of Mus musculus Linnaeus, 1758 (82% and Homo sapiens Linnaeus, 1758 MM-1 isoform a (81% at the amino acid level. The protein secondary structure modeled with the SWISS MODEL server revealed that there were two α-helices and four b-strands in BgMm-1 as its human orthologue, and both proteins belonged to the a class of PFD family. The phylogenetic relationships of Mm-1s from lower archaea to high mammals was consistent with the evolution of species, meanwhile the cluster result was consistent with the multiple alignment and the sequence identity analysis. RT-PCR (reverse transcriptase-polymerase chain reaction analysis demonstrated that BgMm-1 expressed widely in ten tissues of adult toad. These results can be helpful for the further investigation on the evolution of Mm-1.

  20. Small-Molecule Sigma1 Modulator Induces Autophagic Degradation of PD-L1.

    Science.gov (United States)

    Maher, Christina M; Thomas, Jeffrey D; Haas, Derick A; Longen, Charles G; Oyer, Halley M; Tong, Jane Y; Kim, Felix J

    2018-02-01

    Emerging evidence suggests that Sigma1 ( SIGMAR1 , also known as sigma-1 receptor) is a unique ligand-regulated integral membrane scaffolding protein that contributes to cellular protein and lipid homeostasis. Previously, we demonstrated that some small-molecule modulators of Sigma1 alter endoplasmic reticulum (ER)-associated protein homeostasis pathways in cancer cells, including the unfolded protein response and autophagy. Programmed death-ligand 1 (PD-L1) is a type I integral membrane glycoprotein that is cotranslationally inserted into the ER and is processed and transported through the secretory pathway. Once at the surface of cancer cells, PD-L1 acts as a T-cell inhibitory checkpoint molecule and suppresses antitumor immunity. Here, we demonstrate that in Sigma1-expressing triple-negative breast and androgen-independent prostate cancer cells, PD-L1 protein levels were suppressed by RNAi knockdown of Sigma1 and by small-molecule inhibition of Sigma1. Sigma1-mediated action was confirmed by pharmacologic competition between Sigma1-selective inhibitor and activator ligands. When administered alone, the Sigma1 inhibitor decreased cell surface PD-L1 expression and suppressed functional interaction of PD-1 and PD-L1 in a coculture of T cells and cancer cells. Conversely, the Sigma1 activator increased PD-L1 cell surface expression, demonstrating the ability to positively and negatively modulate Sigma1 associated PD-L1 processing. We discovered that the Sigma1 inhibitor induced degradation of PD-L1 via autophagy, by a mechanism distinct from bulk macroautophagy or general ER stress-associated autophagy. Finally, the Sigma1 inhibitor suppressed IFNγ-induced PD-L1. Our data demonstrate that small-molecule Sigma1 modulators can be used to regulate PD-L1 in cancer cells and trigger its degradation by selective autophagy. Implications: Sigma1 modulators sequester and eliminate PD-L1 by autophagy, thus preventing functional PD-L1 expression at the cell surface. This

  1. bg/sup J//bg/sup J/:W/W/sup v/ bone marrow chimera. A model for studying stem cell regulation

    Energy Technology Data Exchange (ETDEWEB)

    Patt, H M; Maloney, M A

    1978-01-01

    In studies with bg/sup J//bg/sup J/:W/W/sup v/ chimeric mice, we used the beige neutrophil marker as a criterion of W/W/sup v/ marrow replacement by implanted bg/sup J//bg/sup J/ stem cells. Data from a 50-fold range of inoculum doses and a 2 y period of observation indicate a hyperbolic pattern of replacement expressed as a log dose-response relationship. The saturating effect with increasing inoculum dose was interpreted as reflecting random initial stem cell seeding in bone marrow coupled with a decreasing efficiency of colonization by migration. From the statistics of random sampling and the exponential decrease of the 63% replacement dose with time, we estimate that W/W/sup v/ marrow contains about 2600 stem cell regulatory volumes of about 10/sup 8/ ..mu../sup 3/ (50 cell diameters) each, a dimension consistent with concepts of short-range cell-cell interactions. Our observations suggest that each regulatory volume is essentially self-contained and that stem cell migration is generally restricted to contiguous volumes.

  2. Dietary Administration of Yeast β 1,3 1,6 Glucan on Immunity and Survival Rate of White Indian Shrimp, Fennerpenaeus indicus Challenged with White Spot Syndrome Disease

    Directory of Open Access Journals (Sweden)

    Babak Ghaednia

    2012-01-01

    Full Text Available The potency of dietary β 1,3 1,6 glucan (BG, derived from Saccharomyces cerevisiae, in stimulating the non-specific immunity of white Indian shrimp, Fennerpenaeus indicus (Milne-Edwards, 1837 and improving its resistance to white spot syndrome disease were investigated. F. indicus (11.32±1.20 g were fed for 20 days on a series of treatment diets containing graded levels of BG (blank control, 0 as control, 2, 10, 20 g kg-1 feed and were then challenged by injection of WSSV virus. Total haemocyte count (THC, total plasma protein (TPP, phagocytic activity (PA and Bacterial Clearance activity (BC were measured at days 0, 7, 14, 21 after BG feeding, and shrimp survival rate was also recorded daily after challenge. THC, TPP, PA and BC of the 10 and 20 g kg-1 BG treatments were significantly higher (P<0.05 by day 14 than control and 2 g kg-1 treatment shrimp. Survival rate of shrimp fed with the diet containing 10 and 20 g kg-1 BG after 21 days, were 53.32±5.77 and 48.32±5.77%, respectively. Accordingly, oral administration of BG at an optimal level of 10 g kg-1 diet for 20 days efficaciously stimulate the immune defense and improve the survival rate of WSV-infected F. indicus.

  3. Isolation, identification, and biocontrol of antagonistic bacterium against Botrytis cinerea after tomato harvest

    Directory of Open Access Journals (Sweden)

    Jun-Feng Shi

    Full Text Available ABSTRACT Tomato is one of the most important vegetables in the world. Decay after harvest is a major issue in the development of tomato industry. Currently, the most effective method for controlling decay after harvest is storage of tomato at low temperature combined with usage of chemical bactericide; however, long-term usage of chemical bactericide not only causes pathogen resistance but also is harmful for human health and environment. Biocontrol method for the management of disease after tomato harvest has great practical significance. In this study, antagonistic bacterium B-6-1 strain was isolated from the surface of tomato and identified as Enterobacter cowanii based on morphological characteristics and physiological and biochemical features combined with sequence analysis of 16SrDNA and ropB gene and construction of dendrogram. Effects of different concentrations of antagonistic bacterium E. cowanii suspension on antifungal activity after tomato harvest were analyzed by mycelium growth rate method. Results revealed that antifungal activity was also enhanced with increasing concentrations of antagonistic bacterium; inhibitory rates of 1 × 105 colony-forming units (cfu/mL antagonistic bacterial solution on Fusarium verticillioides, Alternaria tenuissima, and Botrytis cinerea were 46.31%, 67.48%, and 75.67%, respectively. By using in vivo inoculation method, it was further confirmed that antagonistic bacterium could effectively inhibit the occurrence of B. cinerae after tomato harvest, biocontrol effect of 1 × 109 cfu/mL zymotic fluid reached up to 95.24%, and antagonistic bacterium E. cowanii has biocontrol potential against B. cinerea after harvest of fruits and vegetables.

  4. (1, 3)-β-D-glucan assay for diagnosing invasive fungal infections in critically ill patients with hematological malignancies.

    Science.gov (United States)

    Azoulay, Elie; Guigue, Nicolas; Darmon, Michael; Mokart, Djamel; Lemiale, Virginie; Kouatchet, Achille; Mayaux, Julien; Vincent, François; Nyunga, Martine; Bruneel, Fabrice; Rabbat, Antoine; Bretagne, Stéphane; Lebert, Christine; Meert, Anne-Pascale; Benoit, Dominique; Pene, Frédéric

    2016-04-19

    Invasive fungal infections (IFIs) are life-threatening complications of hematological malignancies that must be diagnosed early to allow effective treatment. Few data are available on the performance of serum (1-3)-β-D-glucan (BG) assays for diagnosing IFI in patients with hematological malignancies admitted to the intensive care unit (ICU). In this study, 737 consecutive patients with hematological malignancies admitted to 17 ICUs routinely underwent a BG assay at ICU admission. IFIs were diagnosed using standard criteria applied by three independent specialists. Among the 737 patients, 439 (60%) required mechanical ventilation and 273 (37%) died before hospital discharge. Factors known to alter BG concentrations were identified in most patients. IFIs were documented in 78 (10.6%) patients (invasive pulmonary aspergillosis, n = 54; Pneumocystis jirovecii pneumonia, n = 13; candidemia, n = 13; and fusarium infections, n = 3). BG concentrations (pg/mL) were higher in patients with than without IFI (144 (77-510) vs. 50 (30-125), 80 pg/mL were IFI, admission SOFA score, autologous bone-marrow or hematopoietic stem-cell transplantation, and microbiologically documented bacterial infection. In conclusion, in unselected critically ill hematology patients with factors known to affect serum BG, this biomarker showed only moderate diagnostic performance and rarely detected IFI. However, the negative predictive value was high. Studies are needed to assess whether a negative BG test indicates that antifungal de-escalation is safe.

  5. L1 French learning of L2 Spanish past tenses: L1 transfer versus aspect and interface issues

    Directory of Open Access Journals (Sweden)

    José Amenós Pons

    2017-09-01

    Full Text Available This paper examines the process of acquiring L2s that are closely related to the L1 through data on how adult French speakers learning L2 Spanish in a formal setting develop knowledge and use of past tenses in this L2. We consider the role of transfer and simplification in acquiring mental representations of the L2 grammar, specifically in the area of tense and aspect, and how learners deal with integrating grammatically encoded, lexical and discursive information, including mismatching feature combinations leading to particular inferential effects on interpretation. Data is presented on the Spanish past tenses (simple and compound past, pluperfect, imperfect and progressive forms from two tasks, an oral production filmretell and a multiple-choice interpretation task, completed by learners at A2, B1, B2 and C1 CEFR levels (N = 20-24 per level. L1 influence is progressively attenuated as proficiency increases. Difficulties were not always due to negative L1 transfer, but related also to grammar-discourse interface issues when integrating linguistic and pragmatic information in the interpretation process. This has clear implications for the teaching of closely related languages: instruction should not only focus on crosslinguistic contrasts, but also prioritize uses requiring complex interface integration, which are harder to process.

  6. Racemization of enantiopure secondary alcohols by Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase

    KAUST Repository

    Musa, Musa M.

    2013-01-01

    Controlled racemization of enantiopure phenyl-ring-containing secondary alcohols is achieved in this study using W110A secondary alcohol dehydrogenase from Thermoanaerobacter ethanolicus (W110A TeSADH) and in the presence of the reduced and oxidized forms of its cofactor nicotinamide-adenine dinucleotide. Racemization of both enantiomers of alcohols accepted by W110A TeSADH, not only with low, but also with reasonably high, enantiomeric discrimination is achieved by this method. Furthermore, the high tolerance of TeSADH to organic solvents allows TeSADH-catalyzed racemization to be conducted in media containing up to 50% (v/v) of organic solvents. © 2013 The Royal Society of Chemistry.

  7. Do L1 Reading Achievement and L1 Print Exposure Contribute to the Prediction of L2 Proficiency?

    Science.gov (United States)

    Sparks, Richard L.; Patton, Jon; Ganschow, Leonore; Humbach, Nancy

    2012-01-01

    The study examined whether individual differences in high school first language (L1) reading achievement and print exposure would account for unique variance in second language (L2) written (word decoding, spelling, writing, reading comprehension) and oral (listening/speaking) proficiency after adjusting for the effects of early L1 literacy and…

  8. Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

    Science.gov (United States)

    Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

    2015-11-01

    Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

  9. [Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

    Science.gov (United States)

    Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

    2005-01-01

    To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

  10. Metabolism of nitrodiphenyl ether herbicides by dioxin-degrading bacterium Sphingomonas wittichii RW1.

    Science.gov (United States)

    Keum, Young Soo; Lee, Young Ju; Kim, Jeong-Han

    2008-10-08

    Nitrodiphenyl ether herbicides, including chlomethoxyfen, nitrofen, and oxyfluorfen are potent herbicides. Some metabolites and parent compounds are considered as possible mutagens and endocrine disruptors. Both properties pose serious hygienic and environmental risks. Sphingomonas wittichii RW1 is a well-known degrader of polychlorinated dibenzo- p-dioxins, dibenzofurans, and diphenyl ethers. However, no detailed research of its metabolic activity has been performed against pesticides with a diphenyl ether scaffold. In this study, we report S. wittichii RW1 as a very potent diphenyl ether herbicide-metabolizing bacterium with broad substrate specificity. The structures of metabolites were determined by instrumental analysis and synthetic standards. Most pesticides were rapidly removed from the culture medium in the order of nitrofen > oxyfluorfen > chlomethoxyfen. In general, herbicides were degraded through the initial reduction and N-acetylation of nitro groups, followed by ether bond cleavage. Relatively low concentrations of phenolic and catecholic metabolites throughout the study suggested that these metabolites were rapidly metabolized and incorporated into primary metabolism. These results indicate that strain RW1 has very versatile metabolic activities over a wide range of environmental contaminants.

  11. PD-L1-specific T cells

    DEFF Research Database (Denmark)

    Ahmad, Shamaila Munir; Borch, Troels Holz; Hansen, Morten

    2016-01-01

    -specific T cells that recognize both PD-L1-expressing immune cells and malignant cells. Thus, PD-L1-specific T cells have the ability to modulate adaptive immune reactions by reacting to regulatory cells. Thus, utilization of PD-L1-derived T cell epitopes may represent an attractive vaccination strategy...... for targeting the tumor microenvironment and for boosting the clinical effects of additional anticancer immunotherapy. This review summarizes present information about PD-L1 as a T cell antigen, depicts the initial findings about the function of PD-L1-specific T cells in the adjustment of immune responses...

  12. Detection of high PD-L1 expression in oral cancers by a novel monoclonal antibody L1Mab-4.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Kaneko, Mika K; Kato, Yukinari

    2018-03-01

    Programmed cell death-ligand 1 (PD-L1), which is a ligand of programmed cell death-1 (PD-1), is a type I transmembrane glycoprotein that is expressed on antigen-presenting cells and several tumor cells, including melanoma and lung cancer cells. There is a strong correlation between human PD-L1 (hPD-L1) expression on tumor cells and negative prognosis in cancer patients. In this study, we produced a novel anti-hPD-L1 monoclonal antibody (mAb), L 1 Mab-4 (IgG 2b , kappa), using cell-based immunization and screening (CBIS) method and investigated hPD-L1 expression in oral cancers. L 1 Mab-4 reacted with oral cancer cell lines (Ca9-22, HO-1-u-1, SAS, HSC-2, HSC-3, and HSC-4) in flow cytometry and stained oral cancers in a membrane-staining pattern. L 1 Mab-4 stained 106/150 (70.7%) of oral squamous cell carcinomas, indicating the very high sensitivity of L 1 Mab-4. These results indicate that L 1 Mab-4 could be useful for investigating the function of hPD-L1 in oral cancers.

  13. Simultaneous production of acetate and methane from glycerol by selective enrichment of hydrogenotrophic methanogens in extreme-thermophilic (70 °C) mixed culture fermentation

    International Nuclear Information System (INIS)

    Zhang, Fang; Zhang, Yan; Chen, Yun; Dai, Kun; Loosdrecht, Mark C.M. van; Zeng, Raymond J.

    2015-01-01

    Highlights: • Simultaneous production of acetate and methane from glycerol was investigated. • Acetate accounted for more than 90% of metabolites in liquid solutions. • The maximum concentration of acetate was above 13 g/L. • 93% of archaea were hydrogenotrophic methanogens. • Thermoanaerobacter was main bacterium and its percentage was 92%. - Abstract: The feasibility of simultaneous production of acetate and methane from glycerol was investigated by selective enrichment of hydrogenotrophic methanogens in an extreme-thermophilic (70 °C) fermentation. Fed-batch experiments showed acetate was produced at the concentration up to 13.0 g/L. A stable operation of the continuous stirred tank reactor (CSTR) was reached within 100 days. Acetate accounted for more than 90 w/w% of metabolites in the fermentation liquid. The yields of methane and acetate were close to the theoretical yields with 0.74–0.80 mol-methane/mol-glycerol and 0.63–0.70 mol-acetate/mol-glycerol. The obtained microbial community was characterized. Hydrogenotrophic methanogens, mainly Methanothermobacter thermautotrophicus formed 93% of the methanogenogenic community. This confirms that a high temperature (70 °C) could effectively select for hydrogenotrophic methanogenic archaea. Thermoanaerobacter spp. was the main bacterium forming 91.5% of the bacterial population. This work demonstrated the conversion of the byproduct of biodiesel production, glycerol, to acetate as a chemical and biogas for energy generation

  14. Detection of high PD-L1 expression in oral cancers by a novel monoclonal antibody L1Mab-4

    Directory of Open Access Journals (Sweden)

    Shinji Yamada

    2018-03-01

    Full Text Available Programmed cell death-ligand 1 (PD-L1, which is a ligand of programmed cell death-1 (PD-1, is a type I transmembrane glycoprotein that is expressed on antigen-presenting cells and several tumor cells, including melanoma and lung cancer cells. There is a strong correlation between human PD-L1 (hPD-L1 expression on tumor cells and negative prognosis in cancer patients. In this study, we produced a novel anti-hPD-L1 monoclonal antibody (mAb, L1Mab-4 (IgG2b, kappa, using cell-based immunization and screening (CBIS method and investigated hPD-L1 expression in oral cancers. L1Mab-4 reacted with oral cancer cell lines (Ca9-22, HO-1-u-1, SAS, HSC-2, HSC-3, and HSC-4 in flow cytometry and stained oral cancers in a membrane-staining pattern. L1Mab-4 stained 106/150 (70.7% of oral squamous cell carcinomas, indicating the very high sensitivity of L1Mab-4. These results indicate that L1Mab-4 could be useful for investigating the function of hPD-L1 in oral cancers. Keywords: Programmed cell death-ligand 1, Monoclonal antibody, Oral cancer

  15. Effects of Calcium Ions on the Thermostability and Spectroscopic Properties of the LH1-RC Complex from a New Thermophilic Purple Bacterium Allochromatium tepidum.

    Science.gov (United States)

    Kimura, Yukihiro; Lyu, Shuwen; Okoshi, Akira; Okazaki, Koudai; Nakamura, Natsuki; Ohashi, Akira; Ohno, Takashi; Kobayashi, Manami; Imanishi, Michie; Takaichi, Shinichi; Madigan, Michael T; Wang-Otomo, Zheng-Yu

    2017-05-18

    The light harvesting-reaction center (LH1-RC) complex from a new thermophilic purple sulfur bacterium Allochromatium (Alc.) tepidum was isolated and characterized by spectroscopic and thermodynamic analyses. The purified Alc. tepidum LH1-RC complex showed a high thermostability comparable to that of another thermophilic purple sulfur bacterium Thermochromatium tepidum, and spectroscopic characteristics similar to those of a mesophilic bacterium Alc. vinosum. Approximately 4-5 Ca 2+ per LH1-RC were detected by inductively coupled plasma atomic emission spectroscopy and isothermal titration calorimetry. Upon removal of Ca 2+ , the denaturing temperature of the Alc. tepidum LH1-RC complex dropped accompanied by a blue-shift of the LH1 Q y absorption band. The effect of Ca 2+ was also observed in the resonance Raman shift of the C3-acetyl νC═O band of bacteriochlorophyll-a, indicating changes in the hydrogen-bonding interactions between the pigment and LH1 polypeptides. Thermodynamic parameters for the Ca 2+ -binding to the Alc. tepidum LH1-RC complex indicated that this reaction is predominantly driven by the largely favorable electrostatic interactions that counteract the unfavorable negative entropy change. Our data support a hypothesis that Alc. tepidum may be a transitional organism between mesophilic and thermophilic purple bacteria and that Ca 2+ is one of the major keys to the thermostability of LH1-RC complexes in purple bacteria.

  16. Clinical efficacy of BG-12 (dimethyl fumarate) in patients with relapsing-remitting multiple sclerosis: subgroup analyses of the CONFIRM study.

    LENUS (Irish Health Repository)

    Hutchinson, Michael

    2013-09-01

    In the phase 3, randomized, placebo-controlled and active reference (glatiramer acetate) comparator CONFIRM study in patients with relapsing-remitting multiple sclerosis, oral BG-12 (dimethyl fumarate) reduced the annualized relapse rate (ARR; primary endpoint), as well as the proportion of patients relapsed, magnetic resonance imaging lesion activity, and confirmed disability progression, compared with placebo. We investigated the clinical efficacy of BG-12 240 mg twice daily (BID) and three times daily (TID) in patient subgroups stratified according to baseline demographic and disease characteristics including gender, age, relapse history, McDonald criteria, treatment history, Expanded Disability Status Scale score, T2 lesion volume, and gadolinium-enhancing lesions. BG-12 treatment demonstrated generally consistent benefits on relapse-related outcomes across patient subgroups, reflecting the positive findings in the overall CONFIRM study population. Treatment with BG-12 BID and TID reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in all subgroups analyzed. Reductions in ARR with BG-12 BID versus placebo ranged from 34% [rate ratio 0.664 (95% confidence interval 0.422-1.043)] to 53% [0.466 (0.313-0.694)] and from 13% [0.870 (0.551-1.373)] to 67% [0.334 (0.226-0.493)] with BG-12 TID versus placebo. Treatment with glatiramer acetate reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in most patient subgroups. The results of these analyses indicate that treatment with BG-12 is effective on relapses across a broad range of patients with relapsing-remitting multiple sclerosis with varied demographic and disease characteristics.

  17. Do L2 Writing Courses Affect the Improvement of L1 Writing Skills via Skills Transfer from L2 to L1?

    Science.gov (United States)

    Gonca, Altmisdort

    2016-01-01

    This study investigates the relationship of second language (L2) writing skills proficiency with the first language (L1) writing skills, in light of the language transfer. The study aims to analyze the positive effects of L2 writing proficiency on L1 writing proficiency. Forty native Turkish-speaking university students participated in the study.…

  18. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Directory of Open Access Journals (Sweden)

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  19. Amylolytic Enzymes Acquired from L-Lactic Acid Producing Enterococcus faecium K-1 and Improvement of Direct Lactic Acid Production from Cassava Starch.

    Science.gov (United States)

    Unban, Kridsada; Kanpiengjai, Apinun; Takata, Goro; Uechi, Keiko; Lee, Wen-Chien; Khanongnuch, Chartchai

    2017-09-01

    An amylolytic lactic acid bacterium isolate K-1 was isolated from the wastewater of a cassava starch manufacturing factory and identified as Entercoccus faecium based on 16S rRNA gene sequence analysis. An extracellular α-amylase was purified to homogeneity and the molecular weight of the purified enzyme was approximately 112 kDa with optimal pH value and temperature measured of 7.0 and 40 °C, respectively. It was stable at a pH range of 6.0-7.0, but was markedly sensitive to high temperatures and low pH conditions, even at a pH value of 5. Ba 2+ , Al 3+ , and Co 2+ activated enzyme activity. This bacterium was capable of producing 99.2% high optically pure L-lactic acid of 4.3 and 8.2 g/L under uncontrolled and controlled pH at 6.5 conditions, respectively, in the MRS broth containing 10 g/L cassava starch as the sole carbon source when cultivated at 37 °C for 48 h. A control pH condition of 6.5 improved and stabilized the yield of L-lactic acid production directly from starch even at a high concentration of starch at up to 150 g/L. This paper is the first report describing the properties of purified α-amylase from E. faecium. Additionally, pullulanase and cyclodextrinase activities were also firstly recorded from E. faecium K-1.

  20. [Construction and application of prokaryotic expression system of Leptospira interrogans lipL32/1-lipL41/1 fusion gene].

    Science.gov (United States)

    Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei

    2005-01-01

    To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.

  1. Concurrent Haloalkanoate Degradation and Chlorate Reduction by Pseudomonas chloritidismutans AW-1T.

    Science.gov (United States)

    Peng, Peng; Zheng, Ying; Koehorst, Jasper J; Schaap, Peter J; Stams, Alfons J M; Smidt, Hauke; Atashgahi, Siavash

    2017-06-15

    Haloalkanoates are environmental pollutants that can be degraded aerobically by microorganisms producing hydrolytic dehalogenases. However, there is a lack of information about the anaerobic degradation of haloalkanoates. Genome analysis of Pseudomonas chloritidismutans AW-1 T , a facultative anaerobic chlorate-reducing bacterium, showed the presence of two putative haloacid dehalogenase genes, the l-DEX gene and dehI , encoding an l-2-haloacid dehalogenase (l-DEX) and a halocarboxylic acid dehydrogenase (DehI), respectively. Hence, we studied the concurrent degradation of haloalkanoates and chlorate as a yet-unexplored trait of strain AW-1 T The deduced amino acid sequences of l-DEX and DehI revealed 33 to 37% and 26 to 86% identities with biochemically/structurally characterized l-DEX and the d- and dl-2-haloacid dehalogenase enzymes, respectively. Physiological experiments confirmed that strain AW-1 T can grow on chloroacetate, bromoacetate, and both l- and d-α-halogenated propionates with chlorate as an electron acceptor. Interestingly, growth and haloalkanoate degradation were generally faster with chlorate as an electron acceptor than with oxygen as an electron acceptor. In line with this, analyses of l-DEX and DehI dehalogenase activities using cell-free extract (CFE) of strain AW-1 T grown on dl-2-chloropropionate under chlorate-reducing conditions showed up to 3.5-fold higher dehalogenase activity than the CFE obtained from AW-1 T cells grown on dl-2-chloropropionate under aerobic conditions. Reverse transcription-quantitative PCR showed that the l-DEX gene was expressed constitutively independently of the electron donor (haloalkanoates or acetate) or acceptor (chlorate or oxygen), whereas the expression of dehI was induced by haloalkanoates. Concurrent degradation of organic and inorganic halogenated compounds by strain AW-1 T represents a unique metabolic capacity in a single bacterium, providing a new piece of the puzzle of the microbial halogen cycle

  2. Proteomic characterization of plasmid pLA1 for biodegradation of polycyclic aromatic hydrocarbons in the marine bacterium, Novosphingobium pentaromativorans US6-1.

    Directory of Open Access Journals (Sweden)

    Sung Ho Yun

    Full Text Available Novosphingobium pentaromativorans US6-1 is a halophilic marine bacterium able to degrade polycyclic aromatic hydrocarbons (PAHs. Genome sequence analysis revealed that the large plasmid pLA1 present in N. pentaromativorans US6-1 consists of 199 ORFs and possess putative biodegradation genes that may be involved in PAH degradation. 1-DE/LC-MS/MS analysis of N. pentaromativorans US6-1 cultured in the presence of different PAHs and monocyclic aromatic hydrocarbons (MAHs identified approximately 1,000 and 1,400 proteins, respectively. Up-regulated biodegradation enzymes, including those belonging to pLA1, were quantitatively compared. Among the PAHs, phenanthrene induced the strongest up-regulation of extradiol cleavage pathway enzymes such as ring-hydroxylating dioxygenase, putative biphenyl-2,3-diol 1,2-dioxygenase, and catechol 2,3-dioxygenase in pLA1. These enzymes lead the initial step of the lower catabolic pathway of aromatic hydrocarbons through the extradiol cleavage pathway and participate in the attack of PAH ring cleavage, respectively. However, N. pentaromativorans US6-1 cultured with p-hydroxybenzoate induced activation of another extradiol cleavage pathway, the protocatechuate 4,5-dioxygenase pathway, that originated from chromosomal genes. These results suggest that N. pentaromativorans US6-1 utilizes two different extradiol pathways and plasmid pLA1 might play a key role in the biodegradation of PAH in N. pentaromativorans US6-1.

  3. Expression of PD-1 and PD-L1 in poorly differentiated neuroendocrine carcinomas of the digestive system: a potential target for anti-PD-1/PD-L1 therapy.

    Science.gov (United States)

    Roberts, Jordan A; Gonzalez, Raul S; Das, Satya; Berlin, Jordan; Shi, Chanjuan

    2017-12-01

    Poorly differentiated neuroendocrine carcinoma of the digestive system has a dismal prognosis with limited treatment options. This study aimed to investigate expression of the PD-1/PD-L1 pathway in these tumors. Thirty-seven patients with a poorly differentiated neuroendocrine carcinoma of the digestive system were identified. Their electronic medical records, pathology reports, and pathology slides were reviewed for demographics, clinical history, and pathologic features. Tumor sections were immunohistochemically labeled for PD-1 and PD-L1, and expression of PD-1 and PD-L1 on tumor and tumor-associated immune cells was analyzed and compared between small cell and large cell neuroendocrine carcinomas. The mean age of patients was 61 years old with 18 men and 19 women. The colorectum (n=20) was the most common primary site; other primary sites included the pancreaticobiliary system, esophagus, stomach, duodenum, and ampulla. Expression of PD-1 was detected on tumor cells (n=6, 16%) as well as on tumor-associated immune cells (n=23, 63%). The 6 cases with PD-1 expression on tumor cells also had the expression on immune cells. Expression of PD-L1 was visualized on tumor cells in 5 cases (14%) and on tumor-associated immune cells in 10 cases (27%). There was no difference in PD-1 and PD-L1 expression between small cell and large cell neuroendocrine carcinomas. In conclusion, PD-1/PD-L1 expression is a frequent occurrence in poorly differentiated neuroendocrine carcinomas of the digestive system. Checkpoint blockade targeting the PD-1/PD-L1 pathway may have a potential role in treating patients with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Gold nanoparticles functionalized with a fragment of the neural cell adhesion molecule L1 stimulate L1-mediated functions

    Science.gov (United States)

    Schulz, Florian; Lutz, David; Rusche, Norman; Bastús, Neus G.; Stieben, Martin; Höltig, Michael; Grüner, Florian; Weller, Horst; Schachner, Melitta; Vossmeyer, Tobias; Loers, Gabriele

    2013-10-01

    The neural cell adhesion molecule L1 is involved in nervous system development and promotes regeneration in animal models of acute and chronic injury of the adult nervous system. To translate these conducive functions into therapeutic approaches, a 22-mer peptide that encompasses a minimal and functional L1 sequence of the third fibronectin type III domain of murine L1 was identified and conjugated to gold nanoparticles (AuNPs) to obtain constructs that interact homophilically with the extracellular domain of L1 and trigger the cognate beneficial L1-mediated functions. Covalent conjugation was achieved by reacting mixtures of two cysteine-terminated forms of this L1 peptide and thiolated poly(ethylene) glycol (PEG) ligands (~2.1 kDa) with citrate stabilized AuNPs of two different sizes (~14 and 40 nm in diameter). By varying the ratio of the L1 peptide-PEG mixtures, an optimized layer composition was achieved that resulted in the expected homophilic interaction of the AuNPs. These AuNPs were stable as tested over a time period of 30 days in artificial cerebrospinal fluid and interacted with the extracellular domain of L1 on neurons and Schwann cells, as could be shown by using cells from wild-type and L1-deficient mice. In vitro, the L1-derivatized particles promoted neurite outgrowth and survival of neurons from the central and peripheral nervous system and stimulated Schwann cell process formation and proliferation. These observations raise the hope that, in combination with other therapeutic approaches, L1 peptide-functionalized AuNPs may become a useful tool to ameliorate the deficits resulting from acute and chronic injuries of the mammalian nervous system.The neural cell adhesion molecule L1 is involved in nervous system development and promotes regeneration in animal models of acute and chronic injury of the adult nervous system. To translate these conducive functions into therapeutic approaches, a 22-mer peptide that encompasses a minimal and functional L1

  5. RAC1 P29S regulates PD-L1 expression in melanoma

    Science.gov (United States)

    Vu, Ha Linh; Rosenbaum, Sheera; Purwin, Timothy J.; Davies, Michael A.; Aplin, Andrew E.

    2015-01-01

    Summary Whole exome sequencing of cutaneous melanoma has led to the detection of P29 mutations in RAC1 in 5–9% of samples, but the role of RAC1 P29 mutations in melanoma biology remains unclear. Using reverse phase protein array analysis to examine the changes in protein/phospho-protein expression, we identified cyclin B1, PD-L1, Ets-1, and Syk as being selectively upregulated with RAC1 P29S expression and downregulated with RAC1 P29S depletion. Using the melanoma patient samples in TCGA, we found PD-L1 expression to be significantly increased in RAC1 P29S patients compared to RAC1 WT as well as other RAC1 mutants. The finding that PD-L1 is upregulated suggests that oncogenic RAC1 P29S may promote suppression of the antitumor immune response. This is a new insight into the biological function of RAC1 P29S mutations with potential clinical implications as PD-L1 is a candidate biomarker for increased benefit from treatment with anti-PD1 or anti-PD-L1 antibodies. PMID:26176707

  6. Semi-field assessment of the BG-Malaria trap for monitoring the African malaria vector, Anopheles arabiensis.

    Directory of Open Access Journals (Sweden)

    Elis P A Batista

    Full Text Available Odour-baited technologies are increasingly considered for effective monitoring of mosquito populations and for the evaluation of vector control interventions. The BG-Malaria trap (BGM, which is an upside-down variant of the widely used BG-Sentinel trap (BGS, has been demonstrated to be effective to sample the Brazilian malaria vector, Anopheles darlingi. We evaluated the BGM as an improved method for sampling the African malaria vectors, Anopheles arabiensis. Experiments were conducted inside a large semi-field cage to compare trapping efficiencies of BGM and BGS traps, both baited with the synthetic attractant, Ifakara blend, supplemented with CO2. We then compared BGMs baited with either of four synthetic mosquito lures, Ifakara blend, Mbita blend, BG-lure or CO2, and an unbaited BGM. Lastly, we compared BGMs baited with the Ifakara blend dispensed via either nylon strips, BG cartridges (attractant-infused microcapsules encased in cylindrical plastic cartridge or BG sachets (attractant-infused microcapsules encased in plastic sachets. All tests were conducted between 6P.M. and 7A.M., with 200-600 laboratory-reared An. arabiensis released nightly in the test chamber. The median number of An. arabiensis caught by the BGM per night was 83, IQR:(73.5-97.75, demonstrating clear superiority over BGS (median catch = 32.5 (25.25-37.5. Compared to unbaited controls, BGMs baited with Mbita blend caught most mosquitoes (45 (29.5-70.25, followed by BGMs baited with CO2 (42.5 (27.5-64, Ifakara blend (31 (9.25-41.25 and BG lure (16 (4-22. BGM caught 51 (29.5-72.25 mosquitoes/night, when the attractants were dispensed using BG-Cartridges, compared to BG-Sachet (29.5 (24.75-40.5, and nylon strips (27 (19.25-38.25, in all cases being significantly superior to unbaited controls (p < 000.1. The findings demonstrate potential of the BGM as a sampling tool for African malaria vectors over the standard BGS trap. Its efficacy can be optimized by selecting

  7. Partial genome sequence of Thioalkalivibrio thiocyanodenitrificans ARhD 1T, a chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacterium capable of complete denitrification

    NARCIS (Netherlands)

    Berben, T.; Sorokin, D.Y.; Ivanova, N.; Pati, A.; Kyrpides, N.; Goodwin, L.A; Woyke, T.; Muyzer, G.

    2015-01-01

    Thioalkalivibrio thiocyanodenitrificans strain ARhD 1 T is a motile, Gram-negative bacterium isolated from soda lakes that belongs to the Gammaproteobacteria. It derives energy for growth and carbon fixation from the oxidation of sulfur compounds, most notably thiocyanate, and so is a

  8. Assay for the pattern recognition molecule collectin liver 1 (CL-L1)

    DEFF Research Database (Denmark)

    Axelgaard, Esben; Jensenius, Jens Christian; Thiel, Steffen

    Collectin liver 1 (also termed collectin 10 and CL-L1) is a C-type lectin that functions as a pattern recognition molecule (PRM) in the innate immune system1. We have produced antibodies against CL-L1 and have developed a sandwich-type time-resolved immuno-fluorometric assay (TRIFMA...... to co-purify with MASPs, possibly rendering it a role in complement. CL-L1 showed binding activity towards mannose-TSK beads in a Ca2+-dependent manner. This binding could be inhibited by mannose and glucose, but not by galactose, indicating that CL-L1 binds via its carbohydrate-recognition domain (CRD)....

  9. Production of ethanol from wet oxidised wheat straw by Thermoanaerobacter mathranii

    DEFF Research Database (Denmark)

    Ahring, B.K.; Licht, D.; Schmidt, A.S.

    1999-01-01

    evaluated with respect to total sugars, xylose, and 2-furfural produced. The concentration of sugars tended to be highest in hydrolysates produced at high oxygen pressures, whereas the concentration of 2-furfural was lowest in hydrolysates produced at low oxygen pressures and high carbonate concentrations...... with the commercial enzyme Celluclast(R) or with acid hydrolysis improved the ethanol yield from the hydrolysates. Treatment with Pentopan(TH) Mono BG or Pulpzyme(R) HC, both endo-1,4-beta-xylanases, had no effect neither had co-cultivation with the xylanase-producing Dictyoglomus B4. (C) 1998 Published by Elsevier...

  10. L1 and L2 Distance Effects in Learning L3 Dutch

    Science.gov (United States)

    Schepens, Job J.; der Slik, Frans; Hout, Roeland

    2016-01-01

    Many people speak more than two languages. How do languages acquired earlier affect the learnability of additional languages? We show that linguistic distances between speakers' first (L1) and second (L2) languages and their third (L3) language play a role. Larger distances from the L1 to the L3 and from the L2 to the L3 correlate with lower…

  11. Characterization Results for the L(2, 1, 1-Labeling Problem on Trees

    Directory of Open Access Journals (Sweden)

    Zhang Xiaoling

    2017-08-01

    Full Text Available An L(2, 1, 1-labeling of a graph G is an assignment of non-negative integers (labels to the vertices of G such that adjacent vertices receive labels with difference at least 2, and vertices at distance 2 or 3 receive distinct labels. The span of such a labelling is the difference between the maximum and minimum labels used, and the minimum span over all L(2, 1, 1-labelings of G is called the L(2, 1, 1-labeling number of G, denoted by λ2,1,1(G. It was shown by King, Ras and Zhou in [The L(h, 1, 1-labelling problem for trees, European J. Combin. 31 (2010 1295–1306] that every tree T has Δ2(T − 1 ≤ λ2,1,1(T ≤ Δ2(T, where Δ2(T = maxuv∈E(T(d(u + d(v. And they conjectured that almost all trees have the L(2, 1, 1-labeling number attain the lower bound. This paper provides some sufficient conditions for λ2,1,1(T = Δ2(T. Furthermore, we show that the sufficient conditions we provide are also necessary for trees with diameter at most 6.

  12. L1 Korean and L1 Mandarin L2 English Learners' Acquisition of the Count/Mass Distinction in English

    Science.gov (United States)

    Choi, Sea Hee; Ionin, Tania; Zhu, Yeqiu

    2018-01-01

    This study investigates the second language (L2) acquisition of the English count/mass distinction by speakers of Korean and Mandarin Chinese, with a focus on the semantics of atomicity. It is hypothesized that L1-Korean and L1-Mandarin L2-English learners are influenced by atomicity in the use of the count/mass morphosyntax in English. This…

  13. Human CRISP-3 binds serum alpha(1)B-glycoprotein across species

    DEFF Research Database (Denmark)

    Udby, Lene; Johnsen, Anders H; Borregaard, Niels

    2010-01-01

    CRISP-3 was previously shown to be bound to alpha(1)B-glycoprotein (A1BG) in human serum/plasma. All mammalian sera are supposed to contain A1BG, although its presence in rodent sera is not well-documented. Since animal sera are often used to supplement buffers in experiments, in particular...

  14. Co-metabolism of DDT by the newly isolated bacterium, Pseudoxanthomonas sp. wax

    Directory of Open Access Journals (Sweden)

    Guangli Wang

    2010-06-01

    Full Text Available Microbial degradation of 1,1,1-trichloro-2,2-bis(p-chlorophenylethane (DDT is the most promising way to clean up DDT residues found in the environment. In this paper, a bacterium designated as wax, which was capable of co-metabolizing DDT with other carbon sources, was isolated from a long-term DDT-contaminated soil sample by an enrichment culture technique. The new isolate was identified as a member of the Pseudoxanthomonas sp., based on its morphological, physiological and biochemical properties, as well as by 16S rRNA gene analysis. In the presence of 100 mg l-1 glucose, the wax strain could degrade over 95% of the total DDT, at a concentration of 20 mg l-1, in 72 hours, and could degrade over 60% of the total DDT, at a concentration of 100 mg l-1, in 144 hours. The wax strain had the highest degradation efficiency among all of the documented DDT-degrading bacteria. The wax strain could efficiently degrade DDT at temperatures ranging from 20 to 37ºC, and with initial pH values ranging from 7 to 9. The bacterium could also simultaneously co-metabolize 1,1-dichloro-2,2-bis(p-chlorophenylethane (DDD, 2,2-bis(p-chlorophenyl-1,1-dichlorethylene (DDE, and other organochlorine compounds. The wax strain could also completely remove 20 mg kg-1 of DDT from both sterile and non-sterile soils in 20 days. This study demonstrates the significant potential use of Pseudoxanthomonas sp. wax for the bioremediation of DDT in the environment.

  15. Basal cell carcinoma: PD-L1/PD-1 checkpoint expression and tumor regression after PD-1 blockade.

    Science.gov (United States)

    Lipson, Evan J; Lilo, Mohammed T; Ogurtsova, Aleksandra; Esandrio, Jessica; Xu, Haiying; Brothers, Patricia; Schollenberger, Megan; Sharfman, William H; Taube, Janis M

    2017-01-01

    Monoclonal antibodies that block immune regulatory proteins such as programmed death-1 (PD-1) have demonstrated remarkable efficacy in controlling the growth of multiple tumor types. Unresectable or metastatic basal cell carcinoma, however, has largely gone untested. Because PD-Ligand-1 (PD-L1) expression in other tumor types has been associated with response to anti-PD-1, we investigated the expression of PD-L1 and its association with PD-1 expression in the basal cell carcinoma tumor microenvironment. Among 40 basal cell carcinoma specimens, 9/40 (22%) demonstrated PD-L1 expression on tumor cells, and 33/40 (82%) demonstrated PD-L1 expression on tumor-infiltrating lymphocytes and associated macrophages. PD-L1 was observed in close geographic association to PD-1+ tumor infiltrating lymphocytes. Additionally, we present, here, the first report of an objective anti-tumor response to pembrolizumab (anti-PD-1) in a patient with metastatic PD-L1 (+) basal cell carcinoma, whose disease had previously progressed through hedgehog pathway-directed therapy. The patient remains in a partial response 14 months after initiation of therapy. Taken together, our findings provide a rationale for testing anti-PD-1 therapy in patients with advanced basal cell carcinoma, either as initial treatment or after acquired resistance to hedgehog pathway inhibition.

  16. BgTEP: An Antiprotease Involved in Innate Immune Sensing in Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Anaïs Portet

    2018-05-01

    Full Text Available Insect thioester-containing protein (iTEP is the most recently defined group among the thioester-containing protein (TEP superfamily. TEPs are key components of the immune system, and iTEPs from flies and mosquitoes were shown to be major immune weapons. Initially characterized from insects, TEP genes homologous to iTEP were further described from several other invertebrates including arthropods, cniderians, and mollusks albeit with few functional characterizations. In the freshwater snail Biomphalaria glabrata, a vector of the schistosomiasis disease, the presence of a TEP protein (BgTEP was previously described in a well-defined immune complex involving snail lectins (fibrinogen-related proteins and schistosome parasite mucins (SmPoMuc. To investigate the potential role of BgTEP in the immune response of the snail, we first characterized its genomic organization and its predicted protein structure. A phylogenetic analysis clustered BgTEP in a well-conserved subgroup of mollusk TEP. We then investigated the BgTEP expression profile in different snail tissues and followed immune challenges using different kinds of intruders during infection kinetics. Results revealed that BgTEP is particularly expressed in hemocytes, the immune-specialized cells in invertebrates, and is secreted into the hemolymph. Transcriptomic results further evidenced an intruder-dependent differential expression pattern of BgTEP, while interactome experiments showed that BgTEP is capable of binding to the surface of different microbes and parasite either in its full length form or in processed forms. An immunolocalization approach during snail infection by the Schistosoma mansoni parasite revealed that BgTEP is solely expressed by a subtype of hemocytes, the blast-like cells. This hemocyte subtype is present in the hemocytic capsule surrounding the parasite, suggesting a potential role in the parasite clearance by encapsulation. Through this work, we report the first

  17. Fermentative hydrogen production by the newly isolated Enterobacter asburiae SNU-1

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jong-Hwan; Hyun Yoon, Jong; Eun Kyoung Ahn; Park, Tai Hyun [School of Chemical and Biological Engineering, Seoul National University, Seoul 151-744 (Korea); Kim, Mi-Sun [Biomass Research Team, Korea Institute of Energy Research, Daejeon 305-343 (Korea); Jun Sim, Sang [Department of Chemical Engineering, Sungkyunkwan University, Suwon 440-746 (Korea)

    2007-02-15

    A new fermentative hydrogen-producing bacterium was isolated from a domestic landfill and identified as Enterobacter asburiae using 16S rRNA gene sequencing and DNA-DNA hybridization methods. The isolated bacterium, designated as Enterobacter asburiae SNU-1, is a new species that has never been examined as a potential hydrogen-producing bacterium. This study examined the hydrogen-producing ability of Enterobacter asburiae SNU-1. During fermentation, the hydrogen was mainly produced in the stationary phase. The hydrogen yield based on the formate consumption was 0.43 mol hydrogen/mol formate. This strain was able to produce hydrogen over a wide range of pH (4-7.5), with the optimum pH being pH 7. The level of hydrogen production was also affected by the initial glucose concentration, and the optimum value was found to be 25 g glucose/l. The maximum and overall hydrogen productivities were 398 and 174 ml/l/hr, respectively, at pH 7 with an initial glucose concentration of 25 g/l. This strain could produce hydrogen from glucose and many other carbon sources such as fructose, sucrose, and sorbitol. (author)

  18. Polymorphisms of vitamin K-related genes (EPHX1 and VKORC1L1) and stable warfarin doses.

    Science.gov (United States)

    Chung, Jee-Eun; Lee, Kyung Eun; Chang, Byung Chul; Gwak, Hye Sun

    2018-01-30

    The aim of this study was to investigate the possible effects of EPHX1 and VKORC1L1 polymorphisms on variability of responses to warfarin. Sixteen single nucleotide polymorphisms (SNPs) in 201 patients with stable warfarin doses were analyzed including genes of VKORC1, CYP2C9, CYP4F2, GGCX, EPHX1 and VKORC1L1. Univariate analysis was conducted for the association of genotypes with stable warfarin doses. Multiple linear regression analysis was used to investigate factors that independently affected the inter-individual variability of warfarin dose requirements. The rs4072879 of VKORC1L1 (A>G) was significantly associated with stable warfarin doses; wild homozygote carriers (AA) required significantly lower stable warfarin doses than those with the variant G allele (5.02±1.56 vs. 5.96±2.01mg; p=0.001). Multivariate analysis showed that EPHX1 rs1877724 and VKORC1L1 rs4072879 accounted for 1.5% and 1.3% of the warfarin dose variability. Adding EPHX1 and VKORC1L1 SNPs to the base model including non-genetic variables (operation age, body weight and the therapy of ACEI or ARB) and genetic variables (VKORC1 rs9934438, CYP2C9 rs1057910, and CYP4F2 rs2108622) gave a number needed to genotype of 34. This study showed that polymorphisms of EPHX1 and VKORC1L1 could be determinants of stable warfarin doses. Copyright © 2017. Published by Elsevier B.V.

  19. Mechanisms for the proliferation of eosinophilic leukemia cells by FIP1L1-PDGFRα

    International Nuclear Information System (INIS)

    Ishihara, Kenji; Kitamura, Hajime; Hiraizumi, Kenji; Kaneko, Motoko; Takahashi, Aki; Zee, OkPyo; Seyama, Toshio; Hong, JangJa; Ohuchi, Kazuo; Hirasawa, Noriyasu

    2008-01-01

    The constitutively activated tyrosine kinase Fip1-like 1 (FIP1L1)-platelet-derived growth factor receptor α (PDGFRα) causes eosinophilic leukemia EoL-1 cells to proliferate. Recently, we demonstrated that histone deacetylase inhibitors suppressed this proliferation and induced the differentiation of EoL-1 cells into eosinophils in parallel with a decrease in the level of FIP1L1-PDGFRα. In this study, we analyzed the mechanism by which FIP1L1-PDGFRα induces the proliferation and whether the suppression of cell proliferation triggers the differentiation into eosinophils. The FIP1L1-PDGFRα inhibitor imatinib inhibited the proliferation of EoL-1 cells and decreased the level of the oncoprotein c-Myc as well as the phosphorylation of extracellular signal-regulated kinase and c-Jun N-terminal kinase (JNK). The proliferation of EoL-1 cells and expression of c-Myc were also inhibited by the MEK inhibitor U0126 and JNK inhibitor SP600125. The expression of the eosinophilic differentiation marker CCR3 was not induced by imatinib. These findings suggest that FIP1L1-PDGFRα induces the proliferation of EoL-1 cells through the induction of c-Myc expression via ERK and JNK signaling pathways, but is not involved in the inhibition of differentiation toward mature eosinophils

  20. 26 CFR 1.7701(l)-1 - Conduit financing arrangements.

    Science.gov (United States)

    2010-04-01

    ... determines that such recharacterization is appropriate to prevent avoidance of any tax imposed by title 26 of...) INCOME TAX (CONTINUED) INCOME TAXES General Actuarial Valuations § 1.7701(l)-1 Conduit financing...

  1. Data of evolutionary structure change: 1E14L-1PCRM [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1E14L-1PCRM 1E14 1PCR L M -ALLSFERKYRVPGGT-----LVGGNLFD----FWVGP-...entryChain> 1PCR M 1PCRM...dbChain>M 1PCRM YGLSFAAPLKE 1PCR M 1PCRM IADRG-----TAAER M 1PCRM TVVDN----WYVWG

  2. ATG16L1

    DEFF Research Database (Denmark)

    Salem, Mohammad; Ammitzboell, Mette; Nys, Kris

    2015-01-01

    Genetic variations in the autophagic pathway influence genetic predispositions to Crohn disease. Autophagy, the major lysosomal pathway for degrading and recycling cytoplasmic material, constitutes an important homeostatic cellular process. Of interest, single-nucleotide polymorphisms in ATG16L1...... (autophagy-related 16-like 1 [S. cerevisiae]), a key component in the autophagic response to invading pathogens, have been associated with an increased risk of developing Crohn disease. The most common and well-studied genetic variant of ATG16L1 (rs2241880; leading to a T300A conversion) exhibits a strong...... association with risk for developing Crohn disease. The rs2241880 variant plays a crucial role in pathogen clearance, resulting in imbalanced cytokine production, and is linked to other biological processes, such as the endoplasmic reticulum stress/unfolded protein response. In this review, we focus...

  3. Luteibacter rhizovicinus MIMR1 promotes root development in barley (Hordeum vulgare L.) under laboratory conditions.

    Science.gov (United States)

    Guglielmetti, Simone; Basilico, Roberto; Taverniti, Valentina; Arioli, Stefania; Piagnani, Claudia; Bernacchi, Andrea

    2013-11-01

    In order to preserve environmental quality, alternative strategies to chemical-intensive agriculture are strongly needed. In this study, we characterized in vitro the potential plant growth promoting (PGP) properties of a gamma-proteobacterium, named MIMR1, originally isolated from apple shoots in micropropagation. The analysis of the 16S rRNA gene sequence allowed the taxonomic identification of MIMR1 as Luteibacter rhizovicinus. The PGP properties of MIMR1 were compared to Pseudomonas chlororaphis subsp. aurantiaca DSM 19603(T), which was selected as a reference PGP bacterium. By means of in vitro experiments, we showed that L. rhizovicinus MIMR1 and P. chlororaphis DSM 19603(T) have the ability to produce molecules able to chelate ferric ions and solubilize monocalcium phosphate. On the contrary, both strains were apparently unable to solubilize tricalcium phosphate. Furthermore, the ability to produce 3-indol acetic acid by MIMR1 was approximately three times higher than that of DSM 19603(T). By using fluorescent recombinants of strains MIMR1 and DSM 19603(T), we also demonstrated that both bacteria are able to abundantly proliferate and colonize the barley rhizosphere, preferentially localizing on root tips and in the rhizoplane. Finally, we observed a negative effect of DSM 19603(T) on barley seed germination and plant growth, whereas MIMR1, compared to the control, determined a significant increase of the weight of aerial part (+22 %), and the weight and length of roots (+53 and +32 %, respectively). The results obtained in this work make L. rhizovicinus MIMR1 a good candidate for possible use in the formulation of bio-fertilizers.

  4. Localization and role of NPC1L1 in cholesterol absorption in human intestine.

    Science.gov (United States)

    Sané, Alain Théophile; Sinnett, Daniel; Delvin, Edgard; Bendayan, Moise; Marcil, Valérie; Ménard, Daniel; Beaulieu, Jean-François; Levy, Emile

    2006-10-01

    Recent studies have documented the presence of Niemann-Pick C1-Like 1 (NPC1L1) in the small intestine and its capacity to transport cholesterol in mice and rats. The current investigation was undertaken to explore the localization and function of NPC1L1 in human enterocytes. Cell fractionation experiments revealed an NPC1L1 association with apical membrane of the enterocyte in human jejunum. Signal was also detected in lysosomes, endosomes, and mitochondria. Confirmation of cellular NPC1L1 distribution was obtained by immunocytochemistry. Knockdown of NPC1L1 caused a decline in the ability of Caco-2 cells to capture micellar [(14)C]free cholesterol. Furthermore, this NPC1L1 suppression resulted in increased and decreased mRNA levels and activity of HMG-CoA reductase, the rate-limiting step in cholesterol synthesis, and of ACAT, the key enzyme in cholesterol esterification, respectively. An increase was also noted in the transcriptional factor sterol-regulatory element binding protein that modulates cholesterol homeostasis. Efforts were devoted to define the impact of NPC1L1 knockdown on other mediators of cholesterol uptake. RT-PCR evidence is presented to show the significant decrease in the levels of scavenger receptor class B type I (SR-BI) with no changes in ABCA1, ABCG5, and cluster determinant 36 in NPC1L1-deficient Caco-2 cells. Together, our data suggest that NPC1L1 contributes to intestinal cholesterol homeostasis and possibly cooperates with SR-BI to mediate cholesterol absorption in humans.

  5. Engineering and Characterization of a Fluorescent Native-Like HIV-1 Envelope Glycoprotein Trimer

    Directory of Open Access Journals (Sweden)

    Kwinten Sliepen

    2015-10-01

    Full Text Available Generation of a stable, soluble mimic of the HIV-1 envelope glycoprotein (Env trimer on the virion surface has been considered an important first step for developing a successful HIV-1 vaccine. Recently, a soluble native-like Env trimer (BG505 SOSIP.664 has been described. This protein has facilitated major advances in the HIV-1 vaccine field, since it was the first Env immunogen that induced consistent neutralizing antibodies against a neutralization-resistant (tier 2 virus. Moreover, BG505 SOSIP.664 enabled elucidation of the atomic resolution structure of the Env trimer and facilitated the isolation and characterization of new broadly neutralizing antibodies against HIV-1. Here, we designed and characterized the BG505 SOSIP.664 trimer fused to fluorescent superfolder GFP (sfGFP, a GFP variant that allows efficient folding (BG505 SOSIP.664-sfGFP. Despite the presence of the sfGFP, the Env protein largely retained its morphology, antigenicity, glycan composition, and thermostability. In addition, we show that BG505 SOSIP.664-sfGFP can be used for fluorescence-based assays, such as flow cytometry.

  6. L-rhamnose induces browning in 3T3-L1 white adipocytes and activates HIB1B brown adipocytes.

    Science.gov (United States)

    Choi, Minji; Mukherjee, Sulagna; Kang, Nam Hyeon; Barkat, Jameel Lone; Parray, Hilal Ahmad; Yun, Jong Won

    2018-04-11

    Induction of the brown adipocyte-like phenotype in white adipocytes (browning) is considered as a novel strategy to fight obesity due to the ability of brown adipocytes to increase energy expenditure. Here, we report that L-rhamnose induced browning by elevating expression levels of beige-specific marker genes, including Cd137, Cited1, Tbx1, Prdm16, Tmem26, and Ucp1, in 3T3-L1 adipocytes. Moreover, L-rhamnose markedly elevated expression levels of proteins involved in thermogenesis both in 3T3-L1 white and HIB1B brown adipocytes. L-rhamnose treatment in 3T3-L1 adipocytes also significantly elevated protein levels of p-HSL, p-AMPK, ACOX, and CPT1 as well as reduced levels of ACC, FAS, C/EBPα, and PPARγ, suggesting its possible role in enhancement of lipolysis and lipid catabolism as well as reduced adipogenesis and lipogenesis, respectively. The quick technique of efficient molecular docking provided insight into the strong binding of L-rhamnose to the fat-digesting glycine residue of β 3 -adrenergic receptor (AR), indicating strong involvement of L-rhamnose in fat metabolism. Further examination of the molecular mechanism of L-rhamnose revealed that it induced browning of 3T3-L1 adipocytes via coordination of multiple signaling pathways through β 3 -AR, SIRT1, PKA, and p-38. To the best of our knowledge, this is the first study to demonstrate that L-rhamnose plays multiple modulatory roles in the induction of white fat browning, activation of brown adipocytes, as well as promotion of lipid metabolism, thereby demonstrating its therapeutic potential for treatment of obesity. © 2018 IUBMB Life, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

  7. Combined effects of moderately elevated blood glucose and locally produced TGF-beta1 on glomerular morphology and renal collagen production

    DEFF Research Database (Denmark)

    Krag, Søren; Nyengaard, Jens R; Wogensen, Lise

    2007-01-01

    BACKGROUND: There is a correlation between renal graft rejection and blood glucose (BG) levels. Furthermore, diabetic patients may develop non-diabetic renal diseases, which in some circumstances progress rapidly. Since transforming growth factor-beta1 (TGF-beta) levels are elevated in many renal...... diseases, the accelerated progression may be due to interactions between glucose and locally produced TGF-beta1. Therefore, we investigated the effect of mild hyperglycaemia on glomerular morphology and collagen production in TGF-beta1 transgenic mice. METHODS: To achieve BG concentrations of approximately...... 15 mmol/l in TGF-beta1 transgenic and non-transgenic mice, we used multiple streptozotocin (STZ) injections, and after 8 weeks, we measured the changes in glomerular morphology and total collagen content. We also analysed extracellular matrix (ECM) and protease mRNA levels using real-time polymerase...

  8. Driving safety: concerns and experiences of parents of adolescent drivers with type 1 diabetes.

    Science.gov (United States)

    Cox, Daniel J; Gonder-Frederick, Linda A; Shepard, Jaclyn A; Campbell, Laura K; Vajda, Karen A

    2012-09-01

    Driving is a dangerous activity for adolescents, perhaps being even more precarious for adolescents with type 1 diabetes due to the possibility of extreme blood glucose (BG). There is no available data on adolescent driving safety concerns and type 1 diabetes. To begin addressing this issue, we surveyed parents regarding their observations and concerns. Seventy-two parents (87.5% mothers) of adolescent drivers aged 16-19 with type 1 diabetes provided analyzable data. Females comprised 36% of their adolescents, with 74% using pump therapy. In the past year, 13 and 84% of parents reported that their adolescent had experienced severe or moderate disruptive hypoglycemia, respectively. Over half (56%) of the parents reported moderate to extreme worry about how diabetes impacted their adolescent's driving, while only 21% of parents thought their adolescents had similar concerns (p = 0.037). Almost one third (31%) of parents thought their adolescent need not treat low BG until it fell below 70 mg/dL, 13% thought their adolescent could safely drive with BG below 65 mg/dL. And, 31 and 14% of parents, respectively, reported their adolescent had been in a collision or stopped by the police in the past year, which they attributed to both hypo- and hyperglycemia. Adolescents reportedly took steps to prevent hypo- and hyperglycemia while driving, but more aggressively avoided hypoglycemia (p < 0.001). While this data is limited, lacking a non-diabetic control group and randomized sample, it does suggest that driving and adolescent type 1 diabetes deserve further attention and investigation. © 2012 John Wiley & Sons A/S.

  9. Multiplexed Immunofluorescence Reveals Potential PD-1/PD-L1 Pathway Vulnerabilities in Craniopharyngioma.

    Science.gov (United States)

    Coy, Shannon; Rashid, Rumana; Lin, Jia-Ren; Du, Ziming; Donson, Andrew M; Hankinson, Todd C; Foreman, Nicholas K; Manley, Peter E; Kieran, Mark W; Reardon, David A; Sorger, Peter K; Santagata, Sandro

    2018-03-02

    Craniopharyngiomas are neoplasms of the sellar/parasellar region that are classified into adamantinomatous (ACP) and papillary (PCP) subtypes. Surgical resection of craniopharyngiomas is challenging, and recurrence is common, frequently leading to profound morbidity. BRAF V600E mutations render PCP susceptible to BRAF/MEK inhibitors, but effective targeted therapies are needed for ACP. We explored the feasibility of targeting the PD-1/PD-L1 immune checkpoint pathway in ACP and PCP. We mapped and quantified PD-L1 and PD-1 expression in ACP and PCP resections using immunohistochemistry, immunofluorescence, and RNA in situ hybridization. We used tissue-based cyclic immunofluorescence (t-CyCIF) to map the spatial distribution of immune cells and characterize cell cycle and signaling pathways in ACP tumor cells which intrinsically express PD-1. All ACP (15±14% of cells, n=23, average±S.D.) and PCP (35±22% of cells, n=18) resections expressed PD-L1. In ACP, PD-L1 was predominantly expressed by tumor cells comprising the cyst-lining. In PCP, PD-L1 was highly-expressed by tumor cells surrounding the stromal fibrovascular cores. ACP also exhibited tumor cell-intrinsic PD-1 expression in whorled epithelial cells with nuclear-localized beta-catenin. These cells exhibited evidence of elevated mTOR and MAPK signaling. Profiling of immune populations in ACP and PCP showed a modest density of CD8+ T-cells. ACP exhibit PD-L1 expression in the tumor cyst-lining and intrinsic PD-1 expression in cells proposed to comprise an oncogenic stem-like population. In PCP, proliferative tumor cells express PD-L1 in a continuous band at the stromal-epithelial interface. Targeting PD-L1 and/or PD-1 in both subtypes of craniopharyngioma might therefore be an effective therapeutic strategy.

  10. Ubiquitin C-Terminal Hydrolase L1 in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jennifer Hurst-Kennedy

    2012-01-01

    Full Text Available Ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1, aka PGP9.5 is an abundant, neuronal deubiquitinating enzyme that has also been suggested to possess E3 ubiquitin-protein ligase activity and/or stabilize ubiquitin monomers in vivo. Recent evidence implicates dysregulation of UCH-L1 in the pathogenesis and progression of human cancers. Although typically only expressed in neurons, high levels of UCH-L1 have been found in many nonneuronal tumors, including breast, colorectal, and pancreatic carcinomas. UCH-L1 has also been implicated in the regulation of metastasis and cell growth during the progression of nonsmall cell lung carcinoma, colorectal cancer, and lymphoma. Together these studies suggest UCH-L1 has a potent oncogenic role and drives tumor development. Conversely, others have observed promoter methylation-mediated silencing of UCH-L1 in certain tumor subtypes, suggesting a potential tumor suppressor role for UCH-L1. In this paper, we provide an overview of the evidence supporting the involvement of UCH-L1 in tumor development and discuss the potential mechanisms of action of UCH-L1 in oncogenesis.

  11. Evaluation of Arthrobacter aurescens Strain TC1 as Bioaugmentation Bacterium in Soils Contaminated with the Herbicidal Substance Terbuthylazine.

    Directory of Open Access Journals (Sweden)

    Vera P Silva

    Full Text Available In the last years the chloro-s-triazine active substance terbuthylazine has been increasingly used as an herbicide and may leave residues in the environment which can be of concern. The present study aimed at developing a bioaugmentation tool based on the soil bacterium Arthrobacter aurescens strain TC1 for the remediation of terbuthylazine contaminated soils and at examining its efficacy for both soil and aquatic compartments. First, the feasibility of growing the bioaugmentation bacterium inocula on simple sole nitrogen sources (ammonium and nitrate instead of atrazine, while still maintaining its efficiency to biodegrade terbuthylazine was shown. In sequence, the successful and quick (3 days bioremediation efficacy of ammonium-grown A. aurescens TC1 cells was proven in a natural soil freshly spiked or four-months aged with commercial terbuthylazine at a dose 10× higher than the recommended in corn cultivation, to mimic spill situations. Ecotoxicity assessment of the soil eluates towards a freshwater microalga supported the effectiveness of the bioaugmentation tool. Obtained results highlight the potential to decontaminate soil while minimizing terbuthylazine from reaching aquatic compartments via the soil-water pathway. The usefulness of this bioaugmentation tool to provide rapid environment decontamination is particularly relevant in the event of accidental high herbicide contamination. Its limitations and advantages are discussed.

  12. Evaluation of Arthrobacter aurescens Strain TC1 as Bioaugmentation Bacterium in Soils Contaminated with the Herbicidal Substance Terbuthylazine

    Science.gov (United States)

    Silva, Vera P.; Moreira-Santos, Matilde; Mateus, Carla; Teixeira, Tânia; Ribeiro, Rui; Viegas, Cristina A.

    2015-01-01

    In the last years the chloro-s-triazine active substance terbuthylazine has been increasingly used as an herbicide and may leave residues in the environment which can be of concern. The present study aimed at developing a bioaugmentation tool based on the soil bacterium Arthrobacter aurescens strain TC1 for the remediation of terbuthylazine contaminated soils and at examining its efficacy for both soil and aquatic compartments. First, the feasibility of growing the bioaugmentation bacterium inocula on simple sole nitrogen sources (ammonium and nitrate) instead of atrazine, while still maintaining its efficiency to biodegrade terbuthylazine was shown. In sequence, the successful and quick (3 days) bioremediation efficacy of ammonium-grown A. aurescens TC1 cells was proven in a natural soil freshly spiked or four-months aged with commercial terbuthylazine at a dose 10× higher than the recommended in corn cultivation, to mimic spill situations. Ecotoxicity assessment of the soil eluates towards a freshwater microalga supported the effectiveness of the bioaugmentation tool. Obtained results highlight the potential to decontaminate soil while minimizing terbuthylazine from reaching aquatic compartments via the soil-water pathway. The usefulness of this bioaugmentation tool to provide rapid environment decontamination is particularly relevant in the event of accidental high herbicide contamination. Its limitations and advantages are discussed. PMID:26662024

  13. Differential gene expression in Xylella fastidiosa 9a5c during co-cultivation with the endophytic bacterium Methylobacterium mesophilicum SR1.6/6.

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Santos, Daiene Souza; Nunes, Luiz Roberto; Costa de Oliveira, Regina Lúcia Batista da; de Oliveira, Marcus Vinicius; Araújo, Welington Luiz

    2015-12-01

    Xylella fastidiosa, the causal agent of citrus variegated chlorosis (CVC), colonizes plant xylem, reducing sap flow, and inducing internerval chlorosis, leaf size reduction, necrosis, and harder and smaller fruits. This bacterium may be transmitted from plant to plant by sharpshooter insects, including Bucephalogonia xanthopis. The citrus endophytic bacterium Methylobacterium mesophilicum SR1.6/6 colonizes citrus xylem and previous studies showed that this strain is also transferred from plant to plant by B. xanthopis (Insecta), suggesting that this endophytic bacterium may interact with X. fastidiosa in planta and inside the insect vector during co-transmission by the same insect vector. To better understand the X. fastidiosa behavior in the presence of M. mesophilicum, we evaluated the X. fastidiosa transcriptional profile during in vitro interaction with M. mesophilicum SR1.6/6. The results showed that during co-cultivation, X. fastidiosa down-regulated genes related to growth and up-regulated genes related to energy production, stress, transport, and motility, suggesting the existence of a specific adaptive response to the presence of M. mesophilicum in the culture medium. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Growth and immune response of Litopenaeus vannamei fed on β-(1, 3 glucan and poly-β hydroxybutyrate

    Directory of Open Access Journals (Sweden)

    , Sarmin

    2015-05-01

    Full Text Available ABSTRACT This research was aimed to examine the growth performance and non-specific immune response of Pacific white shrimp (Litopenaeus vannamei fed on the diet supplemented with β-(1,3 glucan (BG and poly-β-hydroxybutyrate (PHB as feed additives. Shrimp juvenile at an initial body weight of 2.06±0.03 g was randomly distributed into 12 units of aquaria at a density of 20 shrimps/tank and reared for 42 days. The treatments applied in this study were control (without feed additives, 1.5 g/kg BG, 10 g/kg PHB and 1,5 g/kg BG+10 g/kg PHB. Results showed that shrimp fed on 1.5 /kg BG-supplemented feed had significantly higher growth performance and non-specific immune response. Keywords: growth, shrimp, non-specific immune response, Litopenaeus vannamei  ABSTRAK Penelitian ini bertujuan untuk menguji kinerja pertumbuhan dan respons imun nonspesifik udang vaname Litopenaeus vannamei yang diberi pakan dengan penambahan feed additive berupa β-(1,3 glukan (BG dan poli-β-hidroksibutirat (PHB. Juvenil udang 2,06±0,03 g dipelihara pada 12 unit akuarium dengan empat perlakuan dan tiga ulangan, serta padat tebar 20 ekor/tank selama 42 hari pemeliharaan. Perlakuan yang diberikan dalam penelitian ini yaitu penambahan BG (1,5 g/kg, PHB (10 g/kg, dan BG (1,5 g/kg+PHB (10 g/kg, serta kontrol (tanpa penambahan feed additive. Hasil penelitian menunjukkan bahwa udang yang diberi 1,5 g/kg BG memiliki kinerja pertumbuhan dan respons imun nonspesifik yang terbaik. Kata kunci: pertumbuhan, udang, respons imun nonspesifik, Litopenaeus vannamei

  15. Methylobacterium oryzae sp. nov., an aerobic, pink-pigmented, facultatively methylotrophic, 1-aminocyclopropane-1-carboxylate deaminase-producing bacterium isolated from rice.

    Science.gov (United States)

    Madhaiyan, Munusamy; Kim, Byung-Yong; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Song, Myung-Hee; Ryu, Jeoung-Hyun; Go, Seung-Joo; Koo, Bon-Sung; Sa, Tong-Min

    2007-02-01

    A pink-pigmented, facultatively methylotrophic bacterium, strain CBMB20T, isolated from stem tissues of rice, was analysed by a polyphasic approach. Strain CBMB20T utilized 1-aminocyclopropane 1-carboxylate (ACC) as a nitrogen source and produced ACC deaminase. It was related phylogenetically to members of the genus Methylobacterium. 16S rRNA gene sequence analysis indicated that strain CBMB20T was most closely related to Methylobacterium fujisawaense, Methylobacterium radiotolerans and Methylobacterium mesophilicum; however, DNA-DNA hybridization values were less than 70 % with the type strains of these species. The DNA G+C content of strain CBMB20T was 70.6 mol%. The study presents a detailed phenotypic characterization of strain CBMB20T that allows its differentiation from other Methylobacterium species. In addition, strain CBMB20T is the only known member of the genus Methylobacterium to be described from the phyllosphere of rice. Based on the data presented, strain CBMB20T represents a novel species in the genus Methylobacterium, for which the name Methylobacterium oryzae sp. nov. is proposed, with strain CBMB20T (=DSM 18207T=LMG 23582T=KACC 11585T) as the type strain.

  16. Asymmetric Reduction of Substituted 2-Tetralones by Thermoanaerobacter pseudoethanolicus Secondary Alcohol Dehydrogenase

    KAUST Repository

    Bsharat, Odey; Musa, Musa M.; Vieille, Claire; Oladepo, Sulayman; Takahashi, Masateru; Hamdan, Samir

    2017-01-01

    Ketones bearing two bulky substituents, named bulky-bulky ketones, were successfully reduced to their corresponding optically enriched alcohols by using various mutants of Thermoanaerobacter pseudoethanolicus secondary alcohol dehydrogenase (TeSADH). Substituted 2-tetralones, in particular, were reduced to 2-tetralols with high conversion and high enantioselectivity. The pharmacological importance of substituted 2-tetralols as key drug-building blocks makes our biocatalytic reduction method a highly essential tool. We showed that changing the position of the substituent on the aromatic ring of 2-tetralones impacts their binding affinity and the reaction maximum catalytic rate. Docking studies with several TeSADH mutants explain how the position of the substituent on the tetralone influences the binding orientation of substituted 2-tetralones and their reaction stereoselectivity.

  17. Asymmetric Reduction of Substituted 2-Tetralones by Thermoanaerobacter pseudoethanolicus Secondary Alcohol Dehydrogenase

    KAUST Repository

    Bsharat, Odey

    2017-01-30

    Ketones bearing two bulky substituents, named bulky-bulky ketones, were successfully reduced to their corresponding optically enriched alcohols by using various mutants of Thermoanaerobacter pseudoethanolicus secondary alcohol dehydrogenase (TeSADH). Substituted 2-tetralones, in particular, were reduced to 2-tetralols with high conversion and high enantioselectivity. The pharmacological importance of substituted 2-tetralols as key drug-building blocks makes our biocatalytic reduction method a highly essential tool. We showed that changing the position of the substituent on the aromatic ring of 2-tetralones impacts their binding affinity and the reaction maximum catalytic rate. Docking studies with several TeSADH mutants explain how the position of the substituent on the tetralone influences the binding orientation of substituted 2-tetralones and their reaction stereoselectivity.

  18. Voice and Narrative in L1 Writing

    DEFF Research Database (Denmark)

    Krogh, Ellen; Piekut, Anke

    2015-01-01

    This paper investigates issues of voice and narrative in L1 writing. Three branches of research are initial-ly discussed: research on narratives as resources for identity work, research on writer identity and voice as an essential aspect of identity, and research on Bildung in L1 writing. Subsequ...... training of voice and narratives as a resource for academic writing, and that the Bildung potential of L1 writing may be tied to this issue.......This paper investigates issues of voice and narrative in L1 writing. Three branches of research are initial-ly discussed: research on narratives as resources for identity work, research on writer identity and voice as an essential aspect of identity, and research on Bildung in L1 writing...... in lower secondary L1, she found that her previous writing strategies were not rewarded in upper secondary school. In the second empiri-cal study, two upper-secondary exam papers are investigated, with a focus on their approaches to exam genres and their use of narrative resources to address issues...

  19. The Anti-Inflammatory Effects of Dimethyl Fumarate in Astrocytes Involve Glutathione and Haem Oxygenase-1

    Directory of Open Access Journals (Sweden)

    Shao Xia Lin

    2011-03-01

    Full Text Available DMF (dimethyl fumarate exerts anti-inflammatory and prometabolic effects in a variety of cell types, and a formulation (BG-12 is being evaluated for monotherapy in multiple sclerosis patients. DMF modifies glutathione (GSH levels that can induce expression of the anti-inflammatory protein HO-1 (haem oxygenase-1. In primary astrocytes and C6 glioma cells, BG-12 dose-dependently suppressed nitrite production induced by either LI [LPS (lipopolysaccharide at 1 μg/ml plus IFNγ (interferon γ at 20 units/ml] or a mixture of proinflammatory cytokines, with greater efficacy in C6 cells. BG-12 reduced NOS2 (nitric oxide synthase 2 mRNA levels and activation of a NOS2 promoter, reduced nuclear levels of NF-κB (nuclear factor κB p65 subunit and attenuated loss of |κBα (inhibitory κBα in both cell types, although with greater effects in astrocytes. In astrocytes, LI decreased mRNA levels for GSHr (GSH reductase and GCL (c-glutamylcysteine synthetase, and slightly suppressed GSHs (GSH synthetase mRNAs. Co-treatment with BG-12 prevented those decreased and increased levels above control values. In contrast, LI reduced GSHp (GSH peroxidase and GCL in C6 cells, and BG-12 had no effect on those levels. BG-12 increased nuclear levels of Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2, an inducer of GSH-related enzymes, in astrocytes but not C6 cells. In astrocytes, GSH was decreased by BG-12 at 2 h and increased at 24 h. Prior depletion of GSH using buthionine-sulfoximine increased the ability of BG-12 to reduce nitrites. In astrocytes, BG-12 increased HO-1 mRNA levels and effects on nitrite levels were blocked by an HO-1 inhibitor. These results demonstrate that BG-12 suppresses inflammatory activation in astrocytes and C6 glioma cells, but with distinct mechanisms, different dependence on GSH and different effects on transcription factor activation.

  20. How Does L1 and L2 Exposure Impact L1 Performance in Bilingual Children? Evidence from Polish-English Migrants to the United Kingdom

    Directory of Open Access Journals (Sweden)

    Ewa Haman

    2017-09-01

    Full Text Available Most studies on bilingual language development focus on children’s second language (L2. Here, we investigated first language (L1 development of Polish-English early migrant bilinguals in four domains: vocabulary, grammar, phonological processing, and discourse. We first compared Polish language skills between bilinguals and their Polish non-migrant monolingual peers, and then investigated the influence of the cumulative exposure to L1 and L2 on bilinguals’ performance. We then examined whether high exposure to L1 could possibly minimize the gap between monolinguals and bilinguals. We analyzed data from 233 typically developing children (88 bilingual and 145 monolingual aged 4;0 to 7;5 (years;months on six language measures in Polish: receptive vocabulary, productive vocabulary, receptive grammar, productive grammar (sentence repetition, phonological processing (non-word repetition, and discourse abilities (narration. Information about language exposure was obtained via parental questionnaires. For each language task, we analyzed the data from the subsample of bilinguals who had completed all the tasks in question and from monolinguals matched one-on-one to the bilingual group on age, SES (measured by years of mother’s education, gender, non-verbal IQ, and short-term memory. The bilingual children scored lower than monolinguals in all language domains, except discourse. The group differences were more pronounced on the productive tasks (vocabulary, grammar, and phonological processing and moderate on the receptive tasks (vocabulary and grammar. L1 exposure correlated positively with the vocabulary size and phonological processing. Grammar scores were not related to the levels of L1 exposure, but were predicted by general cognitive abilities. L2 exposure negatively influenced productive grammar in L1, suggesting possible L2 transfer effects on L1 grammatical performance. Children’s narrative skills benefitted from exposure to two languages

  1. A Comparative biochemical study on two marine endophytes, Bacterium SRCnm and Bacillus sp. JS, Isolated from red sea algae.

    Science.gov (United States)

    Ahmed, Eman Fadl; Hassan, Hossam Mokhtar; Rateb, Mostafa Ezzat; Abdel-Wahab, Noha; Sameer, Somayah; Aly Taie, Hanan Anwar; Abdel-Hameed, Mohammed Sayed; Hammouda, Ola

    2016-01-01

    Two marine endophytic bacteria were isolated from the Red Sea algae; a red alga; Acanthophora dendroides and the brown alga Sargassum sabrepandum. The isolates were identified based on their 16SrRNA sequences as Bacterium SRCnm and Bacillus sp. JS. The objective of this study was to investigate the potential anti-microbial and antioxidant activities of the extracts of the isolated bacteria grown in different nutrient conditions. Compared to amoxicillin (25μg/disk) and erythromycin (15μg/disk), the extracts of Bacterium SRCn min media II, III, IV and V were potent inhibitors of the gram-positive bacterium Sarcina maxima even at low concentrations. Also, the multidrug resistant Staphylococcus aureus(MRSA) was more sensitive to the metabolites produced in medium (II) of the same endophyte than erythromycin (15μg/disk). A moderate activity of the Bacillus sp. JS extracts of media I and II was obtained against the same pathogen. The total compounds (500ug/ml) of both isolated endophytes showed moderate antioxidant activities (48.9% and 46.1%, respectively). LC/MS analysis of the bacterial extracts was carried out to investigate the likely natural products produced. Cyclo(D-cis-Hyp-L-Leu), dihydrosphingosine and 2-Amino-1,3-hexadecanediol were identified in the fermentation medium of Bacterium SRCnm, whereas cyclo (D-Pro-L-Tyr) and cyclo (L-Leu-L-Pro) were the suggested compounds of Bacillus sp. JS.

  2. PD-1/PD-L1 Inhibitors for Immuno-oncology: From Antibodies to Small Molecules.

    Science.gov (United States)

    Geng, Qiaohong; Jiao, Peifu; Jin, Peng; Su, Gaoxing; Dong, Jinlong; Yan, Bing

    2018-02-12

    The recent regulatory approvals of immune checkpoint protein inhibitors, such as ipilimumab, pembrolizumab, nivolumab, atezolizumab, durvalumab, and avelumab ushered a new era in cancer therapy. These inhibitors do not attack tumor cells directly but instead mobilize the immune system to re-recognize and eradicate tumors, which endows them with unique advantages including durable clinical responses and substantial clinical benefits. PD-1/PD-L1 inhibitors, a pillar of immune checkpoint protein inhibitors, have demonstrated unprecedented clinical efficacy in more than 20 cancer types. Besides monoclonal antibodies, diverse PD- 1/PD-L1 inhibiting candidates, such as peptides, small molecules have formed a powerful collection of weapons to fight cancer. The goal of this review is to summarize and discuss the current PD-1/PD-L1 inhibitors including candidates under clinical development, their molecular interactions with PD-1 or PD-L1, the disclosed structureactivity relationships of peptides and small molecules as inhibitors. Current PD-1/PD-L1 inhibitors under clinical development are exclusively dominated by antibodies. The molecular interactions of therapeutic antibodies with PD-1 or PD-L1 have been gradually elucidated for the design of novel inhibitors. Various peptides and traditional small molecules have been investigated in preclinical model to discover novel PD-1/PD-L1 inhibitors. Peptides and small molecules may play an important role in immuno-oncology because they may bind to multiple immune checkpoint proteins via rational design, opening opportunity for a new generation of novel PD-1/PD-L1 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. KSHV LANA and EBV LMP1 induce the expression of UCH-L1 following viral transformation

    Energy Technology Data Exchange (ETDEWEB)

    Bentz, Gretchen L.; Bheda-Malge, Anjali; Wang, Ling [Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill (United States); Shackelford, Julia [Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill (United States); Department of Cell and Developmental Biology, University of North Carolina, Chapel Hill (United States); Damania, Blossom [Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill (United States); Departments of Medicine and of Microbiology and Immunology, University of North Carolina, Chapel Hill, NC (United States); Pagano, Joseph S., E-mail: joseph_pagano@med.unc.edu [Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill (United States); Departments of Medicine and of Microbiology and Immunology, University of North Carolina, Chapel Hill, NC (United States)

    2014-01-05

    Ubiquitin C-terminal Hydrolase L1 (UCH-L1) has oncogenic properties and is highly expressed during malignancies. We recently documented that Epstein-Barr virus (EBV) infection induces uch-l1 expression. Here we show that Kaposi's Sarcoma-associated herpesvirus (KSHV) infection induced UCH-L1 expression, via cooperation of KSHV Latency-Associated Nuclear Antigen (LANA) and RBP-Jκ and activation of the uch-l1 promoter. UCH-L1 expression was also increased in Primary Effusion Lymphoma (PEL) cells co-infected with KSHV and EBV compared with PEL cells infected only with KSHV, suggesting EBV augments the effect of LANA on uch-l1. EBV latent membrane protein 1 (LMP1) is one of the few EBV products expressed in PEL cells. Results showed that LMP1 was sufficient to induce uch-l1 expression, and co-expression of LMP1 and LANA had an additive effect on uch-l1 expression. These results indicate that viral latency products of both human γ-herpesviruses contribute to uch-l1 expression, which may contribute to the progression of lymphoid malignancies. - Highlights: • Infection of endothelial cells with KSHV induced UCH-L1 expression. • KSHV LANA is sufficient for the induction of uch-l1. • Co-infection with KSHV and EBV (observed in some PELs) results in the additive induction of uch-l1. • EBV LMP1 also induced UCH-L1 expression. • LANA- and LMP1-mediated activation of the uch-l1 promoter is in part through RBP-Jκ.

  4. First-In-Human, Double-Blind, Placebo-Controlled, Randomized, Dose-Escalation Study of BG00010, a Glial Cell Line-Derived Neurotrophic Factor Family Member, in Subjects with Unilateral Sciatica.

    Science.gov (United States)

    Rolan, Paul E; O'Neill, Gilmore; Versage, Eve; Rana, Jitesh; Tang, Yongqiang; Galluppi, Gerald; Aycardi, Ernesto

    2015-01-01

    To evaluate the safety, tolerability, and pharmacokinetics of single doses of BG00010 (neublastin, artemin, enovin) in subjects with unilateral sciatica. This was a single-center, blinded, placebo-controlled, randomized Phase 1 sequential-cohort, dose-escalation study (ClinicalTrials.gov identifier NCT00961766; funded by Biogen Idec). Adults with unilateral sciatica were enrolled at The Royal Adelaide Hospital, Australia. Four subjects were assigned to each of eleven cohorts (intravenous BG00010 0.3, 1, 3, 10, 25, 50, 100, 200, 400, or 800 μg/kg, or subcutaneous BG00010 50 μg/kg) and were randomized 3:1 to receive a single dose of BG00010 or placebo. The primary safety and tolerability assessments were: adverse events; clinical laboratory parameters and vital signs; pain as measured by a Likert rating scale; intra-epidermal nerve fiber density; and longitudinal assessment of quantitative sensory test parameters. Blood, serum, and plasma samples were collected for pharmacokinetic and pharmacodynamic assessments. Subjects were blinded to treatment assignment throughout the study. The investigator was blinded to treatment assignment until the Data Safety Review Committee review of unblinded data, which occurred after day 28. Beyond the planned enrollment of 44 subjects, four additional subjects were enrolled into to the intravenous BG00010 200 μg/kg cohort after one original subject experienced mild generalized pruritus. Therefore, a total of 48 subjects were enrolled between August 2009 and December 2011; all were included in the safety analyses. BG00010 was generally well tolerated: in primary analyses, the most common treatment-emergent adverse events were changes in temperature perception, pruritus, rash, or headache; no trends were observed in clinical laboratory parameters, vital signs, intra-epidermal nerve fiber density, or quantitative sensory testing. BG00010 was not associated with any clear, dose-dependent trends in Likert pain scores. BG00010 was

  5. Dirichlet expression for L(1, χ )

    Indian Academy of Sciences (India)

    We show that this expression with obvious modification is valid for the general primitive Dirichlet character χ. Keywords. Hurwitz zeta function; Dirichlet character; Dirichlet L-series; primitive character. 1. Introduction. In Dirichlet's famous work dealing with class number formula, the value of L(1,χ) is expressed in terms of finite ...

  6. Validation of ATLAS L1 Topological Triggers

    CERN Document Server

    Praderio, Marco

    2017-01-01

    The Topological trigger (L1Topo) is a new component of the ATLAS L1 (Level-1) trigger. Its purpose is that of reducing the otherwise too high rate of data collection from the LHC by rejecting those events considered “uninteresting” (meaning that they have already been studied). This event rate reduction is achieved by applying topological requirements to the physical objects present in each event. It is very important to make sure that this trigger does not reject any “interesting” event. Therefore we need to verify its correct functioning. The goal of this summer student project is to study the response of two L1Topo algorithms (concerning ∆R and invariant mass). To do so I will compare the trigger decisions produced by the L1Topo hardware with the ones produced by the “official” L1Topo simulation. This way I will be able to identify events that could be incorrectly rejected. Simultaneously I will produce an emulation of these triggers that will help me understand the cause of disagreements bet...

  7. Spore-Forming Thermophilic Bacterium within Artificial Meteorite Survives Entry into the Earth's Atmosphere on FOTON-M4 Satellite Landing Module.

    Science.gov (United States)

    Slobodkin, Alexander; Gavrilov, Sergey; Ionov, Victor; Iliyin, Vyacheslav

    2015-01-01

    One of the key conditions of the lithopanspermia hypothesis is that microorganisms situated within meteorites could survive hypervelocity entry from space through the Earth's atmosphere. So far, all experimental proof of this possibility has been based on tests with sounding rockets which do not reach the transit velocities of natural meteorites. We explored the survival of the spore-forming thermophilic anaerobic bacterium, Thermoanaerobacter siderophilus, placed within 1.4-cm thick basalt discs fixed on the exterior of a space capsule (the METEORITE experiment on the FOTON-M4 satellite). After 45 days of orbital flight, the landing module of the space vehicle returned to Earth. The temperature during the atmospheric transit was high enough to melt the surface of basalt. T. siderophilus survived the entry; viable cells were recovered from 4 of 24 wells loaded with this microorganism. The identity of the strain was confirmed by 16S rRNA gene sequence and physiological tests. This is the first report on the survival of a lifeform within an artificial meteorite after entry from space orbit through Earth's atmosphere at a velocity that closely approached the velocities of natural meteorites. The characteristics of the artificial meteorite and the living object applied in this study can serve as positive controls in further experiments on testing of different organisms and conditions of interplanetary transport.

  8. Spore-Forming Thermophilic Bacterium within Artificial Meteorite Survives Entry into the Earth's Atmosphere on FOTON-M4 Satellite Landing Module.

    Directory of Open Access Journals (Sweden)

    Alexander Slobodkin

    Full Text Available One of the key conditions of the lithopanspermia hypothesis is that microorganisms situated within meteorites could survive hypervelocity entry from space through the Earth's atmosphere. So far, all experimental proof of this possibility has been based on tests with sounding rockets which do not reach the transit velocities of natural meteorites. We explored the survival of the spore-forming thermophilic anaerobic bacterium, Thermoanaerobacter siderophilus, placed within 1.4-cm thick basalt discs fixed on the exterior of a space capsule (the METEORITE experiment on the FOTON-M4 satellite. After 45 days of orbital flight, the landing module of the space vehicle returned to Earth. The temperature during the atmospheric transit was high enough to melt the surface of basalt. T. siderophilus survived the entry; viable cells were recovered from 4 of 24 wells loaded with this microorganism. The identity of the strain was confirmed by 16S rRNA gene sequence and physiological tests. This is the first report on the survival of a lifeform within an artificial meteorite after entry from space orbit through Earth's atmosphere at a velocity that closely approached the velocities of natural meteorites. The characteristics of the artificial meteorite and the living object applied in this study can serve as positive controls in further experiments on testing of different organisms and conditions of interplanetary transport.

  9. Isolation and characterization of cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase large and small subunits in Nitrosomonas sp. strain ENI-11.

    Science.gov (United States)

    Hirota, Ryuichi; Kato, Junichi; Morita, Hiromu; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

    2002-03-01

    The cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) large and small subunits in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11 were cloned and sequenced. The deduced gene products, CbbL and CbbS, had 93 and 87% identity with Thiobacillus intermedius CbbL and Nitrobacter winogradskyi CbbS, respectively. Expression of cbbL and cbbS in Escherichia coli led to the detection of RubisCO activity in the presence of 0.1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG). To our knowledge, this is the first paper to report the genes involved in the carbon fixation reaction in chemolithotrophic ammonia-oxidizing bacteria.

  10. Draft Genome Sequence of the Sulfate-Reducing Bacterium Desulfotomaculum copahuensis Strain CINDEFI1 Isolated from the Geothermal Copahue System, Neuqu?n, Argentina

    OpenAIRE

    Willis Poratti, Graciana; Yaakop, Amira Suriaty; Chan, Chia Sing; Urbieta, M. Sof?a; Chan, Kok-Gan; Ee, Robson; Tan-Guan-Sheng, Adrian; Goh, Kian Mau; Donati, Edgardo R.

    2016-01-01

    Desulfotomaculum copahuensis strain CINDEFI1 is a novel spore-forming sulfate-reducing bacterium isolated from the Copahue volcano area, Argentina. Here, we present its draft genome in which we found genes related with the anaerobic respiration of sulfur compounds similar to those present in the Copahue environment.

  11. Progress of PD-1/PD-L1 Inhibitors in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhansheng JIANG

    2017-02-01

    Full Text Available Pembrolizumab, an inhibitor target programmed death 1 (PD-1, was approved into the first line therapy in advanced non-small cell lung cancer (NSCLC. It was a milestone that immune checkpoints drugs have played an important role in the treatment system of NSCLC. The results of clinical trials revealed the superiority of PD-1/programmed death ligand 1 (PD-L1 inhibitors compared with chemotherapy in first-line, second-line and multidrug resistance phase therapy. Objective response rate (ORR was up to 80% with pembrolizumab plus chemotherapy, and progression-free survival (PFS with single pembrolizumab in first line was nearly 1 year (10.3 months, the hazard ratio for death fell by 40%. Overall survival (OS was more or less 1 year with single drug pembrolizumab, nivolumab and atezolizumab for second line therapy. PD-L1 expression was a predictor of PD-1/PD-L1 inhibitors. The positive rate of PD-L1 (more than 1% in advanced NSCLC was about 60% with little difference between the tissue types. However, there was no gold standard test of PD-L1 expression.

  12. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  13. Pancreatic ß-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia; Deacon, Carolyn F.

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  14. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation.

    Science.gov (United States)

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-08-06

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans.

  15. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation

    Science.gov (United States)

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-01-01

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans. DOI: http://dx.doi.org/10.7554/eLife.16078.001 PMID:27495975

  16. MODELING OF MIXED CHEMOSTAT CULTURES OF AN AEROBIC BACTERIUM, COMAMONAS-TESTOSTERONI, AND AN ANAEROBIC BACTERIUM, VEILLONELLA-ALCALESCENS - COMPARISON WITH EXPERIMENTAL-DATA

    NARCIS (Netherlands)

    GERRITSE, J; SCHUT, F; GOTTSCHAL, JC

    A mathematical model of mixed chemostat cultures of the obligately aerobic bacterium Comamonas testosteroni and the anaerobic bacterium Veillonella alcalescens grown under dual limitation Of L-lactate and oxygen was constructed. The model was based on Michaelis-Menten-type kinetics for the

  17. Amadurecimento de sapoti (Manilkara zapota L. submetido ao 1-metilciclopropeno Ripening of sapodilla (Manilkara zapota L. submitted to 1-methylcyclopropene

    Directory of Open Access Journals (Sweden)

    Patrícia Lígia Dantas de Morais

    2006-12-01

    Full Text Available Este trabalho tem como objetivo avaliar o efeito do 1-MCP no controle do amadurecimento de sapoti. Os frutos foram colhidos no estádio de maturação fisiológico (fruto apto para amadurecer separado da planta-mãe, tratados com 0; 300 e 600 nL L-1 de 1-MCP por 12 horas em câmaras vedadas a 25 ± 2ºC e umidade relativa de 70 ± 5%. Ao término do tratamento com 1-MCP, os frutos foram armazenados por 23 dias nas mesmas condições de temperatura e umidade. As variáveis analisadas foram: perda de massa fresca, aparência externa, firmeza, cor da polpa, acidez titulável, pH, sólidos solúveis e açúcares solúveis totais. O 1-metilciclopropeno (1-MCP retarda o amadurecimento e prolonga a vida útil pós-colheita de sapoti. A concentração de 300 nL.L-1 de 1-MCP apresentou melhores resultados, prolongando a vida útil pós-colheita do sapoti por seis dias.This work aimed to evaluate the effect of different concentrations of 1-MCP on the ripening process of sapodilla. Fruits were harvested at the physiologically mature stage and treated with 0, 300 and 600 nL.L-1 dosages of 1-MCP for 12 hours in hermetically closed chambers at 25 ± 2ºC and 70 ± 5% R.H.. After the 12 h 1-MCP treatment, the fruits were stored for 23 days under the same conditions of temperature and humidity. The parameters analyzed for postharvest quality were: weight loss, external appearance, firmness, pulp color, total titrable acidity, total soluble solids and total soluble sugar content. In sapodilla, 1-MCP delays ripening and prolongs the postharvest shelf life and the 300 nL.L-1 of 1-MCP dosage showed the best results extending the postharvest life of sapodilla in 6 days.

  18. Measurements of the total cross-section difference ΔδL (np) at 1.39, 1.69, 1.89 and 1.99 GeV

    International Nuclear Information System (INIS)

    Sharov, V.I.; Anishchenko, N.G.; Antonenko, V.G.

    2004-01-01

    New accurate results of the neutron-proton spin-dependent total cross-section difference Δδ L (np) at the neutron beam kinetic energies of 1.39, 1.69, 1.89 and 1.99 GeV are presented. In general these data complete the measurements of energy dependence of Δδ L (np) over the Dubna Synchrophasotron energy region. The quasi-monochromatic neutron beam was produced by break-up of extracted polarized deuterons. The deuteron (and hence neutron) polarization direction was flipped every accelerator burst. The neutron vertical direction of polarization was rotated onto the neutron beam direction and longitudinally (L) polarized neutrons were transmitted through the large proton L-polarized target. The longitudinal target polarization direction was inverted after 1-2 days of measurements. Four different combinations of the beam and target parallel and antiparallel polarization directions, both oriented along the neutron beam momentum, were used at each energy. A fast decrease of - Δδ L (np) with increasing energy above 1.1 GeV and a structure in the energy dependence around 1.8 GeV, first observed from our previous data, seem to be well revealed. The new results are also compared with model predictions and with phase shift analysis fits. The Δδ L quantities for isosinglet state I = 0, deduced from the measured Δδ L (np) values and known Δδ L (pp) data, are also given. The results of the measurements of unpolarized total cross sections δ 0tot (np) at 1.3, 1.4 and 1.5 GeV and δ 0tot (nC) at 1.4 and 1.5 GeV are presented as well. These data were obtained using the same apparatus and high intensity unpolarized deuteron beams extracted either from the Synchrophasotron, or from the Nuclotron

  19. Characterization and immunogenicity of rLipL32/1-LipL21-OmpL1/2 fusion protein as a novel immunogen for a vaccine against Leptospirosis

    Directory of Open Access Journals (Sweden)

    Zhao Xin

    2015-01-01

    Full Text Available Vaccination is an effective strategy to prevent leptospirosis, a global zoonotic disease caused by infection with pathogenic Leptospira species. However, the currently used multiple-valence vaccine, which is prepared with whole cells of several Leptospira serovars, has major side effects, while its cross-immunogenicity among different Leptospira serovars is weak. LipL32, LipL21 and 2 OmpL1 have been confirmed as surface-exposed antigens in all pathogenic Leptospira strains, but their immunoprotective efficiency needs to be improved. In the present study, we generated a fusion gene lipL32/1-lipL21-ompL1/2 using primer-linking PCR and an engineered E. coli strain to express the recombinant fusion protein rLipL32/1-LipL21-OmpL1/2 (rLLO. Subsequently, the expression conditions were optimized using a central composite design that increased the fusion protein yield 2.7-fold. Western blot assays confirmed that rLLO was recognized by anti-rLipL32/1, anti-rLipL21, and anti-rOmpL1/2 sera as well as 98.5% of the sera from leptospirosis patients. The microscopic agglutination test (MAT demonstrated that rLLO antiserum had a stronger ability to agglutinate the strains of different Leptospira serovars than the rLipL32/1, rLipL21, and rOmpL1/2 antisera. More importantly, tests in hamsters showed that rLLO provided higher immunoprotective rates (91.7% than rLipL32/1, rLipL21 and rOmpL1/2 (50.0-75.0%. All the data indicate that rLLO, a recombinant fusion protein incorporating three antigens, has increased antigenicity and immunoprotective effects, and so can be used as a novel immunogen to develop a universal genetically engineered vaccine against leptospirosis.

  20. Hepatic NPC1L1 overexpression ameliorates glucose metabolism in diabetic mice via suppression of gluconeogenesis.

    Science.gov (United States)

    Kurano, Makoto; Hara, Masumi; Satoh, Hiroaki; Tsukamoto, Kazuhisa

    2015-05-01

    Inhibition of intestinal NPC1L1 by ezetimibe has been demonstrated to improve glucose metabolism in rodent models; however, the role of hepatic NPC1L1 in glucose metabolism has not been elucidated. In this study, we analyzed the effects of hepatic NPC1L1 on glucose metabolism. We overexpressed NPC1L1 in the livers of lean wild type mice, diet-induced obesity mice and db/db mice with adenoviral gene transfer. We found that in all three mouse models, hepatic NPC1L1 overexpression lowered fasting blood glucose levels as well as blood glucose levels on ad libitum; in db/db mice, hepatic NPC1L1 overexpression improved blood glucose levels to almost the same as those found in lean wild type mice. A pyruvate tolerance test revealed that gluconeogenesis was suppressed by hepatic NPC1L1 overexpression. Further analyses revealed that hepatic NPC1L1 overexpression decreased the expression of FoxO1, resulting in the reduced expression of G6Pase and PEPCK, key enzymes in gluconeogenesis. These results indicate that hepatic NPC1L1 might have distinct properties of suppressing gluconeogenesis via inhibition of FoxO1 pathways. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Novel functions for the endocytic regulatory proteins MICAL-L1 and EHD1 in mitosis.

    Science.gov (United States)

    Reinecke, James B; Katafiasz, Dawn; Naslavsky, Naava; Caplan, Steve

    2015-01-01

    During interphase, recycling endosomes mediate the transport of internalized cargo back to the plasma membrane. However, in mitotic cells, recycling endosomes are essential for the completion of cytokinesis, the last phase of mitosis that promotes the physical separation the two daughter cells. Despite recent advances, our understanding of the molecular determinants that regulate recycling endosome dynamics during cytokinesis remains incomplete. We have previously demonstrated that Molecule Interacting with CasL Like-1 (MICAL-L1) and C-terminal Eps15 Homology Domain protein 1 (EHD1) coordinately regulate receptor transport from tubular recycling endosomes during interphase. However, their potential roles in controlling cytokinesis had not been addressed. In this study, we show that MICAL-L1 and EHD1 regulate mitosis. Depletion of either protein resulted in increased numbers of bi-nucleated cells. We provide evidence that bi-nucleation in MICAL-L1- and EHD1-depleted cells is a consequence of impaired recycling endosome transport during late cytokinesis. However, depletion of MICAL-L1, but not EHD1, resulted in aberrant chromosome alignment and lagging chromosomes, suggesting an EHD1-independent function for MICAL-L1 earlier in mitosis. Moreover, we provide evidence that MICAL-L1 and EHD1 differentially influence microtubule dynamics during early and late mitosis. Collectively, our new data suggest several unanticipated roles for MICAL-L1 and EHD1 during the cell cycle. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Heavy metals detection using biosensor cells of a novel marine luminescent bacterium Vibrio sp. MM1 isolated from the Caspian Sea.

    Science.gov (United States)

    Mohseni, Mojtaba; Abbaszadeh, Jaber; Maghool, Shima-Sadat; Chaichi, Mohammad-Javad

    2018-02-01

    Monitoring and assessing toxic materials which are being released into the environment along with wastewater is a growing concern in many industries. The current research describes a highly sensitive and rapid method for the detection of toxic concentrations of heavy metals in aquatic environments. Water samples were collected from southern coasts of the Caspian Sea followed by screening of luminescent bacteria. Phylogenetic analysis, including gene sequence of 16S rRNA, and biochemical tests were performed for identification of the isolate. Luminescence activity was tested and measured after treatment of the isolate with different concentrations of heavy metals and reported as EC 50 value for each metal. A luminous, gram negative bacterium with the shape of a curved rod was isolated from the Caspian Sea. Biochemical tests and 16S rRNA gene sequence analysis indicated that the isolate MM1 had more than 99% similarity to Vibrio campbellii. The novel isolate is able to emit high levels of light. Bioluminescence inhibitory assay showed that the Vibrio sp. MM1 had the highest sensitivity to zinc and the lowest sensitivity to cadmium; EC 50 values were 0.97mgl -1 and 14.54mgl -1 , respectively. The current research shows that even low concentrations of heavy metals can cause a detectable decline in luminescence activity of the novel bacterium Vibrio sp. MM1; hence, it makes a good choice for commercial kits for the purpose of monitoring toxic materials. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Influence of initial insulin dosage on blood glucose dynamics of children and adolescents with newly diagnosed type 1 diabetes mellitus.

    Science.gov (United States)

    Wang, Yi; Gong, Chunxiu; Cao, Bingyan; Meng, Xi; Wei, Liya; Wu, Di; Liang, Xuejun; Li, Wenjing; Liu, Min; Gu, Yi; Su, Chang

    2017-05-01

    To investigate the effect of initial insulin dosage on blood glucose (BG) dynamics, β-cell protection, and oxidative stress in type 1 diabetes mellitus. Sixty newly diagnosed type 1 diabetes mellitus patients were randomly assigned to continuous subcutaneous insulin infusions of 0.6 ± 0.2 IU/kg/d (group 1), 1.0 ± 0.2 IU/kg/d (group 2), or 1.4 ± 0.2 IU/kg/d (group 3) for 3 wk. BG was monitored continuously for the first 10 d and the last 2 d of wk 2 and 3. A total of 24-hour urinary 8-iso-PGF2α was assayed on days 8, 9, and 10. The occurrence and duration of the honeymoon period were recorded. Fasting C-peptide and glycosylated hemoglobin (HbA1c) were assayed after 1, 6, and 12 months of insulin treatment. BG decreased to the target range by the end of wk 3 (group 1), wk 2 (group 2), or wk 1 (group 3). The actual insulin dosage over the 3 wk, frequency of hypoglycemia on wk 1 and 2, and median BG at the end of wk 1 differed significantly, but not 8-iso-PGF2α and the honeymoon period in the three groups. No severe hypoglycemia event was observed in any patient, but there was significant difference in the first occurrence of hypoglycemia. Differences in initial insulin dosage produced different BG dynamics in wk 1, equivalent BG dynamics on wk 2 and 3, but had no influence on short- and long-term BG control and honeymoon phase. The wide range of initial insulin dosage could be chosen if guided by BG monitoring. © 2016 The Authors. Pediatric Diabetes published by John Wiley & Sons Ltd.

  4. The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.

    Science.gov (United States)

    Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping

    2013-10-01

    In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  5. A comparative study of the adsorption and oxidation of L-alanine and L-serine on Au(1 0 0), Au(1 1 1) and gold thin film electrodes in acid media

    International Nuclear Information System (INIS)

    Sandoval, Andrea P.; Orts, José Manuel; Rodes, Antonio; Feliu, Juan M.

    2013-01-01

    The adsorption and oxidation of L-alanine and L-serine at Au(1 1 1) and Au(1 0 0) single crystal and evaporated thin-film electrodes with preferential (1 1 1) orientation was studied in perchloric acid solutions. For this purpose, cyclic voltammetry experiments were combined with external reflection infrared spectroscopy (gold single crystals) and surface-enhanced infrared reflection–absorption spectroscopy under attenuated total reflection conditions (ATR-SEIRAS) (gold thin films). In addition, theoretical harmonic vibrational frequencies, obtained from B3LYP/LANL2DZ, 6-31+G(d) calculations for the zwitterionic species adsorbed on Au clusters with (1 1 1) orientation, were used to interpret the experimental spectra. The optimized geometry obtained from DFT calculations for the corresponding zwitterion plus a water molecule, under the application of an external electric field of 0.01 a.u. corresponds to a bidentate asymmetrical bridge adsorption configuration. The absence of an adsorbate band for the asymmetric OCO stretching in the experimental infrared spectra confirms the bidentate bonding of the adsorbed zwitterion through the oxygen atoms of the carboxylate group irrespective of the crystallographic orientation of the electrode surface, the adsorbate coverage and the electrode potential. In addition to typical interfacial water bands associated to perchlorate anions, which are co-adsorbed in order to compensate the positive charge of the ammonium group, the ATR-SEIRA spectra also show bands around 2950 cm −1 that can be related to the formation of hydrogen bonds between interfacial water and the ammonium group of the adsorbed zwitterion. The voltammetric experiments have shown that, as in the case of platinum electrodes, L-serine oxidizes at lower potentials than L-alanine. Under these conditions, the in situ infrared experiments show the formation of carbon dioxide and adsorbed cyanide as oxidation products of L-serine. In the case of L-alanine, only

  6. Multivalent human papillomavirus l1 DNA vaccination utilizing electroporation.

    Directory of Open Access Journals (Sweden)

    Kihyuck Kwak

    Full Text Available Naked DNA vaccines can be manufactured simply and are stable at ambient temperature, but require improved delivery technologies to boost immunogenicity. Here we explore in vivo electroporation for multivalent codon-optimized human papillomavirus (HPV L1 and L2 DNA vaccination.Balb/c mice were vaccinated three times at two week intervals with a fusion protein comprising L2 residues ∼11-88 of 8 different HPV types (11-88×8 or its DNA expression vector, DNA constructs expressing L1 only or L1+L2 of a single HPV type, or as a mixture of several high-risk HPV types and administered utilizing electroporation, i.m. injection or gene gun. Serum was collected two weeks and 3 months after the last vaccination. Sera from immunized mice were tested for in-vitro neutralization titer, and protective efficacy upon passive transfer to naive mice and vaginal HPV challenge. Heterotypic interactions between L1 proteins of HPV6, HPV16 and HPV18 in 293TT cells were tested by co-precipitation using type-specific monoclonal antibodies.Electroporation with L2 multimer DNA did not elicit detectable antibody titer, whereas DNA expressing L1 or L1+L2 induced L1-specific, type-restricted neutralizing antibodies, with titers approaching those induced by Gardasil. Co-expression of L2 neither augmented L1-specific responses nor induced L2-specific antibodies. Delivery of HPV L1 DNA via in vivo electroporation produces a stronger antibody response compared to i.m. injection or i.d. ballistic delivery via gene gun. Reduced neutralizing antibody titers were observed for certain types when vaccinating with a mixture of L1 (or L1+L2 vectors of multiple HPV types, likely resulting from heterotypic L1 interactions observed in co-immunoprecipitation studies. High titers were restored by vaccinating with individual constructs at different sites, or partially recovered by co-expression of L2, such that durable protective antibody titers were achieved for each type

  7. Effect of uniaxial strain on adatom diffusion across {l_brace}1 1 1{r_brace}-faceted step

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.cn [Department of Maths and Physics, Hunan Institute of Engineering, Donghu Street, Xiangtan 411104 (China); Hu Wangyu, E-mail: Wangyuhu2001@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Tang Jianfeng [Department of Applied Physics, Hunan Agricultural University, Changsha 410128 (China)

    2011-02-01

    Diffusion of Pt adatom across the strained {l_brace}1 1 1{r_brace}-faceted step is studied by embedded atom method along with nudged elastic band method. For adatom on the flat (1 1 1) surface, the anisotropic diffusion behavior is found as the uniaxial strain is imposed. For the strained {l_brace}1 1 1{r_brace}-faceted step, our results show that the maximum energy barrier for adatom crossing step edge remains approximately constant as the strain varied from -1.0% to 1.0%, and there is a rise as the larger uniaxial strain is applied. The calculated energy barrier for adatom diffusion along the step edge increases with increasing tensile strain, and the slope of the straight line is small.

  8. 1H NMR of High-Potential Iron-Sulfur Protein from the Purple Non-Sulfur Bacterium Rhodoferax fermentans

    DEFF Research Database (Denmark)

    Ciurli, Stefano; Cremonini, Mauro Andrea; Kofod, Pauli

    1996-01-01

    residues bound to the [4Fe-4S]3+/2+ cluster have been performed using one-dimensional NOE and exchange spectroscopy experiments. 1H-NMR hyperfine shifts and relaxation rates of cluster-bound Cys β-CH2 protons indicate that in the [4Fe-4S]3+ cluster one iron ion can be formally described as Fe(III), while......Oxidized and reduced forms of high-potential iron-sulfur protein (HiPIP) from the purple non-sulfur photosynthetic bacterium Rhodoferux fermentans have been characterized using 1H-NMR spectroscopy. Pairwise and sequence-specific assignments of hyperfine-shifted 1H-NMR signals to protons of cysteine...... longitudinal relaxation rates of Cys β-CH2 protons in HiPIPs from six different sources as a function of the Fe-S-Cβ-Cα dihedral angle, indicate that the major contribution is due to a dipolar metal-centered mechanism, with a non-negligeable contribution from a ligand-centered dipolar mechanism which involves...

  9. Measurement of the np total cross section difference Δ σ L(np) at 1.39, 1.69, 1.89 and 1.99 GeV

    Science.gov (United States)

    Sharov, V. I.; Anischenko, N. G.; Antonenko, V. G.; Averichev, S. A.; Azhgirey, L. S.; Bartenev, V. D.; Bazhanov, N. A.; Belyaev, A. A.; Blinov, N. A.; Borisov, N. S.; Borzakov, S. B.; Borzunov, Yu T.; Bushuev, Yu P.; Chernenko, L. P.; Chernykh, E. V.; Chumakov, V. F.; Dolgii, S. A.; Fedorov, A. N.; Fimushkin, V. V.; Finger, M.; Finger, M.; Golovanov, L. B.; Gurevich, G. M.; Janata, A.; Kirillov, A. D.; Kolomiets, V. G.; Komogorov, E. V.; Kovalenko, A. D.; Kovalev, A. I.; Krasnov, V. A.; Krstonoshich, P.; Kuzmin, E. S.; Ladygin, V. P.; Lazarev, A. B.; Lehar, F.; de Lesquen, A.; Liburg, M. Yu; Livanov, A. N.; Lukhanin, A. A.; Maniakov, P. K.; Matafonov, V. N.; Matyushevsky, E. A.; Moroz, V. D.; Morozov, A. A.; Neganov, A. B.; Nikolaevsky, G. P.; Nomofilov, A. A.; Panteleev, Tz; Pilipenko, Yu K.; Pisarev, I. L.; Plis, Yu A.; Polunin, Yu P.; Prokofiev, A. N.; Prytkov, V. Yu; Rukoyatkin, P. A.; Schedrov, V. A.; Schevelev, O. N.; Shilov, S. N.; Shindin, R. A.; Slunečka, M.; Slunečková, V.; Starikov, A. Yu; Stoletov, G. D.; Strunov, L. N.; Svetov, A. L.; Usov, Yu A.; Vasiliev, T.; Volkov, V. I.; Vorobiev, E. I.; Yudin, I. P.; Zaitsev, I. V.; Zhdanov, A. A.; Zhmyrov, V. N.

    2004-09-01

    New accurate results of the neutron-proton spin-dependent total cross section difference Δσ_L(np) at the neutron beam kinetic energies 1.39, 1.69, 1.89 and 1.99 GeV are presented. Measurements were carried out in 2001 at the Synchrophasotron of the Veksler and Baldin Laboratory of High Energies of the Joint Institute for Nuclear Research. A quasi-monochromatic neutron beam was produced by break-up of extracted polarized deuterons. The deuteron (and hence neutron) polarization direction was flipped every accelerator burst. The vertical neutron polarization direction was rotated onto the neutron beam direction and longitudinally (L) polarized neutrons were transmitted through a large proton L-polarized target. The target polarization vector was inverted after 1-2 days of measurements. The data were recorded for four different combinations of the beam and target parallel and antiparallel polarization directions at each energy. A fast decrease of Δσ_L(np) with increasing energy above 1.1 GeV was confirmed. The structure in the Δσ_L(np) energy dependence around 1.8 GeV, first observed from our previous data, seems to be well pronounced. The new results are also compared with model predictions and with phase shift analysis fits. The Δσ_L quantities for isosinglet state I = 0, deduced from the measured Δσ_L(np) values and the known Δσ_L(pp) data, are also given. The results were completed by the measurements of unpolarized total cross sections σ_{0tot}(np) at 1.3, 1.4 and 1.5 GeV and σ_{0tot}(nC) at 1.4 and 1.5 GeV. These data were obtained using the same apparatus and high intensity unpolarized deuteron beams were extracted either from the Synchrophasotron, or from the Nuclotron.

  10. Rcan1-1L overexpression induces mitochondrial autophagy and improves cell survival in angiotensin II-exposed cardiomyocytes

    International Nuclear Information System (INIS)

    Duan, Hongyan; Li, Yongqiang; Yan, Lijie; Yang, Haitao; Wu, Jintao; Qian, Peng; Li, Bing; Wang, Shanling

    2015-01-01

    Mitochondrial autophagy is an important adaptive stress response and can be modulated by various key molecules. A previous study found that the regulator of calcineurin 1-1L (Rcan1-1L) may regulate mitochondrial autophagy and cause mitochondria degradation in neurocytes. However, the effect of Rcan1-1L on cardiomyocytes has not been determined. In the present study, we aimed to investigate the role of Rcan1-1L in angiotensin II (Ang II)-exposed human cardiomyocytes. Above all, Human adult cardiac myocytes (HACMs) were exposed to 200 nmol/L Ang II for 4 days. Enhanced H 2 O 2 production, cytochrome C release and mitochondrial permeability were observed in these cells, which were blocked by valsartan. Consistently, Ang II exposure significantly reduced cardiomyocyte viability. However, transfection of Rcan1-1L vector promoted cell viability and ameliorated the apoptosis caused by Ang II. Rcan1-1L clearly promoted mitochondrial autophagy in HACMs, with elevated autophagy protein (ATG) 5 and light chain 3 (LC3) expression. Transient mitochondrial biogenesis and reduced cytochrome C release was also induced by Rcan1-1L. Additionally, Rcan1-1L significantly inhibited calcineurin/nuclear factor of activated T cells (NFAT) signaling. We thus conclude that Rcan1-1L may play a protective role in Ang II-treated cardiomyocytes through the induction of mitochondrial autophagy, and may be an alternative method of cardiac protection. - Highlights: • Transfection of Rcan1-1L into HACMs promoted cell viability and reduced apoptosis. • Transfection of Rcan1-1L promoted mitochondrial autophagy in HACMs. • Rcan1-1L inhibited the calcineurin/nuclear factor of activated T cells signaling

  11. Rcan1-1L overexpression induces mitochondrial autophagy and improves cell survival in angiotensin II-exposed cardiomyocytes

    Energy Technology Data Exchange (ETDEWEB)

    Duan, Hongyan; Li, Yongqiang; Yan, Lijie; Yang, Haitao; Wu, Jintao; Qian, Peng; Li, Bing; Wang, Shanling, E-mail: shanglingwang@126.com

    2015-07-01

    Mitochondrial autophagy is an important adaptive stress response and can be modulated by various key molecules. A previous study found that the regulator of calcineurin 1-1L (Rcan1-1L) may regulate mitochondrial autophagy and cause mitochondria degradation in neurocytes. However, the effect of Rcan1-1L on cardiomyocytes has not been determined. In the present study, we aimed to investigate the role of Rcan1-1L in angiotensin II (Ang II)-exposed human cardiomyocytes. Above all, Human adult cardiac myocytes (HACMs) were exposed to 200 nmol/L Ang II for 4 days. Enhanced H{sub 2}O{sub 2} production, cytochrome C release and mitochondrial permeability were observed in these cells, which were blocked by valsartan. Consistently, Ang II exposure significantly reduced cardiomyocyte viability. However, transfection of Rcan1-1L vector promoted cell viability and ameliorated the apoptosis caused by Ang II. Rcan1-1L clearly promoted mitochondrial autophagy in HACMs, with elevated autophagy protein (ATG) 5 and light chain 3 (LC3) expression. Transient mitochondrial biogenesis and reduced cytochrome C release was also induced by Rcan1-1L. Additionally, Rcan1-1L significantly inhibited calcineurin/nuclear factor of activated T cells (NFAT) signaling. We thus conclude that Rcan1-1L may play a protective role in Ang II-treated cardiomyocytes through the induction of mitochondrial autophagy, and may be an alternative method of cardiac protection. - Highlights: • Transfection of Rcan1-1L into HACMs promoted cell viability and reduced apoptosis. • Transfection of Rcan1-1L promoted mitochondrial autophagy in HACMs. • Rcan1-1L inhibited the calcineurin/nuclear factor of activated T cells signaling.

  12. Malignant mesothelioma effusions are infiltrated by CD3+ T cells highly expressing PD-L1 and the PD-L1+ tumor cells within these effusions are susceptible to ADCC by the anti-PD-L1 antibody avelumab

    Science.gov (United States)

    Khanna, Swati; Thomas, Anish; Abate-Daga, Daniel; Zhang, Jingli; Morrow, Betsy; Steinberg, Seth M.; Orlandi, Augusto; Ferroni, Patrizia; Schlom, Jeffrey; Guadagni, Fiorella; Hassan, Raffit

    2016-01-01

    INTRODUCTION The functional aspects of programmed death 1 (PD-1) and PD ligand 1 (PD-L1) immune checkpoints in malignant mesothelioma have not been studied. METHODS Tumor samples from 65 patients with mesothelioma were evaluated for PD-L1 expression by immunohistochemistry and its prognostic significance. Malignant effusions from patients with pleural and peritoneal mesothelioma were evaluated for PD-1+ and PD-L1+ infiltrating lymphocytes and their role in inducing tumor cell PD-L1 expression. Antibody dependent cellular cytotoxicity (ADCC) of avelumab, a fully humanized IgG1 anti PD-L1 antibody towards primary mesothelioma cell lines was evaluated in presence of autologous and allogeneic NK cells. RESULTS Of 65 pleural and peritoneal mesothelioma tumors examined, 41 (63%) were PD-L1 positive, which was associated with slightly inferior overall survival compared to patients with PD-L1 negative tumors (median 23.0 vs. 33.3 months; p=0.35). The frequency of PD-L1 expression was similar in pleural and peritoneal mesothelioma patients with 62% and 64% of samples positive, respectively. Of nine mesothelioma effusion samples evaluated, the fraction of cells expressing PD-L1 ranged from 12 to 83%. Of 7 patients with paired malignant effusion and peripheral blood mononuclear cells (PBMC) samples, PD-L1 expression was significantly higher on CD3+ T cells present in malignant effusions as compared with PBMC (p=0.016). In addition, CD14+PD-1+ cells were elevated in malignant effusions compared with PBMC (p=0.031). The lymphocytes present in malignant effusions recognized autologous tumor cells and induced IFN-γ-mediated PD-L1 expression on the tumor cell surface. Of the three primary mesothelioma cell lines tested, two were susceptible to avelumab mediated ADCC in presence of autologous NK cells. CONCLUSION The majority of pleural as well as peritoneal mesothelioma express PD-L1. Malignant effusions in this disease are characterized by presence of tumor cells and CD3+ T

  13. Crystal Structure of the CTP1L Endolysin Reveals How Its Activity Is Regulated by a Secondary Translation Product.

    Science.gov (United States)

    Dunne, Matthew; Leicht, Stefan; Krichel, Boris; Mertens, Haydyn D T; Thompson, Andrew; Krijgsveld, Jeroen; Svergun, Dmitri I; Gómez-Torres, Natalia; Garde, Sonia; Uetrecht, Charlotte; Narbad, Arjan; Mayer, Melinda J; Meijers, Rob

    2016-03-04

    Bacteriophages produce endolysins, which lyse the bacterial host cell to release newly produced virions. The timing of lysis is regulated and is thought to involve the activation of a molecular switch. We present a crystal structure of the activated endolysin CTP1L that targets Clostridium tyrobutyricum, consisting of a complex between the full-length protein and an N-terminally truncated C-terminal cell wall binding domain (CBD). The truncated CBD is produced through an internal translation start site within the endolysin gene. Mutants affecting the internal translation site change the oligomeric state of the endolysin and reduce lytic activity. The activity can be modulated by reconstitution of the full-length endolysin-CBD complex with free CBD. The same oligomerization mechanism applies to the CD27L endolysin that targets Clostridium difficile and the CS74L endolysin that targets Clostridium sporogenes. When the CTP1L endolysin gene is introduced into the commensal bacterium Lactococcus lactis, the truncated CBD is also produced, showing that the alternative start codon can be used in other bacterial species. The identification of a translational switch affecting oligomerization presented here has implications for the design of effective endolysins for the treatment of bacterial infections. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Effect of L1-ORF2 on senescence of GES-1 cells and its molecular mechanisms

    Directory of Open Access Journals (Sweden)

    Ying-nan LI

    2016-06-01

    Full Text Available Objective  To investigate the effect of long interspersed nuclear elements 1 open reading frame 2(L1-ORF2 gene on the senescence of GES-1 cells and its mechanism of molecular regulation. Methods  Cell culture of high glucose was used to construct stable model of senescent GES-1 cells. L1-ORF2 siRNA vector was constructed and then transfected into normal GES1 and senescent ones with liposome transfection reagents for transient expression. Forty eight hours after transfection, cell growth curves were drawn to show the speed of cell proliferation, flow cytometry was used to analyze the cell cycle, β-galactosidase staining to detect cell aging and Western blotting to detect the expressions of L1-ORF2, P53 and P21proteins. Results  Senescent GES-1 cell model and L1-ORF2 siRNA vector were constructed. Compared with negative control group, the L1-ORF2 expression decreased in normal and senescent GES-1 cells transfected with L1-ORF2 siRNA vector. There was a faster proliferation of senescent GES1 cells (P<0.05 and lower ratio of β-galactosidase (56% vs 69%, P<0.05 and G0/G1 phase (34.2% vs 39.3%, P<0.05 in senescent GES-1 cells transfected with L1-ORE2 siRNA vector than those transfected with negative control vector, while there was no obvious difference between normal GES-1 cells transfected with L1-ORF2 siRNA vector and negative control vector (P>0.05. P53 protein was expressed only in senescent GES-1 cell, while P21 protein was expressed in both normal and senescent GES-1 cells, and the latter had a higher expression level (P<0.05. The GES-1 cells transfected with L1-ORF2 siRNA vector showed lower expressions of P53 and P21 proteins than those transfected with negative control vector (P<0.05. Conclusions  L1-ORF2-siRNA vector could down-regulate the expression of L1-ORF2 protein in normal and senescent GES-1 cells and promote the proliferation of senescent GES-1 cells. P21 and P53 proteins participate in the process of L1-ORF2 regulating

  15. Expression of PD-L1 on canine tumor cells and enhancement of IFN-γ production from tumor-infiltrating cells by PD-L1 blockade.

    Directory of Open Access Journals (Sweden)

    Naoya Maekawa

    Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.

  16. Proteomic characterization of the outer membrane vesicle of the halophilic marine bacterium Novosphingobium pentaromativorans US6-1.

    Science.gov (United States)

    Yun, Sung Ho; Lee, Sang-Yeop; Choi, Chi-Won; Lee, Hayoung; Ro, Hyun-Joo; Jun, Sangmi; Kwon, Yong Min; Kwon, Kae Kyoung; Kim, Sang-Jin; Kim, Gun-Hwa; Kim, Seung Il

    2017-01-01

    Novosphingobium pentaromativorans US6-1 is a Gram-negative halophilic marine bacterium able to utilize several polycyclic aromatic hydrocarbons such as phenanthrene, pyrene, and benzo[a]pyrene. In this study, using transmission electron microscopy, we confirmed that N. pentaromativorans US6-1 produces outer membrane vesicles (OMVs). N. pentaromativorans OMVs (hereafter OMV Novo ) are spherical in shape, and the average diameter of OMV Novo is 25-70 nm. Proteomic analysis revealed that outer membrane proteins and periplasmic proteins of N. pentaromativorans are the major protein components of OMV Novo . Comparative proteomic analysis with the membrane-associated protein fraction and correlation analysis demonstrated that the outer membrane proteins of OMV Novo originated from the membrane- associated protein fraction. To the best of our knowledge, this study is the first to characterize OMV purified from halophilic marine bacteria.

  17. L1 effects on the processing of grammatical gender in L2

    NARCIS (Netherlands)

    Sabourin, L; Foster-Cohen, S.; Nizegorodcew, A.

    2001-01-01

    This paper explores L1 effects on the L2 off-line processing of Dutch (grammatical gender) agreement The L2 participants had either German, English or a Romance language as their L1. Non-gender agreement (finiteness and agreement) was tested to ascertain the level of proficiency of the participants

  18. Screening of Mutation High-Yielding Biocontrol Bacterium BJ1 by Ion Beam Irradiation and Effect of Controlling Fusarium oxysporum cucunerinum Disease

    International Nuclear Information System (INIS)

    Ma Shuang; Dong Xicun; Li Wenjian; Wang Jufang; Yu Lixia; Liu Jing

    2010-01-01

    BJ1 of Bacillus subtilis is an important biocontrol factor in control of fungus disease. In order to improve the antagonistic ability of the strain,and obtain high-efficiency strains, 12 C 6+ of different doses and linear energy transfer (LET) was used to irradiate the biocontrol bacterium BJ1. The optimum dose and LET of ion beam irradiation for the BJ1 are 200-400 Gy and 60 keV/μm,respectively. The antagonistic ability is increased by 2%-21%. The control effect of mutation to Fusarium oxysporum f. sp. cucunerinum is increased by 17.48% over that of BJ1, and mutation also has better plant growth-promoting effect. (authors)

  19. Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

    Science.gov (United States)

    Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

    2011-06-10

    The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. On the Link Between L1-PCA and ICA.

    Science.gov (United States)

    Martin-Clemente, Ruben; Zarzoso, Vicente

    2017-03-01

    Principal component analysis (PCA) based on L1-norm maximization is an emerging technique that has drawn growing interest in the signal processing and machine learning research communities, especially due to its robustness to outliers. The present work proves that L1-norm PCA can perform independent component analysis (ICA) under the whitening assumption. However, when the source probability distributions fulfil certain conditions, the L1-norm criterion needs to be minimized rather than maximized, which can be accomplished by simple modifications on existing optimal algorithms for L1-PCA. If the sources have symmetric distributions, we show in addition that L1-PCA is linked to kurtosis optimization. A number of numerical experiments illustrate the theoretical results and analyze the comparative performance of different algorithms for ICA via L1-PCA. Although our analysis is asymptotic in the sample size, this equivalence opens interesting new perspectives for performing ICA using optimal algorithms for L1-PCA with guaranteed global convergence while inheriting the increased robustness to outliers of the L1-norm criterion.

  1. Metabolic rate regulates L1 longevity in C. elegans.

    Directory of Open Access Journals (Sweden)

    Inhwan Lee

    Full Text Available Animals have to cope with starvation. The molecular mechanisms by which animals survive long-term starvation, however, are not clearly understood. When they hatch without food, C. elegans arrests development at the first larval stage (L1 and survives more than two weeks. Here we show that the survival span of arrested L1s, which we call L1 longevity, is a starvation response regulated by metabolic rate during starvation. A high rate of metabolism shortens the L1 survival span, whereas a low rate of metabolism lengthens it. The longer worms are starved, the slower they grow once they are fed, suggesting that L1 arrest has metabolic costs. Furthermore, mutants of genes that regulate metabolism show altered L1 longevity. Among them, we found that AMP-dependent protein kinase (AMPK, as a key energy sensor, regulates L1 longevity by regulating this metabolic arrest. Our results suggest that L1 longevity is determined by metabolic rate and that AMPK as a master regulator of metabolism controls this arrest so that the animals survive long-term starvation.

  2. Learners’ L1 Use in a Task-based Classroom

    DEFF Research Database (Denmark)

    Bao, Rui; Du, Xiangyun

    2015-01-01

    , but with only a very small amount oc- curring for off-task talk across tasks. L1 use mainly occurred in learners’ efforts to mediate completion of the tasks. The findings highlight the role of L1 in foreign language learning and suggest that L1 use is associated with a number of factors, such as task types......’ extensive L1 use and off-task talk. Informed by sociocultural theory, this study explored the extent to which L1s and their func- tions were used when performing tasks. The subjects were beginner-level lower-secondary school learners of Chinese. The data shows that learners have a high amount of L1 use...

  3. PD-L1 Expression Induced by the 2009 Pandemic Influenza A(H1N1 Virus Impairs the Human T Cell Response

    Directory of Open Access Journals (Sweden)

    Nuriban Valero-Pacheco

    2013-01-01

    Full Text Available PD-L1 expression plays a critical role in the impairment of T cell responses during chronic infections; however, the expression of PD-L1 on T cells during acute viral infections, particularly during the pandemic influenza virus (A(H1N1pdm09, and its effects on the T cell response have not been widely explored. We found that A(H1N1pdm09 virus induced PD-L1 expression on human dendritic cells (DCs and T cells, as well as PD-1 expression on T cells. PD-L1 expression impaired the T cell response against A(H1N1pdm09 by promoting CD8+ T cell death and reducing cytokine production. Furthermore, we found increased PD-L1 expression on DCs and T cells from influenza-infected patients from the first and second 2009 pandemic waves in Mexico City. PD-L1 expression on CD8+ T cells correlated inversely with T cell proportions in patients infected with A(H1N1pdm09. Therefore, PD-L1 expression on DCs and T cells could be associated with an impaired T cell response during acute infection with A(H1N1pdm09 virus.

  4. Genome Sequence of the Enterobacter mori Type Strain, LMG 25706, a Pathogenic Bacterium of Morus alba L. ▿

    Science.gov (United States)

    Zhu, Bo; Zhang, Guo-Qing; Lou, Miao-Miao; Tian, Wen-Xiao; Li, Bin; Zhou, Xue-Ping; Wang, Guo-Feng; Liu, He; Xie, Guan-Lin; Jin, Gu-Lei

    2011-01-01

    Enterobacter mori is a plant-pathogenic enterobacterium responsible for the bacterial wilt of Morus alba L. Here we present the draft genome sequence of the type strain, LMG 25706. To the best of our knowledge, this is the first genome sequence of a plant-pathogenic bacterium in the genus Enterobacter. PMID:21602328

  5. PODAAC-CYGNS-L1X20

    Data.gov (United States)

    National Aeronautics and Space Administration — This Level 1 (L1) dataset contains the Version 2.0 geo-located Delay Doppler Maps (DDMs) calibrated into Power Received (Watts) and Bistatic Radar Cross Section...

  6. Dicty_cDB: Contig-U16209-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 1 ( FJ393112 ) Uncultured Enterobacteriaceae bacterium clone MFC... 700 0.0 1 ( FJ268925 ) Uncultured Kleb...tia... 700 0.0 1 ( DQ852624 ) Klebsiella pneumoniae strain TM100 16S ribosomal ... 700 0.0 1 ( DQ837043 ) Enterobacteriaceae... bacterium p4s-5f 16S ribosomal... 700 0.0 1 ( DQ837041 ) Enterobacteriaceae bacterium p4f-5... 16S ribosomal ... 700 0.0 1 ( DQ520801 ) Enterobacteriaceae bacterium NR58 16S r... DQ379506 ) Klebsiella pneumoniae strain TSL-2 16S ribosomal ... 700 0.0 1 ( DQ313412 ) Enterobacteriaceae b

  7. Malignant Mesothelioma Effusions Are Infiltrated by CD3+ T Cells Highly Expressing PD-L1 and the PD-L1+ Tumor Cells within These Effusions Are Susceptible to ADCC by the Anti-PD-L1 Antibody Avelumab.

    Science.gov (United States)

    Khanna, Swati; Thomas, Anish; Abate-Daga, Daniel; Zhang, Jingli; Morrow, Betsy; Steinberg, Seth M; Orlandi, Augusto; Ferroni, Patrizia; Schlom, Jeffrey; Guadagni, Fiorella; Hassan, Raffit

    2016-11-01

    The functional aspects of programmed death 1 (PD-1) and PD ligand 1 (PD-L1) immune checkpoints in malignant mesothelioma have not been studied. Tumor samples from 65 patients with mesothelioma were evaluated for PD-L1 expression by immunohistochemistry, and its prognostic significance was examined. Malignant effusions from patients with pleural and peritoneal mesothelioma were evaluated for PD-1-positive and PD-L1-positive infiltrating lymphocytes and their role in inducing PD-L1 expression in tumor cells. Antibody-dependent cellular cytotoxicity (ADCC) of avelumab, a fully humanized immunoglobulin G1 anti PD-L1 antibody against primary mesothelioma cell lines, was evaluated in presence of autologous and allogeneic natural killer cells. Of 65 pleural and peritoneal mesothelioma tumors examined, 41 (63%) were PD-L1-positive, which was associated with slightly inferior overall survival compared to patients with PD-L1-negative tumors (median 23.0 versus 33.3 months, p = 0.35). The frequency of PD-L1 expression was similar in patients with pleural and peritoneal mesothelioma, with 62% and 64% of samples testing positive, respectively. In nine mesothelioma effusion samples evaluated, the fraction of cells expressing PD-L1 ranged from 12% to 83%. In seven patients with paired malignant effusion and peripheral blood mononuclear cell (PBMC) samples, PD-L1 expression was significantly higher on CD3-positive T cells present in malignant effusions as compared with PBMCs (p = 0.016). In addition, the numbers of CD14-positive PD-1-positive cells were increased in malignant effusions compared with PBMCs (p = 0.031). The lymphocytes present in malignant effusions recognized autologous tumor cells and induced interferon-γ-mediated PD-L1 expression on the tumor cell surface. Of the three primary mesothelioma cell lines tested, two were susceptible to avelumab-mediated ADCC in the presence of autologous natural killer cells. Most pleural as well as peritoneal mesotheliomas

  8. Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Jinlan; Li, Xiaolu [State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Peking Union Medical College, Tsinghua University, Beijing 100005, People' s Republic of China (China); Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People' s Republic of China (China); Feng, Yue; Zhang, Bo [Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People' s Republic of China (China); Miao, Shiying [State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Peking Union Medical College, Tsinghua University, Beijing 100005, People' s Republic of China (China); Wang, Linfang, E-mail: lfwangz@yahoo.com [State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Peking Union Medical College, Tsinghua University, Beijing 100005, People' s Republic of China (China); Wang, Na, E-mail: nawang@tsinghua.edu.cn [Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People' s Republic of China (China)

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGE after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .

  9. Dasatinib inhibits the growth and survival of neoplastic human eosinophils (EOL-1) through targeting of FIP1L1-PDGFRalpha.

    Science.gov (United States)

    Baumgartner, Christian; Gleixner, Karoline V; Peter, Barbara; Ferenc, Veronika; Gruze, Alexander; Remsing Rix, Lily L; Bennett, Keiryn L; Samorapoompichit, Puchit; Lee, Francis Y; Pickl, Winfried F; Esterbauer, Harald; Sillaber, Christian; Superti-Furga, Giulio; Valent, Peter

    2008-10-01

    Chronic eosinophilic leukemia (CEL) is a myeloproliferative disorder characterized by molecular and/or cytogenetic evidence of clonality of eosinophils, marked eosinophilia, and organ damage. In many patients, the transforming mutation FIP1L1-PDGFRalpha and the related CHIC2 deletion are found. The respective oncoprotein, FIP1L1-PDGFRalpha, is considered to play a major role in malignant cell growth in CEL. The tyrosine kinase (TK) inhibitor imatinib (STI571) has been described to counteract the TK activity of FIP1L1-PDGFRalpha in most patients. However, not all patients with CEL show a response to imatinib. Therefore, several attempts have been made to identify other TK inhibitors that counteract growth of neoplastic eosinophils. We provide evidence that dasatinib, a multi-targeted kinase inhibitor, blocks the growth and survival of EOL-1, an eosinophil leukemia cell line carrying FIP1L1-PDGFRalpha. The effects of dasatinib on proliferation of EOL-1 cells were dose-dependent, with an IC50 of 0.5 to 1 nM, which was found to be in the same range when compared to IC50 values produced with imatinib. Dasatinib was also found to induce apoptosis in EOL-1 cells in a dose-dependent manner (IC50: 1-10 nM). The apoptosis-inducing effects of dasatinib on EOL-1 cells were demonstrable by light microscopy, flow cytometry, and in a TUNEL assay. In Western blot experiments, dasatinib completely blocked the phosphorylation of FIP1L1-PDGFRalpha in EOL-1 cells. Dasatinib inhibits the growth of leukemic eosinophils through targeting of the disease-related oncoprotein FIP1L1-PDGFRalpha. Based on this observation, dasatinib may be considered as a new interesting treatment option for patients with CEL.

  10. Metacognitive Online Reading Strategy Use: Readers' Perceptions in L1 and L2

    Science.gov (United States)

    Taki, Saeed

    2016-01-01

    This study aimed to explore whether first-language (L1) readers of different language backgrounds would employ similar metacognitive online reading strategies and whether reading online in a second language (L2) could be influenced by L1 reading strategies. To this end, 52 Canadian college students as English L1 readers and 38 Iranian university…

  11. Facile synthesis of cyclopentenone B1- and L1-type Phytoprostanes

    Directory of Open Access Journals (Sweden)

    Alexandre eGuy

    2015-07-01

    Full Text Available Phytoprostanes (PhytoPs represent non-enzymatic metabolites of α-linolenic acid (ALA, the essential omega-3 polyunsaturated fatty acid (PUFA derived from plants. PhytoPs are present in the plant kingdom and represent endogenous mediators capable of protecting cells from oxidative stress damages in plants. Recently, it was found that such metabolites are present in cooking oil in high quantities, and also that B1-PhytoPs protect immature neurons from oxidant injury and promote differentiation of oligodendrocyte progenitors through PPAR-γ activation. We report a novel and facile synthesis of natural 2,3-substituted cyclopentenone PhytoPs, 16-B1-PhytoP and 9-L1-PhytoP. Our strategy is based on reductive alkylation at the 2-position of 1,3-cyclopentanedione using a recent protocol developed by Ramachary et al., and on a cross-coupling metathesis to access conjugate dienone system. In conclusion, this strategy permitted access to B1- and L1-PhytoPs in a relative short sequence process, and afford the possibility to easily develop analogs of PhytoPs.

  12. Anti-tumor immunotherapy by blockade of the PD-1/PD-L1 pathway with recombinant human PD-1-IgV.

    Science.gov (United States)

    Zhang, C; Wu, S; Xue, X; Li, M; Qin, X; Li, W; Han, W; Zhang, Y

    2008-01-01

    Blockade of the programmed death-1 (PD-1)/PD-ligand 1 (PD-L1) pathway can delay tumor growth and prolong the survival of tumor-bearing mice. The extracellular immunoglobulin (Ig) V domain of PD-1 is important for the interaction between PD-1 and PD-L1, suggesting that PD-1-IgV may be a potential target for anti-tumor immunotherapy. The extracellular sequence of human PD-1-IgV (hPD-1-IgV) was expressed in Escherichia coli and purified. The anti-tumor effect of hPD-1-IgV on tumor-bearing mice was tested. hPD-1-IgV recombinant protein could bind PD-L1 at molecular and cellular levels and enhance Cytotoxic T Lymphocyte (CTL) activity and anti-tumor effect on tumor-bearing mice in vivo. The percentage of CD4(+)CD25(+) T cells in tumor-bearing mice was decreased compared with control mice after administration of the recombinant protein. Our results suggest that inhibition of the interaction between PD-1 and PD-L1 by hPD-1-IgV may be a promising strategy for specific tumor immunotherapy.

  13. 40 CFR 721.4575 - L-aspartic acid, N,N′- [(1E) - 1,2 - ethenediylbis[(3-sulfo-4, 1-phenylene)imino [6-(phenylamino...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false L-aspartic acid, N,Nâ²- [(1E) - 1,2... Substances § 721.4575 L-aspartic acid, N,N′- [(1E) - 1,2 - ethenediylbis[(3-sulfo-4, 1-phenylene)imino [6... uses subject to reporting. (1) The chemical substance identified as l-aspartic acid, N,N′- [(1E) - 1,2...

  14. Clostridium scatologenes strain SL1 isolated as an acetogenic bacterium from acidic sediments.

    Science.gov (United States)

    Küsel, K; Dorsch, T; Acker, G; Stackebrandt, E; Drake, H L

    2000-03-01

    A strictly anaerobic, H2-utilizing bacterium, strain SL1, was isolated from the sediment of an acidic coal mine pond. Cells of strain SL1 were sporulating, motile, long rods with a multilayer cell wall. Growth was observed at 5-35 degrees C and pH 3.9-7.0. Acetate was the sole end product of H2 utilization and was produced in stoichiometries indicative of an acetyl-CoA-pathway-dependent metabolism. Growth and substrate utilization also occurred with CO/CO2, vanillate, syringate, ferulate, ethanol, propanol, 1-butanol, glycerine, cellobiose, glucose, fructose, mannose, xylose, formate, lactate, pyruvate and gluconate. With most substrates, acetate was the main or sole product formed. Growth in the presence of H2/CO2 or CO/CO2 was difficult to maintain in laboratory cultures. Methoxyl, carboxyl and acrylate groups of various aromatic compounds were O-demethylated, decarboxylated and reduced, respectively. Small amounts of butyrate were produced during the fermentation of sugars. The acrylate group of ferulate was reduced. Nitrate, sulfate, thiosulfate, dimethylsulfoxide and Fe(III) were not utilized as electron acceptors. Analysis of the 16S rRNA gene sequence of strain SL1 demonstrated that it is closely related to Clostridium scatologenes (99.6% sequence similarity), an organism characterized as a fermentative anaerobe but not previously shown to be capable of acetogenic growth. Comparative experiments with C. scatologenes DSM 757T demonstrated that it utilized H2/CO2 (negligible growth), CO/CO2 (negligible growth), formate, ethanol and aromatic compounds according to stoichiometries indicative of the acetyl-CoA pathway. CO dehydrogenase, formate dehydrogenase and hydrogenase activities were present in both strain SL1 and C. scatologenes DSM 757T. These results indicate that (i) sediments of acidic coal mine ponds harbour acetogens and (ii) C. scatologenes is an acetogen that tends to lose its capacity to grow acetogenically under H2/CO2 or CO/CO2 after prolonged

  15. Denitrifying metabolism of the methylotrophic marine bacterium Methylophaga nitratireducenticrescens strain JAM1.

    Science.gov (United States)

    Mauffrey, Florian; Cucaita, Alexandra; Constant, Philippe; Villemur, Richard

    2017-01-01

    Methylophaga nitratireducenticrescens strain JAM1 is a methylotrophic, marine bacterium that was isolated from a denitrification reactor treating a closed-circuit seawater aquarium. It can sustain growth under anoxic conditions by reducing nitrate ([Formula: see text]) to nitrite ([Formula: see text]). These physiological traits are attributed to gene clusters that encode two dissimilatory nitrate reductases (Nar). Strain JAM1 also contains gene clusters encoding two nitric oxide (NO) reductases and one nitrous oxide (N 2 O) reductase, suggesting that NO and N 2 O can be reduced by strain JAM1. Here we characterized further the denitrifying activities of M. nitratireducenticrescens JAM1. Series of oxic and anoxic cultures of strain JAM1 were performed with N 2 O, [Formula: see text] or sodium nitroprusside, and growth and N 2 O, [Formula: see text], [Formula: see text] and N 2 concentrations were measured. Ammonium ([Formula: see text])-free cultures were also tested to assess the dynamics of N 2 O, [Formula: see text] and [Formula: see text]. Isotopic labeling of N 2 O was performed in 15 NH 4 + -amended cultures. Cultures with the JAM1Δ narG1narG2 double mutant were performed to assess the involvement of the Nar systems on N 2 O production. Finally, RT-qPCR was used to measure the gene expression levels of the denitrification genes cytochrome bc -type nitric oxide reductase ( cnorB1 and cnorB2 ) and nitrous oxide reductase ( nosZ ), and also nnrS and norR that encode NO-sensitive regulators. Strain JAM1 can reduce NO to N 2 O and N 2 O to N 2 and can sustain growth under anoxic conditions by reducing N 2 O as the sole electron acceptor. Although strain JAM1 lacks a gene encoding a dissimilatory [Formula: see text] reductase, [Formula: see text]-amended cultures produce N 2 O, representing up to 6% of the N-input. [Formula: see text] was shown to be the key intermediate of this production process. Upregulation in the expression of c norB1 , cnorB2, nnrS and nor

  16. Cold storage of liver microorgans in ViaSpan and BG35 solutions: study of ammonia metabolism during normothermic reoxygenation.

    Science.gov (United States)

    Pizarro, María Dolores; Mediavilla, María Gabriela; Berardi, Florencia; Tiribelli, Claudio; Rodríguez, Joaquín V; Mamprin, María Eugenia

    2014-01-01

    This work focuses on ammonia metabolism of Liver Microorgans (LMOs) after cold preservation in a normothermic reoxygenation system (NRS). We have previously reported the development of a novel preservation solution, Bes-Gluconate-PEG 35 kDa (BG35) that showed the same efficacy as ViaSpan to protect LMOs against cold preservation injury. The objective of this work was to study mRNA levels and activities of two key Urea Cycle enzymes, Carbamyl Phosphate Synthetase I (CPSI) and Ornithine Transcarbamylase (OTC), after preservation of LMOs in BG35 and ViaSpan and the ability of these tissue slices to detoxify an ammonia overload in a NRS model. After 48 h of cold storage (0°C in BG35 or ViaSpan) LMOs were rewarmed in KHR containing an ammonium chloride overload (1 mM). We determined ammonium detoxification capacity (ADC), urea synthesis and enzyme activities and relative mRNA levels for CPSI and OTC. At the end of reoxygenation LMOs cold preserved in BG35 have ADC and urea synthesis similar to controls. ViaSpan group demonstrated a lower capacity to detoxify ammonia and to synthesize urea than fresh LMOs during the whole reoxygenation period which correlated with the lower mRNA levels and activities for CPSI and OTC observed for this group. We demonstrate that our preservation conditions (48 hours, BG35 solution, anoxia, 0ºC) did not affect ammonia metabolism of cold preserved LMOs maintaining the physiological and biochemical liver functions tested, which allows their future use as biological component of a BAL system.

  17. Measurements of the Total-Cross-Section Difference ΔσL(np) at 1.39, 1.69, 1.89, and 1.99 GeV

    International Nuclear Information System (INIS)

    Sharov, V.I.; Anischenko, N.G.; Averichev, S.A.; Bartenev, V.D.; Blinov, N.A.; Borzunov, Yu.T.; Chernykh, E.V.; Chumakov, V.F.; Dolgii, S.A.; Fimushkin, V.V.; Golovanov, L.B.; Kirillov, A.D.; Komogorov, E.V.; Kovalenko, A.D.; Krasnov, V.A.; Ladygin, V.P.; Liburg, M.Yu.; Livanov, A.N.; Maniakov, P.K.; Matyushevsky, E.A.

    2005-01-01

    New accurate data of the neutron-proton spin-dependent total-cross-section difference Δσ L (np) at the neutron-beam kinetic energies 1.39, 1.69, 1.89, and 1.99 GeV are presented. In general, these data complete the measurements of energy dependence of Δσ L (np) over the Dubna Synchrophasotron energy region. Measurements were carried out at the Synchrophasotron of the Veksler and Baldin Laboratory of High Energies of the Joint Institute for Nuclear Research. The quasi-monochromatic neutron beam was produced by breakup of extracted polarized deuterons. The deuteron (and hence neutron) polarization direction was flipped every accelerator burst. The initial transverse (with respect to beam momentum) neutron polarization was changed to a longitudinal one and longitudinally polarized neutrons were transmitted through the large proton longitudinally polarized target. The target polarization direction was inverted after one to two days of measurements. Four different combinations of the beam and target parallel and antiparallel polarization directions, both oriented along the neutron-beam momentum, were used at each energy. A fast decrease in -Δσ L (np) with increasing energy above 1.1 GeV and a structure in the energy dependence around 1.8 GeV, first observed from our previous data, seem to be well revealed. The new results are also compared with model predictions and with phase-shift analysis fits. The Δσ L quantities for isosinglet state I = 0, deduced from the measured Δσ L (np) values and known Δσ L (pp) data, are also given. The results of the measurements of unpolarized total cross sections σ 0tot (np) at 1.3, 1.4, and 1.5 GeV and σ 0tot (nC) at 1.4 and 1.5 GeV are presented as well. These data were obtained using the same apparatus and high-intensity unpolarized deuteron beams extracted either from the Synchrophasotron or from the Nuclotron

  18. Maladaptive synaptic plasticity in L-DOPA-induced dyskinesia

    Directory of Open Access Journals (Sweden)

    Qiang Wang

    2016-12-01

    Full Text Available The emergence of L-DOPA-induced dyskinesia (LID in patients with Parkinson disease (PD could be due to maladaptive plasticity of corticostriatal synapses in response to L-DOPA treatment. A series of recent studies has revealed that LID is associated with marked morphological plasticity of striatal dendritic spines, particularly cell type-specific structural plasticity of medium spiny neurons (MSNs in the striatum. In addition, evidence demonstrating the occurrence of plastic adaptations, including aberrant morphological and functional features, in multiple components of cortico-basal ganglionic circuitry, such as primary motor cortex (M1 and basal ganglia (BG output nuclei. These adaptations have been implicated in the pathophysiology of LID. Here, we briefly review recent studies that have addressed maladaptive plastic changes within the cortico-BG loop in dyskinetic animal models of PD and patients with PD.

  19. GLI ERRORI DI ITALIANO L1 ED L2: INTERFERENZA E APPRENDIMENTO

    Directory of Open Access Journals (Sweden)

    Rosaria Solarino

    2011-02-01

    Full Text Available Si può oggi affrontare il tema degli errori di italiano da una prospettiva che possa giovare contemporaneamente a docenti di italiano L1 ed L2? Noi pensiamo di sì: la ricerca glottodidattica sembra aver ormai apprestato un terreno comune alle due situazioni di apprendimento, sgombrando il campo da vecchi pregiudizi e distinzioni che appaiono ormai superate. Attraverso la contrapposizione di concetti quali “lingua parlata/lingua scritta”,  “errori di lingua / errori di linguaggio”, “apprendimento spontaneo/apprendimento guidato”, “italiano L1/italiano L2”, “errori di apprendimento/errori di interferenza, si indicano diversi criteri per la interpretazione degli errori e la loro valutazione in relazione alle cause, alle situazioni comunicative, ai contesti o allo stadio di evoluzione dell’apprendimento della lingua.     Errors in italian L1 and L2: interference and learning   Can errors in Italian be approached in a way that benefits both L1 and L2 Italian teachers? We believe so: glottodidactic research seems to have prepared a common terrain for these two learning situations, clearing the field of old prejudices and obsolete distinctions.  Through the juxtaposition of concepts like “spoken language/written language”, “language errors/speech errors”, “spontaneous learning/guided learning”, “L1 Italian/L2 Italian”, “learning errors/interference errors”, different criteria for interpreting errors and evaluating them in relation to their causes, to communicative situations, to contexts and the developmental state in learning a language are singled out.

  20. Near infrared photoimmunotherapy with avelumab, an anti-programmed death-ligand 1 (PD-L1) antibody

    OpenAIRE

    Nagaya, Tadanobu; Nakamura, Yuko; Sato, Kazuhide; Harada, Toshiko; Choyke, Peter L.; Hodge, James W.; Schlom, Jeffrey; Kobayashi, Hisataka

    2016-01-01

    Near Infrared-Photoimmunotherapy (NIR-PIT) is a highly selective tumor treatment that employs an antibody-photo-absorber conjugate (APC). Programmed cell death protein-1 ligand (PD-L1) is emerging as a molecular target. Here, we describe the efficacy of NIR-PIT, using fully human IgG1 anti-PD-L1 monoclonal antibody (mAb), avelumab, conjugated to the photo-absorber, IR700DX, in a PD-L1 expressing H441 cell line, papillary adenocarcinoma of lung. Avelumab-IR700 showed specific binding and cell-...

  1. L-1 constraint in Liouville gravity

    International Nuclear Information System (INIS)

    Kitazawa, Y.

    1992-01-01

    In this paper, the authors study recursion relations among the amplitudes which involve discrete states in c = 1 Liouville gravity on the sphere. The authors find that the spin J = 1/2 discrete state gives rise to the L -1 type recursion relation. Multiple point correlation functions are determined recursively from fewer point functions by this recursion relation. The authors further point out that the analogs of J = 1/2 state exist in c -1 type recursion relation

  2. Antimicrobial polyketide furanoterpenoids from seaweed-associated heterotrophic bacterium Bacillus subtilis MTCC 10403.

    Science.gov (United States)

    Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna

    2017-10-01

    Brown seaweed Anthophycus longifolius (Turner) Kützing (family Sargassaceae) associated heterotrophic bacterium Bacillus subtilis MTCC 10403 was found to be a potent isolate with broad range of antibacterial activity against important perceptive food pathogens Vibrio parahaemolyticus, V. vulnificus, and Aeromonas hydrophila. This bacterium was positive for polyketide synthetase gene (KC589397), and therefore, was selected to bioprospect specialized metabolites bearing polyketide backbone. Bioactivity-guided chromatographic fractionation of the ethyl acetate extract of the seaweed-associated bacterium segregated four homologous polyketide furanoterpenoids with potential antibacterial activities against clinically important pathogens. The minimum inhibitory concentration (MIC) assay showed that the referral antibiotics tetracycline and ampicillin were active at 25 μg/mL against the test pathogens, whereas the previously undescribed (4E)-methyl 13-((16-(furan-2-yl) ethyl)-octahydro-7-hydroxy-4-((E)-23-methylbut-21-enyl)-2H-chromen-6-yl)-4-methylpent-4-enoate (compound 1) and methyl 3-(hexahydro-9-((E)-3-methylpent-1-enyl)-4H-furo[3,2-g]isochromen-6-yl) propanoate (compound 3) displayed antibacterial activities against the test pathogens at a lesser concentration (MIC subtilis MTCC 10403 demonstrated to represent a potential source of antimicrobial polyketides for pharmaceutical applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The neural cell adhesion molecule L1 plays important roles in neuronal migration and survival, neuritogenesis and synaptogenesis. L1 has also been found in tumors of different origins, with levels of L1 expression correlating positively with the metastatic potential of tumors. To select antibodies targeting the varied functions of L1, we screened the Tomlinson library of recombinant human antibody fragments to identify antibodies binding to recombinant human L1 protein comprising the entire extracellular domain of human L1. We obtained four L1 binding single-chain variable fragment antibodies (scFvs, named I4, I6, I13, and I27 and showed by enzyme-linked immunosorbent assay (ELISA that scFvs I4 and I6 have high affinity to the immunoglobulin-like (Ig domains 1-4 of L1, while scFvs I13 and I27 bind strongly to the fibronectin type III homologous (Fn domains 1-3 of L1. Application of scFvs I4 and I6 to human SK-N-SH neuroblastoma cells reduced proliferation and transmigration of these cells. Treatment of SK-N-SH cells with scFvs I13 and I27 enhanced cell proliferation and migration, neurite outgrowth, and protected against the toxic effects of H(2O(2 by increasing the ratio of Bcl-2/Bax. In addition, scFvs I4 and I6 inhibited and scFvs I13 and I27 promoted phosphorylation of src and Erk. Our findings indicate that scFvs reacting with the immunoglobulin-like domains 1-4 inhibit L1 functions, whereas scFvs interacting with the fibronectin type III domains 1-3 trigger L1 functions of cultured neuroblastoma cells.

  4. Bacteriophage GC1, a Novel Tectivirus Infecting Gluconobacter Cerinus, an Acetic Acid Bacterium Associated with Wine-Making

    Directory of Open Access Journals (Sweden)

    Cécile Philippe

    2018-01-01

    Full Text Available The Gluconobacter phage GC1 is a novel member of the Tectiviridae family isolated from a juice sample collected during dry white wine making. The bacteriophage infects Gluconobacter cerinus, an acetic acid bacterium which represents a spoilage microorganism during wine making, mainly because it is able to produce ethyl alcohol and transform it into acetic acid. Transmission electron microscopy revealed tail-less icosahedral particles with a diameter of ~78 nm. The linear double-stranded DNA genome of GC1 (16,523 base pairs contains terminal inverted repeats and carries 36 open reading frames, only a handful of which could be functionally annotated. These encode for the key proteins involved in DNA replication (protein-primed family B DNA polymerase as well as in virion structure and assembly (major capsid protein, genome packaging ATPase (adenosine triphosphatase and several minor capsid proteins. GC1 is the first tectivirus infecting an alphaproteobacterial host and is thus far the only temperate tectivirus of gram-negative bacteria. Based on distinctive sequence and life-style features, we propose that GC1 represents a new genus within the Tectiviridae, which we tentatively named “Gammatectivirus”. Furthermore, GC1 helps to bridge the gap in the sequence space between alphatectiviruses and betatectiviruses.

  5. Dual enzymatic dynamic kinetic resolution by Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase and Candida antarctica lipase B

    KAUST Repository

    Karume, Ibrahim

    2016-10-04

    The immobilization of Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase (TeSADH) using sol–gel method enables its use to racemize enantiopure alcohols in organic media. Here, we report the racemization of enantiopure phenyl-ring-containing secondary alcohols using xerogel-immobilized W110A TeSADH in hexane rather than the aqueous medium required by the enzyme. We further showed that this racemization approach in organic solvent was compatible with Candida antarctica lipase B (CALB)-catalyzed kinetic resolution. This compatibility, therefore, allowed a dual enzymatic dynamic kinetic resolution of racemic alcohols using CALB-catalyzed kinetic resolution and W110A TeSADH-catalyzed racemization of phenyl-ring-containing alcohols.

  6. Draft Genome Sequence of the Sulfate-Reducing Bacterium Desulfotomaculum copahuensis Strain CINDEFI1 Isolated from the Geothermal Copahue System, Neuquén, Argentina.

    Science.gov (United States)

    Willis Poratti, Graciana; Yaakop, Amira Suriaty; Chan, Chia Sing; Urbieta, M Sofía; Chan, Kok-Gan; Ee, Robson; Tan-Guan-Sheng, Adrian; Goh, Kian Mau; Donati, Edgardo R

    2016-08-18

    Desulfotomaculum copahuensis strain CINDEFI1 is a novel spore-forming sulfate-reducing bacterium isolated from the Copahue volcano area, Argentina. Here, we present its draft genome in which we found genes related with the anaerobic respiration of sulfur compounds similar to those present in the Copahue environment. Copyright © 2016 Willis Poratti et al.

  7. Factors associated with nocturnal hypoglycemia in at-risk adolescents and young adults with type 1 diabetes.

    Science.gov (United States)

    Wilson, Darrell M; Calhoun, Peter M; Maahs, David M; Chase, H Peter; Messer, Laurel; Buckingham, Bruce A; Aye, Tandy; Clinton, Paula K; Hramiak, Irene; Kollman, Craig; Beck, Roy W

    2015-06-01

    Hypoglycemia remains an impediment to good glycemic control, with nocturnal hypoglycemia being particularly dangerous. Information on major contributors to nocturnal hypoglycemia remains critical for understanding and mitigating risk. Continuous glucose monitoring (CGM) data for 855 nights were studied, generated by 45 subjects 15-45 years of age with hemoglobin A1c (HbA1c) levels of ≤8.0% who participated in a larger randomized study. Factors assessed for potential association with nocturnal hypoglycemia (CGM measurement of <60 mg/dL for ≥30 min) included bedtime blood glucose (BG), exercise intensity, bedtime snack, insulin on board, day of the week, previous daytime hypoglycemia, age, gender, HbA1c level, diabetes duration, daily basal insulin, and daily insulin dose. Hypoglycemia occurred during 221 of 885 (25%) nights and was more frequent with younger age (P<0.001), lower HbA1c levels (P=0.006), medium/high-intensity exercise during the preceding day (P=0.003), and the occurrence of antecedent daytime hypoglycemia (P=0.001). There was a trend for lower bedtime BG levels to be associated with more frequent nocturnal hypoglycemia (P=0.10). Bedtime snack, before bedtime insulin bolus, weekend versus weekday, gender, and daily basal and bolus insulin were not associated with nocturnal hypoglycemia. Awareness that HbA1c level, exercise, bedtime BG level, and daytime hypoglycemia are all modifiable factors associated with nocturnal hypoglycemia may help patients and providers decrease the risk of hypoglycemia at night. Risk for nocturnal hypoglycemia increased in a linear fashion across the range of variables, with no clear-cut thresholds to guide clinicians or patients for any particular night.

  8. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  9. Evidence from adult L1 Afrikaans L2 French

    African Journals Online (AJOL)

    results of this study show that a large number of the L2 learners had indeed acquired ... position in V2-languages (such as German) and in third position in non-V2 ... L1, allows construction types x and y but he will have no problem acquiring .... Modern Foreign Languages at Stellenbosch University at the time of testing.

  10. BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data

    Science.gov (United States)

    Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel

    2012-01-01

    BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310

  11. BG7: a new approach for bacterial genome annotation designed for next generation sequencing data.

    Directory of Open Access Journals (Sweden)

    Pablo Pareja-Tobes

    Full Text Available BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version - which is developed in Java, takes advantage of Amazon Web Services (AWS cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future.

  12. The Influence of Schema and Cultural Difference on L1 and L2 Reading

    Science.gov (United States)

    Yang, Shi-sheng

    2010-01-01

    Reading in L1 shares numerous basic elements with reading in L2, and the processes also differ greatly. Intriguing questions involve whether there are two parallel cognitive processes at work, or whether there are processing strategies that accommodate both L1 and L2. This paper examines how reading in L1 is different from and similar to reading…

  13. Denitrifying metabolism of the methylotrophic marine bacterium Methylophaga nitratireducenticrescens strain JAM1

    Directory of Open Access Journals (Sweden)

    Florian Mauffrey

    2017-11-01

    Full Text Available Background Methylophaga nitratireducenticrescens strain JAM1 is a methylotrophic, marine bacterium that was isolated from a denitrification reactor treating a closed-circuit seawater aquarium. It can sustain growth under anoxic conditions by reducing nitrate ( ${\\mathrm{NO}}_{3}^{-}$ NO 3 − to nitrite ( ${\\mathrm{NO}}_{2}^{-}$ NO 2 − . These physiological traits are attributed to gene clusters that encode two dissimilatory nitrate reductases (Nar. Strain JAM1 also contains gene clusters encoding two nitric oxide (NO reductases and one nitrous oxide (N2O reductase, suggesting that NO and N2O can be reduced by strain JAM1. Here we characterized further the denitrifying activities of M. nitratireducenticrescens JAM1. Methods Series of oxic and anoxic cultures of strain JAM1 were performed with N2O, ${\\mathrm{NO}}_{3}^{-}$ NO 3 − or sodium nitroprusside, and growth and N2O, ${\\mathrm{NO}}_{3}^{-}$ NO 3 − , ${\\mathrm{NO}}_{2}^{-}$ NO 2 − and N2 concentrations were measured. Ammonium ( ${\\mathrm{NH}}_{4}^{+}$ NH 4 + -free cultures were also tested to assess the dynamics of N2O, ${\\mathrm{NO}}_{3}^{-}$ NO 3 − and ${\\mathrm{NO}}_{2}^{-}$ NO 2 − . Isotopic labeling of N2O was performed in 15NH4+-amended cultures. Cultures with the JAM1ΔnarG1narG2 double mutant were performed to assess the involvement of the Nar systems on N2O production. Finally, RT-qPCR was used to measure the gene expression levels of the denitrification genes cytochrome bc-type nitric oxide reductase (cnorB1 and cnorB2 and nitrous oxide reductase (nosZ, and also nnrS and norR that encode NO-sensitive regulators. Results Strain JAM1 can reduce NO to N2O and N2O to N2 and can sustain growth under anoxic conditions by reducing N2O as the sole electron acceptor. Although strain JAM1 lacks a gene encoding a dissimilatory ${\\mathrm{NO}}_{2}^{-}$ NO 2 − reductase, ${\\mathrm{NO}}_{3}^{-}$ NO 3 − -amended cultures produce N2O, representing up to 6% of the N

  14. L-DOPA is an endogenous ligand for OA1.

    Directory of Open Access Journals (Sweden)

    Vanessa M Lopez

    2008-09-01

    Full Text Available Albinism is a genetic defect characterized by a loss of pigmentation. The neurosensory retina, which is not pigmented, exhibits pathologic changes secondary to the loss of pigmentation in the retina pigment epithelium (RPE. How the loss of pigmentation in the RPE causes developmental defects in the adjacent neurosensory retina has not been determined, but offers a unique opportunity to investigate the interactions between these two important tissues. One of the genes that causes albinism encodes for an orphan GPCR (OA1 expressed only in pigmented cells, including the RPE. We investigated the function and signaling of OA1 in RPE and transfected cell lines. Our results indicate that OA1 is a selective L-DOPA receptor, with no measurable second messenger activity from two closely related compounds, tyrosine and dopamine. Radiolabeled ligand binding confirmed that OA1 exhibited a single, saturable binding site for L-DOPA. Dopamine competed with L-DOPA for the single OA1 binding site, suggesting it could function as an OA1 antagonist. OA1 response to L-DOPA was defined by several common measures of G-protein coupled receptor (GPCR activation, including influx of intracellular calcium and recruitment of beta-arrestin. Further, inhibition of tyrosinase, the enzyme that makes L-DOPA, resulted in decreased PEDF secretion by RPE. Further, stimulation of OA1 in RPE with L-DOPA resulted in increased PEDF secretion. Taken together, our results illustrate an autocrine loop between OA1 and tyrosinase linked through L-DOPA, and this loop includes the secretion of at least one very potent retinal neurotrophic factor. OA1 is a selective L-DOPA receptor whose downstream effects govern spatial patterning of the developing retina. Our results suggest that the retinal consequences of albinism caused by changes in melanin synthetic machinery may be treated by L-DOPA supplementation.

  15. Gene calling and bacterial genome annotation with BG7.

    Science.gov (United States)

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  16. NCBI nr-aa BLAST: CBRC-EEUR-01-0292 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-EEUR-01-0292 ref|ZP_01453909.1| Abortive infection protein [Thermoanaerobacter... ethanolicus X514] gb|EAU58431.1| Abortive infection protein [Thermoanaerobacter ethanolicus X514] ZP_01453909.1 0.40 36% ...

  17. Increase of cells expressing PD-L1 in bovine leukemia virus infection and enhancement of anti-viral immune responses in vitro via PD-L1 blockade

    Directory of Open Access Journals (Sweden)

    Ikebuchi Ryoyo

    2011-09-01

    Full Text Available Abstract The inhibitory receptor programmed death-1 (PD-1 and its ligand, programmed death-ligand 1 (PD-L1 are involved in immune evasion mechanisms for several pathogens causing chronic infections. Blockade of the PD-1/PD-L1 pathway restores anti-virus immune responses, with concomitant reduction in viral load. In a previous report, we showed that, in bovine leukemia virus (BLV infection, the expression of bovine PD-1 is closely associated with disease progression. However, the functions of bovine PD-L1 are still unknown. To investigate the role of PD-L1 in BLV infection, we identified the bovine PD-L1 gene, and examined PD-L1 expression in BLV-infected cattle in comparison with uninfected cattle. The deduced amino acid sequence of bovine PD-L1 shows high homology to the human and mouse PD-L1. The proportion of PD-L1 positive cells, especially among B cells, was upregulated in cattle with the late stage of the disease compared to cattle at the aleukemic infection stage or uninfected cattle. The proportion of PD-L1 positive cells correlated positively with prediction markers for the progression of the disease such as leukocyte number, virus load and virus titer whilst on the contrary, it inversely correlated with the degree of interferon-gamma expression. Blockade of the PD-1/PD-L1 pathway in vitro by PD-L1-specific antibody upregulated the production of interleukin-2 and interferon-gamma, and correspondingly, downregulated the BLV provirus load and the proportion of BLV-gp51 expressing cells. These data suggest that PD-L1 induces immunoinhibition in disease progressed cattle during chronic BLV infection. Therefore, PD-L1 would be a potential target for developing immunotherapies against BLV infection.

  18. Dialogic spaces of knowledge construction in research article Conclusion sections written by English L1, English L2 and Spanish L1 writers

    Directory of Open Access Journals (Sweden)

    Elena Sheldon

    2018-04-01

    Full Text Available While vast research efforts have been directed to the identification of moves and their constituent steps in research articles (RA, less attention has been paid to the social negotiation of knowledge, in particular in the Conclusion section of RAs. In this paper, I examine the Conclusion sections of RAs in English and Spanish, including RA Conclusions written in English by Spanish-background speakers in the field of applied linguistics. This study brings together two complementary frameworks, genre-based knowledge and evaluative stance, drawing on Swales’s (1990, 2004 move analysis framework and on the engagement system in Martin and White’s (2005 Appraisal framework. The results indicate that the English L1 group negotiates a consistent space for readers to approve or disapprove the writers’ propositions. However, the Spanish L1 group aligns with readers, using a limited space through contracting resources, which may be because this group addresses a smaller audience in comparison to the English L1 group which addresses an international readership. On the other hand, the English L2 group tends to move towards English rhetorical international practice, but without fully abandoning their SpL1. These results contribute to gaining a better understanding of how successful scholarly writing in English is achieved, and offers important insights for teaching multilingual researchers.

  19. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Jan Winchenbach

    2016-12-01

    Full Text Available Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.

  20. Heart rate informed artificial pancreas system enhances glycemic control during exercise in adolescents with T1D.

    Science.gov (United States)

    DeBoer, Mark D; Cherñavvsky, Daniel R; Topchyan, Katarina; Kovatchev, Boris P; Francis, Gary L; Breton, Marc D

    2017-11-01

    To evaluate the safety and performance of using a heart rate (HR) monitor to inform an artificial pancreas (AP) system during exercise among adolescents with type 1 diabetes (T1D). In a randomized, cross-over trial, adolescents with T1D age 13 - 18 years were enrolled to receive on separate days either the unmodified UVa AP (stdAP) or an AP system connected to a portable HR monitor (AP-HR) that triggered an exercise algorithm for blood glucose (BG) control. During admissions participants underwent a structured exercise regimen. Hypoglycemic events and CGM tracings were compared between the two admissions, during exercise and for the full 24-hour period. Eighteen participants completed the trial. While number of hypoglycemic events during exercise and rest was not different between visits (0.39 AP-HR vs 0.50 stdAP), time below 70 mg dL -1 was lower on AP-HR compared to stdAP, 0.5±2.1% vs 7.4±12.5% (P = 0.028). Time with BG within 70-180 mg dL -1 was higher for the AP-HR admission vs stdAP during the exercise portion and overall (96% vs 87%, and 77% vs 74%), but these did not reach statistical significance (P = 0.075 and P = 0.366). Heart rate signals can safely and efficaciously be integrated in a wireless AP system to inform of physical activity. While exercise contributes to hypoglycemia among adolescents, even when using an AP system, informing the system of exercise via a HR monitor improved time <70 mg dL -1 . Nonetheless, it did not significantly reduce the total number of hypoglycemic events, which were low in both groups. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. L1 and L2 Spoken Word Processing: Evidence from Divided Attention Paradigm.

    Science.gov (United States)

    Shafiee Nahrkhalaji, Saeedeh; Lotfi, Ahmad Reza; Koosha, Mansour

    2016-10-01

    The present study aims to reveal some facts concerning first language (L 1 ) and second language (L 2 ) spoken-word processing in unbalanced proficient bilinguals using behavioral measures. The intention here is to examine the effects of auditory repetition word priming and semantic priming in first and second languages of these bilinguals. The other goal is to explore the effects of attention manipulation on implicit retrieval of perceptual and conceptual properties of spoken L 1 and L 2 words. In so doing, the participants performed auditory word priming and semantic priming as memory tests in their L 1 and L 2 . In a half of the trials of each experiment, they carried out the memory test while simultaneously performing a secondary task in visual modality. The results revealed that effects of auditory word priming and semantic priming were present when participants processed L 1 and L 2 words in full attention condition. Attention manipulation could reduce priming magnitude in both experiments in L 2 . Moreover, L 2 word retrieval increases the reaction times and reduces accuracy on the simultaneous secondary task to protect its own accuracy and speed.

  2. Sensitivity to TOP2 targeting chemotherapeutics is regulated by Oct1 and FILIP1L.

    Directory of Open Access Journals (Sweden)

    Huarui Lu

    Full Text Available Topoisomerase II (TOP2 targeting drugs like doxorubicin and etoposide are frontline chemotherapeutics for a wide variety of solid and hematological malignancies, including breast and ovarian adenocarcinomas, lung cancers, soft tissue sarcomas, leukemias and lymphomas. These agents cause a block in DNA replication leading to a pronounced DNA damage response and initiation of apoptotic programs. Resistance to these agents is common, however, and elucidation of the mechanisms causing resistance to therapy could shed light on strategies to reduce the frequency of ineffective treatments. To explore these mechanisms, we utilized an unbiased shRNA screen to identify genes that regulate cell death in response to doxorubicin treatment. We identified the Filamin A interacting protein 1-like (FILIP1L gene as a crucial mediator of apoptosis triggered by doxorubicin. FILIP1L shares significant similarity with bacterial SbcC, an ATPase involved in DNA repair. FILIP1L was originally described as DOC1, or "down-regulated in ovarian cancer" and has since been shown to be downregulated in a wide variety of human tumors. FILIP1L levels increase markedly through transcriptional mechanisms following treatment with doxorubicin and other TOP2 poisons, including etoposide and mitoxantrone, but not by the TOP2 catalytic inhibitors merbarone or dexrazoxane (ICRF187, or by UV irradiation. This induction requires the action of the OCT1 transcription factor, which relocalizes to the FILIP1L promoter and facilitates its expression following doxorubicin treatment. Our findings suggest that the FILIP1L expression status in tumors may influence the response to anti-TOP2 chemotherapeutics.

  3. Bacterium oxidizing carbon monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Kistner, A

    1953-01-01

    Present-day knowledge of the microbiological oxidation of carbon monoxide is based on doubtful observations and imperfect experimental procedures. By making use of shake cultures in contact with gas mixtures containing high concentrations of CO and by employing liquid enrichment media with a low content of organic matter and solid media of the same composition with not more than 1.2% agar, it proved possible to isolate a co-oxidizing bacterium of the genus hydrogenomonas from sewage sludge. For the first time irrefutable proof has been given of the oxidation of carbon monoxide by a pure culture of a bacterium, both in growing cultures and in resting cell suspensions. 12 references.

  4. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice.

    Science.gov (United States)

    Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A; Stumpf, Sina K; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine

    2016-01-01

    Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.

  5. Multifunctional chitosan/polyvinyl pyrrolidone/45S5 Bioglass® scaffolds for MC3T3-E1 cell stimulation and drug release

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Qingqing [Institute of Advanced Materials for Nano-Bio Applications, School of Ophthalmology & Optometry, Wenzhou Medical University, 270 Xueyuan Xi Road, Wenzhou, Zhejiang 325027 (China); Li, Wei [Institute of Biomaterials, Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Cauerstrasse 6, Erlangen 91058 (Germany); Yu, Shanshan; Ma, Liwei [Institute of Advanced Materials for Nano-Bio Applications, School of Ophthalmology & Optometry, Wenzhou Medical University, 270 Xueyuan Xi Road, Wenzhou, Zhejiang 325027 (China); Jin, Dayong [Institute for Biomedical Materials and Devices, Faculty of Science, University of Technology Sydney, NSW 2007 (Australia); Advanced Cytometry Labs, ARC Center of Excellence for Nanoscale BioPhotonics, Macquarie University, Sydney, NSW 2109 (Australia); Boccaccini, Aldo R., E-mail: Aldo.Boccaccini@ww.uni-erlangen.de [Institute of Biomaterials, Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Cauerstrasse 6, Erlangen 91058 (Germany); Liu, Yong, E-mail: yongliu1980@hotmail.com [Institute of Advanced Materials for Nano-Bio Applications, School of Ophthalmology & Optometry, Wenzhou Medical University, 270 Xueyuan Xi Road, Wenzhou, Zhejiang 325027 (China); Advanced Cytometry Labs, ARC Center of Excellence for Nanoscale BioPhotonics, Macquarie University, Sydney, NSW 2109 (Australia)

    2015-11-01

    Novel chitosan–polyvinyl pyrrolidone/45S5 Bioglass® (CS-PVP/BG) scaffolds were prepared via foam replication and chemical cross-linking techniques. The pristine BG, CS-PVP coated BG and genipin cross-linked CS-PVP/BG (G-CS-PVP/BG) scaffolds were synthesized and characterized in terms of chemical composition, physical structure and morphology respectively. Resistance to enzymatic degradation of the scaffold is improved significantly with the use of genipin cross-linked CS-PVP. The bio-effects of scaffolds on MC3T3-E1 osteoblast-like cells were evaluated by studying cell viability, adhesion and proliferation. The CCK-8 assay shows that cell viability on the resulting G-CS-PVP/BG scaffold is improved obviously after cross-linking of genipin. Cell skeleton images exhibit that well-stretched F-actin bundles are obtained on the G-CS-PVP/BG scaffold. SEM results present significant improvement on the cell adhesion and proliferation for cells cultured on the G-CS-PVP/BG scaffold. The drug release performance on the as-synthesized scaffold was studied in a phosphate buffered saline (PBS) solution. Vancomycin is found to be released in burst fashion within 24 h from the pristine BG scaffold, however, the release period from the G-CS-PVP/BG scaffold is enhanced to 7 days, indicating improved drug release properties of the G-CS-PVP/BG scaffold. Our results suggest that the G-CS-PVP/BG scaffolds possess promising physicochemical properties, sustained drug release capability and good biocompatibility for MC3T3-E1 cells' proliferation and adhesion, suggesting their potential applications in areas such as MC3T3-E1 cell stimulation and bone tissue engineering. - Highlights: • Novel genipi–chitosan–polyvinyl pyrrolidone/45S5 Bioglass® scaffolds are prepared. • Resistance to enzymatic degradation of the scaffold is improved significantly. • The resulting scaffold shows enhanced MC3T3-E1 cell adhesion and proliferation. • Release of antibiotic vancomycin from the

  6. Multifunctional chitosan/polyvinyl pyrrolidone/45S5 Bioglass® scaffolds for MC3T3-E1 cell stimulation and drug release

    International Nuclear Information System (INIS)

    Yao, Qingqing; Li, Wei; Yu, Shanshan; Ma, Liwei; Jin, Dayong; Boccaccini, Aldo R.; Liu, Yong

    2015-01-01

    Novel chitosan–polyvinyl pyrrolidone/45S5 Bioglass® (CS-PVP/BG) scaffolds were prepared via foam replication and chemical cross-linking techniques. The pristine BG, CS-PVP coated BG and genipin cross-linked CS-PVP/BG (G-CS-PVP/BG) scaffolds were synthesized and characterized in terms of chemical composition, physical structure and morphology respectively. Resistance to enzymatic degradation of the scaffold is improved significantly with the use of genipin cross-linked CS-PVP. The bio-effects of scaffolds on MC3T3-E1 osteoblast-like cells were evaluated by studying cell viability, adhesion and proliferation. The CCK-8 assay shows that cell viability on the resulting G-CS-PVP/BG scaffold is improved obviously after cross-linking of genipin. Cell skeleton images exhibit that well-stretched F-actin bundles are obtained on the G-CS-PVP/BG scaffold. SEM results present significant improvement on the cell adhesion and proliferation for cells cultured on the G-CS-PVP/BG scaffold. The drug release performance on the as-synthesized scaffold was studied in a phosphate buffered saline (PBS) solution. Vancomycin is found to be released in burst fashion within 24 h from the pristine BG scaffold, however, the release period from the G-CS-PVP/BG scaffold is enhanced to 7 days, indicating improved drug release properties of the G-CS-PVP/BG scaffold. Our results suggest that the G-CS-PVP/BG scaffolds possess promising physicochemical properties, sustained drug release capability and good biocompatibility for MC3T3-E1 cells' proliferation and adhesion, suggesting their potential applications in areas such as MC3T3-E1 cell stimulation and bone tissue engineering. - Highlights: • Novel genipi–chitosan–polyvinyl pyrrolidone/45S5 Bioglass® scaffolds are prepared. • Resistance to enzymatic degradation of the scaffold is improved significantly. • The resulting scaffold shows enhanced MC3T3-E1 cell adhesion and proliferation. • Release of antibiotic vancomycin from the

  7. Endoplasmic reticulum stress suppresses lipin-1 expression in 3T3-L1 adipocytes

    International Nuclear Information System (INIS)

    Takahashi, Nobuhiko; Yoshizaki, Takayuki; Hiranaka, Natsumi; Suzuki, Takeshi; Yui, Tomoo; Akanuma, Masayoshi; Kanazawa, Kaoru; Yoshida, Mika; Naito, Sumiyoshi; Fujiya, Mikihiro; Kohgo, Yutaka; Ieko, Masahiro

    2013-01-01

    Highlights: ► Lipin-1 involves lipid metabolism, adipocyte differentiation, and inflammation. ► Adipose lipin-1 expression is reduced in obesity. ► ER stress suppresses lipin-1 expression in 3T3-L1 adipocytes. ► Activation of PPAR-γ recovers ER stress-induced lipin-1 reduction. -- Abstract: Lipin-1 plays crucial roles in the regulation of lipid metabolism and cell differentiation in adipocytes. In obesity, adipose lipin-1 mRNA expression is decreased and positively correlated with systemic insulin sensitivity. Amelioration of the lipin-1 depletion might be improved dysmetabolism. Although some cytokines such as TNF-α and interleukin-1β reduces adipose lipin-1 expression, the mechanism of decreased adipose lipin-1 expression in obesity remains unclear. Recently, endoplasmic reticulum (ER) stress is implicated in the pathogenesis of obesity. Here we investigated the role of ER stress on the lipin-1 expression in 3T3-L1 adipocytes. We demonstrated that lipin-1 expression was suppressed by the treatment with ER stress inducers (tunicamycin and thapsigargin) at transcriptional level. We also showed that constitutive lipin-1 expression could be maintained by peroxisome proliferator-activated receptor-γ in 3T3-L1 adipocytes. Activation of peroxisome proliferator-activated receptor-γ recovered the ER stress-induced lipin-1 suppression. These results suggested that ER stress might be involved in the pathogenesis of obesity through lipin-1 depletion

  8. Endoplasmic reticulum stress suppresses lipin-1 expression in 3T3-L1 adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Nobuhiko, E-mail: ntkhs@hoku-iryo-u.ac.jp [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, 2-1-1-1, Midorigaoka-Higashi, Asahikawa, Hokkaido 078-8510 (Japan); Yoshizaki, Takayuki [Innovation Center, Kagoshima University, 1-21-40, Korimoto, Kagoshima 890-0065 (Japan); Hiranaka, Natsumi; Suzuki, Takeshi [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Yui, Tomoo; Akanuma, Masayoshi [Department of Fixed Prosthodontics and Oral Implantology, School of Dentistry, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Kanazawa, Kaoru [Department of Dental Anesthesiology, School of Dentistry, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Yoshida, Mika; Naito, Sumiyoshi [Department of Clinical Laboratory, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Fujiya, Mikihiro; Kohgo, Yutaka [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, 2-1-1-1, Midorigaoka-Higashi, Asahikawa, Hokkaido 078-8510 (Japan); Ieko, Masahiro [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757, Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan)

    2013-02-01

    Highlights: ► Lipin-1 involves lipid metabolism, adipocyte differentiation, and inflammation. ► Adipose lipin-1 expression is reduced in obesity. ► ER stress suppresses lipin-1 expression in 3T3-L1 adipocytes. ► Activation of PPAR-γ recovers ER stress-induced lipin-1 reduction. -- Abstract: Lipin-1 plays crucial roles in the regulation of lipid metabolism and cell differentiation in adipocytes. In obesity, adipose lipin-1 mRNA expression is decreased and positively correlated with systemic insulin sensitivity. Amelioration of the lipin-1 depletion might be improved dysmetabolism. Although some cytokines such as TNF-α and interleukin-1β reduces adipose lipin-1 expression, the mechanism of decreased adipose lipin-1 expression in obesity remains unclear. Recently, endoplasmic reticulum (ER) stress is implicated in the pathogenesis of obesity. Here we investigated the role of ER stress on the lipin-1 expression in 3T3-L1 adipocytes. We demonstrated that lipin-1 expression was suppressed by the treatment with ER stress inducers (tunicamycin and thapsigargin) at transcriptional level. We also showed that constitutive lipin-1 expression could be maintained by peroxisome proliferator-activated receptor-γ in 3T3-L1 adipocytes. Activation of peroxisome proliferator-activated receptor-γ recovered the ER stress-induced lipin-1 suppression. These results suggested that ER stress might be involved in the pathogenesis of obesity through lipin-1 depletion.

  9. The L1TD1 Protein Interactome Reveals the Importance of Post-transcriptional Regulation in Human Pluripotency

    Directory of Open Access Journals (Sweden)

    Maheswara Reddy Emani

    2015-03-01

    Full Text Available The RNA-binding protein L1TD1 is one of the most specific and abundant proteins in pluripotent stem cells and is essential for the maintenance of pluripotency in human cells. Here, we identify the protein interaction network of L1TD1 in human embryonic stem cells (hESCs and provide insights into the interactome network constructed in human pluripotent cells. Our data reveal that L1TD1 has an important role in RNA splicing, translation, protein traffic, and degradation. L1TD1 interacts with multiple stem-cell-specific proteins, many of which are still uncharacterized in the context of development. Further, we show that L1TD1 is a part of the pluripotency interactome network of OCT4, SOX2, and NANOG, bridging nuclear and cytoplasmic regulation and highlighting the importance of RNA biology in pluripotency.

  10. Kinetic imaging of NPC1L1 and sterol trafficking between plasma membrane and recycling endosomes in hepatoma cells

    DEFF Research Database (Denmark)

    Hartwig Petersen, Nicole; Færgeman, Nils J; Yu, Liqing

    2008-01-01

    fluorescent protein (NPC1L1-EGFP) and cholesterol analogues in hepatoma cells. At steady state about 42% of NPC1L1 resided in the transferrin (Tf) positive, sterol enriched endocytic recycling compartment (ERC), while time-lapse microscopy demonstrated NPC1L1 traffic between plasma membrane and ERC...... the ERC to the plasma membrane. NPC1L1-EGFP facilitated transport of fluorescent sterols from the plasma membrane to the ERC. Insulin induced translocation of vesicles containing NPC1L1 and fluorescent sterol from the ERC to the cell membrane. Upon polarization of hepatoma cells NPC1L1 resided almost...... exclusively in the canalicular membrane, where the protein is highly mobile. Our study demonstrates dynamic trafficking of NPC1L1 between cell surface and intracellular compartments and suggests that this transport is involved in NPC1L1 mediated cellular sterol uptake....

  11. NCBI nr-aa BLAST: CBRC-XTRO-01-0902 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0902 ref|NP_622433.1| hypothetical protein TTE0780 [Thermoanaerobacter... tengcongensis MB4] gb|AAM24037.1| hypothetical protein TTE0780 [Thermoanaerobacter tengcongensis MB4] NP_622433.1 4.7 28% ...

  12. The PD1:PD-L1/2 Pathway from Discovery to Clinical Implementation.

    Science.gov (United States)

    Bardhan, Kankana; Anagnostou, Theodora; Boussiotis, Vassiliki A

    2016-01-01

    The immune system maintains a critically organized network to defend against foreign particles, while evading self-reactivity simultaneously. T lymphocytes function as effectors and play an important regulatory role to orchestrate the immune signals. Although central tolerance mechanism results in the removal of the most of the autoreactive T cells during thymic selection, a fraction of self-reactive lymphocytes escapes to the periphery and pose a threat to cause autoimmunity. The immune system evolved various mechanisms to constrain such autoreactive T cells and maintain peripheral tolerance, including T cell anergy, deletion, and suppression by regulatory T cells (T Regs ). These effects are regulated by a complex network of stimulatory and inhibitory receptors expressed on T cells and their ligands, which deliver cell-to-cell signals that dictate the outcome of T cell encountering with cognate antigens. Among the inhibitory immune mediators, the pathway consisting of the programed cell death 1 (PD-1) receptor (CD279) and its ligands PD-L1 (B7-H1, CD274) and PD-L2 (B7-DC, CD273) plays an important role in the induction and maintenance of peripheral tolerance and for the maintenance of the stability and the integrity of T cells. However, the PD-1:PD-L1/L2 pathway also mediates potent inhibitory signals to hinder the proliferation and function of T effector cells and have inimical effects on antiviral and antitumor immunity. Therapeutic targeting of this pathway has resulted in successful enhancement of T cell immunity against viral pathogens and tumors. Here, we will provide a brief overview on the properties of the components of the PD-1 pathway, the signaling events regulated by PD-1 engagement, and their consequences on the function of T effector cells.

  13. The PD1: PD-L1/2 pathway from discovery to clinical implementation

    Directory of Open Access Journals (Sweden)

    Kankana Bardhan

    2016-12-01

    Full Text Available The immune system has the difficult challenge of discerning and defending against a diversity of microbial pathogens, while simultaneously avoiding self-reactivity. T lymphocytes function as effectors and regulators of the immune system. While central tolerance mechanism results in deletion of the majority of self-reactive T lymphocytes during thymic selection, a fraction of self reactive lymphocytes escapes to the periphery and retains the potential to inflict destructive autoimmune pathology. The immune system evolved various mechanisms to restrain such auto-reactive T cells and maintain peripheral tolerance, including T cell anergy, deletion, and suppression by regulatory T cells (TRegs. These effects are regulated by a complex network of stimulatory and inhibitory receptors expressed on T cells and their ligands, which deliver cell-to-cell signals that dictate the outcome of T cell encountering with cognate antigens. Among the inhibitory immune mediators, the pathway consisting of the programmed cell death 1 (PD-1 receptor (CD279 and its ligands PD-L1 (B7-H1, CD274 and PD-L2 (B7-DC; CD273 plays a vital role in the induction and maintenance of peripheral tolerance and for the maintenance of T cell homeostasis. In contrast to its beneficial role in self-tolerance, the PD-1: PD-L1/L2 pathway mediates potent inhibitory signals that prevent the expansion and function of T effector cells and have detrimental effects on antiviral and antitumor immunity. Therapeutic targeting of this pathway has resulted in successful enhancement of T cell immunity against viral pathogens and tumors. Here, we will provide a brief overview on the properties of the components of the PD-1 pathway, the signaling events that are regulated by PD-1 triggering, and their consequences on the function of T effector cells.

  14. Electromagnetic decay widths for L=1, Jsup(PC)=1-- T-baryonia: II

    International Nuclear Information System (INIS)

    Ellis, R.G.; McKellar, B.H.J.; Joshi, G.C.

    1981-01-01

    The electromagnetic decay widths of the Jsup(PC)=1 -- , L=1 T-baryonia in the 1-5 GeV region are estimated. The Van Royen-Weisskopf technique is extended to baryonia within the framework of the QCD potential model. The diquark and antidiquark are assumed to have finite extent. Potential dependent coefficients are scaled from known baryon and mesons

  15. Variability in Immunohistochemical Detection of Programmed Death Ligand 1 (PD-L1) in Cancer Tissue Types

    Science.gov (United States)

    Scognamiglio, Giosuè; De Chiara, Anna; Di Bonito, Maurizio; Tatangelo, Fabiana; Losito, Nunzia Simona; Anniciello, Annamaria; De Cecio, Rossella; D’Alterio, Crescenzo; Scala, Stefania; Cantile, Monica; Botti, Gerardo

    2016-01-01

    In normal cell physiology, programmed death 1 (PD-1) and its ligand, PD-L1, play an immunoregulatory role in T-cell activation, tolerance, and immune-mediated tissue damage. The PD-1/PD-L1 pathway also plays a critical role in immune escape of tumor cells and has been demonstrated to correlate with a poor prognosis of patients with several types of cancer. However, recent reports have revealed that the immunohistochemical (IHC) expression of the PD-L1 in tumor cells is not uniform for the use of different antibodies clones, with variable specificity, often doubtful topographical localization, and with a score not uniquely defined. The purpose of this study was to analyze the IHC expression of PD-L1 on a large series of several human tumors to correctly define its staining in different tumor tissues. PMID:27213372

  16. Robotic synthesis of L-[1-11C]tyrosine

    International Nuclear Information System (INIS)

    Luurtsema, Gert; Medema, Jitze; Elsinga, P.H.; Visser, G.M.; Vaalburg, Willem

    1994-01-01

    L-[1- 11 C]tyrosine promises to become an important tracer for determination of the protein synthesis rate (PSR) in tumor tissue and brain. The commercially available Anatech RB-86 robotic system is utilized for the automation of the L-[1- 11 C]tyrosine production via the isocyanide method as reported by Bolster et al. (Eur. J. Nucl. Med. 12, 321-324, 1986). The total synthesis time, including HPLC-purification and enantiomeric separation is 60 min. With a practical yield of 20 mCi L-[1- 11 C]tyrosine at a specific activity > 1000 Ci/mmol. (author)

  17. Mineralization behavior and interface properties of BG-PVA/bone composite implants in simulated body fluid

    Energy Technology Data Exchange (ETDEWEB)

    Ma Yanxuan; Zheng Yudong; Huang Xiaoshan; Xi Tingfei; Han Dongfei [School of Materials Science and Engineering, Beijing University of Science and Technology, Beijing 100083 (China); Lin Xiaodan [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510640 (China); Song Wenhui, E-mail: zhengyudong@mater.ustb.edu.c, E-mail: wenhui.song@brunel.ac.u [Wolfson Center for Materials Processing, School of Engineering and Design, Brunel University, West London, UB8 3PH (United Kingdom)

    2010-04-15

    Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.

  18. Mineralization behavior and interface properties of BG-PVA/bone composite implants in simulated body fluid.

    Science.gov (United States)

    Ma, Yanxuan; Zheng, Yudong; Huang, Xiaoshan; Xi, Tingfei; Lin, Xiaodan; Han, Dongfei; Song, Wenhui

    2010-04-01

    Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.

  19. First report of a lipopeptide biosurfactant from thermophilic bacterium Aneurinibacillus thermoaerophilus MK01 newly isolated from municipal landfill site.

    Science.gov (United States)

    Sharafi, Hakimeh; Abdoli, Mahya; Hajfarajollah, Hamidreza; Samie, Nima; Alidoust, Leila; Abbasi, Habib; Fooladi, Jamshid; Zahiri, Hossein Shahbani; Noghabi, Kambiz Akbari

    2014-07-01

    A biosurfactant-producing thermophile was isolated from the Kahrizak landfill of Tehran and identified as a bacterium belonging to the genus Aneurinibacillus. A thermostable lipopeptide-type biosurfactant was purified from the culture medium of this bacterium and showed stability in the temperature range of 20-90 °C and pH range of 5-10. The produced biosurfactant could reduce the surface tension of water from 72 to 43 mN/m with a CMC of 1.21 mg/mL. The strain growing at a temperature of 45 °C produces a substantial amount of 5 g/L of biosurfactant in the medium supplemented with sunflower oil as the sole carbon source. Response surface methodology was employed to optimize the biosurfactant production using sunflower oil, sodium nitrate, and yeast extract as variables. The optimization resulted in 6.75 g/L biosurfactant production, i.e., 35% improved as compared to the unoptimized condition. Thin-layer chromatography, FTIR spectroscopy, 1H-NMR spectroscopy, and biochemical composition analysis confirmed the lipopeptide structure of the biosurfactant.

  20. Cellulosic ethanol production via consolidated bioprocessing by a novel thermophilic anaerobic bacterium isolated from a Himalayan hot spring.

    Science.gov (United States)

    Singh, Nisha; Mathur, Anshu S; Tuli, Deepak K; Gupta, Ravi P; Barrow, Colin J; Puri, Munish

    2017-01-01

    Cellulose-degrading thermophilic anaerobic bacterium as a suitable host for consolidated bioprocessing (CBP) has been proposed as an economically suited platform for the production of second-generation biofuels. To recognize the overall objective of CBP, fermentation using co-culture of different cellulolytic and sugar-fermenting thermophilic anaerobic bacteria has been widely studied as an approach to achieving improved ethanol production. We assessed monoculture and co-culture fermentation of novel thermophilic anaerobic bacterium for ethanol production from real substrates under controlled conditions. In this study, Clostridium sp. DBT-IOC-C19, a cellulose-degrading thermophilic anaerobic bacterium, was isolated from the cellulolytic enrichment cultures obtained from a Himalayan hot spring. Strain DBT-IOC-C19 exhibited a broad substrate spectrum and presented single-step conversion of various cellulosic and hemicellulosic substrates to ethanol, acetate, and lactate with ethanol being the major fermentation product. Additionally, the effect of varying cellulose concentrations on the fermentation performance of the strain was studied, indicating a maximum cellulose utilization ability of 10 g L -1 cellulose. Avicel degradation kinetics of the strain DBT-IOC-C19 displayed 94.6% degradation at 5 g L -1 and 82.74% degradation at 10 g L -1 avicel concentration within 96 h of fermentation. In a comparative study with Clostridium thermocellum DSM 1313, the ethanol and total product concentrations were higher by the newly isolated strain on pretreated rice straw at an equivalent substrate loading. Three different co-culture combinations were used on various substrates that presented two-fold yield improvement than the monoculture during batch fermentation. This study demonstrated the direct fermentation ability of the novel thermophilic anaerobic bacteria on various cellulosic and hemicellulosic substrates into ethanol without the aid of any exogenous enzymes

  1. Purification and Characterization of Haloalkaline, Organic Solvent Stable Xylanase from Newly Isolated Halophilic Bacterium-OKH

    Science.gov (United States)

    Sanghvi, Gaurav; Jivrajani, Mehul; Patel, Nirav; Jivrajani, Heta; Bhaskara, Govinal Badiger; Patel, Shivani

    2014-01-01

    A novel, alkali-tolerant halophilic bacterium-OKH with an ability to produce extracellular halophilic, alkali-tolerant, organic solvent stable, and moderately thermostable xylanase was isolated from salt salterns of Mithapur region, Gujarat, India. Identification of the bacterium was done based upon biochemical tests and 16S rRNA sequence. Maximum xylanase production was achieved at pH 9.0 and 37°C temperature in the medium containing 15% NaCl and 1% (w/v) corn cobs. Sugarcane bagasse and wheat straw also induce xylanase production when used as carbon source. The enzyme was active over a range of 0–25% sodium chloride examined in culture broth. The optimum xylanase activity was observed at 5% sodium chloride. Xylanase was purified with 25.81%-fold purification and 17.1% yield. Kinetic properties such as Km and Vmax were 4.2 mg/mL and 0.31 μmol/min/mL, respectively. The enzyme was stable at pH 6.0 and 50°C with 60% activity after 8 hours of incubation. Enzyme activity was enhanced by Ca2+, Mn2+, and Mg2+ but strongly inhibited by heavy metals such as Hg2+, Fe3+, Ni2+, and Zn2+. Xylanase was found to be stable in organic solvents like glutaraldehyde and isopropanol. The purified enzyme hydrolysed lignocellulosic substrates. Xylanase, purified from the halophilic bacterium-OKH, has potential biotechnological applications. PMID:27350996

  2. Reviving the dead: history and reactivation of an extinct l1.

    Science.gov (United States)

    Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly

    2014-06-01

    Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs). However, the intergenic region (IGR) of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction.

  3. Reviving the dead: history and reactivation of an extinct l1.

    Directory of Open Access Journals (Sweden)

    Lei Yang

    2014-06-01

    Full Text Available Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs. However, the intergenic region (IGR of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction.

  4. Bi-allelic Mutations in PKD1L1 Are Associated with Laterality Defects in Humans.

    Science.gov (United States)

    Vetrini, Francesco; D'Alessandro, Lisa C A; Akdemir, Zeynep C; Braxton, Alicia; Azamian, Mahshid S; Eldomery, Mohammad K; Miller, Kathryn; Kois, Chelsea; Sack, Virginia; Shur, Natasha; Rijhsinghani, Asha; Chandarana, Jignesh; Ding, Yan; Holtzman, Judy; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Hanchard, Neil A; Harel, Tamar; Rosenfeld, Jill A; Belmont, John W; Lupski, James R; Yang, Yaping

    2016-10-06

    Disruption of the establishment of left-right (L-R) asymmetry leads to situs anomalies ranging from situs inversus totalis (SIT) to situs ambiguus (heterotaxy). The genetic causes of laterality defects in humans are highly heterogeneous. Via whole-exome sequencing (WES), we identified homozygous mutations in PKD1L1 from three affected individuals in two unrelated families. PKD1L1 encodes a polycystin-1-like protein and its loss of function is known to cause laterality defects in mouse and medaka fish models. Family 1 had one fetus and one deceased child with heterotaxy and complex congenital heart malformations. WES identified a homozygous splicing mutation, c.6473+2_6473+3delTG, which disrupts the invariant splice donor site in intron 42, in both affected individuals. In the second family, a homozygous c.5072G>C (p.Cys1691Ser) missense mutation was detected in an individual with SIT and congenital heart disease. The p.Cys1691Ser substitution affects a highly conserved cysteine residue and is predicted by molecular modeling to disrupt a disulfide bridge essential for the proper folding of the G protein-coupled receptor proteolytic site (GPS) motif. Damaging effects associated with substitutions of this conserved cysteine residue in the GPS motif have also been reported in other genes, namely GPR56, BAI3, and PKD1 in human and lat-1 in C. elegans, further supporting the likely pathogenicity of p.Cys1691Ser in PKD1L1. The identification of bi-allelic PKD1L1 mutations recapitulates previous findings regarding phenotypic consequences of loss of function of the orthologous genes in mice and medaka fish and further expands our understanding of genetic contributions to laterality defects in humans. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  5. L(2,1)-labelling of Circular-arc Graph

    OpenAIRE

    Paul, Satyabrata; Pal, Madhumangal; Pal, Anita

    2014-01-01

    An L(2,1)-labelling of a graph $G=(V, E)$ is $\\lambda_{2,1}(G)$ a function $f$ from the vertex set V (G) to the set of non-negative integers such that adjacent vertices get numbers at least two apart, and vertices at distance two get distinct numbers. The L(2,1)-labelling number denoted by $\\lambda_{2,1}(G)$ of $G$ is the minimum range of labels over all such labelling. In this article, it is shown that, for a circular-arc graph $G$, the upper bound of $\\lambda_{2,1}(G)$ is $\\Delta+3\\omega$, ...

  6. NCBI nr-aa BLAST: CBRC-TTRU-01-0941 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0941 ref|ZP_05380337.1| Na+/Picotransporter [Thermoanaerobacter mathranii subsp. math...ranii str. A3] gb|EET63018.1| Na+/Picotransporter [Thermoanaerobacter mathranii subsp. mathranii str. A3] ZP_05380337.1 0.013 23% ...

  7. [Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

    Science.gov (United States)

    Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

    2013-08-01

    This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

  8. L1 and L2 Strategy Use in Reading Comprehension of Chinese EFL Readers

    Science.gov (United States)

    Tsai, Yea-Ru; Ernst, Cheryl; Talley, Paul C.

    2010-01-01

    This study revealed the relationship between L1 (Mandarin Chinese) and L2 (English) strategy use in L2 reading comprehension by focusing on the correlation of L1 reading ability, L2 proficiency and employed reading strategies. The participants, 222 undergraduates learning English as a foreign language (EFL), were classified into skilled and…

  9. Biochemical Characterization and Structural Basis of Reactivity and Regioselectivity Differences between Burkholderia thailandensis and Burkholderia glumae 1,6-Didesmethyltoxoflavin N-Methyltransferase.

    Science.gov (United States)

    Fenwick, Michael K; Almabruk, Khaled H; Ealick, Steven E; Begley, Tadhg P; Philmus, Benjamin

    2017-08-01

    Burkholderia glumae converts the guanine base of guanosine triphosphate into an azapteridine and methylates both the pyrimidine and triazine rings to make toxoflavin. Strains of Burkholderia thailandensis and Burkholderia pseudomallei have a gene cluster encoding seven putative biosynthetic enzymes that resembles the toxoflavin gene cluster. Four of the enzymes are similar in sequence to BgToxBCDE, which have been proposed to make 1,6-didesmethyltoxoflavin (1,6-DDMT). One of the remaining enzymes, BthII1283 in B. thailandensis E264, is a predicted S-adenosylmethionine (SAM)-dependent N-methyltransferase that shows a low level of sequence identity to BgToxA, which sequentially methylates N6 and N1 of 1,6-DDMT to form toxoflavin. Here we show that, unlike BgToxA, BthII1283 catalyzes a single methyl transfer to N1 of 1,6-DDMT in vitro. In addition, we investigated the differences in reactivity and regioselectivity by determining crystal structures of BthII1283 with bound S-adenosylhomocysteine (SAH) or 1,6-DDMT and SAH. BthII1283 contains a class I methyltransferase fold and three unique extensions used for 1,6-DDMT recognition. The active site structure suggests that 1,6-DDMT is bound in a reduced form. The plane of the azapteridine ring system is orthogonal to its orientation in BgToxA. In BthII1283, the modeled SAM methyl group is directed toward the p orbital of N1, whereas in BgToxA, it is first directed toward an sp 2 orbital of N6 and then toward an sp 2 orbital of N1 after planar rotation of the azapteridine ring system. Furthermore, in BthII1283, N1 is hydrogen bonded to a histidine residue whereas BgToxA does not supply an obvious basic residue for either N6 or N1 methylation.

  10. L1 Differences and L2 Similarities: Teaching Verb Tenses in English

    Science.gov (United States)

    Collins, Laura

    2007-01-01

    In making decisions regarding the focus for grammar teaching, ESL instructors may take into consideration errors that appear to result from the influence of their students' first language(s) (L1). There is also evidence from language acquisition research suggesting that for some grammatical features, learners of different L1 backgrounds may face…

  11. 40 CFR 721.3821 - L-Glutamic acid, N-(1-oxododecyl)-.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false L-Glutamic acid, N-(1-oxododecyl... Substances § 721.3821 L-Glutamic acid, N-(1-oxododecyl)-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as L-Glutamic acid, N-(1-oxododecyl)- (PMN P...

  12. Structural Biology of the Immune Checkpoint Receptor PD-1 and Its Ligands PD-L1/PD-L2

    NARCIS (Netherlands)

    Zak, Krzysztof M.; Grudnik, Przemyslaw; Magiera, Katarzyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

    2017-01-01

    Cancer cells can avoid and suppress immune responses through activation of inhibitory immune checkpoint proteins, such as PD-1, PD-L1, and CTLA-4. Blocking the activities of these proteins with monoclonal antibodies, and thus restoring T cell function, has delivered breakthrough therapies against

  13. [Biocompatibility of poly-L-lactic acid/Bioglass-guided bone regeneration membranes processed with oxygen plasma].

    Science.gov (United States)

    Fang, Wei; Zeng, Shu-Guang; Gao, Wen-Feng

    2015-04-01

    To prepare and characterize a nano-scale fibrous hydrophilic poly-L-lactic acid/ Bioglass (PLLA/BG) composite membrane and evaluate its biocompatibility as a composite membrane for guiding bone regeneration (GBR). PLLA/BG-guided bone regeneration membrane was treated by oxygen plasma to improved its hydrophilicity. The growth of MG-63 osteoblasts on the membrane was observed using Hoechst fluorescence staining, and the biocompatibility of the membrane was evaluated by calculating the cells adhesion rate and proliferation rate. Osteogenesis of MG-63 cells was assessed by detecting alkaline phosphatase (ALP), and the formation of calcified nodules and cell morphology changes were observed using scanning electron microscope (SEM). The cell adhesion rates of PLLA/BG-guided bone regeneration membrane treated with oxygen plasma were (30.570±0.96)%, (47.27±0.78)%, and (66.78±0.69)% at 1, 3, and 6 h, respectively, significantly higher than those on PLLA membrane and untreated PLLA/BG membrane (Pmembranes increased with time, but highest on oxygen plasma-treated PLLA/BG membrane (Pplasma treatment of the PLLA/BG membrane promoted cell adhesion. The membranes with Bioglass promoted the matrix secretion of the osteoblasts. Under SEM, the formation of calcified nodules and spindle-shaped cell morphology were observed on oxygen plasma-treated PLLA/BG membrane. Oxygen plasma-treated PLLA/BG composite membrane has good biocompatibility and can promote adhesion, proliferation and osteogenesis of the osteoblasts.

  14. Phobos L1 Operational Tether Experiment (PHLOTE)

    Data.gov (United States)

    National Aeronautics and Space Administration — A sensor package that “floats” just above the surface of Phobos, suspended by a tether from a small spacecraft operating at the Mars/Phobos Lagrange 1 (L1) Point...

  15. Dicty_cDB: Contig-U03778-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available DY679985 ) TTDA465TO Tetrahymena thermophila EST library str... 62 7e-09 3 ( CJ948566 ) Triticum aestivum cDNA clone:whchul...spotted knapweed Cen... 42 1e-07 4 ( EX126122 ) BR109952 etiolated mature leaf cDNA library KHLW ... 52 1e-0...cDNA cl... 48 2e-07 2 ( EG402891 ) BG01043A2F03.f1 BG01 - normalized library Leymus ... 48 2e-07 2 ( CJ650115 ) Triticum aesti...NA, gonad clone:mtgd004b03,... 60 4e-09 2 ( EX123216 ) BR107046 mature green leaf cDNA library...... 64 3e-21 5 ( CK272276 ) EST718354 potato abiotic stress cDNA library Sola... 44 2e-20 6 ( AM910992

  16. Phylodynamics of the HIV-1 epidemic in Cuba.

    Science.gov (United States)

    Delatorre, Edson; Bello, Gonzalo

    2013-01-01

    Previous studies have shown that the HIV-1 epidemic in Cuba displayed a complex molecular epidemiologic profile with circulation of several subtypes and circulating recombinant forms (CRF); but the evolutionary and population history of those viral variants remains unknown. HIV-1 pol sequences of the most prevalent Cuban lineages (subtypes B, C and G, CRF18_cpx, CRF19_cpx, and CRFs20/23/24_BG) isolated between 1999 and 2011 were analyzed. Maximum-likelihood analyses revealed multiple introductions of subtype B (n≥66), subtype C (n≥10), subtype G (n≥8) and CRF18_cpx (n≥2) viruses in Cuba. The bulk of HIV-1 infections in this country, however, was caused by dissemination of a few founder strains probably introduced from North America/Europe (clades B(CU-I) and B(CU-II)), east Africa (clade C(CU-I)) and central Africa (clades G(CU), CRF18(CU) and CRF19(CU)), or locally generated (clades CRFs20/23/24_BG). Bayesian-coalescent analyses show that the major HIV-1 founder strains were introduced into Cuba during 1985-1995; whereas the CRFs_BG strains emerged in the second half of the 1990s. Most HIV-1 Cuban clades appear to have experienced an initial period of fast exponential spread during the 1990s and early 2000s, followed by a more recent decline in growth rate. The median initial growth rate of HIV-1 Cuban clades ranged from 0.4 year⁻¹ to 1.6 year⁻¹. Thus, the HIV-1 epidemic in Cuba has been a result of the successful introduction of a few viral strains that began to circulate at a rather late time of the AIDS pandemic, but then were rapidly disseminated through local transmission networks.

  17. Discourse Connectives in L1 and L2 Argumentative Writing

    Science.gov (United States)

    Hu, Chunyu; Li, Yuanyuan

    2015-01-01

    Discourse connectives (DCs) are multi-functional devices used to connect discourse segments and fulfill interpersonal levels of discourse. This study investigates the use of selected 80 DCs within 11 categories in the argumentative essays produced by L1 and L2 university students. The analysis is based on the International Corpus Network of Asian…

  18. Suitability of the alkalistable carbonic anhydrase from a polyextremophilic bacterium Aeribacillus pallidus TSHB1 in biomimetic carbon sequestration.

    Science.gov (United States)

    Bose, Himadri; Satyanarayana, T

    2016-10-01

    Carbonic anhydrase (CA) was produced from the polyextremophilic (halotolerant, moderately thermophilic and alkaliphilic) bacterium Aeribacillus pallidus TSHB1 isolated from water and sediment samples of Choti Anhoni hot spring of Pipariya, Madhya Pradesh (India), is being reported to be suitable for carbon sequestration. Growth and CA production were inhibited at higher CO2 concentration (5-10 %). Under optimized culture variables (tryptone 0.8 %, yeast extract 0.08 %, glucose 1 %, micronutrient solution 1 %, inoculums size 1.10 %, agitation 200 at pH 8, and temperature 55 °C), 3.7-fold higher CA production was attained than that under unoptimized conditions. The zymogram analysis of the partially purified CA revealed an activity band corresponding to 32 kDa. The enzyme is stable in the pH range between 8.0 and 11.0 with T 1/2 of 40, 15, and 8 min at 60, 70, and 80 °C, respectively. The CA of A. pallidus displayed a marked enhancement in the rate of CaCO3 precipitation from aqueous CO2. The CA-aided formation of CaCO3 was 42.5 mg mg(-1) protein. Scanning electron microscopy revealed the formation of rhomboid calcite crystals. This is the first report on the production and applicability of CA from the polyextremophilic A. pallidus in carbon sequestration.

  19. Simulation Experiment Description Markup Language (SED-ML Level 1 Version 3 (L1V3

    Directory of Open Access Journals (Sweden)

    Bergmann Frank T.

    2018-03-01

    Full Text Available The creation of computational simulation experiments to inform modern biological research poses challenges to reproduce, annotate, archive, and share such experiments. Efforts such as SBML or CellML standardize the formal representation of computational models in various areas of biology. The Simulation Experiment Description Markup Language (SED-ML describes what procedures the models are subjected to, and the details of those procedures. These standards, together with further COMBINE standards, describe models sufficiently well for the reproduction of simulation studies among users and software tools. The Simulation Experiment Description Markup Language (SED-ML is an XML-based format that encodes, for a given simulation experiment, (i which models to use; (ii which modifications to apply to models before simulation; (iii which simulation procedures to run on each model; (iv how to post-process the data; and (v how these results should be plotted and reported. SED-ML Level 1 Version 1 (L1V1 implemented support for the encoding of basic time course simulations. SED-ML L1V2 added support for more complex types of simulations, specifically repeated tasks and chained simulation procedures. SED-ML L1V3 extends L1V2 by means to describe which datasets and subsets thereof to use within a simulation experiment.

  20. Near infrared photoimmunotherapy with avelumab, an anti-programmed death-ligand 1 (PD-L1) antibody.

    Science.gov (United States)

    Nagaya, Tadanobu; Nakamura, Yuko; Sato, Kazuhide; Harada, Toshiko; Choyke, Peter L; Hodge, James W; Schlom, Jeffrey; Kobayashi, Hisataka

    2017-01-31

    Near Infrared-Photoimmunotherapy (NIR-PIT) is a highly selective tumor treatment that employs an antibody-photo-absorber conjugate (APC). Programmed cell death protein-1 ligand (PD-L1) is emerging as a molecular target. Here, we describe the efficacy of NIR-PIT, using fully human IgG1 anti-PD-L1 monoclonal antibody (mAb), avelumab, conjugated to the photo-absorber, IR700DX, in a PD-L1 expressing H441 cell line, papillary adenocarcinoma of lung. Avelumab-IR700 showed specific binding and cell-specific killing was observed after exposure of the cells to NIR in vitro. In the in vivo study, avelumab-IR700 showed high tumor accumulation and high tumor-background ratio. Tumor-bearing mice were separated into 4 groups: (1) no treatment; (2) 100 μg of avelumab-IR700 i.v.; (3) NIR light exposure only, NIR light was administered; (4) 100 μg of avelumab-IR700 i.v., NIR light was administered. Tumor growth was significantly inhibited by NIR-PIT treatment compared with the other groups (p avelumab, is suitable as an APC for NIR-PIT. Furthermore, NIR-PIT with avelumab-IR700 is a promising candidate of the treatment of PD-L1-expressing tumors that could be readily translated to humans.

  1. Simulation Experiment Description Markup Language (SED-ML) Level 1 Version 3 (L1V3).

    Science.gov (United States)

    Bergmann, Frank T; Cooper, Jonathan; König, Matthias; Moraru, Ion; Nickerson, David; Le Novère, Nicolas; Olivier, Brett G; Sahle, Sven; Smith, Lucian; Waltemath, Dagmar

    2018-03-19

    The creation of computational simulation experiments to inform modern biological research poses challenges to reproduce, annotate, archive, and share such experiments. Efforts such as SBML or CellML standardize the formal representation of computational models in various areas of biology. The Simulation Experiment Description Markup Language (SED-ML) describes what procedures the models are subjected to, and the details of those procedures. These standards, together with further COMBINE standards, describe models sufficiently well for the reproduction of simulation studies among users and software tools. The Simulation Experiment Description Markup Language (SED-ML) is an XML-based format that encodes, for a given simulation experiment, (i) which models to use; (ii) which modifications to apply to models before simulation; (iii) which simulation procedures to run on each model; (iv) how to post-process the data; and (v) how these results should be plotted and reported. SED-ML Level 1 Version 1 (L1V1) implemented support for the encoding of basic time course simulations. SED-ML L1V2 added support for more complex types of simulations, specifically repeated tasks and chained simulation procedures. SED-ML L1V3 extends L1V2 by means to describe which datasets and subsets thereof to use within a simulation experiment.

  2. Asimmetrie L1/L2: una sfida nella didattica di “lingua e traduzione”.

    Directory of Open Access Journals (Sweden)

    Laura Salmon

    2004-12-01

    Full Text Available Asymmetries Between L1 and L2: a Challenge in the Teaching of "Language and Translation" Language teaching is deeply connected to the cognitive and brain sciences. The attribution of meaning of linguistic messages depends on the interaction between the communicant’s brain and the external world. The interaction is based on the cognitive and emotional experience shared by a L-community. Competence in L2 is acquired by the development of an internal data base of contextualised .units of living speech. (Lurija 1976. L2 teaching is particularly successful when the L2 units are inscribed in memory by means of the functionally equivalent L1 units. Selection of the L1/L2 correspondent units is due to the principle of markedness: each unit of L1 has a functional equivalent in one and only one unit of the L2. Because of the interlingual asymmetries (a set of Italian/Russian examples is given, functional equivalence differs from morphosyntactic and lexical equivalence. The competency in ascribing a degree of markedness to each linguistic unit needs the regular implicit acquisition of the L2 intonational and prosodic system; the processes of the metalinguistic conscious reflection are instead a .hindrance. to the procedural acting of a “living speaker”.

  3. Optimization of bioethanol production from carbohydrate rich wastes by extreme thermophilic microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Tomas, A.F.

    2013-05-15

    Second-generation bioethanol is produced from residual biomass such as industrial and municipal waste or agricultural and forestry residues. However, Saccharomyces cerevisiae, the microorganism currently used in industrial first-generation bioethanol production, is not capable of converting all of the carbohydrates present in these complex substrates into ethanol. This is in particular true for pentose sugars such as xylose, generally the second major sugar present in lignocellulosic biomass. The transition of second-generation bioethanol production from pilot to industrial scale is hindered by the recalcitrance of the lignocellulosic biomass, and by the lack of a microorganism capable of converting this feedstock to bioethanol with high yield, efficiency and productivity. In this study, a new extreme thermophilic ethanologenic bacterium was isolated from household waste. When assessed for ethanol production from xylose, an ethanol yield of 1.39 mol mol-1 xylose was obtained. This represents 83 % of the theoretical ethanol yield from xylose and is to date the highest reported value for a native, not genetically modified microorganism. The bacterium was identified as a new member of the genus Thermoanaerobacter, named Thermoanaerobacter pentosaceus and was subsequently used to investigate some of the factors that influence secondgeneration bioethanol production, such as initial substrate concentration and sensitivity to inhibitors. Furthermore, T. pentosaceus was used to develop and optimize bioethanol production from lignocellulosic biomass using a range of different approaches, including combination with other microorganisms and immobilization of the cells. T. pentosaceus could produce ethanol from a wide range of substrates without the addition of nutrients such as yeast extract and vitamins to the medium. It was initially sensitive to concentrations of 10 g l-1 of xylose and 1 % (v/v) ethanol. However, long term repeated batch cultivation showed that the strain

  4. Suppression of lipin-1 expression increases monocyte chemoattractant protein-1 expression in 3T3-L1 adipocytes

    International Nuclear Information System (INIS)

    Takahashi, Nobuhiko; Yoshizaki, Takayuki; Hiranaka, Natsumi; Suzuki, Takeshi; Yui, Tomoo; Akanuma, Masayasu; Oka, Kazuya; Kanazawa, Kaoru; Yoshida, Mika; Naito, Sumiyoshi; Fujiya, Mikihiro; Kohgo, Yutaka; Ieko, Masahiro

    2011-01-01

    Highlights: ► Lipin-1 affects lipid metabolism, adipocyte differentiation, and transcription. ► Adipose lipin-1 expression is reduced in obesity. ► Lipin-1 depletion using siRNA in 3T3-L1 adipocytes increased MCP-1 expression. ► Lipin-1 is involved in adipose inflammation. -- Abstract: Lipin-1 plays a crucial role in the regulation of lipid metabolism and cell differentiation in adipocytes. Expression of adipose lipin-1 is reduced in obesity, and metabolic syndrome. However, the significance of this reduction remains unclear. This study investigated if and how reduced lipin-1 expression affected metabolism. We assessed mRNA expression levels of various genes related to adipocyte metabolism in lipin-1-depleted 3T3-L1 adipocytes by introducing its specific small interfering RNA. In lipin-1-depleted adipocytes, mRNA and protein expression levels of monocyte chemoattractant protein-1 (MCP-1) were significantly increased, although the other genes tested were not altered. The conditioned media from the cells promoted monocyte chemotaxis. The increase in MCP-1 expression was prevented by treatment with quinazoline or salicylate, inhibitors of nuclear factor-κB activation. Because MCP-1 is related to adipose inflammation and systemic insulin resistance, these results suggest that a reduction in adipose lipin-1 in obesity may exacerbate adipose inflammation and metabolism.

  5. Suppression of lipin-1 expression increases monocyte chemoattractant protein-1 expression in 3T3-L1 adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Nobuhiko, E-mail: ntkhs@hoku-iryo-u.ac.jp [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, 2-1-1-1 Midorigaoka-Higashi, Asahikawa, Hokkaido 078-8510 (Japan); Yoshizaki, Takayuki [Innovation Center, Kagoshima University, 1-21-40 Korimoto, Kagoshima 890-0065 (Japan); Hiranaka, Natsumi; Suzuki, Takeshi [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Yui, Tomoo; Akanuma, Masayasu; Oka, Kazuya [Department of Fixed Prosthodontics and Oral Implantology, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Kanazawa, Kaoru [Department of Dental Anesthesiology, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Yoshida, Mika; Naito, Sumiyoshi [Department of Clinical Laboratory, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan); Fujiya, Mikihiro; Kohgo, Yutaka [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, 2-1-1-1 Midorigaoka-Higashi, Asahikawa, Hokkaido 078-8510 (Japan); Ieko, Masahiro [Department of Internal Medicine, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Toubetsu, Hokkaido 061-0023 (Japan)

    2011-11-11

    Highlights: Black-Right-Pointing-Pointer Lipin-1 affects lipid metabolism, adipocyte differentiation, and transcription. Black-Right-Pointing-Pointer Adipose lipin-1 expression is reduced in obesity. Black-Right-Pointing-Pointer Lipin-1 depletion using siRNA in 3T3-L1 adipocytes increased MCP-1 expression. Black-Right-Pointing-Pointer Lipin-1 is involved in adipose inflammation. -- Abstract: Lipin-1 plays a crucial role in the regulation of lipid metabolism and cell differentiation in adipocytes. Expression of adipose lipin-1 is reduced in obesity, and metabolic syndrome. However, the significance of this reduction remains unclear. This study investigated if and how reduced lipin-1 expression affected metabolism. We assessed mRNA expression levels of various genes related to adipocyte metabolism in lipin-1-depleted 3T3-L1 adipocytes by introducing its specific small interfering RNA. In lipin-1-depleted adipocytes, mRNA and protein expression levels of monocyte chemoattractant protein-1 (MCP-1) were significantly increased, although the other genes tested were not altered. The conditioned media from the cells promoted monocyte chemotaxis. The increase in MCP-1 expression was prevented by treatment with quinazoline or salicylate, inhibitors of nuclear factor-{kappa}B activation. Because MCP-1 is related to adipose inflammation and systemic insulin resistance, these results suggest that a reduction in adipose lipin-1 in obesity may exacerbate adipose inflammation and metabolism.

  6. Curcumin inhibits cholesterol uptake in Caco-2 cells by down-regulation of NPC1L1 expression

    Directory of Open Access Journals (Sweden)

    Duan Rui-Dong

    2010-04-01

    Full Text Available Abstract Background Curcumin is a polyphenol and the one of the principle curcuminoids of the spice turmeric. Its antioxidant, anti-cancer and anti-inflammatory effects have been intensively studied. Previous in vivo studies showed that administration of curcumin also decreased cholesterol levels in the blood, and the effects were considered to be related to upregulation of LDL receptor. However, since plasma cholesterol levels are also influenced by the uptake of cholesterol in the gut, which is mediated by a specific transporter Niemann-Pick Cl-like 1 (NPC1L1 protein, the present study is to investigate whether curcumin affects cholesterol uptake in the intestinal Caco-2 cells. Methods Caco-2 cells were cultured to confluence. The micelles composed of bile salt, monoolein, and 14C-cholesterol were prepared. We first incubated the cells with the micelles in the presence and absence of ezetimibe, the specific inhibitor of NPC1L1, to see whether the uptake of the cholesterol in the cells was mediated by NPC1L1. We then pretreated the cells with curcumin at different concentrations for 24 h followed by examination of the changes of cholesterol uptake in these curcumin-treated cells. Finally we determined whether curcumin affects the expression of NPC1L1 by both Western blot analysis and qPCR quantification. Results We found that the uptake of radioactive cholesterol in Caco-2 cells was inhibited by ezetimibe in a dose-dependent manner. The results indicate that the uptake of cholesterol in this study was mediated by NPC1L1. We then pretreated the cells with 25-100 μM curcumin for 24 h and found that such a treatment dose-dependently inhibited cholesterol uptake with 40% inhibition obtained by 100 μM curcumin. In addition, we found that the curcumin-induced inhibition of cholesterol uptake was associated with significant decrease in the levels of NPC1L1 protein and NPC1L1 mRNA, as analyzed by Western blot and qPCR, respectively. Conclusion

  7. Curcumin inhibits cholesterol uptake in Caco-2 cells by down-regulation of NPC1L1 expression.

    Science.gov (United States)

    Feng, Dan; Ohlsson, Lena; Duan, Rui-Dong

    2010-04-19

    Curcumin is a polyphenol and the one of the principle curcuminoids of the spice turmeric. Its antioxidant, anti-cancer and anti-inflammatory effects have been intensively studied. Previous in vivo studies showed that administration of curcumin also decreased cholesterol levels in the blood, and the effects were considered to be related to upregulation of LDL receptor. However, since plasma cholesterol levels are also influenced by the uptake of cholesterol in the gut, which is mediated by a specific transporter Niemann-Pick Cl-like 1 (NPC1L1) protein, the present study is to investigate whether curcumin affects cholesterol uptake in the intestinal Caco-2 cells. Caco-2 cells were cultured to confluence. The micelles composed of bile salt, monoolein, and 14C-cholesterol were prepared. We first incubated the cells with the micelles in the presence and absence of ezetimibe, the specific inhibitor of NPC1L1, to see whether the uptake of the cholesterol in the cells was mediated by NPC1L1. We then pretreated the cells with curcumin at different concentrations for 24 h followed by examination of the changes of cholesterol uptake in these curcumin-treated cells. Finally we determined whether curcumin affects the expression of NPC1L1 by both Western blot analysis and qPCR quantification. We found that the uptake of radioactive cholesterol in Caco-2 cells was inhibited by ezetimibe in a dose-dependent manner. The results indicate that the uptake of cholesterol in this study was mediated by NPC1L1. We then pretreated the cells with 25-100 muM curcumin for 24 h and found that such a treatment dose-dependently inhibited cholesterol uptake with 40% inhibition obtained by 100 muM curcumin. In addition, we found that the curcumin-induced inhibition of cholesterol uptake was associated with significant decrease in the levels of NPC1L1 protein and NPC1L1 mRNA, as analyzed by Western blot and qPCR, respectively. Curcumin inhibits cholesterol uptake through suppression of NPC1L1

  8. L2 Word Recognition: Influence of L1 Orthography on Multi-Syllabic Word Recognition

    Science.gov (United States)

    Hamada, Megumi

    2017-01-01

    L2 reading research suggests that L1 orthographic experience influences L2 word recognition. Nevertheless, the findings on multi-syllabic words in English are still limited despite the fact that a vast majority of words are multi-syllabic. The study investigated whether L1 orthography influences the recognition of multi-syllabic words, focusing on…

  9. TV-L1 optical flow for vector valued images

    DEFF Research Database (Denmark)

    Rakêt, Lars Lau; Roholm, Lars; Nielsen, Mads

    2011-01-01

    The variational TV-L1 framework has become one of the most popular and successful approaches for calculating optical flow. One reason for the popularity is the very appealing properties of the two terms in the energy formulation of the problem, the robust L1-norm of the data fidelity term combined...... with the total variation (TV) regular- ization that smoothes the flow, but preserve strong discontinuities such as edges. Specifically the approach of Zach et al. [1] has provided a very clean and efficient algorithm for calculating TV-L1 optical flows between grayscale images. In this paper we propose...

  10. Automated PET Radiotracer Manufacture on the BG75 System and Imaging Validation Studies of [18F]fluoromisonidazole ([18F]FMISO).

    Science.gov (United States)

    Yuan, Hong; Frank, Jonathan E; Merrill, Joseph R; Hillesheim, Daniel A; Khachaturian, Mark H; Anzellotti, Atilio I

    2016-01-01

    The hypoxia PET tracer, 1-[18F]fluoro-3-(2-nitro-1Himidazol- 1-yl)-propan-2-ol ([18F]FMISO) is the first radiotracer developed for hypoxia PET imaging and has shown promising for cancer diagnosis and prognosis. However, access to [18F]FMISO radiotracer is limited due to the needed cyclotron and radiochemistry expertise. The study aimed to develop the automated production method on the [18F]FMISO radiotracer with the novel fully automated platform of the BG75 system and validate its usage on animal tumor models. [18F]FMISO was produced with the dose synthesis cartridge automatically on the BG75 system. Validation of [18F]FMISO hypoxia imaging functionality was conducted on two tumor mouse models (FaDu/U87 tumor). The distribution of [18F]FMISO within tumor was further validated by the standard hypoxia marker EF5. The average radiochemical purity was (99±1) % and the average pH was 5.5±0.2 with other quality attributes passing standard criteria (n=12). Overall biodistribution for [18F]FMISO in both tumor models was consistent with reported studies where bladder and large intestines presented highest activity at 90 min post injection. High spatial correlation was found between [18F]FMISO autoradiography and EF5 hypoxia staining, indicating high hypoxia specificity of [18MF]FMISO. This study shows that qualified [18F]FMISO can be efficiently produced on the BG75 system in an automated "dose-on-demand" mode using single dose disposable cards. The possibilities of having a low-cost, automated system manufacturing ([18F]Fluoride production + synthesis + QC) different radiotracers will greatly enhance the potential for PET technology to reach new geographical areas and underserved patient populations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. Accumulation of mixed linkage (1¿3) (1¿4)-ß-D-glucan during grain filling in barley

    DEFF Research Database (Denmark)

    Seefeldt, Helene Fast; Blennow, Per Gunnar Andreas; Jespersen, Birthe P Møller

    2009-01-01

    18% BG (w/w) dry matter 30 days after flowering (DAF), seemingly compensating for a decreased synthesis of starch. The spectral information of the barley flour was compared to pure BG spectra and partial least squares regression (PLS) models were constructed for calibration to BG content. Informative...... the normal control Cork were studied. The Cork and lys3a genotypes showed a linear BG accumulation throughout the grain filling to reach a maximum of approximately 6 and 4% BG (w/w) dry matter, respectively. However, lys5f mutant exhibited an exponential increase in BG synthesis to a maximum of approximately...

  12. The Emerging Role of PD-1/PD-L1-Targeting Immunotherapy in the Treatment of Metastatic Urothelial Carcinoma.

    Science.gov (United States)

    Gwynn, Morgan E; DeRemer, David L

    2018-01-01

    To summarize and evaluate immunotherapy agents targeting programmed cell death protein-1 (PD-1) and programmed death ligand-1 (PD-L1) recently approved for the treatment of metastatic urothelial carcinomas (UC). A literature review was performed using PubMed (2012 to June 2017), the American Society of Clinical Oncology abstract databases (2012 to June 2017 Annual Meetings/symposia), and the America Association for Cancer Research symposia (2012 to June 2017). A search using clinicaltrials.gov was conducted to identify studies for atezolizumab, avelumab, durvalumab, nivolumab, and pembrolizumab. English language phase I to III studies assessing PD-1 and PD-L1 in UC were incorporated. Atezolizumab, avelumab, durvalumab, nivolumab, and pembrolizumab have demonstrated clinical efficacy with tolerable toxicities in patients with metastatic UC with disease progression following platinum-based chemotherapy. Anti-PD-1/PD-L1 therapies may provide overall survival advantage; these are currently being evaluated in ongoing phase 3 studies. Greater objective response rates seem to be observed in PD-L1-positive patients versus PD-L1-negative patients, but methodologies in this assessment differ among clinical trials. The identification of biomarkers that provide greater insight into patients who positively respond to PD-1/PD-L1 therapies are needed. Treatment options for metastatic UC have expanded to include PD-1/PD-L1 therapies. These agents should be strongly considered as second-line therapy over single-agent chemotherapy for patients who fail or progress after platinum-based treatment.

  13. Targeting PD-1/PD-L1 in lung cancer: current perspectives

    Directory of Open Access Journals (Sweden)

    González-Cao M

    2015-07-01

    Full Text Available María González-Cao,1 Niki Karachaliou,1 Santiago Viteri,1 Daniela Morales-Espinosa,1 Cristina Teixidó,2 Jesús Sánchez Ruiz,3 Miquel Ángel Molina-Vila,2 Mariacarmela Santarpia,4 Rafael Rosell1,2,5,61Translational Cancer Research Unit, Instituto Oncológico Dr Rosell, Quirón Dexeus University Hospital, Barcelona, Spain; 2Pangaea Biotech SL, Barcelona, Spain; 3Centro Nacional de Investigación Oncología (CNIO, Madrid, Spain; 4Medical Oncology Unit, Human Pathology Department, University of Messina, Messina, Italy; 5Cancer Biology and Precision Medicine Program, Catalan Institute of Oncology, Germans Trias i Pujol Health Sciences Institute and Hospital, Campus Can Ruti, Badalona, Barcelona, Spain; 6Fundación Molecular Oncology Research, Barcelona, SpainAbstract: Increased understanding of tumor immunology has led to the development of effective immunotherapy treatments. One of the most important advances in this field has been due to pharmacological design of antibodies against immune checkpoint inhibitors. Anti-PD-1/PD-L1 antibodies are currently in advanced phases of clinical development for several tumors, including lung cancer. Results from Phase I–III trials with anti-PD-1/PD-L1 antibodies in non-small-cell lung cancer have demonstrated response rates of around 20% (range, 16%–50%. More importantly, responses are long-lasting (median duration of response, 18 months and fast (50% of responses are detected at time of first tumor evaluation with very low grade 3–4 toxicity (less than 5%. Recently, the anti-PD-1 antibody pembrolizumab received US Food and Drug Administration (FDA breakthrough therapy designation for treatment of non-small-cell lung cancer, supported by data from a Phase Ib trial. Another anti-PD-1 antibody, nivolumab, has also been approved for lung cancer based on survival advantage demonstrated in recently released data from a Phase III trial in squamous cell lung cancer.Keywords: immunotherapy, immunoncology

  14. Genetic variation at the NPC1L1 gene locus, plasma lipoproteins, and heart disease risk in the elderly

    Science.gov (United States)

    Niemann-Pick C1-like 1 protein (NPC1L1) plays a critical role in intestinal cholesterol absorption. Our objective was to examine whether five variants (-133A>G, -18A>C, L272L, V1296V, and U3_28650A>G) at the NPC1L1 gene have effects on lipid levels, prevalence, and incidence of coronary heart diseas...

  15. A plasmodesmata-associated beta-1,3-glucanase in Arabidopsis.

    Science.gov (United States)

    Levy, Amit; Erlanger, Michael; Rosenthal, Michal; Epel, Bernard L

    2007-02-01

    Plasmodesmal conductivity is regulated in part by callose turnover, which is hypothesized to be determined by beta-1,3-glucan synthase versus glucanase activities. A proteomic analysis of an Arabidopsis thaliana plasmodesmata (Pd)-rich fraction identified a beta-1,3-glucanase as present in this fraction. The protein encoded by the putative plasmodesmal associated protein (ppap) gene, termed AtBG_ppap, had previously been found to be a post-translationally modified glycosylphosphatidylinositol (GPI) lipid-anchored protein. When fused to green fluorescent protein (GFP) and expressed in tobacco (Nicotiana tabacum) or Nicotiana benthamiana epidermal cells, this protein displays fluorescence patterns in the endoplasmic reticulum (ER) membrane system, along the cell periphery and in a punctate pattern that co-localizes with aniline blue-stained callose present around the Pd. Plasma membrane localization was verified by co-localization of AtBG_ppap:GFP together with a plasma membrane marker N-[3-triethylammoniumpropyl]-4-[p-diethylaminophenylhexatrienyl] pyridinium dibromide (FM4-64) in plasmolysed cells. In Arabidopsis T-DNA insertion mutants that do not transcribe AtBG_ppap, functional studies showed that GFP cell-to-cell movement between epidermal cells is reduced, and the conductivity coefficient of Pd is lower. Measurements of callose levels around Pd after wounding revealed that callose accumulation in the mutant plants was higher. Taken together, we suggest that AtBG_ppap is a Pd-associated membrane protein involved in plasmodesmal callose degradation, and functions in the gating of Pd.

  16. Main: 1L6H [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available cule: Non-Specific Lipid Transfer Protein; Chain: A; Synonym: Ltp2 Lipid Transport D.Samuel, P.-C.Lyu D.Samu... SWS:P83210,P83210|PDB; 1L6H; NMR; A=1-69.|Gramene; P83210; -.|InterPro; IPR003612; AAI.|Pfam; PF00234; Tryp..._alpha_amyl; 1.|SMART; SM00499; AAI; 1. Nmr, Minimized Average Structure Length: 69 AA, Molecular weight: 7009 Da AGCNAGQLTVCTGAI

  17. Complete Genome Sequence of Spiroplasma floricola 23-6T (ATCC 29989), a Bacterium Isolated from a Tulip Tree (Liriodendron tulipifera L.).

    Science.gov (United States)

    Tsai, Yi-Ming; Wu, Pei-Shan; Lo, Wen-Sui; Kuo, Chih-Horng

    2018-04-19

    Spiroplasma floricola 23-6 T (ATCC 29989) was isolated from the flower surface of a tulip tree ( Liriodendron tulipifera L.). Here, we report the complete genome sequence of this bacterium to facilitate the investigation of its biology and the comparative genomics among Spiroplasma species. Copyright © 2018 Tsai et al.

  18. Regulation of synaptic structure by ubiquitin C-terminal hydrolase L1.

    Science.gov (United States)

    Cartier, Anna E; Djakovic, Stevan N; Salehi, Afshin; Wilson, Scott M; Masliah, Eliezer; Patrick, Gentry N

    2009-06-17

    Ubiquitin C-terminal hydrolase L1 (UCH-L1) is a deubiquitinating enzyme that is selectively and abundantly expressed in the brain, and its activity is required for normal synaptic function. Here, we show that UCH-L1 functions in maintaining normal synaptic structure in hippocampal neurons. We found that UCH-L1 activity is rapidly upregulated by NMDA receptor activation, which leads to an increase in the levels of free monomeric ubiquitin. Conversely, pharmacological inhibition of UCH-L1 significantly reduces monomeric ubiquitin levels and causes dramatic alterations in synaptic protein distribution and spine morphology. Inhibition of UCH-L1 activity increases spine size while decreasing spine density. Furthermore, there is a concomitant increase in the size of presynaptic and postsynaptic protein clusters. Interestingly, however, ectopic expression of ubiquitin restores normal synaptic structure in UCH-L1-inhibited neurons. These findings point to a significant role of UCH-L1 in synaptic remodeling, most likely by modulating free monomeric ubiquitin levels in an activity-dependent manner.

  19. Electrical sounding data inversion with minimum L-1 norm; Inversao de dados de sondagem eletrica minimizando a norma L1

    Energy Technology Data Exchange (ETDEWEB)

    Marinho, Jose Marcio Lins [Bahia Univ., Salvador, BA (Brazil). Inst. de Geociencias. Programa de Pesquisa e Pos-graduacao em Geociencias]|[Ceara Univ., Fortaleza, CE (Brazil). Dept. de Geologia; Lima, Olivar Antonio Lima de [Bahia Univ., Salvador, BA (Brazil). Inst. de Geociencias. Programa de Pesquisa e Pos-graduacao em Geociencias

    1995-12-31

    The steepest descent and the damped least squares are the most used methods for inverting electrical sounding data. Normally, such inversions are made in the apparent resistivity domain using the norm L{sub 2}. For one dimensional earth models we present a new inversion scheme based on the minimization of norm L{sub 1} applied in the logarithmic domain. In the steepest descent case, the implementation of the L{sub 1} norm consists essentially in computing partial derivatives of the objective function with respect to the model parameters. In the second case, referred here as the damped least absolute deviation, the implementation is done via an interactively reweighed least square procedure. Several inversions were done for the Schlumberger array using both theoretical and field data. The results are very promising and attest the robustness of the L{sub 1} norm. A comparative performance study of the both norms are in progress using more than 140 Schlumberger soundings obtained in a groundwater exploration program in the area of Itarema-Acarau, Ceara State, Brazil. (author). 9 refs., 3 figs

  20. Involvement of Fenton chemistry in rice straw degradation by the lignocellulolytic bacterium Pantoea ananatis Sd-1.

    Science.gov (United States)

    Ma, Jiangshan; Zhang, Keke; Huang, Mei; Hector, Stanton B; Liu, Bin; Tong, Chunyi; Liu, Qian; Zeng, Jiarui; Gao, Yan; Xu, Ting; Liu, Ying; Liu, Xuanming; Zhu, Yonghua

    2016-01-01

    Lignocellulolytic bacteria have revealed to be a promising source for biofuel production, yet the underlying mechanisms are still worth exploring. Our previous study inferred that the highly efficient lignocellulose degradation by bacterium Pantoea ananatis Sd-1 might involve Fenton chemistry (Fe 2+  + H 2 O 2  + H +  → Fe 3+  + OH· + H 2 O), similar to that of white-rot and brown-rot fungi. The aim of this work is to investigate the existence of this Fenton-based oxidation mechanism in the rice straw degradation process of P. ananatis Sd-1. After 3 days incubation of unpretreated rice straw with P. ananatis Sd-1, the percentage in weight reduction of rice straw as well as its cellulose, hemicellulose, and lignin components reached 46.7, 43.1, 42.9, and 37.9 %, respectively. The addition of different hydroxyl radical scavengers resulted in a significant decline ( P  Fenton reagent treatment. In addition to the increased total iron ion concentration throughout the rice straw decomposition process, the Fe 3+ -reducing capacity of P. ananatis Sd-1 was induced by rice straw and predominantly contributed by aromatic compounds metabolites. The transcript levels of the glucose-methanol-choline oxidoreductase gene related to hydrogen peroxide production were significantly up-regulated (at least P  Fenton-like reactions. Our results confirmed the Fenton chemistry-assisted degradation model in P. ananatis Sd-1. We are among the first to show that a Fenton-based oxidation mechanism exists in a bacteria degradation system, which provides a new perspective for how natural plant biomass is decomposed by bacteria. This degradative system may offer an alternative approach to the fungi system for lignocellulosic biofuels production.

  1. Fire-related post-traumatic stress disorder: brain 1H-MR spetroscopic findings

    International Nuclear Information System (INIS)

    Lim, Myung Kwan; Suh, Chang Hae; Kim, Hyung Jin; Kim, Sung Tae; Lee, Jeong Seop; Kang, Min Hee; Kim, Ji Hye; Lee, Jung Hee

    2003-01-01

    To investigate the MR imaging and 1 H-MR spectroscopic findings of acute fire-related post-traumatic stress disorder (PTSD). Sixteen patients (M:F=10:6; mean age, 16 years) with fire-related PTSD underwent MR imagine and 1 H-MR spectroscopy, and for control purposes, the procedures were repeated in eight age-matched normal volunteers. In all patients and controls, the regions of interest where data were acquired at MRS were the basal ganglia (BG), frontal periventricular white matter (FWM), and parietal periventricular white matter (PWM). In all patients with PTSD, MR images appeared normal. In contrast, MRS showed that in the BG, NAA/Cr ratios were significantly lower in patients than in volunteers. This decrease did not, however, show close correlation with the severity of the neuropsychiatric symptoms. In patients, neither NAA/Cr ratios in FWM nor PWM, nor Cho/Cr ratios in all three regions, were significantly different from those in the control group. Decreased NAA/Cr ratios in the BG, as seen at 1 H-MRS, might be an early sign of acute fire-related PTSD

  2. PRMT1-mediated arginine methylation controls ATXN2L localization

    Energy Technology Data Exchange (ETDEWEB)

    Kaehler, Christian; Guenther, Anika; Uhlich, Anja; Krobitsch, Sylvia, E-mail: krobitsc@molgen.mpg.de

    2015-05-15

    Arginine methylation is a posttranslational modification that is of importance in diverse cellular processes. Recent proteomic mass spectrometry studies reported arginine methylation of ataxin-2-like (ATXN2L), the paralog of ataxin-2, a protein that is implicated in the neurodegenerative disorder spinocerebellar ataxia type 2. Here, we investigated the methylation state of ATXN2L and its significance for ATXN2L localization. We first confirmed that ATXN2L is asymmetrically dimethylated in vivo, and observed that the nuclear localization of ATXN2L is altered under methylation inhibition. We further discovered that ATXN2L associates with the protein arginine-N-methyltransferase 1 (PRMT1). Finally, we showed that neither mutation of the arginine–glycine-rich motifs of ATXN2L nor methylation inhibition alters ATXN2L localization to stress granules, suggesting that methylation of ATXN2L is probably not mandatory. - Highlights: • ATXN2L is asymmetrically dimethylated in vivo. • ATXN2L interacts with PRMT1 under normal and stress conditions. • PRMT1-mediated dimethylation of ATXN2L controls its nuclear localization. • ATXN2L localization to stress granules appears independent of its methylation state.

  3. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  4. Associations between blood glucose level and outcomes of adult in-hospital cardiac arrest: a retrospective cohort study.

    Science.gov (United States)

    Wang, Chih-Hung; Huang, Chien-Hua; Chang, Wei-Tien; Tsai, Min-Shan; Yu, Ping-Hsun; Wu, Yen-Wen; Chen, Wen-Jone

    2016-08-24

    We intended to analyse the associations between blood glucose (BG) level and clinical outcomes of in-hospital cardiac arrest (IHCA). We conducted a retrospective observational study in a single medical centre and evaluated patients who experienced IHCA between 2006 and 2014. We used multivariable logistic regression analysis to study associations between independent variables and outcomes. We calculated the mean BG level for each patient by averaging the maximum and minimum BG levels in the first 24 h after arrest, and we used mean BG level for our final analysis. We included a total of 402 patients. Of these, 157 patients (39.1 %) had diabetes mellitus (DM). The average mean BG level was 209.9 mg/dL (11.7 mmol/L). For DM patients, a mean BG level between 183 and 307 mg/dL (10.2-17.1 mmol/L) was significantly associated with favourable neurological outcome (odds ratio [OR] 2.71, 95 % confidence interval [CI] 1.18-6.20; p value = 0.02); a mean BG level between 147 and 317 mg/dL (8.2-17.6 mmol/L) was significantly associated with survival to hospital discharge (OR 2.38, 95 % CI 1.26-4.53; p value = 0.008). For non-DM patients, a mean BG level between 143 and 268 mg/dL (7.9-14.9 mmol/L) was significantly associated with survival to hospital discharge (OR 2.93, 95 % CI 1.62-5.40; p value level in the first 24 h after cardiac arrest was associated with neurological outcome for IHCA patients with DM. For neurological and survival outcomes, the optimal BG range may be higher for patients with DM than for patients without DM.

  5. L1 retrotransposition is activated by Ten-eleven-translocation protein 1 and repressed by methyl-CpG binding proteins.

    Science.gov (United States)

    Zhang, Peng; Ludwig, Anne K; Hastert, Florian D; Rausch, Cathia; Lehmkuhl, Anne; Hellmann, Ines; Smets, Martha; Leonhardt, Heinrich; Cardoso, M Cristina

    2017-09-03

    One of the major functions of DNA methylation is the repression of transposable elements, such as the long-interspersed nuclear element 1 (L1). The underlying mechanism(s), however, are unclear. Here, we addressed how retrotransposon activation and mobilization are regulated by methyl-cytosine modifying ten-eleven-translocation (Tet) proteins and how this is modulated by methyl-CpG binding domain (MBD) proteins. We show that Tet1 activates both, endogenous and engineered L1 retrotransposons. Furthermore, we found that Mecp2 and Mbd2 repress Tet1-mediated activation of L1 by preventing 5hmC formation at the L1 promoter. Finally, we demonstrate that the methyl-CpG binding domain, as well as the adjacent non-sequence specific DNA binding domain of Mecp2 are each sufficient to mediate repression of Tet1-induced L1 mobilization. Our study reveals a mechanism how L1 elements get activated in the absence of Mecp2 and suggests that Tet1 may contribute to Mecp2/Mbd2-deficiency phenotypes, such as the Rett syndrome. We propose that the balance between methylation "reader" and "eraser/writer" controls L1 retrotransposition.

  6. Synthesis, crystal structure and properties of [Co(L2](ClO42 (L=1,3-bis(1H-benzimidazol-2-yl-2-oxapropane

    Directory of Open Access Journals (Sweden)

    Tavman Aydin

    2015-01-01

    Full Text Available The reaction of 1,3-bis(1H-benzimidazol-2-yl-2-oxapropane (L with Co(ClO42•6H2O in absolute ethanol produces di[1,3-bis(1H-benzimidazol-2-yl-2-oxapropane-k2N,N’]cobalt(IIdiperchlorate chelate complex ([Co(L2](ClO42, 1. The complex 1 was characterized by elemental analysis, magnetic moment, molar conductivity, thermogravimetric analysis, FT-IR, UV-visible, mass spectrometry, and its solid state structure was determined by single crystal X-ray diffraction. According to the thermogravimetric analysis data, there is no any water coordinated or uncoordinated in 1 as well as elemental analysis. The complex 1 has 1:2 M:L ionic characteristic according to the molar conductivity. In the complex, the distances between the cobalt and the ethereal oxygen atoms (Co1-O2: 2.805(3; Co2-O1: 2.752(2 Å show the semi-coordination bonding and the Co(II ion is six-coordinated with a N4O2 ligand set, resulting in a distorted octahedron.

  7. (1→3)-β-d-Glucan and Galactomannan for Differentiating Chemical "Black Particles" and Fungal Particles Inside Peritoneal Dialysis Tubing.

    Science.gov (United States)

    Leelahavanichkul, Asada; Pongpirul, Krit; Thongbor, Nisa; Worasilchai, Navaporn; Petphuak, Kwanta; Thongsawang, Bussakorn; Towannang, Piyaporn; Lorvinitnun, Pichet; Sukhontasing, Kanya; Katavetin, Pisut; Praditpornsilpa, Kearkiat; Eiam-Ong, Somchai; Chindamporn, Ariya; Kanjanabuch, Talerngsak

    2016-01-01

    ♦ Aseptic, sheet-like foreign bodies observed inside Tenckhoff (TK) catheter lumens (referred to as "black particles") are, on gross morphology, hardly distinguishable from fungal colonization because these contaminants adhere tightly to the catheter. Detection of fungal cell wall components using (1→3)-β-d-glucan (BG) and galactomannan index (GMI) might be an alternative method for differentiating the particles. ♦ Foreign particles retrieved from TK catheters in 19 peritoneal dialysis patients were examined microscopically and cultured for fungi and bacteria. Simultaneously, a Fungitell test (Associates of Cape Cod, Falmouth, MA, USA) and a Platelia Aspergillus ELISA assay (Bio-Rad Laboratories, Marnes-La-Coquette, France) were used to test the spent dialysate for BG and GMI respectively. ♦ Of the 19 patients, 9 had aseptic black particles and 10 had fungal particles in their tubing. The fungal particles looked grainy, were tightly bound to the catheter, and appeared more "colorful" than the black particles, which looked sheet-like and could easily be removed by milking the tubing. Compared with effluent from patients having aseptic particles, effluent from patients with fungal particles had significantly higher levels of BG (501 ± 70 pg/mL vs. 46 ± 10 pg/mL) and GMI (10.98 ± 2.17 vs. 0.25 ± 0.05). Most of the fungi that formed colonies inside the catheter lumen were molds not usually found in clinical practice, but likely from water or soil, suggesting environmental contamination. Interestingly, in all 10 patients with fungal colonization, visualization of black particles preceded a peritonitis episode and TK catheter removal by approximately 1-3 weeks; in patients with aseptic particles, a 17-week onset to peritonitis was observed. ♦ In all patients with particle-coated peritoneal dialysis tubing, spent dialysate should be screened for BG and GMI. Manipulation of the TK catheter by squeezing, hard flushing, or even brushing to dislodge black

  8. Text message-based diabetes self-management support (SMS4BG): study protocol for a randomised controlled trial.

    Science.gov (United States)

    Dobson, Rosie; Whittaker, Robyn; Jiang, Yannan; Shepherd, Matthew; Maddison, Ralph; Carter, Karen; Cutfield, Richard; McNamara, Catherine; Khanolkar, Manish; Murphy, Rinki

    2016-04-02

    Addressing the increasing prevalence, and associated disease burden, of diabetes is a priority of health services internationally. Interventions to support patients to effectively self-manage their condition have the potential to reduce the risk of costly and debilitating complications. The utilisation of mobile phones to deliver self-management support allows for patient-centred care at the frequency and intensity that patients desire from outside the clinic environment. Self-Management Support for Blood Glucose (SMS4BG) is a novel text message-based intervention for supporting people with diabetes to improve self-management behaviours and achieve better glycaemic control and is tailored to individual patient preferences, demographics, clinical characteristics, and culture. This study aims to assess whether SMS4BG can improve glycaemic control in adults with poorly controlled diabetes. This paper outlines the rationale and methods of the trial. A two-arm, parallel, randomised controlled trial will be conducted across New Zealand health districts. One thousand participants will be randomised at a 1:1 ratio to receive SMS4BG, a theoretically based and individually tailored automated text message-based diabetes self-management support programme (intervention) in addition to usual care, or usual care alone (control). The primary outcome is change in glycaemic control (HbA1c) at 9 months. Secondary outcomes include glycaemic control at 3 and 6 months, self-efficacy, self-care behaviours, diabetes distress, health-related quality of life, perceived social support, and illness perceptions. Cost information and healthcare utilisation will also be collected as well as intervention satisfaction and interaction. This study will provide information on the effectiveness of a text message-based self-management support tool for people with diabetes. If found to be effective it has the potential to provide individualised support to people with diabetes across New Zealand (and

  9. The PD-1/PD-L1 complex resembles the antigen-binding Fv domains of antibodies and T cell receptors

    Energy Technology Data Exchange (ETDEWEB)

    Lin, David Yin-wei; Tanaka, Yoshimasa; Iwasaki, Masashi; Gittis, Apostolos G.; Su, Hua-Poo; Mikami, Bunzo; Okazaki, Taku; Honjo, Tasuku; Minato, Nagahiro; Garboczi, David N. (NIH); (Kyoto)

    2008-07-29

    Signaling through the programmed death 1 (PD-1) inhibitory receptor upon binding its ligand, PD-L1, suppresses immune responses against autoantigens and tumors and plays an important role in the maintenance of peripheral immune tolerance. Release from PD-1 inhibitory signaling revives 'exhausted' virus-specific T cells in chronic viral infections. Here we present the crystal structure of murine PD-1 in complex with human PD-L1. PD-1 and PD-L1 interact through the conserved front and side of their Ig variable (IgV) domains, as do the IgV domains of antibodies and T cell receptors. This places the loops at the ends of the IgV domains on the same side of the PD-1/PD-L1 complex, forming a surface that is similar to the antigen-binding surface of antibodies and T cell receptors. Mapping conserved residues allowed the identification of residues that are important in forming the PD-1/PD-L1 interface. Based on the structure, we show that some reported loss-of-binding mutations involve the PD-1/PD-L1 interaction but that others compromise protein folding. The PD-1/PD-L1 interaction described here may be blocked by antibodies or by designed small-molecule drugs to lower inhibitory signaling that results in a stronger immune response. The immune receptor-like loops offer a new surface for further study and potentially the design of molecules that would affect PD-1/PD-L1 complex formation and thereby modulate the immune response.

  10. House dust mite induces expression of intercellular adhesion molecule-1 in EoL-1 human eosinophilic leukemic cells.

    Science.gov (United States)

    Kwon, Byoung Chul; Sohn, Myung Hyun; Kim, Kyung Won; Kim, Eun Soo; Kim, Kyu-Earn; Shin, Myeong Heon

    2007-10-01

    The house dust mite (HDM) is considered to be the most common indoor allergen associated with bronchial asthma. In this study, we investigated whether crude extract of the HDM Dermatophagoides farinae could activate human eosinophilic leukemic cells (EoL-1) to induce upregulation of cell-surface adhesion molecules. When EoL-1 cells were incubated with D. farinae extract, expression of intercellular adhesion molecule-1 (ICAM-1) significantly increased on the cell surfaces compared to cells incubated with medium alone. In contrast, surface expression of CD11b and CD49d in EoL-1 cells was not affected by D. farinae extract. In addition, pretreatment of cells with NF-kappaB inhibitor (MG-132) or JNK inhibitor (SP600125) significantly inhibited ICAM-1 expression promoted by HDM extract. However, neither p38 MAP kinase inhibitor nor MEK inhibitor prevented HDM-induced ICAM-1 expression in EoL-1 cells. These results suggest that crude extract of D. farinae induces ICAM-1 expression in EoL-1 cells through signaling pathways involving both NF-kappaB and JNK.

  11. Insights into Brevibacillus borstelensis AK1 through Whole Genome Sequencing: A Thermophilic Bacterium Isolated from a Hot Spring in Saudi Arabia

    KAUST Repository

    Khalil, Amjad B.

    2018-05-24

    Brevibacillus borstelensis AK1 is a thermophile which grows between the temperatures of 45°C and 70°C. The present study is an extended genome report of B. borstelensis AK1 along with the morphological characterization. The strain is isolated from a hot spring in Saudi Arabia (southeast of the city Gazan). It is observed that the strain AK1 is rod-shaped, motile, and strictly aerobic bacterium. The whole genome sequence resulted in 29 contigs with a total length of 5,155,092 bp. In total, 3,946 protein-coding genes and 139 RNA genes were identified. Comparison with the previously submitted strains of B. borstelensis strains illustrates that strain AK1 has a small genome size but high GC content. The strain possesses putative genes for degradation of a wide range of substrates including polyethylene (plastic) and long-chain hydrocarbons. These genomic features may be useful for future environmental/biotechnological applications.

  12. Insights into Brevibacillus borstelensis AK1 through Whole Genome Sequencing: A Thermophilic Bacterium Isolated from a Hot Spring in Saudi Arabia

    KAUST Repository

    Khalil, Amjad B.; Neelamegam, Sivakumar; Arslan, Muhammad; Saleem, Hamna; Alqarawi, Sami

    2018-01-01

    Brevibacillus borstelensis AK1 is a thermophile which grows between the temperatures of 45°C and 70°C. The present study is an extended genome report of B. borstelensis AK1 along with the morphological characterization. The strain is isolated from a hot spring in Saudi Arabia (southeast of the city Gazan). It is observed that the strain AK1 is rod-shaped, motile, and strictly aerobic bacterium. The whole genome sequence resulted in 29 contigs with a total length of 5,155,092 bp. In total, 3,946 protein-coding genes and 139 RNA genes were identified. Comparison with the previously submitted strains of B. borstelensis strains illustrates that strain AK1 has a small genome size but high GC content. The strain possesses putative genes for degradation of a wide range of substrates including polyethylene (plastic) and long-chain hydrocarbons. These genomic features may be useful for future environmental/biotechnological applications.

  13. ANALYSIS OF IMMUNE RESPONSES ON TRANSGENIC TIGER SHRIMP (Penaeus monodon AGAINST PATHOGENIC BACTERIUM Vibrio harveyi

    Directory of Open Access Journals (Sweden)

    Andi Parenrengi

    2014-06-01

    Full Text Available Vibriosis is one of main diseases of the black tiger shrimp Penaeus monodon infected by pathogenic bioluminous bacterium Vibrio harveyi that can cause mass mortalities in shrimp culture. The bacteria can also trigger the disease white spot syndrome virus (WSSV. An effort to produce shrimp disease-resistant strains has been done through transgenesis technology with antiviral gene transfection. By this technology, it is expected an increase in the immune response of shrimp in a variety of diseasecausing pathogens. This study aimed to determine the immune responses (total haemocytes, haemocyte differentiation, and phenoloxydase activity of transgenic tiger shrimp against pathogenic bacterium V. harveyi. Research using completely randomized design, which consists of two treatments and three replications. Test animals being used were transgenic and non-transgenic shrimp with size, weight 3.93±1.25 g and a total length of 7.59±0.87 cm. Treatments being tested were the injection of bacterium V. harveyi (density of 5x106 cfu/mL of 0.1 mL/individual on transgenic (A and non-transgenic shrimp (B. Immune response parameters such as total haemocytes, haemocyte differentiation, and phenoloxydase activity were observed on day 1, 3, and 6 days after challenging. Data were analyzed using t-test by SPSS software. The results showed that the total haemocyte of transgenic shrimp was not significantly different (P>0.05 from non-transgenic shrimp, but haemocyte differentiation and phenoloxydase activity were significantly different (P<0.05 especially on sixth days after being exposed to the bioluminescent bacteria. The study results implied that transgenic shrimp has a better immune response compared than non-transgenic shrimp.

  14. Fermentation products of solvent tolerant marine bacterium Moraxella spp. MB1 and its biotechnological applications in salicylic acid bioconversion.

    Directory of Open Access Journals (Sweden)

    Solimabi Wahidullah

    Full Text Available As part of a proactive approach to environmental protection, emerging issues with potential impact on the environment is the subject of ongoing investigation. One emerging area of environmental research concerns pharmaceuticals like salicylic acid, which is the main metabolite of various analgesics including aspirin. It is a common component of sewage effluent and also an intermediate in the degradation pathway of various aromatic compounds which are introduced in the marine environment as pollutants. In this study, biotransformation products of salicylic acid by seaweed, Bryopsis plumosa, associated marine bacterium, Moraxella spp. MB1, have been investigated. Phenol, conjugates of phenol and hydroxy cinnamic acid derivatives (coumaroyl, caffeoyl, feruloyl and trihydroxy cinnamyl with salicylic acid (3-8 were identified as the bioconversion products by electrospray ionization mass spectrometry. These results show that the microorganism do not degrade phenolic acid but catalyses oxygen dependent transformations without ring cleavage. The degradation of salicylic acid is known to proceed either via gentisic acid pathway or catechol pathway but this is the first report of biotransformation of salicylic acid into cinnamates, without ring cleavage. Besides cinnamic acid derivatives (9-12, metabolites produced by the bacterium include antimicrobial indole (13 and β-carbolines, norharman (14, harman (15 and methyl derivative (16, which are beneficial to the host and the environment.

  15. Reviving the Dead: History and Reactivation of an Extinct L1

    OpenAIRE

    Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly

    2014-01-01

    Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accomm...

  16. Characterization of the novel dimethyl sulfide-degrading bacterium Alcaligenes sp. SY1 and its biochemical degradation pathway

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Yiming; Qiu, Jiguo; Chen, Dongzhi; Ye, Jiexu; Chen, Jianmeng, E-mail: jchen@zjut.edu.cn

    2016-03-05

    Highlights: • A novel efficient DMS-degrading bacterium Alcaligenes sp. SY1 was identified. • A RSM was applied to optimize incubation condition of Alcaligenes sp. SY1. • SIP was applied as C{sup 13} labelled DMS to trace intermediates during DMS degradation. • Kinetics of DMS degradation via batch experiment was revealed. • Carbon and sulfur balance were analyzed during DMS degradation process. - Abstract: Recently, the biodegradation of volatile organic sulfur compounds (VOSCs) has become a burgeoning field, with a growing focus on the reduction of VOSCs. The reduction of VOSCs encompasses both organic emission control and odor control. Herein, Alcaligenes sp. SY1 was isolated from active sludge and found to utilize dimethyl sulfide (DMS) as a growth substrate in a mineral salt medium. Response surface methodology (RSM) analysis was applied to optimize the incubation conditions. The following conditions for optimal degradation were identified: temperature 27.03 °C; pH 7.80; inoculum salinity 0.84%; and initial DMS concentration 1585.39 μM. Under these conditions, approximately 99% of the DMS was degraded within 30 h of incubation. Two metabolic compounds were detected and identified by gas chromatography–mass spectrometry (GC–MS): dimethyl disulfide (DMDS) and dimethyl trisulfide (DMTS). The DMS degradation kinetics for different concentrations were evaluated using the Haldane–Andrews model and the pseudo first-order model. The maximum specific growth rate and degradation rate of Alcaligenes sp. SY1 were 0.17 h{sup −1} and 0.63 gs gx{sup −1} h{sup −1}. A possible degradation pathway is proposed, and the results suggest that Alcaligenes sp. SY1 has the potential to control odor emissions under aerobic conditions.

  17. The roles of MCP-1 and protein kinase C delta activation in human eosinophilic leukemia EoL-1 cells.

    Science.gov (United States)

    Lee, Ji-Sook; Yang, Eun Ju; Kim, In Sik

    2009-12-01

    Idiopathic hypereosinophilc syndrome is a disorder associated with clonally eosinophilic proliferation. The importance of FIP1-like-1-platelet-derived growth factor receptor-alpha (FIP1L1-PDGFRA) in the pathogenesis and classification of HES has been recently reported. In this study, we investigated the contribution of monocyte chemoattractant protein-1 (MCP-1)/CCL2 to chemotactic activity and protein kinase C delta (PKC delta in the human eosinophilic leukemia cell line EoL-1. These cells express CCR2 protein among the CC chemokine receptors (CCR1-5). MCP-1 induces strong migration of EoL-1 cells and the chemotaxis signal in response to MCP-1 involves a G(i)/G(o) protein, phospholipase C (PLC), PKC delta, p38 MAPK and NF-kappaB. MCP-1 activates p38 MAPK via G(i)/G(o) protein, PLC and PKC delta cascade. MCP-1 also induces NF-kappaB translocation and the activation is inhibited by PKC delta activation. The increase in the basal expression and activity of PKC delta in EoL-1 cells, compared to normal eosinophils, inhibits apoptosis in EoL-1 cells. Anti-apoptotic mechanism of PKC delta is related to inhibition of caspase 3 and caspase 9, but not to FIP1L1-PDGFRA. PKC delta functions as an anti-apoptotic molecule, and is involved in EoL-1 cell movement stimulated by MCP-1. This study contributes to an understanding of MCP-1 in eosinophil biology and pathogenic mechanism of eosinophilic disorders.

  18. Cloning and expression analysis of genes encoding lytic endopeptidases L1 and L5 from Lysobacter sp. strain XL1.

    Science.gov (United States)

    Lapteva, Y S; Zolova, O E; Shlyapnikov, M G; Tsfasman, I M; Muranova, T A; Stepnaya, O A; Kulaev, I S; Granovsky, I E

    2012-10-01

    Lytic enzymes are the group of hydrolases that break down structural polymers of the cell walls of various microorganisms. In this work, we determined the nucleotide sequences of the Lysobacter sp. strain XL1 alpA and alpB genes, which code for, respectively, secreted lytic endopeptidases L1 (AlpA) and L5 (AlpB). In silico analysis of their amino acid sequences showed these endopeptidases to be homologous proteins synthesized as precursors similar in structural organization: the mature enzyme sequence is preceded by an N-terminal signal peptide and a pro region. On the basis of phylogenetic analysis, endopeptidases AlpA and AlpB were assigned to the S1E family [clan PA(S)] of serine peptidases. Expression of the alpA and alpB open reading frames (ORFs) in Escherichia coli confirmed that they code for functionally active lytic enzymes. Each ORF was predicted to have the Shine-Dalgarno sequence located at a canonical distance from the start codon and a potential Rho-independent transcription terminator immediately after the stop codon. The alpA and alpB mRNAs were experimentally found to be monocistronic; transcription start points were determined for both mRNAs. The synthesis of the alpA and alpB mRNAs was shown to occur predominantly in the late logarithmic growth phase. The amount of alpA mRNA in cells of Lysobacter sp. strain XL1 was much higher, which correlates with greater production of endopeptidase L1 than of L5.

  19. HIV-1 neutralizing antibodies induced by native-like envelope trimers

    NARCIS (Netherlands)

    Sanders, Rogier W.; van Gils, Marit J.; Derking, Ronald; Sok, Devin; Ketas, Thomas J.; Burger, Judith A.; Ozorowski, Gabriel; Cupo, Albert; Simonich, Cassandra; Goo, Leslie; Arendt, Heather; Kim, Helen J.; Lee, Jeong Hyun; Pugach, Pavel; Williams, Melissa; Debnath, Gargi; Moldt, Brian; van Breemen, Mariëlle J.; Isik, Gözde; Medina-Ramírez, Max; Back, Jaap Willem; Koff, Wayne C.; Julien, Jean-Philippe; Rakasz, Eva G.; Seaman, Michael S.; Guttman, Miklos; Lee, Kelly K.; Klasse, Per Johan; Labranche, Celia; Schief, William R.; Wilson, Ian A.; Overbaugh, Julie; Burton, Dennis R.; Ward, Andrew B.; Montefiori, David C.; Dean, Hansi; Moore, John P.

    2015-01-01

    A challenge for HIV-1 immunogen design is the difficulty of inducing neutralizing antibodies (NAbs) against neutralization-resistant (tier 2) viruses that dominate human transmissions. We show that a soluble recombinant HIV-1 envelope glycoprotein trimer that adopts a native conformation, BG505

  20. Dual inhibition of STAT1 and STAT3 activation downregulates expression of PD-L1 in human breast cancer cells.

    Science.gov (United States)

    Sasidharan Nair, Varun; Toor, Salman M; Ali, Bassam R; Elkord, Eyad

    2018-05-02

    Breast cancer is the most commonly diagnosed cancer, and it is a leading cause of cancer-related deaths in females worldwide. Triple-negative breast cancer (TNBC) constitutes 15% of breast cancer and shows distinct metastasis profiles with poor prognosis. Strong PD-L1 expression has been observed in some tumors, supporting their escape from immune surveillance. Targeting PD-L1 could be a promising therapeutic approach in breast cancer patients. We investigated potential molecular mechanisms for constitutive expression of PD-L1 by inhibiting upstream STAT1 and STAT3 signals. PD-L1 expression in three breast cancer cell lines was measured using quantitative PCR and western blotting. Activation of STAT1 and STAT3 was blocked using pharmacological inhibitors and siRNA. The mechanism underlying the constitutive expression of PD-L1 was investigated using ChIP and co-immunoprecipitation assays. We found that individual inhibition of STAT1 and STAT3 activation partially downregulated PD-L1, while combined inhibition completely downregulated PD-L1 expression. Moreover, our results suggest that pSTAT1-pSTAT3 dimerize in cytosol and translocate to the nucleus, where they bind to PD-L1 promoter and induce PD-L1 expression. These findings provide a rationale for combined targeting of STAT1 and STAT3 for the development of immune-based cancer therapies for down regulation of PD-L1 expression.

  1. Enhancement of cadmium bioremediation by endophytic bacterium Bacillus sp. L14 using industrially used metabolic inhibitors (DCC or DNP)

    International Nuclear Information System (INIS)

    Luo Shenglian; Xiao Xiao; Xi Qiang; Wan Yong; Chen Liang; Zeng Guangming; Liu Chengbin; Guo Hanjun; Chen Jueliang

    2011-01-01

    Bioremediations of cadmium by endophytic bacterium (EB) L14 (Bacillus sp.) in the presence of industrially used metabolic inhibitors (DCC or DNP) were investigated. In the presence of DCC or DNP, the biomass population of EB L14 was greatly inhibited. However, the cadmium removal of EB L14 increased from 73.6% (in the absence of DCC or DNP) to 93.7% and 80.8%, respectively. The analysis of total and intracellular cadmium concentrations during 24 h of incubation indicated that this enhanced cadmium removal was the inhibition effect of DCC or DNP on the cations export resistance system of EB L14. This unique property strongly indicated the superiority of this endophyte for practical application in cadmium bioremediation in the presence of industrially used metabolic inhibitors.

  2. PD-L1 Deficiency within Islets Reduces Allograft Survival in Mice.

    Directory of Open Access Journals (Sweden)

    Dongxia Ma

    Full Text Available Islet transplantation may potentially cure type 1 diabetes mellitus (T1DM. However, immune rejection, especially that induced by the alloreactive T-cell response, remains a restraining factor for the long-term survival of grafted islets. Programmed death ligand-1 (PD-L1 is a negative costimulatory molecule. PD-L1 deficiency within the donor heart accelerates allograft rejection. Here, we investigate whether PD-L1 deficiency in donor islets reduces allograft survival time.Glucose Stimulation Assays were performed to evaluate whether PD-L1 deficiency has detrimental effects on islet function. Islets isolated from PDL1-deficient mice or wild- type (WT mice (C57BL/6j were implanted beneath the renal capsule of streptozotocin (STZ-induced diabetic BALB/c mice. Blood glucose levels and graft survival time after transplantation were monitored. Moreover, we analyzed the residual islets, infiltrating immune cells and alloreactive cells from the recipients.PD-L1 deficiency within islets does not affect islet function. However, islet PD-L1 deficiency increased allograft rejection and was associated with enhanced inflammatory cell infiltration and recipient T-cell alloreactivity.This is the first report to demonstrate that PD-L1 deficiency accelerated islet allograft rejection and regulated recipient alloimmune responses.

  3. Structure of the Bacillus anthracis dTDP- L -rhamnose-biosynthetic enzyme glucose-1-phosphate thymidylyltransferase (RfbA)

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Jackson; Lee, Jesi; Halavaty, Andrei S.; Minasov, George; Anderson, Wayne F.; Kuhn, Misty L. (NWU); (SFSU)

    2017-10-30

    L-Rhamnose is a ubiquitous bacterial cell-wall component. The biosynthetic pathway for its precursor dTDP-L-rhamnose is not present in humans, which makes the enzymes of the pathway potential drug targets. In this study, the three-dimensional structure of the first protein of this pathway, glucose-1-phosphate thymidylyltransferase (RfbA), fromBacillus anthraciswas determined. In other organisms this enzyme is referred to as RmlA. RfbA was co-crystallized with the products of the enzymatic reaction, dTDP-α-D-glucose and pyrophosphate, and its structure was determined at 2.3 Å resolution. This is the first reported thymidylyltransferase structure from a Gram-positive bacterium. RfbA shares overall structural characteristics with known RmlA homologs. However, RfbA exhibits a shorter sequence at its C-terminus, which results in the absence of three α-helices involved in allosteric site formation. Consequently, RfbA was observed to exhibit a quaternary structure that is unique among currently reported glucose-1-phosphate thymidylyltransferase bacterial homologs. These structural analyses suggest that RfbA may not be allosterically regulated in some organisms and is structurally distinct from other RmlA homologs.

  4. IceBridge NSERC L1B Geolocated Meteorologic and Surface Temperature Data, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — The IceBridge National Suborbital Education & Research Center (NSERC) L1B Geolocated Meteorologic and Surface Temperature (IAMET1B) data set is a collection of...

  5. Expanding the Substrate Specificity of Thermoanaerobacter pseudoethanolicus Secondary Alcohol Dehydrogenase by a Dual Site Mutation

    KAUST Repository

    Musa, Musa M.; Bsharat, Odey; Karume, Ibrahim; Vieille, Claire; Takahashi, Masateru; Hamdan, Samir

    2017-01-01

    Here, we report the asymmetric reduction of selected phenyl-ring-containing ketones by various single and dual site mutants of Thermoanaerobacter pseudoethanolicus secondary alcohol dehydrogenase (TeSADH). Further expanding the size of the substrate binding pocket in the mutant W110A/I86A not only allowed substrates of the single mutants W110A and I86A to be accommodated within the expanded active site, but also expanded the enzyme's substrate range to ketones bearing two sterically demanding groups (bulky-bulky ketones), which are not substrates for TeSADH single mutants. We also report the regio- and enantioselective reduction of diketones using W110A/I86A TeSADH and single TeSADH mutants. The double mutant exhibited dual stereopreference generating the Prelog products most of the time and the anti-Prelog products in a few cases.

  6. Expanding the Substrate Specificity of Thermoanaerobacter pseudoethanolicus Secondary Alcohol Dehydrogenase by a Dual Site Mutation

    KAUST Repository

    Musa, Musa M.

    2017-12-14

    Here, we report the asymmetric reduction of selected phenyl-ring-containing ketones by various single and dual site mutants of Thermoanaerobacter pseudoethanolicus secondary alcohol dehydrogenase (TeSADH). Further expanding the size of the substrate binding pocket in the mutant W110A/I86A not only allowed substrates of the single mutants W110A and I86A to be accommodated within the expanded active site, but also expanded the enzyme\\'s substrate range to ketones bearing two sterically demanding groups (bulky-bulky ketones), which are not substrates for TeSADH single mutants. We also report the regio- and enantioselective reduction of diketones using W110A/I86A TeSADH and single TeSADH mutants. The double mutant exhibited dual stereopreference generating the Prelog products most of the time and the anti-Prelog products in a few cases.

  7. Synthesis and degradation properties of β-TCP/BG porous ...

    Indian Academy of Sciences (India)

    -TCP/BG porous composite materials were successfully fabricated by foaming technology. X-ray diffraction was used to determine the crystal structure of powders. The pore size and distribution of the resulting materials were characterized using scanning electron microscopy. The porosity and degradation performance of ...

  8. Down regulation of macrophage IFNGR1 exacerbates systemic L. monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Emily M Eshleman

    2017-05-01

    Full Text Available Interferons (IFNs target macrophages to regulate inflammation and resistance to microbial infections. The type II IFN (IFNγ acts on a cell surface receptor (IFNGR to promote gene expression that enhance macrophage inflammatory and anti-microbial activity. Type I IFNs can dampen macrophage responsiveness to IFNγ and are associated with increased susceptibility to numerous bacterial infections. The precise mechanisms responsible for these effects remain unclear. Type I IFNs silence macrophage ifngr1 transcription and thus reduce cell surface expression of IFNGR1. To test how these events might impact macrophage activation and host resistance during bacterial infection, we developed transgenic mice that express a functional FLAG-tagged IFNGR1 (fGR1 driven by a macrophage-specific promoter. Macrophages from fGR1 mice expressed physiologic levels of cell surface IFNGR1 at steady state and responded equivalently to WT C57Bl/6 macrophages when treated with IFNγ alone. However, fGR1 macrophages retained cell surface IFNGR1 and showed enhanced responsiveness to IFNγ in the presence of type I IFNs. When fGR1 mice were infected with the bacterium Listeria monocytogenes their resistance was significantly increased, despite normal type I and II IFN production. Enhanced resistance was dependent on IFNγ and associated with increased macrophage activation and antimicrobial function. These results argue that down regulation of myeloid cell IFNGR1 is an important mechanism by which type I IFNs suppress inflammatory and anti-bacterial functions of macrophages.

  9. Dicty_cDB: Contig-U02803-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available nF01.b1.ab1 PiTA - Interaction library bet... 44 6.5 1 ( EU795129 ) Uncultured Rickettsiales bacterium ANIW_...rary ... 58 4e-04 1 ( CX089074 ) EHADR85TR E. histolytica Normalized cDNA library ....ata genomic DNA chromosome 4. 46 0.21 2 ( DX429070 ) BE1082_N01_F IASMA L1 HindIII BAC library Viti... clone CH242-143I8, genomic sur... 38 0.26 2 ( DU785603 ) APKH1203.b2 HF770_12-21-03 uncultured marine mic...M... 48 0.41 1 ( DX017844 ) KBrB010H03F KBrB, Brassica rapa BamHI BAC library... 48 0.41 1 ( DU836813 ) MUGQ

  10. Photocatalytic properties of zinc sulfide nanocrystals biofabricated by metal-reducing bacterium Shewanella oneidensis MR-1

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiang [School of The Environment and Safety Engineering, Jiangsu University, Zhenjiang 212013 (China); State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150090 (China); Ma, Xiao-Bo [School of The Environment and Safety Engineering, Jiangsu University, Zhenjiang 212013 (China); Yuan, Hang [Key Laboratory of Ion Beam Bioengineering, Institute of Technical Biology & Agriculture Engineering, Chinese Academy of Sciences, Hefei 230031 (China); Liu, Peng-Cheng; Lei, Yu-Bin; Xu, Hui [School of The Environment and Safety Engineering, Jiangsu University, Zhenjiang 212013 (China); Du, Dao-Lin, E-mail: ddl@ujs.edu.cn [School of The Environment and Safety Engineering, Jiangsu University, Zhenjiang 212013 (China); State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150090 (China); Sun, Jian-Fan [School of The Environment and Safety Engineering, Jiangsu University, Zhenjiang 212013 (China); Feng, Yu-Jie, E-mail: yujief@hit.edu.cn [State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150090 (China)

    2015-05-15

    Highlights: • S. oneidensis MR-1 biofabricated ZnS nanocrystals using artificial wastewater. • ZnS nanocrystals were 5 nm in diameter and aggregated extracellularly. • ZnS had good catalytic activity in the degradation of RHB under UV irradiation. • Photogenerated holes mainly contributed to the degradation of RhB. - Abstract: Accumulation and utilization of heavy metals from wastewater by biological treatment system has aroused great interest. In the present study, a metal-reducing bacterium Shewanella oneidensis MR-1 was used to explore the biofabrication of ZnS nanocrystals from the artificial wastewater. The biogenic H{sub 2}S produced via the reduction of thiosulfate precipitated the Zn(II) as sulfide extracellularly. Characterization by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM), and field emission scanning electron microscope (FESEM) confirmed the precipitates as ZnS nanocrystals. The biogenic ZnS nanocrystals appeared spherical in shape with an average diameter of 5 nm and mainly aggregated in the medium and cell surface of S. oneidensis MR-1. UV–vis DRS spectra showed ZnS nanoparticles appeared a strong absorption below 360 nm. Thus, the photocatalytic activity of ZnS was evaluated by the photodegradation of rhodamine B (RhB) under UV irradiation. The biogenic ZnS nanocrystals showed a high level of photodegradation efficiency to RhB coupled with a significant blue-shift of maximum adsorption peak. A detailed analysis indicated the photogenerated holes, rather than hydroxyl radicals, contributed to the photocatalytic decolorization of RhB. This approach of coupling biosynthesis of nanoparticles with heavy metal removal may offer a potential avenue for efficient bioremediation of heavy metal wastewater.

  11. Photocatalytic properties of zinc sulfide nanocrystals biofabricated by metal-reducing bacterium Shewanella oneidensis MR-1

    International Nuclear Information System (INIS)

    Xiao, Xiang; Ma, Xiao-Bo; Yuan, Hang; Liu, Peng-Cheng; Lei, Yu-Bin; Xu, Hui; Du, Dao-Lin; Sun, Jian-Fan; Feng, Yu-Jie

    2015-01-01

    Highlights: • S. oneidensis MR-1 biofabricated ZnS nanocrystals using artificial wastewater. • ZnS nanocrystals were 5 nm in diameter and aggregated extracellularly. • ZnS had good catalytic activity in the degradation of RHB under UV irradiation. • Photogenerated holes mainly contributed to the degradation of RhB. - Abstract: Accumulation and utilization of heavy metals from wastewater by biological treatment system has aroused great interest. In the present study, a metal-reducing bacterium Shewanella oneidensis MR-1 was used to explore the biofabrication of ZnS nanocrystals from the artificial wastewater. The biogenic H 2 S produced via the reduction of thiosulfate precipitated the Zn(II) as sulfide extracellularly. Characterization by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM), and field emission scanning electron microscope (FESEM) confirmed the precipitates as ZnS nanocrystals. The biogenic ZnS nanocrystals appeared spherical in shape with an average diameter of 5 nm and mainly aggregated in the medium and cell surface of S. oneidensis MR-1. UV–vis DRS spectra showed ZnS nanoparticles appeared a strong absorption below 360 nm. Thus, the photocatalytic activity of ZnS was evaluated by the photodegradation of rhodamine B (RhB) under UV irradiation. The biogenic ZnS nanocrystals showed a high level of photodegradation efficiency to RhB coupled with a significant blue-shift of maximum adsorption peak. A detailed analysis indicated the photogenerated holes, rather than hydroxyl radicals, contributed to the photocatalytic decolorization of RhB. This approach of coupling biosynthesis of nanoparticles with heavy metal removal may offer a potential avenue for efficient bioremediation of heavy metal wastewater

  12. Lunar and Lagrangian Point L1 L2 CubeSat Communication and Navigation Considerations

    Science.gov (United States)

    Schaire, Scott; Wong, Yen F.; Altunc, Serhat; Bussey, George; Shelton, Marta; Folta, Dave; Gramling, Cheryl; Celeste, Peter; Anderson, Mile; Perrotto, Trish; hide

    2017-01-01

    CubeSats have grown in sophistication to the point that relatively low-cost mission solutions could be undertaken for planetary exploration. There are unique considerations for lunar and L1/L2 CubeSat communication and navigation compared with low earth orbit CubeSats. This paper explores those considerations as they relate to the Lunar IceCube Mission. The Lunar IceCube is a CubeSat mission led by Morehead State University with participation from NASA Goddard Space Flight Center, Jet Propulsion Laboratory, the Busek Company and Vermont Tech. It will search for surface water ice and other resources from a high inclination lunar orbit. Lunar IceCube is one of a select group of CubeSats designed to explore beyond low-earth orbit that will fly on NASA’s Space Launch System (SLS) as secondary payloads for Exploration Mission (EM) 1. Lunar IceCube and the EM-1 CubeSats will lay the groundwork for future lunar and L1/L2 CubeSat missions. This paper discusses communication and navigation needs for the Lunar IceCube mission and navigation and radiation tolerance requirements related to lunar and L1/L2 orbits. Potential CubeSat radios and antennas for such missions are investigated and compared. Ground station coverage, link analysis, and ground station solutions are also discussed. This paper will describe modifications in process for the Morehead ground station, as well as further enhancements of the Morehead ground station and NASA Near Earth Network (NEN) that are being considered. The potential NEN enhancements include upgrading current NEN Cortex receiver with Forward Error Correction (FEC) Turbo Code, providing X-band uplink capability, and adding ranging options. The benefits of ground station enhancements for CubeSats flown on NASA Exploration Missions (EM) are presented. This paper also describes how the NEN may support lunar and L1/L2 CubeSats without any enhancements. In addition, NEN is studying other initiatives to better support the CubeSat community

  13. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  14. MUC1-C integrates PD-L1 induction with repression of immune effectors in non-small-cell lung cancer.

    Science.gov (United States)

    Bouillez, A; Rajabi, H; Jin, C; Samur, M; Tagde, A; Alam, M; Hiraki, M; Maeda, T; Hu, X; Adeegbe, D; Kharbanda, S; Wong, K-K; Kufe, D

    2017-07-13

    Immunotherapeutic approaches, particularly programmed death 1/programmed death ligand 1 (PD-1/PD-L1) blockade, have improved the treatment of non-small-cell lung cancer (NSCLC), supporting the premise that evasion of immune destruction is of importance for NSCLC progression. However, the signals responsible for upregulation of PD-L1 in NSCLC cells and whether they are integrated with the regulation of other immune-related genes are not known. Mucin 1 (MUC1) is aberrantly overexpressed in NSCLC, activates the nuclear factor-κB (NF-κB) p65→︀ZEB1 pathway and confers a poor prognosis. The present studies demonstrate that MUC1-C activates PD-L1 expression in NSCLC cells. We show that MUC1-C increases NF-κB p65 occupancy on the CD274/PD-L1 promoter and thereby drives CD274 transcription. Moreover, we demonstrate that MUC1-C-induced activation of NF-κB→︀ZEB1 signaling represses the TLR9 (toll-like receptor 9), IFNG, MCP-1 (monocyte chemoattractant protein-1) and GM-CSF genes, and that this signature is associated with decreases in overall survival. In concert with these results, targeting MUC1-C in NSCLC tumors suppresses PD-L1 and induces these effectors of innate and adaptive immunity. These findings support a previously unrecognized central role for MUC1-C in integrating PD-L1 activation with suppression of immune effectors and poor clinical outcome.

  15. NCBI nr-aa BLAST: CBRC-DNOV-01-1963 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-1963 ref|NP_622305.1| ABC-type nitrate/sulfonate/taurine/bicarbonate t...ransport systems, permease components [Thermoanaerobacter tengcongensis MB4] gb|AAM23909.1| ABC-type nitrate/sulfonate/taurine/bicarb...onate transport systems, permease components [Thermoanaerobacter tengcongensis MB4] NP_622305.1 0.013 26% ...

  16. Cognitive Style and Reading Comprehension in L1 and L2.

    Science.gov (United States)

    Vivaldo-Lima, Javier

    This paper presents the results of a research study carried out with Mexican college students to analyze the relationship between readers' cognitive styles (field dependent/independent) and their performance at different levels of written discourse processing in Spanish (L1) and English (L2). The sample for the study included 452 undergraduate…

  17. Crystal clear: visualizing the intervention mechanism of the PD-1/PD-L1 interaction by two cancer therapeutic monoclonal antibodies

    Directory of Open Access Journals (Sweden)

    Shuguang Tan

    2016-11-01

    Full Text Available Abstract Antibody-based PD-1/PD-L1 blockade therapies have taken center stage in immunotherapies for cancer, with multiple clinical successes. PD-1 signaling plays pivotal roles in tumor-driven T-cell dysfunction. In contrast to prior approaches to generate or boost tumor-specific T-cell responses, antibody-based PD-1/PD-L1 blockade targets tumor-induced T-cell defects and restores pre-existing T-cell function to modulate antitumor immunity. In this review, the fundamental knowledge on the expression regulations and inhibitory functions of PD-1 and the present understanding of antibody-based PD-1/PD-L1 blockade therapies are briefly summarized. We then focus on the recent breakthrough work concerning the structural basis of the PD-1/PD-Ls interaction and how therapeutic antibodies, pembrolizumab targeting PD-1 and avelumab targeting PD-L1, compete with the binding of PD-1/PD-L1 to interrupt the PD-1/PD-L1 interaction. We believe that this structural information will benefit the design and improvement of therapeutic antibodies targeting PD-1 signaling.

  18. Fire-related post-traumatic stress disorder: brain {sup 1}H-MR spetroscopic findings

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Myung Kwan; Suh, Chang Hae; Kim, Hyung Jin; Kim, Sung Tae; Lee, Jeong Seop; Kang, Min Hee [Inha University Hospital College of Medicine, Incheon (Korea, Republic of); Kim, Ji Hye [Gachon Medical School, Incheon (Korea, Republic of); Lee, Jung Hee [National Institute of Neurologic Disorders and Stroke, Bethesda (United States)

    2003-06-01

    To investigate the MR imaging and {sup 1}H-MR spectroscopic findings of acute fire-related post-traumatic stress disorder (PTSD). Sixteen patients (M:F=10:6; mean age, 16 years) with fire-related PTSD underwent MR imagine and {sup 1}H-MR spectroscopy, and for control purposes, the procedures were repeated in eight age-matched normal volunteers. In all patients and controls, the regions of interest where data were acquired at MRS were the basal ganglia (BG), frontal periventricular white matter (FWM), and parietal periventricular white matter (PWM). In all patients with PTSD, MR images appeared normal. In contrast, MRS showed that in the BG, NAA/Cr ratios were significantly lower in patients than in volunteers. This decrease did not, however, show close correlation with the severity of the neuropsychiatric symptoms. In patients, neither NAA/Cr ratios in FWM nor PWM, nor Cho/Cr ratios in all three regions, were significantly different from those in the control group. Decreased NAA/Cr ratios in the BG, as seen at {sup 1}H-MRS, might be an early sign of acute fire-related PTSD.

  19. Conditions for l =1 Pomeranchuk instability in a Fermi liquid

    Science.gov (United States)

    Wu, Yi-Ming; Klein, Avraham; Chubukov, Andrey V.

    2018-04-01

    We perform a microscopic analysis of how the constraints imposed by conservation laws affect q =0 Pomeranchuk instabilities in a Fermi liquid. The conventional view is that these instabilities are determined by the static interaction between low-energy quasiparticles near the Fermi surface, in the limit of vanishing momentum transfer q . The condition for a Pomeranchuk instability is set by Flc (s )=-1 , where Flc (s ) (a Landau parameter) is a properly normalized partial component of the antisymmetrized static interaction F (k ,k +q ;p ,p -q ) in a charge (c) or spin (s) subchannel with angular momentum l . However, it is known that conservation laws for total spin and charge prevent Pomeranchuk instabilities for l =1 spin- and charge-current order parameters. Our study aims to understand whether this holds only for these special forms of l =1 order parameters or is a more generic result. To this end we perform a diagrammatic analysis of spin and charge susceptibilities for charge and spin density order parameters, as well as perturbative calculations to second order in the Hubbard U . We argue that for l =1 spin-current and charge-current order parameters, certain vertex functions, which are determined by high-energy fermions, vanish at Fl=1 c (s )=-1 , preventing a Pomeranchuk instability from taking place. For an order parameter with a generic l =1 form factor, the vertex function is not expressed in terms of Fl=1 c (s ), and a Pomeranchuk instability may occur when F1c (s )=-1 . We argue that for other values of l , a Pomeranchuk instability may occur at Flc (s )=-1 for an order parameter with any form factor.

  20. Study on human intestinal bacterium Blautia sp. AUH-JLD56 for the conversion of arctigenin to (-)-3'-desmethylarctigenin.

    Science.gov (United States)

    Liu, Ming-Yue; Li, Meng; Wang, Xiu-Ling; Liu, Peng; Hao, Qing-Hong; Yu, Xiu-Mei

    2013-12-11

    Arctium lappa L. (A. lappa) is a popularly used vegetable as well as herbal medicine. Human intestinal microflora was reported to convert arctiin, the lignan compound with highest content in the dried fruits of Arctium lappa, to a series of metabolites. However, the specific bacterium responsible for the formation of 3'-desmethylarctigenin (3'-DMAG), the most predominant metabolite of arctiin by rat or human intestinal microflora, has not been isolated yet. In the present study, we isolated one single bacterium, which we named Blautia sp. AUH-JLD56, capable of solely biotransforming arctiin or arctigenin to (-)-3'-DMAG. The structure of the metabolite 3'-DMAG was elucidated by electrospray ionization mass spectrometry (ESI-MS) and (1)H and (13)C nuclear magnetic resonance spectroscopy. The biotransforming kinetics and maximum biotransforming capacity of strain AUH-JLD56 was investigated. In addition, the metabolite 3'-DMAG showed significantly higher 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity than that of the substrate arctigenin at the concentrations tested.

  1. IceBridge Atmospheric Chemistry L1B Data

    Data.gov (United States)

    National Aeronautics and Space Administration — The IceBridge Atmospheric Chemistry L1B Data set (ICHEM1B) contains measurements acquired over Antarctica using the AVOCET differential Non-Dispersive Infrared...

  2. Apolipoprotein L1 confers pH-switchable ion permeability to phospholipid vesicles.

    Science.gov (United States)

    Bruno, Jonathan; Pozzi, Nicola; Oliva, Jonathan; Edwards, John C

    2017-11-03

    Apolipoprotein L1 (ApoL1) is a human serum protein conferring resistance to African trypanosomes, and certain ApoL1 variants increase susceptibility to some progressive kidney diseases. ApoL1 has been hypothesized to function like a pore-forming colicin and has been reported to have permeability effects on both intracellular and plasma membranes. Here, to gain insight into how ApoL1 may function in vivo , we used vesicle-based ion permeability, direct membrane association, and intrinsic fluorescence to study the activities of purified recombinant ApoL1. We found that ApoL1 confers chloride-selective permeability to preformed phospholipid vesicles and that this selectivity is strongly pH-sensitive, with maximal activity at pH 5 and little activity above pH 7. When ApoL1 and lipid were allowed to interact at low pH and were then brought to neutral pH, chloride permeability was suppressed, and potassium permeability was activated. Both chloride and potassium permeability linearly correlated with the mass of ApoL1 in the reaction mixture, and both exhibited lipid selectivity, requiring the presence of negatively charged lipids for activity. Potassium, but not chloride, permease activity required the presence of calcium ions in both the association and activation steps. Direct assessment of ApoL1-lipid associations confirmed that ApoL1 stably associates with phospholipid vesicles, requiring low pH and the presence of negatively charged phospholipids for maximal binding. Intrinsic fluorescence of ApoL1 supported the presence of a significant structural transition when ApoL1 is mixed with lipids at low pH. This pH-switchable ion-selective permeability may explain the different effects of ApoL1 reported in intracellular and plasma membrane environments. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Tackling Cancer Resistance by Immunotherapy: Updated Clinical Impact and Safety of PD-1/PD-L1 Inhibitors

    Directory of Open Access Journals (Sweden)

    Shifaa M. Abdin

    2018-01-01

    Full Text Available Cancer therapy has been constantly evolving with the hope of finding the most effective agents with the least toxic effects to eradicate tumors. Cancer immunotherapy is currently among the most promising options, fulfilling this hope in a wide range of tumors. Immunotherapy aims to activate immunity to fight cancer in a very specific and targeted manner; however, some abnormal immune reactions known as immune-related adverse events (IRAEs might occur. Therefore, many researchers are aiming to define the most proper protocols for managing these complications without interfering with the anticancer effect. One of these targeted approaches is the inhibition of the interaction between the checkpoint protein, programmed death-receptor 1 (PD-1, and its ligand, programmed death-ligand 1 (PD-L1, via a class of antibodies known as PD-1/PD-L1 inhibitors. These antibodies achieved prodigious success in a wide range of malignancies, including those where optimal treatment is not yet fully identified. In this review, we have critically explored and discussed the outcome of the latest PD-1 and PD-L1 inhibitor studies in different malignancies compared to standard chemotherapeutic alternatives with a special focus on the clinical efficacy and safety. The approval of the clinical applications of nivolumab, pembrolizumab, atezolizumab, avelumab, and durvalumab in the last few years clearly highlights the hopeful future of PD-1/PD-L1 inhibitors for cancer patients. These promising results of PD-1/PD-L1 inhibitors have encouraged many ongoing preclinical and clinical trials to explore the extent of antitumor activity, clinical efficacy and safety as well as to extend their applications.

  4. Tackling Cancer Resistance by Immunotherapy: Updated Clinical Impact and Safety of PD-1/PD-L1 Inhibitors.

    Science.gov (United States)

    Abdin, Shifaa M; Zaher, Dana M; Arafa, El-Shaimaa A; Omar, Hany A

    2018-01-25

    Cancer therapy has been constantly evolving with the hope of finding the most effective agents with the least toxic effects to eradicate tumors. Cancer immunotherapy is currently among the most promising options, fulfilling this hope in a wide range of tumors. Immunotherapy aims to activate immunity to fight cancer in a very specific and targeted manner; however, some abnormal immune reactions known as immune-related adverse events (IRAEs) might occur. Therefore, many researchers are aiming to define the most proper protocols for managing these complications without interfering with the anticancer effect. One of these targeted approaches is the inhibition of the interaction between the checkpoint protein, programmed death-receptor 1 (PD-1), and its ligand, programmed death-ligand 1 (PD-L1), via a class of antibodies known as PD-1/PD-L1 inhibitors. These antibodies achieved prodigious success in a wide range of malignancies, including those where optimal treatment is not yet fully identified. In this review, we have critically explored and discussed the outcome of the latest PD-1 and PD-L1 inhibitor studies in different malignancies compared to standard chemotherapeutic alternatives with a special focus on the clinical efficacy and safety. The approval of the clinical applications of nivolumab, pembrolizumab, atezolizumab, avelumab, and durvalumab in the last few years clearly highlights the hopeful future of PD-1/PD-L1 inhibitors for cancer patients. These promising results of PD-1/PD-L1 inhibitors have encouraged many ongoing preclinical and clinical trials to explore the extent of antitumor activity, clinical efficacy and safety as well as to extend their applications.

  5. B→K1l+l- decays in a family non-universal Z' model

    International Nuclear Information System (INIS)

    Li, Ying; Hua, Juan; Yang, Kwei-Chou

    2011-01-01

    The implications of the family non-universal Z' model in the B→K 1 (1270,1400)l + l - (l=e,μ,τ) decays are explored, where the mass eigenstates K 1 (1270, 1400) are the mixtures of 1 P 1 and 3 P 1 states with the mixing angle θ. In this work, considering the Z' boson and setting the mixing angle θ=(-34±13) , we analyze the branching ratio, the dilepton invariant mass spectrum, the normalized forward-backward asymmetry and lepton polarization asymmetries of each decay mode. We find that all observables of B→K 1 (1270)μ + μ - are sensitive to the Z' contribution. Moreover, the observables of B→K 1 (1400)μ + μ - have a relatively strong θ-dependence; thus, the Z' contribution will be buried by the uncertainty of the mixing angle θ. Furthermore, the zero crossing position in the FBA spectrum of B→K 1 (1270)μ + μ - at low dilepton mass will move to the positive direction with Z' contribution. For the tau modes, the effects of Z' are not remarkable due to the small phase space. These results could be tested in the running LHC-b experiment and super-B factory. (orig.)

  6. Pragmatic assessment of schizophrenic bilinguals' L1 and L2 use ...

    African Journals Online (AJOL)

    This paper reports on a study investigating the pragmatic skills and deficits of schizophrenic bilinguals in their spontaneous first language (L1) and second language (L2) speech. Smit (2009) (see also Smit et al., this volume) argues that the locus of deficits in schizophrenic speech is semantics and suggests that a next step ...

  7. Phosphatidylcholine induces apoptosis of 3T3-L1 adipocytes

    Directory of Open Access Journals (Sweden)

    Li Hailan

    2011-12-01

    Full Text Available Abstract Background Phosphatidylcholine (PPC formulation is used for lipolytic injection, even though its mechanism of action is not well understood. Methods The viability of 3T3-L1 pre-adipocytes and differentiated 3T3-L1 cells was measured after treatment of PPC alone, its vehicle sodium deoxycholate (SD, and a PPC formulation. Western blot analysis was performed to examine PPC-induced signaling pathways. Results PPC, SD, and PPC formulation significantly decreased 3T3-L1 cell viability in a concentration-dependent manner. PPC alone was not cytotoxic to CCD-25Sk human fibroblasts at concentrations Conclusions PPC results in apoptosis of 3T3-L1 cells.

  8. GPM TMI on TRMM Common Calibrated Brightness Temperatures L1C 1.5 hours 13 km V05 (GPM_1CTRMMTMI) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  9. The Status of the Auxiliary "Do" in L1 and L2 English Negative Clauses

    Science.gov (United States)

    Perales, Susana

    2010-01-01

    This paper addresses the issue of whether negative sentences containing auxiliary "do" in L1 and L2 English share the same underlying syntactic representation. To this end, I compare the negative sentences produced by 77 bilingual (Spanish/Basque) L2 learners of English with the corresponding data available for L1 acquirers reported on in Schutze…

  10. Relationship between interstitial and blood glucose in type 1 diabetes patients: delay and the push-pull phenomenon revisited

    NARCIS (Netherlands)

    Wentholt, Iris M. E.; Hart, Augustus A. M.; Hoekstra, Joost B. L.; DeVries, J. Hans

    2007-01-01

    BACKGROUND: Interpretation of glucose sensor results requires clarification of the relationship between interstitial (IG) and blood (BG) glucose. We examined the delay of IG upon BG change and reinvestigated the push-pull phenomenon in type 1 diabetes patients. The push-pull phenomenon postulates

  11. L1 influence in the L2 acquisition of isiXhosa verb placement by ...

    African Journals Online (AJOL)

    1. Introduction. In second language (L2) acquisition research conducted within ..... versus Afrikaans-speaking beginner learners of isiXhosa, with regard to verb ..... Language contact within one home is also illustrated by the case of the four L1 ...

  12. Structural Dynamics Investigation of Human Family 1 & 2 Cystatin-Cathepsin L1 Interaction: A Comparison of Binding Modes.

    Directory of Open Access Journals (Sweden)

    Suman Kumar Nandy

    Full Text Available Cystatin superfamily is a large group of evolutionarily related proteins involved in numerous physiological activities through their inhibitory activity towards cysteine proteases. Despite sharing the same cystatin fold, and inhibiting cysteine proteases through the same tripartite edge involving highly conserved N-terminal region, L1 and L2 loop; cystatins differ widely in their inhibitory affinity towards C1 family of cysteine proteases and molecular details of these interactions are still elusive. In this study, inhibitory interactions of human family 1 & 2 cystatins with cathepsin L1 are predicted and their stability and viability are verified through protein docking & comparative molecular dynamics. An overall stabilization effect is observed in all cystatins on complex formation. Complexes are mostly dominated by van der Waals interaction but the relative participation of the conserved regions varied extensively. While van der Waals contacts prevail in L1 and L2 loop, N-terminal segment chiefly acts as electrostatic interaction site. In fact the comparative dynamics study points towards the instrumental role of L1 loop in directing the total interaction profile of the complex either towards electrostatic or van der Waals contacts. The key amino acid residues surfaced via interaction energy, hydrogen bonding and solvent accessible surface area analysis for each cystatin-cathepsin L1 complex influence the mode of binding and thus control the diverse inhibitory affinity of cystatins towards cysteine proteases.

  13. The relationship between the PD-1/PD-L1 pathway and DNA mismatch repair in cervical cancer and its clinical significance

    Directory of Open Access Journals (Sweden)

    Feng YC

    2018-01-01

    Full Text Available Yang-chun Feng,1,2 Wen-li Ji,3 Na Yue,3 Yan-chun Huang,2 Xiu-min Ma1 1Clinical Laboratory Center, The First Affiliated Hospital of Xinjiang Medical University, 2Clinical Laboratory Center, 3Clinical Pathology Center, Tumor Hospital Affiliated to Xinjiang Medical University, Urumqi, People’s Republic of China Background: According to recent clinical observations, deficient DNA mismatch repair (dMMR is capable of improving antitumor effects of the PD-1/PD-L1 pathway, suggesting that dMMR may act as a prognostic indicator of PD-1/PD-L1 antibody drugs. In this study, we examined the dMMR and PD-1/PD-L1 expression, as well as explored the correlation of dMMR status with PD-1/PD-L1 expression in cervical cancer patients, in order to optimize cervical cancer patient selection for PD-1/PD-L1 antibody drug treatment, which is helpful to avoid adverse effects and keep costs manageable. Methods: Sixty-six tissue samples from patients with squamous cell carcinoma were collected, and data of their clinical characteristics were also gathered. Based on these samples, the expression levels of MLH1, MSH2, and PD-L1 in cancer cells were tested by immunohistochemical assay (IHC. Moreover, PD-1/PD-L1 expression in tumor-invading lymphocytes (TILs was detected by IHC as well. Six single-nucleotide-repeat markers of microsatellite instability (MSI, including NR-27, MONO-27, BAT-25, NR-24, NR-21, and BAT-26, were tested by capillary electrophoresis sequencer analysis. According to expression of MLH1, MSH2 and the MSI test, all 66 cases were divided into dMMR or proficient DNA mismatch repair (pMMR groups. The comparisons of dMMR and PD-L1 in cancer cells and of PD-1/PD-L1 in TILs were conducted categorized by age, childbearing history, history of abortion, ethnicity, and cancer cell differentiation subgroup. Furthermore, PD-L1 levels in cancer cells and PD-1/PD-L1 in TILs were analyzed and compared in both dMMR and pMMR subgroups. Results: Of the patient samples, 25

  14. Generalized L1 penalized matrix factorization

    DEFF Research Database (Denmark)

    Rasmussen, Morten Arendt

    2017-01-01

    Traditionally, chemometric models consists of parameters found by solving a least squares criterion. However, these models can suffer from overfitting, as well as being hard to interpret because of the large number of active parameters. This work proposes the use of a generalized L1 norm penalty ...

  15. Large-scale bioreactor production of the herbicide-degrading Aminobacter sp. strain MSH1

    DEFF Research Database (Denmark)

    Schultz-Jensen, Nadja; Knudsen, Berith Elkær; Frkova, Zuzana

    2014-01-01

    The Aminobacter sp. strain MSH1 has potential for pesticide bioremediation because it degrades the herbicide metabolite 2,6-dichlorobenzamide (BAM). Production of the BAM-degrading bacterium using aerobic bioreactor fermentation was investigated. A mineral salt medium limited for carbon and with ......The Aminobacter sp. strain MSH1 has potential for pesticide bioremediation because it degrades the herbicide metabolite 2,6-dichlorobenzamide (BAM). Production of the BAM-degrading bacterium using aerobic bioreactor fermentation was investigated. A mineral salt medium limited for carbon...... and with an element composition similar to the strain was generated. The optimal pH and temperature for strain growth were determined using shaker flasks and verified in bioreactors. Glucose, fructose, and glycerol were suitable carbon sources for MSH1 (μ =0.1 h−1); slower growth was observed on succinate and acetic...... acid (μ =0.01 h−1). Standard conditions for growth of theMSH1 strain were defined at pH 7 and 25 °C, with glucose as the carbon source. In bioreactors (1 and 5 L), the specific growth rate of MSH1 increased from μ =0.1 h−1 on traditional mineral salt medium to μ =0.18 h−1 on the optimized mineral salt...

  16. Self-renewal and differentiation capabilities are variable between human embryonic stem cell lines I3, I6 and BG01V

    Directory of Open Access Journals (Sweden)

    Rao Mahendra S

    2009-06-01

    Full Text Available Abstract Background A unique and essential property of embryonic stem cells is the ability to self-renew and differentiate into multiple cell lineages. However, the possible differences in proliferation and differentiation capabilities among independently-derived human embryonic stem cells (hESCs are not well known because of insufficient characterization. To address this question, a side-by-side comparison of 1 the ability to maintain an undifferentiated state and to self-renew under standard conditions; 2 the ability to spontaneously differentiate into three primary embryonic germ lineages in differentiating embryoid bodies; and 3 the responses to directed neural differentiation was made between three NIH registered hES cell lines I3 (TE03, I6 (TE06 and BG01V. Lines I3 and I6 possess normal XX and a normal XY karyotype while BG01V is a variant cell line with an abnormal karyotype derived from the karyotypically normal cell line BG01. Results Using immunocytochemistry, flow cytometry, qRT-PCR and MPSS, we found that all three cell lines actively proliferated and expressed similar "stemness" markers including transcription factors POU5F1/Oct3/4 and NANOG, glycolipids SSEA4 and TRA-1-81, and alkaline phosphatase activity. All cell lines differentiated into three embryonic germ lineages in embryoid bodies and into neural cell lineages when cultured in neural differentiation medium. However, a profound variation in colony morphology, growth rate, BrdU incorporation, and relative abundance of gene expression in undifferentiated and differentiated states of the cell lines was observed. Undifferentiated I3 cells grew significantly slower but their differentiation potential was greater than I6 and BG01V. Under the same neural differentiation-promoting conditions, the ability of each cell line to differentiate into neural progenitors varied. Conclusion Our comparative analysis provides further evidence for similarities and differences between three h

  17. MODIS/Terra Calibrated Radiances 5-Min L1B Swath 1km V006

    Data.gov (United States)

    National Aeronautics and Space Administration — The MODIS/Terra Calibrated Radiances 5-Min L1B Swath 1km (MOD021KM) contains calibrated and geolocated at-aperture radiances for 36 discrete bands located in the 0.4...

  18. l=1,2 high-beta stellarator

    International Nuclear Information System (INIS)

    Bartsch, R.R.; Cantrell, E.L.; Gribble, R.F.; Klare, K.A.; Kutac, K.J.; Miller, G.; Siemon, R.E.

    1978-01-01

    The final scyllac experiments are described. These experiments utilized a feedback-stabilized, l=1,2 high-beta stellarator configuration and like the previous feedback-stabilization experiments were carried out in a toroidal sector, rather than a complete torus. The energy confinement time, obtained from excluded flux measurements, agrees with a two-dimensional calculation of particle end loss from a straight theta pinch. Because simple end loss was dominant, the energy confinement time was independent of whether equilibrium adjustment or feedback stabilization fields were applied. The dynamical characteristics of the toroidal equilibrium were improved by elimination of the l=0 field used previously, as expected from theory. A modal rather than local feedback control algorithm was used. Although feedback clearly decreased the m=1 motion of the plasma, the experimental test of modal feedback, which is expected from theory to be superior to local feedback, is considered inconclusive because of the limitations imposed by the sector configuration

  19. The MOON-1 detector construction and the study of backgrounds from radioactive isotopes

    International Nuclear Information System (INIS)

    Ogama, T; Nakamura, H; Ejiri, H; Fushimi, K; Ichihara, K; Matsuoka, K; Nomachi, M; Hazama, R; Umehara, S; Yoshida, S; Sakiuchi, T; Hai, V H; Sugaya, Y

    2006-01-01

    MOON is a multilayer system of plastic scintillators and 100 Mo films for 100 Mo 0νββ decays. A prototype detector MOON-1 was built with 6 layers of plastic scintillators and 142g of 100Mo films for background (BG), energy and position resolution studies of the MOON detector. No serious BG from natural radioactive isotopes (RI) for 0νββ detection was found

  20. MLH1 expression predicts the response to preoperative therapy and is associated with PD-L1 expression in esophageal cancer.

    Science.gov (United States)

    Momose, Kota; Yamasaki, Makoto; Tanaka, Koji; Miyazaki, Yasuhiro; Makino, Tomoki; Takahashi, Tsuyoshi; Kurokawa, Yukinori; Nakajima, Kiyokazu; Takiguchi, Shuji; Mori, Masaki; Doki, Yuichiro

    2017-07-01

    Programmed death-ligand 1 (PD-1/PD-L1) inhibition therapy demonstrates potential as a future treatment for esophageal cancer. Mismatch repair status and tumor PD-L1 expression are the candidate predictive biomarkers for response to this therapy. In colorectal cancer, mismatch repair-deficient tumors are associated with improved survival, although they are not sensitive to 5-fluorouracil-based chemotherapy. The purpose of the present study was to investigate the association between MutL homolog 1 (MLH1) expression and prognosis, response to therapy and PD-L1 expression in esophageal cancer. Immunohistochemistry was used to evaluate MLH1 and PD-L1 expression in 251 resected specimens. Of the specimens, 30.3% exhibited low MLH1 expression and 15.5% exhibited high PD-L1 expression. The 5-year overall survival rates for the high MLH1 expression group and the low MLH1 expression group were 51.3 and 55.6%, respectively (P=0.5260). The responder ratio was 45.7% in the high MLH1 expression group and 15.4% in the low MLH1 expression group (PMLH1 expression group (P=0.0064) and 25.0% in the low MLH1 expression group. MLH1 expression may be a predictive factor for the response to preoperative therapy in esophageal cancer, and esophageal cancer with low MLH1 expression may have a mechanism that assists in promoting tumor PD-L1 expression.

  1. Mitigation of Membrane Biofouling in MBR Using a Cellulolytic Bacterium, Undibacterium sp. DM-1, Isolated from Activated Sludge.

    Science.gov (United States)

    Nahm, Chang Hyun; Lee, Seonki; Lee, Sang Hyun; Lee, Kibaek; Lee, Jaewoo; Kwon, Hyeokpil; Choo, Kwang-Ho; Lee, Jung-Kee; Jang, Jae Young; Lee, Chung-Hak; Park, Pyung-Kyu

    2017-03-28

    Biofilm formation on the membrane surface results in the loss of permeability in membrane bioreactors (MBRs) for wastewater treatment. Studies have revealed that cellulose is not only produced by a number of bacterial species but also plays a key role during formation of their biofilm. Hence, in this study, cellulase was introduced to a MBR as a cellulose-induced biofilm control strategy. For practical application of cellulase to MBR, a cellulolytic ( i.e ., cellulase-producing) bacterium, Undibacterium sp. DM-1, was isolated from a lab-scale MBR for wastewater treatment. Prior to its application to MBR, it was confirmed that the cell-free supernatant of DM-1 was capable of inhibiting biofilm formation and of detaching the mature biofilm of activated sludge and cellulose-producing bacteria. This suggested that cellulase could be an effective anti-biofouling agent for MBRs used in wastewater treatment. Undibacterium sp. DM-1-entrapping beads ( i.e ., cellulolytic-beads) were applied to a continuous MBR to mitigate membrane biofouling 2.2-fold, compared with an MBR with vacant-beads as a control. Subsequent analysis of the cellulose content in the biofilm formed on the membrane surface revealed that this mitigation was associated with an approximately 30% reduction in cellulose by cellulolytic-beads in MBR.

  2. No apparent costs for facultative antibiotic production by the soil bacterium Pseudomonas fluorescens Pf0-1.

    Science.gov (United States)

    Garbeva, Paolina; Tyc, Olaf; Remus-Emsermann, Mitja N P; van der Wal, Annemieke; Vos, Michiel; Silby, Mark; de Boer, Wietse

    2011-01-01

    Many soil-inhabiting bacteria are known to produce secondary metabolites that can suppress microorganisms competing for the same resources. The production of antimicrobial compounds is expected to incur fitness costs for the producing bacteria. Such costs form the basis for models on the co-existence of antibiotic-producing and non-antibiotic producing strains. However, so far studies quantifying the costs of antibiotic production by bacteria are scarce. The current study reports on possible costs, for antibiotic production by Pseudomonas fluorescens Pf0-1, a soil bacterium that is induced to produce a broad-spectrum antibiotic when it is confronted with non-related bacterial competitors or supernatants of their cultures. We measured the possible cost of antibiotic production for Pseudomonas fluorescens Pf0-1 by monitoring changes in growth rate with and without induction of antibiotic production by supernatant of a bacterial competitor, namely Pedobacter sp.. Experiments were performed in liquid as well as on semi-solid media under nutrient-limited conditions that are expected to most clearly reveal fitness costs. Our results did not reveal any significant costs for production of antibiotics by Pseudomonas fluorescens Pf0-1. Comparison of growth rates of the antibiotic-producing wild-type cells with those of non-antibiotic producing mutants did not reveal costs of antibiotic production either. Based on our findings we propose that the facultative production of antibiotics might not be selected to mitigate metabolic costs, but instead might be advantageous because it limits the risk of competitors evolving resistance, or even the risk of competitors feeding on the compounds produced.

  3. L1-L2 Transfer in the Narrative Styles of Chinese EFL Learners' Written Personal Narratives

    Science.gov (United States)

    Su, I-Ru; Chou, Yi-Chun

    2016-01-01

    Most of the research on second language (L2) narratives has focused on whether or how L2 learners carry their L1 narrative styles into L2 narration; few studies have explored whether L2 learners' knowledge of the L2 also in turn affects their L1 narrative performance. The present study attempted to probe the issue of cultural transfer in narrative…

  4. Removal of Chlorpyrifos by Water Hyacinth (Eichhornia crassipes) and the Role of a Plant-Associated Bacterium.

    Science.gov (United States)

    Anudechakul, Choochai; Vangnai, Alisa S; Ariyakanon, Naiyanan

    2015-01-01

    The objective of this research was to study the efficiency of water hyacinth (Eichhornia crassipes) and the role of any plant-associated bacteria in removing chlorpyrifos from water. The relative growth rate (RGR) of E. crassipes in the presence of 0.1 mg/L chlorpyrifos was not significantly different from that in its absence and only slightly decreased at concentrations of 0.5 and 1.0 mg/L by ∼1.1- and ∼1.2-fold, respectively, with an observed dry weight based RGRDW for E. crassipes of 0.036-0.041 mg/g/d. The removal rate constants of chlorpyrifos in the absence of plants were low at 3.52, 2.29 and 1.84 h(-1) for concentrations of 0.1, 0.5 and 1.0 mg/L, respectively, but were some 3.89- to 4.87-fold higher in the presence of E. crassipes. Chlorpyrifos removal was markedly facilitated by the presence of a root-associated bacterium, preliminarily identified as Acinetobacter sp. strain WHA. The interaction of E. crassipes and Acinetobacter sp. strain WHA provide an efficient and ecological alternative to accelerate the removal and degradation of chlorpyrifos pollution from aquatic systems including wastewater.

  5. Black hole thermodynamical entropy

    International Nuclear Information System (INIS)

    Tsallis, Constantino; Cirto, Leonardo J.L.

    2013-01-01

    As early as 1902, Gibbs pointed out that systems whose partition function diverges, e.g. gravitation, lie outside the validity of the Boltzmann-Gibbs (BG) theory. Consistently, since the pioneering Bekenstein-Hawking results, physically meaningful evidence (e.g., the holographic principle) has accumulated that the BG entropy S BG of a (3+1) black hole is proportional to its area L 2 (L being a characteristic linear length), and not to its volume L 3 . Similarly it exists the area law, so named because, for a wide class of strongly quantum-entangled d-dimensional systems, S BG is proportional to lnL if d=1, and to L d-1 if d>1, instead of being proportional to L d (d ≥ 1). These results violate the extensivity of the thermodynamical entropy of a d-dimensional system. This thermodynamical inconsistency disappears if we realize that the thermodynamical entropy of such nonstandard systems is not to be identified with the BG additive entropy but with appropriately generalized nonadditive entropies. Indeed, the celebrated usefulness of the BG entropy is founded on hypothesis such as relatively weak probabilistic correlations (and their connections to ergodicity, which by no means can be assumed as a general rule of nature). Here we introduce a generalized entropy which, for the Schwarzschild black hole and the area law, can solve the thermodynamic puzzle. (orig.)

  6. Improvement and characterization of a hyperthermophilic glucose isomerase from Thermoanaerobacter ethanolicus and its application in production of high fructose corn syrup.

    Science.gov (United States)

    Liu, Zhi-Qiang; Zheng, Wei; Huang, Jian-Feng; Jin, Li-Qun; Jia, Dong-Xu; Zhou, Hai-Yan; Xu, Jian-Miao; Liao, Cheng-Jun; Cheng, Xin-Ping; Mao, Bao-Xing; Zheng, Yu-Guo

    2015-08-01

    High fructose corn syrup (HFCS) is an alternative of liquid sweetener to sucrose that is isomerized by commercial glucose isomerase (GI). One-step production of 55 % HFCS by thermostable GI has been drawn more and more attentions. In this study, a new hyperthermophilic GI from Thermoanaerobacter ethanolicus CCSD1 (TEGI) was identified by genome mining, and then a 1317 bp fragment encoding the TEGI was synthesized and expressed in Escherichia coli BL21(DE3). To improve the activity of TEGI, two amino acid residues, Trp139 and Val186, around the active site and substrate-binding pocket based on the structural analysis and molecular docking were selected for site-directed mutagenesis. The specific activity of mutant TEGI-W139F/V186T was 2.3-fold and the value of k cat/K m was 1.86-fold as compared to the wild type TEGI, respectively. Thermostability of mutant TEGI-W139F/V186T at 90 °C for 24 h showed 1.21-fold extension than that of wild type TEGI. During the isomerization of glucose to fructose, the yield of fructose could maintain above 55.4 % by mutant TEGI-W139F/V186T as compared to 53.8 % by wild type TEGI at 90 °C. This study paved foundation for the production of 55 % HFCS using the thermostable TEGI.

  7. The Design of Morphological/Linguistic Data in L1 and L2 ...

    African Journals Online (AJOL)

    user

    learners' MA of an L1 or L2 can be measured (and, as an extension to this, that users' and .... and they could activate these strategies and skills when confronted with new .... cussion of a wide range of morphological phenomena in English.

  8. Subunit rotation in a single FoF1-ATP synthase in a living bacterium monitored by FRET

    Science.gov (United States)

    Seyfert, K.; Oosaka, T.; Yaginuma, H.; Ernst, S.; Noji, H.; Iino, R.; Börsch, M.

    2011-03-01

    FoF1-ATP synthase is the ubiquitous membrane-bound enzyme in mitochondria, chloroplasts and bacteria which provides the 'chemical energy currency' adenosine triphosphate (ATP) for cellular processes. In Escherichia coli ATP synthesis is driven by a proton motive force (PMF) comprising a proton concentration difference ΔpH plus an electric potential ΔΨ across the lipid membrane. Single-molecule in vitro experiments have confirmed that proton-driven subunit rotation within FoF1-ATP synthase is associated with ATP synthesis. Based on intramolecular distance measurements by single-molecule fluorescence resonance energy transfer (FRET) the kinetics of subunit rotation and the step sizes of the different rotor parts have been unraveled. However, these experiments were accomplished in the presence of a PMF consisting of a maximum ΔpH ~ 4 and an unknown ΔΨ. In contrast, in living bacteria the maximum ΔpH across the plasma membrane is likely 0.75, and ΔΨ has been measured between -80 and -140 mV. Thus the problem of in vivo catalytic turnover rates, or the in vivo rotational speed in single FoF1-ATP synthases, respectively, has to be solved. In addition, the absolute number of functional enzymes in a single bacterium required to maintain the high ATP levels has to be determined. We report our progress of measuring subunit rotation in single FoF1-ATP synthases in vitro and in vivo, which was enabled by a new labeling approach for single-molecule FRET measurements.

  9. Imaging expression of adenoviral HSV1-tk suicide gene transfer using the nucleoside analogue FIRU

    Energy Technology Data Exchange (ETDEWEB)

    Nanda, Dharmin [Department of Neurology, Daniel den Hoed Cancer Centre, University Hospital Rotterdam (Netherlands); Department of Neurosurgery, University Hospital Rotterdam (Netherlands); Jong, Marion de; Bakker, Willem; Bijster, Magda; Cox, Peter [Department of Nuclear Medicine, University Hospital Rotterdam (Netherlands); Vogels, Ronald; Havenga, Menzo [Crucell Holland BV, Leiden (Netherlands); Driesse, Maarten; Avezaat, Cees [Department of Neurosurgery, University Hospital Rotterdam (Netherlands); Morin, Kevin; Naimi, Ebrahim; Knaus, Edward; Wiebe, Leonard [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton (Canada); Smitt, Peter Sillevis [Department of Neurology, Daniel den Hoed Cancer Centre, University Hospital Rotterdam (Netherlands)

    2002-07-01

    Substrates for monitoring HSV1-tk gene expression include uracil and acycloguanosine derivatives.The most commonly used uracil derivative to monitor HSV1-tk gene transfer is 1-(2-fluoro-2-deoxy-{beta}-D-arabinofuranosyl)-5-[*I]iodouracil (fialuridine; I*-FIAU), where the asterisk denotes any of the radioactive iodine isotopes that can be used. We have previously studied other nucleosides with imaging properties as good as or better than FIAU, including 1-(2-fluoro-2-deoxy-{beta}-D-ribofuranosyl)-5-[*I]iodouracil (FIRU). The first aim of this study was to extend the biodistribution data of {sup 123}I-labelled FIRU. Secondly, we assessed the feasibility of detecting differences in HSV1-tk gene expression levels following adenoviral gene transfer in vivo with {sup 123}I-FIRU. 9L rat gliosarcoma cells were stably transfected with the HSV1-tk gene (9L-tk+). {sup 123}I-FIRU was prepared by radioiodination of 1-(2-fluoro-2-deoxy-{beta}-D-ribofuranosyl)-5-tributylstannyl uracil (FTMRSU; precursor compound) and purified using an activated Sep-Pak column. Incubation of 9L-tk+ cells and the parental 9L cells with {sup 123}I-FIRU resulted in a 100-fold higher accumulation of radioactivity in the 9L-tk+ cells after an optimum incubation time of 4 h. NIH-bg-nu-xid mice were then inoculated subcutaneously with HSV1-tk (-) 9L cells or HSV1-tk (+) 9L-tk+ cells into both flanks. Biodistribution studies and gamma camera imaging were performed at 15 min and 1, 2, 4 and 24 h p.i. At 15 min, the tumour/muscle, tumour/blood and tumour/brain ratios were 5.2, 1.0 and 30.3 respectively. Rapid renal clearance of the tracer from the body resulted in increasing tumour/muscle, tumour/blood and tumour/brain ratios, reaching values of 32.2, 12.5 and 171.6 at 4 h p.i. A maximum specific activity of 22%ID/g tissue was reached in the 9L-tk+ tumours 4 h after {sup 123}I-FIRU injection. Two Ad5-based adenoviral vectors containing the HSV1-tk gene were constructed: a replication-incompetent vector with

  10. VizieR Online Data Catalog: L1157-B1 DCN (2-1) and H13CN (2-1) datacubes (Busquet+,

    Science.gov (United States)

    Busquet, G.; Fontani, F.; Viti, S.; Codella, C.; Lefloch, B.; Benedettini, M.; Ceccarellli, C.

    2017-06-01

    IRAM NOEMA observations of DCN(2-1) and H13CN(2-1) towa brightest bow-shock B1 of the L1157 molecular outflow. All data cubes are provided in fits format smoothed to a velocity resolution of 0.5km/s. (2 data files).

  11. Negative Transfer of L1 on English Grammar Learning in SLA

    Institute of Scientific and Technical Information of China (English)

    马秀琳

    2015-01-01

    At present,many scholars pay more attention to the positive transfer of native language on the English learning,while ignoring the negative transfer of L1 on English grammar learning.Therefore native transfer of L1 often appears on English grammar learning.This paper aims to point out that the negative transfer of L1 has a profound and vast influence on the English grammar learning,to find out the countermeasures to reduce the influence of negative transfer of L1 and finally to bring the benefits to the following relative studies.

  12. L1/L2 Differences in the Acquisition of Form-Meaning Pairings in a Second Language

    Science.gov (United States)

    McManus, Kevin

    2015-01-01

    This paper examines the impact of L1/L2 form-meaning differences in the domain of aspect to investigate whether L2 learners are able to acquire properties of the L2 that are different from the L1. Oral data were collected from English- and German-speaking university learners of French L2 (n = 75) at two different levels of proficiency. The results…

  13. Thermoanaerobacter pentosaceus sp. nov., an anaerobic, extreme thermophilic, high ethanol-yielding bacterium isolated from household waste

    DEFF Research Database (Denmark)

    Tomás, Ana Faria; Karakashev, Dimitar Borisov; Angelidaki, Irini

    2013-01-01

    of approximately 0.5 µm. Optimal growth occurred at 70 °C and pH(25°C) 7, with a maximum growth rate of 0.1 h-1. DNA G+C content was 34.2 mol %. Strain DTU01(T) could ferment arabinose, cellobiose, fructose, galactose, glucose, inulin, lactose, mannose, melibiose, pectin, starch, sucrose, xylan, yeast extract...

  14. Imaging the L-type amino acid transporter-1 (LAT1 with Zr-89 immunoPET.

    Directory of Open Access Journals (Sweden)

    Oluwatayo F Ikotun

    Full Text Available The L-type amino acid transporter-1 (LAT1, SLC7A5 is upregulated in a wide range of human cancers, positively correlated with the biological aggressiveness of tumors, and a promising target for both imaging and therapy. Radiolabeled amino acids such as O-(2-[(18F]fluoroethyl-L-tyrosine (FET that are transport substrates for system L amino acid transporters including LAT1 have met limited success for oncologic imaging outside of the brain, and thus new strategies are needed for imaging LAT1 in systemic cancers. Here, we describe the development and biological evaluation of a novel zirconium-89 labeled antibody, [(89Zr]DFO-Ab2, targeting the extracellular domain of LAT1 in a preclinical model of colorectal cancer. This tracer demonstrated specificity for LAT1 in vitro and in vivo with excellent tumor imaging properties in mice with xenograft tumors. PET imaging studies showed high tumor uptake, with optimal tumor-to-non target contrast achieved at 7 days post administration. Biodistribution studies demonstrated tumor uptake of 10.5 ± 1.8 percent injected dose per gram (%ID/g at 7 days with a tumor to muscle ratio of 13 to 1. In contrast, the peak tumor uptake of the radiolabeled amino acid [(18F]FET was 4.4 ± 0.5 %ID/g at 30 min after injection with a tumor to muscle ratio of 1.4 to 1. Blocking studies with unlabeled anti-LAT1 antibody demonstrated a 55% reduction of [(89Zr]DFO-Ab2 accumulation in the tumor at 7 days. These results are the first report of direct PET imaging of LAT1 and demonstrate the potential of immunoPET agents for imaging specific amino acid transporters.

  15. Dicty_cDB: Contig-U03991-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 32 5.2 2 ( AZ306413 ) 1M0007B05R Mouse 10kb plasmid UUGC1M library Mus ... 38 5.2 2 ( BJ824535 ) Misgurnus anguillicaudatu...us visual cortex cDNA, RIKEN full-lengt... 32 6.7 2 ( AZ500970 ) 1M0339B10R Mouse 10kb plasmid UUGC1M library...7 2 ( AZ845402 ) 2M0145M09F Mouse 10kb plasmid UUGC1M library Mus ... 32 1.7 2 ( AZ990102 ) 2M0273L11R Mouse 10kb plasmid UUGC2M libr...07.... 44 2.5 1 ( AP009510 ) Uncultured Termite group 1 bacterium phylotype Rs...... cl... 32 6.5 2 ( AZ364702 ) 1M0110P21R Mouse 10kb plasmid UUGC1M library Mus ... 32 6.5 2 ( BH053767 ) R

  16. A Prerequisite to L1 Homophone Effects in L2 Spoken-Word Recognition

    Science.gov (United States)

    Nakai, Satsuki; Lindsay, Shane; Ota, Mitsuhiko

    2015-01-01

    When both members of a phonemic contrast in L2 (second language) are perceptually mapped to a single phoneme in one's L1 (first language), L2 words containing a member of that contrast can spuriously activate L2 words in spoken-word recognition. For example, upon hearing cattle, Dutch speakers of English are reported to experience activation…

  17. Prognostic Value of PD-L1 in Breast Cancer: A Meta-Analysis.

    Science.gov (United States)

    Wang, Changjun; Zhu, Hanjiang; Zhou, Yidong; Mao, Feng; Lin, Yan; Pan, Bo; Zhang, Xiaohui; Xu, Qianqian; Huang, Xin; Sun, Qiang

    2017-07-01

    Programmed cell death 1 ligand 1 (PD-L1) is a promising therapeutic target for cancer immunotherapy. However, the correlation between PD-L1 and breast cancer survival remains unclear. Here, we present the first meta-analysis to investigate the prognostic value of PD-L1 in breast cancer. We searched Pubmed, Embase, and Cochrane Central Register of Controlled Trials databases for relevant studies evaluating PD-L1 expression and breast cancer survival. Fixed- and random-effect meta-analyses were conducted based on heterogeneity of included studies. Publication bias was evaluated by funnel plot and Begg's test. Overall, nine relevant studies with 8583 patients were included. PD-L1 overexpression was found in 25.8% of breast cancer patients. PD-L1 (+) associated with several high-risk prognostic indicators, such as ductal cancer (p = 0.037), high tumor grade (p = 0.000), ER negativity (p = 0.000), PR negativity (p = 0.000), HER2 positivity (p = 0.001) and aggressive molecular subtypes (HER2-rich and Basal-like p = 0.000). PD-L1 overexpression had no significant impact on metastasis-free survival (HR 0.924, 95% CI = 0.747-1.141, p = 0.462), disease-free survival (HR 1.122, 95% CI = 0.878-1.434, p = 0.357) and overall specific survival (HR 0.837, 95% CI = 0.640-1.093, p = 0.191), but significantly correlated with shortened overall survival (HR 1.573, 95% CI = 1.010-2.451, p = 0.045). PD-L1 overexpression in breast cancer associates with multiple clinicopathological parameters that indicated poor outcome, and may increase the risk for mortality. Further standardization of PD-L1 assessment assay and well-controlled clinical trials are warranted to clarify its prognostic and therapeutic value. © 2017 Wiley Periodicals, Inc.

  18. Enrichment of variations in KIR3DL1/S1 and KIR2DL2/L3 among H1N1/09 ICU patients: an exploratory study.

    Directory of Open Access Journals (Sweden)

    David La

    Full Text Available BACKGROUND: Infection by the pandemic influenza A (H1N1/09 virus resulted in significant pathology among specific ethnic groups worldwide. Natural Killer (NK cells are important in early innate immune responses to viral infections. Activation of NK cells, in part, depend on killer-cell immunoglobulin-like receptors (KIR and HLA class I ligand interactions. To study factors involved in NK cell dysfunction in overactive immune responses to H1N1 infection, KIR3DL1/S1 and KIR2DL2/L3 allotypes and cognate HLA ligands of H1N1/09 intensive-care unit (ICU patients were determined. METHODOLOGY AND FINDINGS: KIR3DL1/S1, KIR2DL2/L3, and HLA -B and -C of 51 H1N1/09 ICU patients and 105 H1N1-negative subjects (St. Theresa Point, Manitoba were characterized. We detected an increase of 3DL1 ligand-negative pairs (3DL1/S1(+ Bw6(+ Bw4(-, and a lack of 2DL1 HLA-C2 ligands, among ICU patients. They were also significantly enriched for 2DL2/L3 ligand-positive pairs (PVA, P=0.024, Pc=0.047; Odds Ratio:2.563, CI95%:1.109-5.923, 3DL1*00101 (Ab>VA, PSTh, P=0.034, Pc=0.268, and 3DL1*029 (Ab>STh, P=0.039, Pc=0.301. Aboriginal patients ligand-positive for 3DL1/S1 and 2DL1 had the lowest probabilities of death (R(d (R(d=28%, compared to patients that were 3DL1/S1 ligand-negative (R(d=52% or carried 3DL1*029 (R(d=52%. Relative to Caucasoids (CA, two allotypes were enriched among non-aboriginal ICU patients (NAb: 3DL1*00401 (NAb>CA, P<0.001, Pc<0.001 and 3DL1*01502 (CA1/S1, 2DL2/L3, and 2DL1 had the lowest probabilities of death (R(d=36%, compared to subjects with 3DL1*01502 (R(d=48% and/or 3DL1*00401 (R(d=58%. CONCLUSIONS: Specific KIR3DL1/S1 allotypes, 3DL1/S1 and 2DL1 ligand-negative pairs, and 2DL2/L3 ligand-positive pairs were enriched among ICU patients. This suggests a possible association with NK cell dysfunction in patients with overactive immune responses to H1N1/09, leading to

  19. Anti-PD-L1 Treatment Induced Central Diabetes Insipidus.

    Science.gov (United States)

    Zhao, Chen; Tella, Sri Harsha; Del Rivero, Jaydira; Kommalapati, Anuhya; Ebenuwa, Ifechukwude; Gulley, James; Strauss, Julius; Brownell, Isaac

    2018-02-01

    Immune checkpoint inhibitors, including anti-programmed cell death protein 1 (PD-1), anti-programmed cell death protein ligand 1 (PD-L1), and anti-cytotoxic T-lymphocyte antigen 4 (anti-CTLA4) monoclonal antibodies, have been widely used in cancer treatment. They are known to cause immune-related adverse events (irAEs), which resemble autoimmune diseases. Anterior pituitary hypophysitis with secondary hypopituitarism is a frequently reported irAE, especially in patients receiving anti-CTLA4 treatment. In contrast, posterior pituitary involvement, such as central diabetes insipidus (DI), is relatively rare and is unreported in patients undergoing PD-1/PD-L1 blockade. We describe a case of a 73-year-old man with Merkel cell carcinoma who received the anti-PD-L1 monoclonal antibody avelumab and achieved partial response. The patient developed nocturia, polydipsia, and polyuria 3 months after starting avelumab. Further laboratory testing revealed central DI. Avelumab was held and he received desmopressin for the management of central DI. Within 6 weeks after discontinuation of avelumab, the patient's symptoms resolved and he was eventually taken off desmopressin. The patient remained off avelumab and there were no signs or symptoms of DI 2 months after the discontinuation of desmopressin. To our knowledge, this is the first report of central DI associated with anti-PD-L1 immunotherapy. The patient's endocrinopathy was successfully managed by holding treatment with the immune checkpoint inhibitor. This case highlights the importance of early screening and appropriate management of hormonal irAEs in subjects undergoing treatment with immune checkpoint inhibitors to minimize morbidity and mortality. Copyright © 2017 Endocrine Society

  20. Zymomonas mobilis: a bacterium for ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Baratti, J.C.; Bu' Lock, J.D.

    1986-01-01

    Zymomonas mobilis is a facultative anaerobic gram negative bacterium first isolated in tropical countries from alcoholic beverages like the African palm wine, the Mexican pulque and also as a contaminant of cider (cider sickness) or beer in the European countries. It is one of the few facultative anaerobic bacteria degrading glucose by the Entner-Doudoroff pathway usually found in strictly aerobic microorganisms. Some work was devoted to this bacterium in the 50s and 60s and was reviewed by Swings and De Ley in their classical paper published in 1977. During the 70s there was very little work on the bacterium until 1979 and the first report by the Australian group of P.L. Rogers on the great potentialities of Z. mobilis for ethanol production. At that time the petroleum crisis had led the developed countries to search for alternative fuel from renewable resources. The Australian group clearly demonstrated the advantages of the bacterium compared to the yeasts traditionally used for the alcoholic fermentation. As a result, there was a considerable burst in the Zymomonas literature which started from nearly zero in the late 70s to attain 70 papers published in the field in 1984. In this article, papers published from 1982 to 1986 are reviewed.

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  2. The Pleiotropic Role of L1CAM in Tumor Vasculature

    Directory of Open Access Journals (Sweden)

    Francesca Angiolini

    2017-01-01

    Full Text Available Angiogenesis, the formation of new vessels, is a key step in the development, invasion, and dissemination of solid tumors and, therefore, represents a viable target in the context of antitumor therapy. Indeed, antiangiogenic approaches have given promising results in preclinical models and entered the clinical practice. However, in patients, the results obtained so far with antiangiogenic drugs have not completely fulfilled expectations, especially because their effect has been transient with tumors developing resistance and evasion mechanisms. A better understanding of the mechanisms that underlie tumor vascularization and the functional regulation of cancer vessels is a prerequisite for the development of novel and alternative antiangiogenic treatments. The L1 cell adhesion molecule (L1CAM, a cell surface glycoprotein previously implicated in the development and plasticity of the nervous system, is aberrantly expressed in the vasculature of various cancer types. L1CAM plays multiple pro-angiogenic roles in the endothelial cells of tumor-associated vessels, thus emerging as a potential therapeutic target. In addition, L1CAM prevents the maturation of cancer vasculature and its inhibition promotes vessel normalization, a process that is thought to improve the therapeutic response of tumors to cytotoxic drugs. We here provide an overview on tumor angiogenesis and antiangiogenic therapies and summarize the current knowledge on the biological role of L1CAM in cancer vasculature. Finally, we highlight the clinical implications of targeting L1CAM as a novel antiangiogenic and vessel-normalizing approach.

  3. Rotational hypersurfaces with $L_r$-pointwise 1-type Gauss map

    Directory of Open Access Journals (Sweden)

    Akram Mohammadpouri

    2018-07-01

    Full Text Available In this paper, we study hypersurfaces in $\\E^{n+1}$ which Gauss map $G$ satisfies the equation $L_rG = f(G + C$ for a smooth function $f$ and a constant vector $C$, where $L_r$ is the linearized operator of the $(r + 1$th mean curvature of the hypersurface, i.e., $L_r(f=tr(P_r\\circ\

  4. Understanding the structural and energetic basis of PD-1 and monoclonal antibodies bound to PD-L1: A molecular modeling perspective.

    Science.gov (United States)

    Shi, Danfeng; Zhou, Shuangyan; Liu, Xuewei; Zhao, Chenxi; Liu, Huanxiang; Yao, Xiaojun

    2018-03-01

    The inhibitors blocking the interaction between programmed cell death protein 1(PD-1) and programmed death-ligand 1(PD-L1) can activate the immune response of T cell and eliminate cancer cells. The crystallographic studies have provided structural insights of the interactive interfaces between PD-L1 and its protein ligands. However, the hotspot residues on PD-L1 as well as structural and energetic basis for different protein ligands still need to be further investigated. Molecular modeling methods including molecular dynamics simulation, per-residue free energy decomposition, virtual alanine scanning mutagenesis and residue-residue contact analysis were used to qualitatively and quantitatively analyze the interactions between PD-L1 and different protein ligands. The results of virtual alanine scanning mutagenesis suggest that Y56, Q66, M115, D122, Y123, R125 are the hotspot residues on PD-L1. The residue-residue contact analysis further shows that PD-1 interacts with PD-L1 mainly by F and G strands while monoclonal antibodies like avelumab and BMS-936559 mainly interact with PD-L1 by CDR2 and CDR3 loops of the heavy chain. A structurally similar β-hairpin peptide with 13 or 14 residues was extracted from each protein ligand and these β-hairpin peptides were found tightly binding to the putative hotspot residues on PD-L1. This study recognizes the hotspot residues on PD-L1 and uncovers the common structural and energetic basis of different protein ligands binding to PD-L1. These results will be valuable for the design of small molecule or peptide inhibitors targeting on PD-L1. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Dicty_cDB: Contig-U10497-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ce 9 from Patent WO0234921. ... 79 2e-13 AF511570_1( AF511570 |pid:none) Uncultured soil bacterium clone 57....000542_2092( CP000542 |pid:none) Verminephrobacter eiseniae EF01... 58 4e-07 AF511571_1( AF511571 |pid:none) Uncultured soil... Pseudomonas fluorescens Pf0-1, ... 51 7e-05 AF511572_1( AF511572 |pid:none) Uncultured soil bacterium clone

  6. Subband Adaptive Filtering with l1-Norm Constraint for Sparse System Identification

    Directory of Open Access Journals (Sweden)

    Young-Seok Choi

    2013-01-01

    Full Text Available This paper presents a new approach of the normalized subband adaptive filter (NSAF which directly exploits the sparsity condition of an underlying system for sparse system identification. The proposed NSAF integrates a weighted l1-norm constraint into the cost function of the NSAF algorithm. To get the optimum solution of the weighted l1-norm regularized cost function, a subgradient calculus is employed, resulting in a stochastic gradient based update recursion of the weighted l1-norm regularized NSAF. The choice of distinct weighted l1-norm regularization leads to two versions of the l1-norm regularized NSAF. Numerical results clearly indicate the superior convergence of the l1-norm regularized NSAFs over the classical NSAF especially when identifying a sparse system.

  7. Butyric acid production from red algae by a newly isolated Clostridium sp. S1.

    Science.gov (United States)

    Lee, Kyung Min; Choi, Okkyoung; Kim, Ki-Yeon; Woo, Han Min; Kim, Yunje; Han, Sung Ok; Sang, Byoung-In; Um, Youngsoon

    2015-09-01

    To produce butyric acid from red algae such as Gelidium amansii in which galactose is a main carbohydrate, microorganisms utilizing galactose and tolerating inhibitors in hydrolysis including levulinic acid and 5-hydroxymethylfurfural (HMF) are required. A newly isolated bacterium, Clostridium sp. S1 produced butyric acid not only from galactose as the sole carbon source but also from a mixture of galactose and glucose through simultaneous utilization. Notably, Clostridium sp. S1 produced butyric acid and a small amount of acetic acid with the butyrate:acetate ratio of 45.4:1 and it even converted acetate to butyric acid. Clostridium sp. S1 tolerated 0.5-2 g levulinic acid/l and recovered from HMF inhibition at 0.6-2.5 g/l, resulting in 85-92% butyric acid concentration of the control culture. When acid-pretreated G. amansii hydrolysate was used, Clostridium sp. S1 produced 4.83 g butyric acid/l from 10 g galactose/l and 1 g glucose/l. Clostridium sp. S1 produces butyric acid from red algae due to its characteristics in sugar utilization and tolerance to inhibitors, demonstrating its advantage as a red algae-utilizing microorganism.

  8. Lactococcus lactis - a diploid bacterium

    DEFF Research Database (Denmark)

    Michelsen, Ole; Hansen, Flemming G.; Jensen, Peter Ruhdal

    the next division. Thus, the regions of the chromosome that are the last to be replicated are haploid even in fast-growing bacteria. In contrast to this general rule for bacteria, we found that Lactococcus lactis, a bacterium which has been exploited for thousands of years for the production of fermented...... milk products, is born with two complete non-replicating chromosomes. L. lactis therefore remain diploid throughout its entire life cycle....

  9. Implementation of DoS attack and mitigation strategies in IEEE 802.11b/g WLAN

    Science.gov (United States)

    Deng, Julia; Meng, Ke; Xiao, Yang; Xu, Roger

    2010-04-01

    IEEE 802.11 wireless Local Area Network (WLAN) becomes very prevalent nowadays. Either as a simple range extender for a home wired Ethernet interface, or as a wireless deployment throughout an enterprise, WLAN provides mobility, convenience, and low cost. However, an IEEE 802.11b/g wireless network uses the frequency of unlicensed 2.4GHz, which makes the network unsafe and more vulnerable than traditional Ethernet networks. As a result, anyone who is familiar with wireless network may initiate a Denial of Service (DoS) attack to influence the common communication of the network or even make it crash. In this paper, we present our studies on the DoS attacks and mitigation strategies for IEEE 802.11b/g WLANs and describe some initial implementations using IEEE 802.11b/g wireless devices.

  10. Comparing L1 and L2 Texts and Writers in First-Year Composition

    Science.gov (United States)

    Eckstein, Grant; Ferris, Dana

    2018-01-01

    Scholars have at various points discussed the needs of second language (L2) writers enrolled in "mainstream" composition courses where they are mixed with native (L1) English speakers. Other researchers have investigated the experiences of L2 writers in mainstream classes and the perceptions of their instructors about their abilities and…

  11. Sequence of a complete chicken BG haplotype shows dynamic expansion and contraction of two gene lineages with particular expression patterns

    DEFF Research Database (Denmark)

    Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.

    2014-01-01

    complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...

  12. Increased cell survival by inhibition of BRCA1 using an antisense approach in an estrogen responsive ovarian carcinoma cell line

    International Nuclear Information System (INIS)

    Annab, Lois A; Hawkins, Rebecca E; Solomon, Greg; Barrett, J Carl; Afshari, Cynthia A

    2000-01-01

    protection assay (Fig. 1a). BRCA1 ribonuclease protection probe was made using an in vitro transcription kit (Ambion, Inc, Austin, TX, USA) as previously described [10] and derived clones were tested for protein levels by Western blot analysis using an anti-BRCA1 (Oncogene Research, Ab-1, Cambridge, MA, USA) antibody. Growth curve analysis of Infected populations and were pretreated for 5 days in phenol red-free, Dulbecco's modified eagle medium (DMEM)/F-12 medium (Gibco/Life Technologies) supplemented with 10% charcoal/dextran treated serum (Hyclone, Logan, UT, USA), then plated at 2.5 × 10 6 cells per 100mm dish in triplicate in the absence or presence of estrogen (10 -8 mol/l; 17β-Estradiol; 1,3,5 (10) - Estratriene 3,17β-diol; Sigma, St Louis, MO, USA). For soft agar assay, clones were plated into 10 60-mm dishes at 1 × 10 5 cells/dish containing 0.3% bactopeptone agar with or without added estrogen (10 -8 mol/l) in phenol red-free medium with 10% stripped serum in order to test for anchorage independent growth. BG-1 infected clones were tested for tumorigenicity by injection of cells (10 6 cells in 0.1cm 2 50% matrigel; Collaborative Biomedical Products, Bedford, MA, USA) into subcutaneous sites in 6-week-old athymic Ncr-nude mice (NCI Animal Program, Bethesda, MD, USA) that were ovariectomized at approximately 4 weeks of age. Half of the ovariectomized mice received an implanted 0.18mg estrogen 60-day pellet (Innovative Research of America, Sarasota, FL, USA). Antisense technology was effective in decreasing both RNA and protein levels of BRCA1 in the BG-1 human ovarian adenocarcinoma cells. BRCA1 antisense-infected populations contained significantly less BRCA1 message than control LXSN-infected pools and selected clones contained varying reduced levels of BRCA1 protein compared with control clones (Figs 1a and 1b). Three independent BRCA1 antisense-infected cultures demonstrated a resistance to cell death induced by withdrawal from estrogen over a 6- to 20

  13. No apparent costs for facultative antibiotic production by the soil bacterium Pseudomonas fluorescens Pf0-1.

    Directory of Open Access Journals (Sweden)

    Paolina Garbeva

    Full Text Available BACKGROUND: Many soil-inhabiting bacteria are known to produce secondary metabolites that can suppress microorganisms competing for the same resources. The production of antimicrobial compounds is expected to incur fitness costs for the producing bacteria. Such costs form the basis for models on the co-existence of antibiotic-producing and non-antibiotic producing strains. However, so far studies quantifying the costs of antibiotic production by bacteria are scarce. The current study reports on possible costs, for antibiotic production by Pseudomonas fluorescens Pf0-1, a soil bacterium that is induced to produce a broad-spectrum antibiotic when it is confronted with non-related bacterial competitors or supernatants of their cultures. METHODOLOGY AND PRINCIPAL FINDINGS: We measured the possible cost of antibiotic production for Pseudomonas fluorescens Pf0-1 by monitoring changes in growth rate with and without induction of antibiotic production by supernatant of a bacterial competitor, namely Pedobacter sp.. Experiments were performed in liquid as well as on semi-solid media under nutrient-limited conditions that are expected to most clearly reveal fitness costs. Our results did not reveal any significant costs for production of antibiotics by Pseudomonas fluorescens Pf0-1. Comparison of growth rates of the antibiotic-producing wild-type cells with those of non-antibiotic producing mutants did not reveal costs of antibiotic production either. SIGNIFICANCE: Based on our findings we propose that the facultative production of antibiotics might not be selected to mitigate metabolic costs, but instead might be advantageous because it limits the risk of competitors evolving resistance, or even the risk of competitors feeding on the compounds produced.

  14. L 1 Generalized Procrustes 2D Shape Alignment

    DEFF Research Database (Denmark)

    Larsen, Rasmus

    2008-01-01

    on the orientation of the coordinate system, i.e. it is not rotationally invariant. However, by simultaneously minimizing the city block distances in a series of rotated coordinate systems we are able to approximate the circular equidistance curves of Euclidean distances with a regular polygonal equidistance curve...... to the precision needed. Using 3 coordinate systems rotated 30 degrees we get a 12 sided regular polygon, with which we achieve deviations from Euclidean distances less than 2 % over all directions. This new formulation allows for minimization in the L1-norm using LP. We demonstrate that the use of the L1-norm...

  15. B-G cDNA clones have multiple small repeats and hybridize to both chicken MHC regions

    DEFF Research Database (Denmark)

    Kaufman, J; Salomonsen, J; Skjødt, K

    1989-01-01

    We used rabbit antisera to the chicken MHC erythrocyte molecule B-G and to the class I alpha chain (B-F) to screen lambda gt11 cDNA expression libraries made with RNA selected by oligo-dT from bone marrow cells of anemic B19 homozygous chickens. Eight clones were found to encode B-G molecules which...

  16. Requirements for an "ideal" bilingual L1L2 translation- oriented ...

    African Journals Online (AJOL)

    The major aim of this article is to outline the requirements for an "ideal" bilingual L1L2 dictionary of the general vocabulary specifically designed for the purposes of professional translation. The article challenges three commonly accepted beliefs: (a) a bilingual dictionary equals a translation dictionary; (b) a bilingual ...

  17. Reviews on 1,4-naphthoquinones from Diospyros L.

    Science.gov (United States)

    Nematollahi, Alireza; Aminimoghadamfarouj, Noushin; Wiart, Christophe

    2012-01-01

    The genus Diospyros is one of the most important sources of bioactive compounds, exclusively 1,4-naphthoquinones. The following information is an attempt to cover the developments in the biology and phytochemistry of 1,4-naphthoquinones isolated from this genus, as well as the studies done and the suggested mechanisms regarding their activities. During the past 60 years, many of these agents have been isolated from Diospyros L. Twelve considerable bioactive structures are reported in this review. The basic 1,4-naphthoquinone skeletons, on which a large number of studies have been done, are plumbagin and diospyrin. Today, the potential for development of leads from 1,4-naphthoquinones obtained from Diospyros L. is growing dramatically, mainly in the area of anticancer and antibacterial investigations. The data prepared and described here are intended to be served as a reference tool to the natural products and chemistry specialists in order to expand the rational drug design.

  18. Characterization of new cell line stably expressing CHI3L1 oncogene

    Directory of Open Access Journals (Sweden)

    Chekhonin V. P.

    2011-06-01

    Full Text Available Aim. To characterize the immortalized 293 cell line after stable transfection with human oncogene (CHI3L1. Methods. 293 cells, stably transfected with pcDNA3.1_CHI3L1, and 293 cells, stably transfected with pcDNA3.1 as a negative control, were used throughout all experiments. The clones of CHI3L1-expressing 293 cells and 293 cells, transfected with pcDNA3.1, were analyzed by immunofluorescence and confocal microscopy. Cell proliferation was measured using MTT assay; analyses of ERK1/2 and AKT activation and their cellular localization were performed with anti-phospho-ERK and anti-phospho-AKT antibodies. Specific activation of MAP and PI3 kinases was measured by densitometric analysis of Western-blot signals. Results. The obtained results show quite modest ability of CHI3L1 to stimulate cell growth and reflect rather an improved cellular plating efficiency of the 293 cells stably transfected with pcDNA3.1_CHI3L1 as compared to the 293 cells transfected with an «empty» vector. ERK1/2 and AKT are activated in the 293_CHI3L1 cells. In these cells phosphorylated ERK1/2 were localized in both cell cytoplasm and nuclei while AKT only in cytoplasm. The 293_CHI3L1 cells differed from the 293 cells, transfected with an «empty» vector, in their size and ability to adhere to the culture plates. Conclusions. The overexpression of CHI3L1 is likely to have an important role in tumorigenesis via a mechanism which involves activation of PI3K and ERK1/2 pathways. The tumors which can be induced by orthotopic implantation of the transformed human cells with overexpressed human oncogene CHI3L1 into the rat brain can be used as a target for anticancer drug development.

  19. GCN5L1 modulates cross-talk between mitochondria and cell signaling to regulate FoxO1 stability and gluconeogenesis.

    Science.gov (United States)

    Wang, Lingdi; Scott, Iain; Zhu, Lu; Wu, Kaiyuan; Han, Kim; Chen, Yong; Gucek, Marjan; Sack, Michael N

    2017-09-12

    The mitochondrial enriched GCN5-like 1 (GCN5L1) protein has been shown to modulate mitochondrial protein acetylation, mitochondrial content and mitochondrial retrograde signaling. Here we show that hepatic GCN5L1 ablation reduces fasting glucose levels and blunts hepatic gluconeogenesis without affecting systemic glucose tolerance. PEPCK and G6Pase transcript levels are downregulated in hepatocytes from GCN5L1 liver specific knockout mice and their upstream regulator, FoxO1 protein levels are decreased via proteasome-dependent degradation and via reactive oxygen species mediated ERK-1/2 phosphorylation. ERK inhibition restores FoxO1, gluconeogenic enzyme expression and glucose production. Reconstitution of mitochondrial-targeted GCN5L1 blunts mitochondrial ROS, ERK activation and increases FoxO1, gluconeogenic enzyme expression and hepatocyte glucose production. We suggest that mitochondrial GCN5L1 modulates post-translational control of FoxO1, regulates gluconeogenesis and controls metabolic pathways via mitochondrial ROS mediated ERK activation. Exploring mechanisms underpinning GCN5L1 mediated ROS signaling may expand our understanding of the role of mitochondria in gluconeogenesis control.Hepatic gluconeogenesis is tightly regulated at transcriptional level and is essential for survival during prolonged fasting. Here Wang et al. show that the mitochondrial enriched GCN5-like 1 protein controls hepatic glucose production by regulating FoxO1 protein levels via proteasome-dependent degradation and, in turn, gluconeogenic gene expression.

  20. Nephrogenic diabetes insipidus in a patient with L1 syndrome: a new report of a contiguous gene deletion syndrome including L1CAM and AVPR2.

    Science.gov (United States)

    Knops, Noël B B; Bos, Krista K; Kerstjens, Mieke; van Dael, Karin; Vos, Yvonne J

    2008-07-15

    We report on an infant boy with congenital hydrocephalus due to L1 syndrome and polyuria due to diabetes insipidus. We initially believed his excessive urine loss was from central diabetes insipidus and that the cerebral malformation caused a secondary insufficient pituitary vasopressin release. However, he failed to respond to treatment with a vasopressin analogue, which pointed to nephrogenic diabetes insipidus (NDI). L1 syndrome and X-linked NDI are distinct clinical disorders caused by mutations in the L1CAM and AVPR2 genes, respectively, located in adjacent positions in Xq28. In this boy we found a deletion of 61,577 basepairs encompassing the entire L1CAM and AVPR2 genes and extending into intron 7 of the ARHGAP4 gene. To our knowledge this is the first description of a patient with a deletion of these three genes. He is the second patient to be described with L1 syndrome and NDI. During follow-up he manifested complications from the hydrocephalus and NDI including global developmental delay and growth failure with low IGF-1 and hypothyroidism. 2008 Wiley-Liss, Inc.

  1. Bioethanol production from mannitol by a newly isolated bacterium, Enterobacter sp. JMP3.

    Science.gov (United States)

    Wang, Jing; Kim, Young Mi; Rhee, Hong Soon; Lee, Min Woo; Park, Jong Moon

    2013-05-01

    In this study a new bacterium capable of growing on brown seaweed Laminaria japonica, Enterobacter sp. JMP3 was isolated from the gut of turban shell, Batillus cornutus. In anaerobic condition, it produced high yields of ethanol (1.15 mol-EtOH mol-mannitol(-1)) as well as organic acids from mannitol, the major carbohydrate component of L. japonica. Based on carbon distribution and metabolic flux analysis, it was revealed that mannitol was more favorable than glucose for ethanol production due to their different redox states. This indicates that L. japonica is one of the promising feedstock for bioethanol production. Additionally, the mannitol dehydrogenation pathway in Enterobacter sp. JMP3 was examined and verified. Finally, an attempt was made to explore the possibility of controlling ethanol production by altering the redox potential via addition of external NADH in mannitol fermentation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Data of evolutionary structure change: 1AIFL-2AI0L [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available /ss_2> 0 n> 1AIF L...n> 1AIFLn> VSSSI----SSSNL 2AI0 Ln> 2AI0L...1AIFL-2AI0L 1AIF 2AI0 L L DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...line> SER CA 273 SER CA 260 ASN CA 337 LEU CA 408

  3. CLPTM1L is overexpressed in lung cancer and associated with apoptosis.

    Directory of Open Access Journals (Sweden)

    Zhenhua Ni

    Full Text Available CLPTM1L is believed to be associated with lung cancer. However, there is little information regarding its expression and function. Here using immunohistochemistry, we found that CLPTM1L expression was markedly increased in lung cancer tissues relative to normal tissues, especially in lung adenocarcinoma. CLPTM1L expression was not found to be associated with stages, smoking status, lymph node metastasis, or T lymphocyte infiltration but with differentiation stage. We found CLPTM1L to be enriched in the mitochondrial compared with plasma membrane protein extracts. CLPTM1L-EGFP transfection showed that the molecule product was expressed in cytoplasm and indicated the mitochondrial localization stained with mitochondrial marker MitoTracker. CLPTM1L transferred lung cancer cell line 95-D showed no growth inhibition or cell apoptosis, but it did show inhibited sensitivity to cis-diamminedichloroplatinum(II (cisplatin, CDDP. Knockdown of CLPTM1L by RNAi did not interfere with cell proliferation but it did increase cell sensitivity to CDDP and activation of caspase-9 and caspase-3/7. These data indicate CLPTM1L is a mitochondria protein and that it may be associated with anti-apoptotic mechanism which affects drug-resistance in turn.

  4. The impact of language co-activation on L1 and L2 speech fluency.

    Science.gov (United States)

    Bergmann, Christopher; Sprenger, Simone A; Schmid, Monika S

    2015-10-01

    Fluent speech depends on the availability of well-established linguistic knowledge and routines for speech planning and articulation. A lack of speech fluency in late second-language (L2) learners may point to a deficiency of these representations, due to incomplete acquisition. Experiments on bilingual language processing have shown, however, that there are strong reasons to believe that multilingual speakers experience co-activation of the languages they speak. We have studied to what degree language co-activation affects fluency in the speech of bilinguals, comparing a monolingual German control group with two bilingual groups: 1) first-language (L1) attriters, who have fully acquired German before emigrating to an L2 English environment, and 2) immersed L2 learners of German (L1: English). We have analysed the temporal fluency and the incidence of disfluency markers (pauses, repetitions and self-corrections) in spontaneous film retellings. Our findings show that learners to speak more slowly than controls and attriters. Also, on each count, the speech of at least one of the bilingual groups contains more disfluency markers than the retellings of the control group. Generally speaking, both bilingual groups-learners and attriters-are equally (dis)fluent and significantly more disfluent than the monolingual speakers. Given that the L1 attriters are unaffected by incomplete acquisition, we interpret these findings as evidence for language competition during speech production. Copyright © 2015. Published by Elsevier B.V.

  5. Ultra-broadband 2D electronic spectroscopy of carotenoid-bacteriochlorophyll interactions in the LH1 complex of a purple bacterium

    Energy Technology Data Exchange (ETDEWEB)

    Maiuri, Margherita [CNR-IFN, Dipartimento di Fisica, Politecnico di Milano, P.zza L. da Vinci 32, Milano 20133 (Italy); Department of Chemistry, Princeton University, Washington Road, Princeton, New Jersey 08544 (United States); Réhault, Julien; Polli, Dario; Cerullo, Giulio, E-mail: giulio.cerullo@polimi.it [CNR-IFN, Dipartimento di Fisica, Politecnico di Milano, P.zza L. da Vinci 32, Milano 20133 (Italy); Carey, Anne-Marie; Hacking, Kirsty; Cogdell, Richard J. [Glasgow Biomedical Research Centre, IBLS, University of Glasgow, 126 Place, Glasgow G12 8TA, Scotland (United Kingdom); Garavelli, Marco [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, Université de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France); Lüer, Larry [Madrid Institute for Advanced Studies, IMDEA Nanociencia, Madrid (Spain)

    2015-06-07

    We investigate the excitation energy transfer (EET) pathways in the photosynthetic light harvesting 1 (LH1) complex of purple bacterium Rhodospirillum rubrum with ultra-broadband two-dimensional electronic spectroscopy (2DES). We employ a 2DES apparatus in the partially collinear geometry, using a passive birefringent interferometer to generate the phase-locked pump pulse pair. This scheme easily lends itself to two-color operation, by coupling a sub-10 fs visible pulse with a sub-15-fs near-infrared pulse. This unique pulse combination allows us to simultaneously track with extremely high temporal resolution both the dynamics of the photoexcited carotenoid spirilloxanthin (Spx) in the visible range and the EET between the Spx and the B890 bacterio-chlorophyll (BChl), whose Q{sub x} and Q{sub y} transitions peak at 585 and 881 nm, respectively, in the near-infrared. Global analysis of the one-color and two-color 2DES maps unravels different relaxation mechanisms in the LH1 complex: (i) the initial events of the internal conversion process within the Spx, (ii) the parallel EET from the first bright state S{sub 2} of the Spx towards the Q{sub x} state of the B890, and (iii) the internal conversion from Q{sub x} to Q{sub y} within the B890.

  6. Association between Virulence Factors and TRAF1/4-1BB/Bcl-xL Expression in Gastric Mucosa Infected with Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Fen Wang

    2015-01-01

    Full Text Available Objective. CagA+/vacAs1+/vacAm1+ Helicobacter pylori upregulates the expression of tumor necrosis factor receptor–associated factor 1 (TRAF1, tumor necrosis factor receptor superfamily member 9 (4-1BB, and B-cell lymphoma-extra large (Bcl-xL in human gastric epithelial cells. We investigated the correlation between cagA/vacAs1/vacAm1 and TRAF1/4-1BB/Bcl-xL expression in gastric mucosal tissue of patients with gastric disorders. Methods. We collected gastric mucosa samples from 35 chronic, nonatrophic gastritis (CG patients, 41 atrophic gastritis patients, 44 intestinal metaplasia with atypical hyperplasia (IM patients, and 28 gastric carcinoma (Ca patients. The expression of  TRAF1, 4-1BB, and Bcl-xL was determined using western blotting. The expression of cagA, vacAs1, and vacAm1 in H. pylori was examined with polymerase chain reaction. Results. The expression of TRAF1, 4-1BB, and Bcl-xL was significantly upregulated in IM and Ca patients (P<0.05 compared with CG. There were more cases of cagA+/vacAs1+/vacAm1+ H. pylori infection in samples with elevated TRAF1, 4-1BB, or Bcl-xL expression (P<0.05. Additionally, there were a remarkably large number of samples with upregulated TRAF1/4-1BB/Bcl-xL expression in cases of cagA+/vacAs1+/vacAm1+ H. pylori infection (44 cases, 67.7%; P<0.05. Conclusions. The pathogenesis of IM and Ca may be promoted by cagA+/vacAs1+/vacAm1+ H. pylori, possibly via upregulated TRAF1, 4-1BB, and Bcl-xL in gastric mucosal tissue.

  7. Anomalous phonon stiffening associated with the (1 1 1) antiphase boundary in L12 Ni3Al

    International Nuclear Information System (INIS)

    Manga, Venkateswara Rao; Shang, Shun-Li; Wang, William Yi; Wang, Yi; Liang, Jiang; Crespi, Vincent H.; Liu, Zi-Kui

    2015-01-01

    Antiphase boundaries (APBs) play a crucial role in the anomalous yield behavior exhibited by Ni 3 Al with L1 2 structure. We investigated the changes in the vibrational properties associated with the formation of (0 0 1) and (1 1 1) APBs in Ni 3 Al by employing first-principles calculations. The phonon density of states of Ni 3 Al with and without (0 0 1) and (1 1 1) APBs revealed an interesting result: the (0 0 1) APB softens the phonons in its vicinity, while the (1 1 1) stiffens them. We also calculated the finite-temperature (0 0 1) and (1 1 1) APB Gibbs free energies from the first-principles quasi-harmonic approximation. The vibrational entropy of formation is positive (e.g. 0.053 mJ K −1 m −2 at 300 K) for the (0 0 1) APB and is negative (e.g. −0.0157 mJ K −1 m −2 at 300 K) for the (1 1 1) APB over the entire temperature range. We also find a significant change in the thermal electronic free energy due to the creation of the (0 0 1) or (1 1 1) APB. The anisotropy ratio of the APB energies, i.e. the ratio of the (1 1 1) APB free energy to the (0 0 1) APB free energy, changes from 2.9 at 300 K to 15.9 at 1000 K

  8. [Regulatory Mechanisms of PD-L1 Expression and Its Role in Immune Evasion].

    Science.gov (United States)

    Kataoka, Keisuke

    2017-11-01

    Immune checkpoint blockade therapy using anti-PD-1 or anti-PD-L1 antibodies can unleash anti-tumor immunity and induce durable remission in a variety ofhuman cancers. However, the regulatory mechanisms of PD-L1 expression mediating immune evasion ofcancer cells have not been fully elucidated, including the genetic alterations causing PD-L1 overexpression. Recently, we have reported a novel genetic mechanism ofimmune evasion associated with structural variations(SVs)disrupting the 3'-untranslated region(UTR)ofthe PD-L1 gene in various malignancies, such as aggressive lymphomas and gastrointestinal cancers. Despite a heterogenous nature ofthese SVs, they are closely associated with a marked upregulation of PD-L1 expression, which augments tumor growth and escape from anti-tumor immunity. Here we present an overview of the regulatory mechanisms of PD-L1 expression in cancer cells, highlighting the genetic mechanisms of PD-L1 constitutive activation, with specific focus on PD-L1 3'-UTR disruption.

  9. Structure-Based Design of a Soluble Prefusion-Closed HIV-1 Env Trimer with Reduced CD4 Affinity and Improved Immunogenicity

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Gwo-Yu; Geng, Hui; Pancera, Marie; Xu, Kai; Cheng, Cheng; Acharya, Priyamvada; Chambers, Michael; Druz, Aliaksandr; Tsybovsky, Yaroslav; Wanninger, Timothy G.; Yang, Yongping; Doria-Rose, Nicole A.; Georgiev, Ivelin S.; Gorman, Jason; Joyce, M.Gordon; O; Dell, Sijy; Zhou, Tongqing; McDermott, Adrian B.; Mascola, John R.; Kwong, Peter D. (NIH); (FNL)

    2017-03-08

    ABSTRACT

    The HIV-1 envelope (Env) trimer is a target for vaccine design as well as a conformational machine that facilitates virus entry by transitioning between prefusion-closed, CD4-bound, and coreceptor-bound conformations by transitioning into a postfusion state. Vaccine designers have sought to restrict the conformation of the HIV-1 Env trimer to its prefusion-closed state as this state is recognized by most broadly neutralizing, but not nonneutralizing, antibodies. We previously identified a disulfide bond, I201C-A433C (DS), which stabilizes Env in the vaccine-desired prefusion-closed state. When placed into the context of BG505 SOSIP.664, a soluble Env trimer mimic developed by Sanders, Moore, and colleagues, the engineered DS-SOSIP trimer showed reduced conformational triggering by CD4. Here, we further stabilize DS-SOSIP through a combination of structure-based design and 96-well-based expression and antigenic assessment. From 103 designs, we identified one, named DS-SOSIP.4mut, with four additional mutations at the interface of potentially mobile domains of the prefusion-closed structure. We also determined the crystal structures of DS-SOSIP.4mut at 4.1-Å resolution and of an additional DS-SOSIP.6mut variant at 4.3-Å resolution, and these confirmed the formation of engineered disulfide bonds. Notably, DS-SOSIP.4mut elicited a higher ratio of tier 2 autologous titers versus tier 1 V3-sensitive titers than BG505 SOSIP.664. DS-SOSIP.4mut also showed reduced recognition of CD4 and increased thermostability. The improved antigenicity, thermostability, and immunogenicity of DS-SOSIP.4mut suggest utility as an immunogen or a serologic probe; moreover, the specific four alterations identified here, M154, M300, M302, and L320 (4mut), can also be transferred to other HIV-1 Env trimers of interest to improve their properties.

    IMPORTANCEOne approach to elicit broadly neutralizing antibodies against HIV-1 is to stabilize the

  10. Equilibrium, stability and transport in L=1 compact helical axis configuration

    International Nuclear Information System (INIS)

    Kikuchi, Hitoshi; Ueno, Hikaru; Aizawa, Masamitsu; Suzuki, Kiyomitsu; Gesso, Hirokazu; Saito, Katsunori; Kawakami, Ichiro; Shiina, Shoichi

    1990-01-01

    The L=1 torsatron is modified by two methods to improve the plasma stability. First one is the negative pitch modulation of coil winding. Second is the superposition of a relatively weak L=-1 torsatron field. These modification give rise to a local magnetic well keeping a positive magnetic shear. The equilibrium, stability and transport of plasma in these modified L=1 torsatrons are described and discussed. (author)

  11. GPM AMSR-E on AQUA Common Calibrated Brightness Temperatures L1C 1.5 hours 10.5 km V05 (GPM_1CAQUAAMSRE) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  12. Structural basis for small molecule targeting of the programmed death ligand 1 (PD-L1)

    NARCIS (Netherlands)

    Zak, Krzysztof M.; Grudnik, Przemyslaw; Guzik, Katarzyna; Zieba, Bartosz J.; Musielak, Bogdan; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

    2016-01-01

    Targeting the PD-1/PD-L1 immunologic checkpoint with monoclonal antibodies has provided unprecedented results in cancer treatment in the recent years. Development of chemical inhibitors for this pathway lags the antibody development because of insufficient structural information. The first

  13. Combining Amplification Typing of L1 Active Subfamilies (ATLAS) with High-Throughput Sequencing.

    Science.gov (United States)

    Rahbari, Raheleh; Badge, Richard M

    2016-01-01

    With the advent of new generations of high-throughput sequencing technologies, the catalog of human genome variants created by retrotransposon activity is expanding rapidly. However, despite these advances in describing L1 diversity and the fact that L1 must retrotranspose in the germline or prior to germline partitioning to be evolutionarily successful, direct assessment of de novo L1 retrotransposition in the germline or early embryogenesis has not been achieved for endogenous L1 elements. A direct study of de novo L1 retrotransposition into susceptible loci within sperm DNA (Freeman et al., Hum Mutat 32(8):978-988, 2011) suggested that the rate of L1 retrotransposition in the germline is much lower than previously estimated (ATLAS L1 display technique (Badge et al., Am J Hum Genet 72(4):823-838, 2003) to investigate de novo L1 retrotransposition in human genomes. In this chapter, we describe how we combined a high-coverage ATLAS variant with high-throughput sequencing, achieving 11-25× sequence depth per single amplicon, to study L1 retrotransposition in whole genome amplified (WGA) DNAs.

  14. Evaluation of a novel tool for bone graft delivery in minimally invasive transforaminal lumbar interbody fusion

    Directory of Open Access Journals (Sweden)

    Kleiner JB

    2016-05-01

    Full Text Available Jeffrey B Kleiner, Hannah M Kleiner, E John Grimberg Jr, Stefanie J Throlson The Spine Center of Innovation, The Medical Center of Aurora, Aurora, CO, USA Study design: Disk material removed (DMR during L4-5 and L5-S1 transforaminal lumbar interbody fusion (T-LIF surgery was compared to the corresponding bone graft (BG volumes inserted at the time of fusion. A novel BG delivery tool (BGDT was used to apply the BG. In order to establish the percentage of DMR during T-LIF, it was compared to DMR during anterior diskectomy (AD. This study was performed prospectively. Summary of background data: Minimal information is available as to the volume of DMR during a T-LIF procedure, and the relationship between DMR and BG delivered is unknown. BG insertion has been empiric and technically challenging. Since the volume of BG applied to the prepared disk space likely impacts the probability of arthrodesis, an investigation is justified. Methods: A total of 65 patients with pathology at L4-5 and/or L5-S1 necessitating fusion were treated with a minimally invasive T-LIF procedure. DMR was volumetrically measured during disk space preparation. BG material consisting of local autograft, BG extender, and bone marrow aspirate were mixed to form a slurry. BG slurry was injected into the disk space using a novel BGDT and measured volumetrically. An additional 29 patients who were treated with L5-S1 AD were compared to L5-S1 T-LIF DMR to determine the percent of T-LIF DMR relative to AD. Results: DMR volumes averaged 3.6±2.2 mL. This represented 34% of the disk space relative to AD. The amount of BG delivered to the disk spaces was 9.3±3.2 mL, which is 2.6±2.2 times the amount of DMR. The BGDT allowed uncomplicated filling of the disk space in <1 minute. Conclusion: The volume of DMR during T-LIF allows for a predictable volume of BG delivery. The BGDT allowed complete filling of the entire prepared disk space. The T-LIF diskectomy debrides 34% of the disk

  15. Klebsiella sp. FIRD 2, a TBT-resistant bacterium isolated from contaminated surface sediment along Strait of Johor Malaysia.

    Science.gov (United States)

    Abubakar, Abdussamad; Mustafa, Muskhazli B; Johari, Wan Lutfi Wan; Zulkifli, Syaizwan Zahmir; Ismail, Ahmad; Mohamat-Yusuff, Ferdaus Binti

    2015-12-15

    A possible tributyltin (TBT)-degrading bacterium isolated from contaminated surface sediment was successfully identified as Klebsiella sp. FIRD 2. It was found to be the best isolate capable of resisting TBT at a concentration of 1000 μg L(-1). This was a concentration above the reported contaminated level at the sampling station, 790 μg L(-1). Further studies revealed that the isolate was Gram negative and resisted TBT concentrations of up to 1500 μg L(-1) in a Minimal Salt Broth without the addition of any carbon source within the first 48 h of incubation. It is expected that additional work could be conducted to check the degradation activity of this new isolate and possibly improve the degradation capacity in order to contribute to finding a safe and sustainable remediation solution of TBT contamination. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade.

    Science.gov (United States)

    Zhang, Fei; Wei, Hudie; Wang, Xiaoxiao; Bai, Yu; Wang, Pilin; Wu, Jiawei; Jiang, Xiaoyong; Wang, Yugang; Cai, Haiyan; Xu, Ting; Zhou, Aiwu

    2017-01-01

    The use of antibodies to target immune checkpoints, particularly PD-1/PD-L1, has made a profound impact in the field of cancer immunotherapy. Here, we identified KN035, an anti-PD-L1 nanobody that can strongly induce T-cell responses and inhibit tumor growth. The crystal structures of KN035 complexed with PD-L1 and free PD-L1, solved here at 1.7 and 2.7 Å resolution, respectively, show that KN035 competes with PD-1 (programmed death protein 1) for the same flat surface on PD-L1, mainly through a single surface loop of 21 amino acids. This loop forms two short helices and develops key hydrophobic and ionic interactions with PD-L1 residues, such as Ile54, Tyr56 and Arg113, which are also involved in PD-1 binding. The detailed mutagenesis study identified the hotspot residues of the PD-L1 surface and provides an explanation for the stronger (~1 000-fold) binding of KN035 to PD-L1 than PD-1 and its lack of binding to PD-L2. Overall, this study reveals how a single immunoglobulin-variable scaffold of KN035 or PD-1 can bind to a flat protein surface through either a single surface loop or beta-sheet strands; and provides a basis for designing new immune checkpoint blockers and generating bi-specific antibodies for combination therapy.

  17. The MLL1-H3K4me3 Axis-Mediated PD-L1 Expression and Pancreatic Cancer Immune Evasion.

    Science.gov (United States)

    Lu, Chunwan; Paschall, Amy V; Shi, Huidong; Savage, Natasha; Waller, Jennifer L; Sabbatini, Maria E; Oberlies, Nicholas H; Pearce, Cedric; Liu, Kebin

    2017-01-01

    Pancreatic cancer is one of the cancers where anti-PD-L1/PD-1 immunotherapy has been unsuccessful. What confers pancreatic cancer resistance to checkpoint immunotherapy is unknown. The aim of this study is to elucidate the underlying mechanism of PD-L1 expression regulation in the context of pancreatic cancer immune evasion. Pancreatic cancer mouse models and human specimens were used to determine PD-L1 and PD-1 expression and cancer immune evasion. Histone methyltransferase inhibitors, RNAi, and overexpression were used to elucidate the underlying molecular mechanism of PD-L1 expression regulation. All statistical tests were two-sided. PD-L1 is expressed in 60% to 90% of tumor cells in human pancreatic carcinomas and in nine of 10 human pancreatic cancer cell lines. PD-1 is expressed in 51.2% to 52.1% of pancreatic tumor-infiltrating cytotoxic T lymphocytes (CTLs). Tumors grow statistically significantly faster in FasL-deficient mice than in wild-type mice (P = .03-.001) and when CTLs are neutralized (P = .03-evasion. Targeting the MLL1-H3K4me3 axis is an effective approach to enhance the efficacy of checkpoint immunotherapy against pancreatic cancer. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Vaccine potential of recombinant cathepsinL1G against Fasciola gigantica in mice.

    Science.gov (United States)

    Changklungmoa, Narin; Phoinok, Natthacha; Yencham, Chonthicha; Sobhon, Prasert; Kueakhai, Pornanan

    2016-08-15

    In this study, we characterized and investigated the vaccine potential of FgCatL1G against Fasciola gigantica infection in mice. Recombinant mature FgCatL1G (rmFgCatL1G) was expressed in Escherichia coli BL21. The vaccination was performed in Imprinting Control Region (ICR) mice (n=10) by subcutaneous injection with 50μg of rmFgCatL1G combined with Freund's adjuvant. Two weeks after the second boost, mice were infected with 15 metacercariae by the oral route. The percents of protection of rmFgCatL1G vaccine were estimated to be 56.5% and 58.3% when compared with non vaccinated-infected and adjuvant-infected controls, respectively. Antibodies in the immune sera of vaccinated mice were shown by immunoblot to react with the native FgCatL1s in the extract of all stages of parasites and rmFgCatL1H, recombinant pro - FgCatL1 (rpFgCatL1). By immunohistochemistry, the immune sera also reacted with FgCatL1s in the caecal epithelial cells of the parasites. The levels of IgG1 and IgG2a in the immune sera, which are indicative of Th2 and Th1 immune responses, were also increased with IgG1 predominating. The levels of serum glutamic oxaloacetic transaminase (SGOT) and serum glutamic pyruvic transaminase (SGPT) in rmFgCatL1G-immunized group showed no significant difference from the control groups, but pathological lesions of livers in rmFgCatL1G-immunized group showed significant decrease when compared to the control groups. This study indicates that rmFgCatL1G has a vaccine potential against F. gigantica in mice, and this potential will be tested in larger livestock animals. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. UCH-L1-containing exosomes mediate chemotherapeutic resistance transfer in breast cancer.

    Science.gov (United States)

    Ning, Kuan; Wang, Teng; Sun, Xu; Zhang, Pengfei; Chen, Yun; Jin, Jian; Hua, Dong

    2017-06-01

    Chemotherapy resistance has become a serious challenge in the treatment of breast cancer. Previous studies showed cells can transfer proteins, including those responsible for drug resistance to adjacent cells via exosomes. The switches of drug resistance via exosomes transfer were assessed by CellTiter-Blue Viability assay, flow cytometry, and immunostaining analysis. Relative protein levels of Ubiquitin carboxyl terminal hydrolase-L1 (UCH-L1), P-glycoprotein (P-gp), extracellular-signal regulated protein kinase1/2 (ERK1/2), and phospho-extracellular-signal regulated protein kinase1/2 (p-ERK1/2) were measured by Western blot. Immunohistochemistry was performed on 93 breast cancer samples to assess the associations of UCH-L1 levels with immunofluorescence value of UCH-L1 in circulating exosomes. The Adriamycin-resistant human breast cancer cells (MCF7/ADM) secreted exosomes carrying UCH-L1 and P-gp proteins into the extracellular microenvironment then integrated into Adriamycin-sensitive human breast cancer cells (MCF7/WT) in a time-dependent manner, transferring the chemoresistance phenotype. Notably, in blood samples from patients with breast cancer, the level of exosomes carrying UCH-L1 before chemotherapy was significantly negatively correlated with prognosis. Our study demonstrated that UCH-L1-containing exosomes can transfer chemoresistance to recipient cells and these exosomes may be useful as non-invasive diagnostic biomarkers for detection of chemoresitance in breast cancer patients, achieving more effective and individualized chemotherapy. © 2017 Wiley Periodicals, Inc.

  20. Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

    Science.gov (United States)

    Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

    2018-04-01

    The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Draft genome of an Aerophobetes bacterium reveals a facultative lifestyle in deep-sea anaerobic sediments

    KAUST Repository

    Wang, Yong

    2016-07-01

    Aerophobetes (or CD12) is a recently defined bacterial phylum, of which the metabolic processes and ecological importance remain unclear. In the present study, we obtained the draft genome of an Aerophobetes bacterium TCS1 from saline sediment near the Thuwal cold seep in the Red Sea using a genome binning method. Analysis of 16S rRNA genes of TCS1 and close relatives revealed wide distribution of Aerophobetes in deep-sea sediments. Phylogenetic relationships showed affinity between Aerophobetes TCS1 and some thermophilic bacterial phyla. The genome of TCS1 (at least 1.27 Mbp) contains a full set of genes encoding core metabolic pathways, including glycolysis and pyruvate fermentation to produce acetyl-CoA and acetate. The identification of cross-membrane sugar transporter genes further indicates its potential ability to consume carbohydrates preserved in the sediment under the microbial mat. Aerophobetes bacterium TCS1 therefore probably carried out saccharolytic and fermentative metabolism. The genes responsible for autotrophic synthesis of acetyl-CoA via the Wood–Ljungdahl pathway were also found in the genome. Phylogenetic study of the essential genes for the Wood–Ljungdahl pathway implied relative independence of Aerophobetes bacterium from the known acetogens and methanogens. Compared with genomes of acetogenic bacteria, Aerophobetes bacterium TCS1 genome lacks the genes involved in nitrogen metabolism, sulfur metabolism, signal transduction and cell motility. The metabolic activities of TCS1 might depend on geochemical conditions such as supplies of CO2, hydrogen and sugars, and therefore the TCS1 might be a facultative bacterium in anaerobic saline sediments near cold seeps. © 2016, Science China Press and Springer-Verlag Berlin Heidelberg.

  2. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes.

    Science.gov (United States)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F; Hare, Kristine; Holst, Jens J; Madsbad, Sten

    2010-02-25

    This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both days, while AUC proinsulin/C-peptide ratio was higher with GLP-1 (P=0.02). In the patients, amylin, C-peptide and proinsulin AUCs were unaltered by near-normoglycaemia per se. Proinsulin responses to GLP-1 were unchanged, but amylin and C-peptide AUCs increased (PAUC amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks of near-normoglycaemia, whereas GLP-1 increased amylin and C-peptide secretion and amylin/C-peptide ratio. Near-normoglycaemia reduced proinsulin/C-peptide ratio during stimulation with GLP-1, suggesting that strict glycaemic control might ameliorate some of the disturbances in beta-cell function characterizing T2DM. Copyright 2010 Elsevier B.V. All rights reserved.

  3. A new approach to fabrication of Cs/BG/CNT nanocomposite scaffold towards bone tissue engineering and evaluation of its properties

    Energy Technology Data Exchange (ETDEWEB)

    Shokri, S. [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Movahedi, B., E-mail: b.movahedi@ast.ui.ac.ir [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Rafieinia, M. [Biosensor Research Center, Department of Advanced Medical Technology, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of); Salehi, H. [Department of Anatomical Sciences, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of)

    2015-12-01

    Graphical abstract: - Highlights: • Nanocomposite scaffold was produced using a novel technique. • Bioactive glass, carbon nanotube and chitosan were used for fabrication of nanocomposite scaffold. • The compressive strength of the scaffold was near to the cancellous bone. • Biodegradability of the scaffolds in PBS shows the slow destruction. - Abstract: In the present study, bioactive glass (BG), carbon nanotube (CNT), and chitosan (Cs) were used with different ratios for the fabrication of nanocomposite scaffold for bone tissue engineering. BG was synthesized by sol–gel process and CNT was functionalized by immersing in sulfuric acid as well as nitric acid. Nanocomposite scaffold was produced using a novel technique, hot press, and salt leaching process and cross-linked by Hexamethylene diisocyanate (HDI). The optimum porosity of the scaffold with respect to the ratio of salt and precursor was kept around 70%. Mechanical properties of the scaffolds were increased by the addition of CNT and hence, the compressive strength of them with 4 wt% CNT was increased up to 5.95 ± 0.5 MPa. The nanocomposite scaffolds were characterized by FT-IR, SEM, XRD, and electrochemical analysis. Furthermore, scaffolds were immersed in PBS for evaluating the biodegradability, water absorption, and CNT release. The results indicated that water absorption of the scaffolds was increased by adding CNT to the scaffold. The amount of released CNT after 30 days was measured within 6 × 10{sup −4} and 1 × 10{sup −3} mg/ml. Attachment and proliferation of MG63 osteoblast cell line on Cs/BG/CNT scaffolds were investigated by MTT assay indicating no toxicity for this nanocomposite scaffolds. According to the results of the experiments, the nanocomposite scaffold with modified composition (Cs/BG/CNT, 80:20:2 wt%) was the best one in matters of mechanical, chemical, and cellular properties and also the most appropriate for trabecular bone tissue.

  4. Experiment prediction for Loft Nonnuclear Experiment L1-4

    International Nuclear Information System (INIS)

    White, J.R.; Berta, V.T.; Holmstrom, H.L.O.

    1977-04-01

    A computer analysis, using the WHAM and RELAP4 computer codes, was performed to predict the LOFT system thermal-hydraulic response for Experiment L1-4 of the nonnuclear (isothermal) test series. Experiment L1-4 will simulate a 200 percent double-ended offset shear in the cold leg of a four-loop large pressurized water reactor. A core simulator will be used to provide a reactor vessel pressure drop representative of the LOFT nuclear core. Experiment L1-4 will be initiated with a nominal isothermal primary coolant temperature of 282.2 0 C, a pressurizer pressure of 15.51 MPa, and a primary coolant flow of 270.9 kg/s. In general, the predictions of saturated blowdown for Experiment Ll-4 are consistent with the expected system behavior, and predicted trends agree with results from Semiscale Test S-01-4A, which simulated the Ll-4 experiment conditions

  5. The "adjuvant effect" of the polymorphic B-G antigens of the chicken major histocompatibility complex analyzed using purified molecules incorporated in liposomes

    DEFF Research Database (Denmark)

    Salomonsen, J; Eriksson, H; Skjødt, K

    1991-01-01

    The polymorphic B-G region of the chicken major histocompatibility complex has previously been shown to mediate an "adjuvant effect" on the humoral response to other erythrocyte alloantigens. We demonstrate here that B-G molecules purified with monoclonal antibodies exert this adjuvant effect...... on the production of alloantibodies to chicken class I (B-F) molecules, when the two are in the same liposome. The adjuvant effect may in part be mediated by antibodies, since the antibody response to B-G molecules occurs much faster than the response to B-F molecules, and conditions in which antibodies to B......-G are present increase the speed of the response to B-F molecules. We also found that the presence of B-G molecules in separate liposomes results in a lack of response to B-F molecules. In the light of this and other data, we consider the possible roles for the polymorphic B-G molecules, particularly...

  6. Attitudes held by Setswana L1-speaking university students toward ...

    African Journals Online (AJOL)

    Respondents believed that their L1 had limitations in wider society; and that it had prestige, albeit a covert one. Generally, they held favourable attitudes toward their L1. Further comprehensive research needs to be done to explore these new variables, as well as to explore their statistical significance in language attitude ...

  7. Ribosomal L1 domain and lysine-rich region are essential for CSIG/ RSL1D1 to regulate proliferation and senescence

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Liwei; Zhao, Wenting; Zheng, Quanhui; Chen, Tianda; Qi, Ji; Li, Guodong; Tong, Tanjun, E-mail: tztong@bjmu.edu.cn

    2016-01-15

    The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. The data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.

  8. Ribosomal L1 domain and lysine-rich region are essential for CSIG/ RSL1D1 to regulate proliferation and senescence

    International Nuclear Information System (INIS)

    Ma, Liwei; Zhao, Wenting; Zheng, Quanhui; Chen, Tianda; Qi, Ji; Li, Guodong; Tong, Tanjun

    2016-01-01

    The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. The data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.

  9. Immunohistochemical Analysis of PD-L1 Expression in Canine Malignant Cancers and PD-1 Expression on Lymphocytes in Canine Oral Melanoma.

    Science.gov (United States)

    Maekawa, Naoya; Konnai, Satoru; Okagawa, Tomohiro; Nishimori, Asami; Ikebuchi, Ryoyo; Izumi, Yusuke; Takagi, Satoshi; Kagawa, Yumiko; Nakajima, Chie; Suzuki, Yasuhiko; Kato, Yukinari; Murata, Shiro; Ohashi, Kazuhiko

    2016-01-01

    Spontaneous cancers are common diseases in dogs. Among these, some malignant cancers such as oral melanoma, osteosarcoma, hemangiosarcoma, and mast cell tumor are often recognized as clinical problems because, despite their high frequencies, current treatments for these cancers may not always achieve satisfying outcomes. The absence of effective systemic therapies against these cancers leads researchers to investigate novel therapeutic modalities, including immunotherapy. Programmed death 1 (PD-1) is a costimulatory receptor with immunosuppressive function. When it binds its ligands, PD-ligand 1 (PD-L1) or PD-L2, PD-1 on T cells negatively regulates activating signals from the T cell receptor, resulting in the inhibition of the effector function of cytotoxic T lymphocytes. Aberrant PD-L1 expression has been reported in many human cancers and is considered an immune escape mechanism for cancers. In clinical trials, anti-PD-1 or anti-PD-L1 antibodies induced tumor regression for several malignancies, including advanced melanoma, non-small cell lung carcinoma, and renal cell carcinoma. In this study, to assess the potential of the PD-1/PD-L1 axis as a novel therapeutic target for canine cancer immunotherapy, immunohistochemical analysis of PD-L1 expression in various malignant cancers of dogs was performed. Here, we show that dog oral melanoma, osteosarcoma, hemangiosarcoma, mast cell tumor, mammary adenocarcinoma, and prostate adenocarcinoma expressed PD-L1, whereas some other types of cancer did not. In addition, PD-1 was highly expressed on tumor-infiltrating lymphocytes obtained from oral melanoma, showing that lymphocytes in this cancer type might have been functionally exhausted. These results strongly encourage the clinical application of PD-1/PD-L1 inhibitors as novel therapeutic agents against these cancers in dogs.

  10. Immunohistochemical Analysis of PD-L1 Expression in Canine Malignant Cancers and PD-1 Expression on Lymphocytes in Canine Oral Melanoma.

    Directory of Open Access Journals (Sweden)

    Naoya Maekawa

    Full Text Available Spontaneous cancers are common diseases in dogs. Among these, some malignant cancers such as oral melanoma, osteosarcoma, hemangiosarcoma, and mast cell tumor are often recognized as clinical problems because, despite their high frequencies, current treatments for these cancers may not always achieve satisfying outcomes. The absence of effective systemic therapies against these cancers leads researchers to investigate novel therapeutic modalities, including immunotherapy. Programmed death 1 (PD-1 is a costimulatory receptor with immunosuppressive function. When it binds its ligands, PD-ligand 1 (PD-L1 or PD-L2, PD-1 on T cells negatively regulates activating signals from the T cell receptor, resulting in the inhibition of the effector function of cytotoxic T lymphocytes. Aberrant PD-L1 expression has been reported in many human cancers and is considered an immune escape mechanism for cancers. In clinical trials, anti-PD-1 or anti-PD-L1 antibodies induced tumor regression for several malignancies, including advanced melanoma, non-small cell lung carcinoma, and renal cell carcinoma. In this study, to assess the potential of the PD-1/PD-L1 axis as a novel therapeutic target for canine cancer immunotherapy, immunohistochemical analysis of PD-L1 expression in various malignant cancers of dogs was performed. Here, we show that dog oral melanoma, osteosarcoma, hemangiosarcoma, mast cell tumor, mammary adenocarcinoma, and prostate adenocarcinoma expressed PD-L1, whereas some other types of cancer did not. In addition, PD-1 was highly expressed on tumor-infiltrating lymphocytes obtained from oral melanoma, showing that lymphocytes in this cancer type might have been functionally exhausted. These results strongly encourage the clinical application of PD-1/PD-L1 inhibitors as novel therapeutic agents against these cancers in dogs.

  11. Efficacy and safety of an insulin infusion protocol in a surgical ICU.

    Science.gov (United States)

    Taylor, Beth E; Schallom, Marilyn E; Sona, Carrie S; Buchman, Timothy G; Boyle, Walter A; Mazuski, John E; Schuerer, Douglas E; Thomas, James M; Kaiser, Christy; Huey, Way Y; Ward, Myrna R; Zack, Jeanne E; Coopersmith, Craig M

    2006-01-01

    Hyperglycemia is associated with complications in the surgical intensive care unit. The purpose of this study was to determine the efficacy and safety of nurse-driven insulin infusion protocols in lowering blood glucose (BG) in critical illness. All patients in a 24-bed surgical intensive care unit who required i.v. insulin infusions during 3 noncontiguous 6-month periods from 2002 to 2004 were evaluated. In the preintervention phase, 71 patients received a physician-initiated insulin infusion without a developed protocol. They were compared with 95 patients who received a nurse-driven insulin infusion protocol with a target BG of 120 to 150 mg/dL and to 119 patients who received a more stringent protocol with a target BG of 80 to 110 mg/dL. There was a stepwise decrease in average daily BG levels, from 190 to 163 to 132 mg/dL (p < 0.001). The less stringent protocol decreased the time to achieve a BG level < 150 mg/dL from 14.1 to 7.4 hours compared with physician-driven management (p < 0.05) resulting in similar time on an insulin infusion (53 versus 48 hours). The more intensive protocol brought BG levels < 150 mg/dL in 7.2 hours and < 111 mg/dL in 13.6 hours, but increased the length of time a patient was on an insulin infusion to 77 hours. The incidence of severe hypoglycemia (BG < 40 mg/dL) was statistically similar between the groups, ranging between 1.1% and 3.4%. Implementation of a nurse-driven protocol led to more rapid and more effective BG control in critically ill surgical patients compared with physician management. Tighter BG control can be obtained without a significant increase in hypoglycemia, although this is associated with increased time on an insulin infusion.

  12. l1- and l2-Norm Joint Regularization Based Sparse Signal Reconstruction Scheme

    Directory of Open Access Journals (Sweden)

    Chanzi Liu

    2016-01-01

    Full Text Available Many problems in signal processing and statistical inference involve finding sparse solution to some underdetermined linear system of equations. This is also the application condition of compressive sensing (CS which can find the sparse solution from the measurements far less than the original signal. In this paper, we propose l1- and l2-norm joint regularization based reconstruction framework to approach the original l0-norm based sparseness-inducing constrained sparse signal reconstruction problem. Firstly, it is shown that, by employing the simple conjugate gradient algorithm, the new formulation provides an effective framework to deduce the solution as the original sparse signal reconstruction problem with l0-norm regularization item. Secondly, the upper reconstruction error limit is presented for the proposed sparse signal reconstruction framework, and it is unveiled that a smaller reconstruction error than l1-norm relaxation approaches can be realized by using the proposed scheme in most cases. Finally, simulation results are presented to validate the proposed sparse signal reconstruction approach.

  13. Crassaminicella profunda gen. nov., sp. nov., an anaerobic marine bacterium isolated from deep-sea sediments.

    Science.gov (United States)

    Lakhal, Raja; Pradel, Nathalie; Postec, Anne; Ollivier, Bernard; Cayol, Jean-Luc; Godfroy, Anne; Fardeau, Marie-Laure; Galés, Grégoire

    2015-09-01

    A novel, anaerobic, chemo-organotrophic bacterium, designated strain Ra1766H(T), was isolated from sediments of the Guaymas basin (Gulf of California, Mexico) taken from a depth of 2002  m. Cells were thin, motile, Gram-stain-positive, flexible rods forming terminal endospores. Strain Ra1766H(T) grew at temperatures of 25-45 °C (optimum 30 °C), pH 6.7-8.1 (optimum 7.5) and in a salinity of 5-60 g l(-1) NaCl (optimum 30 g l(-1)). It was an obligate heterotrophic bacterium fermenting carbohydrates (glucose and mannose) and organic acids (pyruvate and succinate). Casamino acids and amino acids (glutamate, aspartate and glycine) were also fermented. The main end products from glucose fermentation were acetate, butyrate, ethanol, H2 and CO2. Sulfate, sulfite, thiosulfate, elemental sulfur, fumarate, nitrate, nitrite and Fe(III) were not used as terminal electron acceptors. The predominant cellular fatty acids were C14  : 0, C16 : 1ω7, C16 : 1ω7 DMA and C16 : 0. The main polar lipids consisted of phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and phospholipids. The G+C content of the genomic DNA was 33.7 mol%. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain Ra1766H(T) was affiliated to cluster XI of the order Clostridiales, phylum Firmicutes. The closest phylogenetic relative of Ra1766H(T) was Geosporobacter subterraneus (94.2% 16S rRNA gene sequence similarity). On the basis of phylogenetic inference and phenotypic properties, strain Ra1766H(T) ( = DSM 27501(T) = JCM 19377(T)) is proposed to be the type strain of a novel species of a novel genus, named Crassaminicella profunda.

  14. Reading in L2 (English) and L1 (Persian): An Investigation into Reverse Transfer of Reading Strategies

    Science.gov (United States)

    Talebi, Seyed Hassan

    2012-01-01

    This study investigates the effect of reading strategies instruction in L2 (English) on raising reading strategies awareness and use and reading ability of Iranian EFL learners in L2 (English) and L1 (Persian) as a result of transfer of reading strategies from L2 to L1. To this purpose, 120 students of intermediate and advanced English proficiency…

  15. L1-norm locally linear representation regularization multi-source adaptation learning.

    Science.gov (United States)

    Tao, Jianwen; Wen, Shiting; Hu, Wenjun

    2015-09-01

    In most supervised domain adaptation learning (DAL) tasks, one has access only to a small number of labeled examples from target domain. Therefore the success of supervised DAL in this "small sample" regime needs the effective utilization of the large amounts of unlabeled data to extract information that is useful for generalization. Toward this end, we here use the geometric intuition of manifold assumption to extend the established frameworks in existing model-based DAL methods for function learning by incorporating additional information about the target geometric structure of the marginal distribution. We would like to ensure that the solution is smooth with respect to both the ambient space and the target marginal distribution. In doing this, we propose a novel L1-norm locally linear representation regularization multi-source adaptation learning framework which exploits the geometry of the probability distribution, which has two techniques. Firstly, an L1-norm locally linear representation method is presented for robust graph construction by replacing the L2-norm reconstruction measure in LLE with L1-norm one, which is termed as L1-LLR for short. Secondly, considering the robust graph regularization, we replace traditional graph Laplacian regularization with our new L1-LLR graph Laplacian regularization and therefore construct new graph-based semi-supervised learning framework with multi-source adaptation constraint, which is coined as L1-MSAL method. Moreover, to deal with the nonlinear learning problem, we also generalize the L1-MSAL method by mapping the input data points from the input space to a high-dimensional reproducing kernel Hilbert space (RKHS) via a nonlinear mapping. Promising experimental results have been obtained on several real-world datasets such as face, visual video and object. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Genetic variation of COLEC10 and COLEC11 and association with serum levels of collectin liver 1 (CL-L1) and collectin kidney 1 (CL-K1)

    DEFF Research Database (Denmark)

    Bayarri-Olmos, Rafael; Hansen, Soren; Henriksen, Maiken Lumby

    2015-01-01

    Collectin liver 1 (CL-L1, alias CL-10) and collectin kidney 1 (CL-K1, alias CL-11), encoded by the COLEC10 and COLEC11 genes, respectively, are highly homologous soluble pattern recognition molecules in the lectin pathway of complement. These proteins may be involved in anti-microbial activity...

  17. Monitoring of a novel bacterium, Lactobacillus thermotolerans , in ...

    African Journals Online (AJOL)

    Abstract. We successfully established fluorescence in situ hybridization (FISH) method for specific detection and enumeration of a novel bacterium, Lactobacillus thermotolerans, in chicken feces. The specific FISH probes were designed based on the L. thermotolerans 16S rRNA gene sequences, and these sequences were ...

  18. BG-4, a novel anticancer peptide from bitter gourd (Momordica charantia), promotes apoptosis in human colon cancer cells

    Science.gov (United States)

    Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity ...

  19. Impact of L1 Use in L2 English Writing Classes

    African Journals Online (AJOL)

    This experimental study endeavored to assess the impact of L1 use in .... Two sections were selected using simple ... practice. In all the four writing practice activities, the experimental group ..... during the pre-test, but this was not true for.

  20. Evidence consistent with human L1 retrotransposition in maternal meiosis I

    NARCIS (Netherlands)

    Brouha, Brook; Meischl, Christof; Ostertag, Eric; de Boer, Martin; Zhang, Yue; Neijens, Herman; Roos, Dirk; Kazazian, Haig H.

    2002-01-01

    We have used a unique polymorphic 3' transduction to show that a human L1, or LINE-1 ((l) under bar ong (i) under bar nterspersed (n) under bar ucleotide (e) under bar lement-1), retrotransposition event most likely occurred in the maternal primary oocyte during meiosis I. We characterized a

  1. L2-L1 Translation Priming Effects in a Lexical Decision Task: Evidence From Low Proficient Korean-English Bilinguals

    Directory of Open Access Journals (Sweden)

    Yoonhyoung Lee

    2018-03-01

    Full Text Available One of the key issues in bilingual lexical representation is whether L1 processing is facilitated by L2 words. In this study, we conducted two experiments using the masked priming paradigm to examine how L2-L1 translation priming effects emerge when unbalanced, low proficiency, Korean-English bilinguals performed a lexical decision task. In Experiment 1, we used a 150 ms SOA (50 ms prime duration followed by a blank interval of 100 ms and found a significant L2-L1 translation priming effect. In contrast, in Experiment 2, we used a 60 ms SOA (50 ms prime duration followed by a blank interval of 10 ms and found a null effect of L2-L1 translation priming. This finding is the first demonstration of a significant L2-L1 translation priming effect with unbalanced Korean-English bilinguals. Implications of this work are discussed with regard to bilingual word recognition models.

  2. Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars.

    Science.gov (United States)

    Dezhbord, Mehrangiz; Esmaelizad, Majid; Khaki, Pejvak; Fotohi, Fariba; Zarehparvar Moghaddam, Athena

    2014-06-11

    Leptospirosis, caused by infection with pathogenic Leptospira species, is one of the most prevalent zoonotic diseases in the world. Current leptospiral vaccines are mainly multivalent dead whole-cell mixtures made of several local dominant serovars. Therefore, design and construction of an efficient recombinant vaccine for leptospirosis control is very important. OmpL1 is an immunogenic porin protein that could be of special significance in vaccination and serodiagnosis for leptospirosis. Three strains belonging to pathogenic L. interrogans were analyzed. The specific primers for proliferation of the ompL1 gene were designed. The amplified gene was cloned. In order to investigate the ompL1 nucleotide sequence and homological analysis of this gene, ompL1 genes cloned from standard vaccinal Leptospira serovars prevalent in Iran were sequenced and cloned. PCR amplification of the ompL1 gene using the designed primers resulted in a 963 bp ompL1 gene product. The PCR based on the ompL1 gene detected all pathogenic reference serovars of Leptospira spp. tested. Based on alignment and phylogenetic analysis, although the ompL1 nucleotide sequence was slightly different within three vaccinal serovars (100%-85% identity), amino acid alignment of the OmpL1 proteins revealed that there would be inconsiderable difference among them. The ompL1 gene of the three isolates was well conserved, differing only by a total of 6 bp and the proteins by 2 amino acids. The cloned gene could be further used for expression and recombinant OmpL1 as an efficient and conserved antigen, and may be a useful vaccine candidate against leptospirosis in our region.

  3. Thrombin selectively engages LIM kinase 1 and slingshot-1L phosphatase to regulate NF-κB activation and endothelial cell inflammation.

    Science.gov (United States)

    Leonard, Antony; Marando, Catherine; Rahman, Arshad; Fazal, Fabeha

    2013-11-01

    Endothelial cell (EC) inflammation is a central event in the pathogenesis of many pulmonary diseases such as acute lung injury and its more severe form acute respiratory distress syndrome. Alterations in actin cytoskeleton are shown to be crucial for NF-κB regulation and EC inflammation. Previously, we have described a role of actin binding protein cofilin in mediating cytoskeletal alterations essential for NF-κB activation and EC inflammation. The present study describes a dynamic mechanism in which LIM kinase 1 (LIMK1), a cofilin kinase, and slingshot-1Long (SSH-1L), a cofilin phosphatase, are engaged by procoagulant and proinflammatory mediator thrombin to regulate these responses. Our data show that knockdown of LIMK1 destabilizes whereas knockdown of SSH-1L stabilizes the actin filaments through modulation of cofilin phosphorylation; however, in either case thrombin-induced NF-κB activity and expression of its target genes (ICAM-1 and VCAM-1) is inhibited. Further mechanistic analyses reveal that knockdown of LIMK1 or SSH-1L each attenuates nuclear translocation and thereby DNA binding of RelA/p65. In addition, LIMK1 or SSH-1L depletion inhibited RelA/p65 phosphorylation at Ser(536), a critical event conferring transcriptional competency to the bound NF-κB. However, unlike SSH-1L, LIMK1 knockdown also impairs the release of RelA/p65 by blocking IKKβ-dependent phosphorylation/degradation of IκBα. Interestingly, LIMK1 or SSH-1L depletion failed to inhibit TNF-α-induced RelA/p65 nuclear translocation and proinflammatory gene expression. Thus this study provides evidence for a novel role of LIMK1 and SSH-1L in selectively regulating EC inflammation associated with intravascular coagulation.

  4. 40 CFR 721.3820 - L-Glutamic acid, N-(1-oxododecyl)-, disodium salt.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false L-Glutamic acid, N-(1-oxododecyl... Specific Chemical Substances § 721.3820 L-Glutamic acid, N-(1-oxododecyl)-, disodium salt. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as L-Glutamic...

  5. Physiological and biochemical characterization of a novel nicotine-degrading bacterium Pseudomonas geniculata N1.

    Directory of Open Access Journals (Sweden)

    Yanghui Liu

    Full Text Available Management of solid wastes with high nicotine content, such as those accumulated during tobacco manufacturing, poses a major challenge, which can be addressed by using bacteria such as Pseudomonas and Arthrobacter. In this study, a new species of Pseudomonas geniculata, namely strain N1, which is capable of efficiently degrading nicotine, was isolated and identified. The optimal growth conditions for strain N1 are a temperature of 30°C, and a pH 6.5, at a rotation rate of 120 rpm min(-1 with 1 g l(-1 nicotine as the sole source of carbon and nitrogen. Myosmine, cotinine, 6-hydroxynicotine, 6-hydroxy-N-methylmyosmine, and 6-hydroxy-pseudooxynicotine were detected as the five intermediates through gas chromatography-mass and liquid chromatography-mass analyses. The identified metabolites were different from those generated by Pseudomonas putida strains. The analysis also highlighted the bacterial metabolic diversity in relation to nicotine degradation by different Pseudomonas strains.

  6. SYSTEMATICITY OF L1 THAI LEARNERS' ENGLISH INTERLANGUAGE OF DEPENDENT PREPOSITIONS

    Directory of Open Access Journals (Sweden)

    Piyaboot Sumonsriworakun

    2017-01-01

    Full Text Available The study investigates systematicity in English interlanguage of dependent prepositions among L1 Thai learners of L2 English. It is hypothesized that Thai learners show non-random use of English dependent prepositions in their English interlanguage, and that the systematicity is largely attributable to cross-linguistic influence and certain cognitive factors. To test the hypothesis, 30 L1 Thai undergraduate students of L2 English at elementary, intermediate, and advanced proficiency levels took two tests: a Thai–English translation test and a cloze test. The tests involved four types of relationship between English and Thai dependent prepositions: (1 [–prep] in English but [+prep] in Thai, (2 [+prep] in English but [–prep] in Thai, (3 [+prep1] in English but [+prep2] in Thai, and (4 [+prep] in English and [+prep] in Thai. The findings demonstrate that systematicity occurred in the learners’ English usage of prepositions of all such types, possibly due to negative transfer from the learners’ native language. Also, the L2 learners tended to exhibit such systematicity irrespective of their English proficiency level. It may be assumed that the cognitive aspect of L2 learners’ working memory is involved in processing the usage of the four types of English dependent prepositions. The results of the study are expected to shed light on the problems of L2 English interlanguage of dependent prepositions among L1 Thai learners.

  7. Ursolic acid inhibits adipogenesis in 3T3-L1 adipocytes through LKB1/AMPK pathway.

    Directory of Open Access Journals (Sweden)

    Yonghan He

    Full Text Available BACKGROUND: Ursolic acid (UA is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. OBJECTIVE: As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. METHODS AND RESULTS: The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ, peroxisome proliferator-activated receptor γ (PPARγ, CCAAT element binding protein α (C/EBPα and sterol regulatory element binding protein 1c (SREBP-1c, respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC and protein expression of carnitine palmitoyltransferase 1 (CPT1, but decreased protein expression of fatty acid synthase (FAS and fatty acid-binding protein 4 (FABP4. Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK and protein expression of (silent mating type information regulation 2, homolog 1 (Sirt1. Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1, the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. CONCLUSIONS: Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK

  8. Exonization of active mouse L1s: a driver of transcriptome evolution?

    Directory of Open Access Journals (Sweden)

    Badge Richard

    2007-10-01

    Full Text Available Abstract Background Long interspersed nuclear elements (LINE-1s, L1s have been recently implicated in the regulation of mammalian transcriptomes. Results Here, we show that members of the three active mouse L1 subfamilies (A, GF and TF contain, in addition to those on their sense strands, conserved functional splice sites on their antisense strands, which trigger multiple exonization events. The latter is particularly intriguing in the light of the strong antisense orientation bias of intronic L1s, implying that the toleration of antisense insertions results in an increased potential for exonization. Conclusion In a genome-wide analysis, we have uncovered evidence suggesting that the mobility of the large number of retrotransposition-competent mouse L1s (~2400 potentially active L1s in NCBIm35 has significant potential to shape the mouse transcriptome by continuously generating insertions into transcriptional units.

  9. High surface stability of magnetite on bi-layer Fe3O4/Fe/MgO(0 0 1) films under 1 MeV Kr+ ion irradiation

    Czech Academy of Sciences Publication Activity Database

    Kim-Ngan, N.-T.H.; Krupska, M.; Balogh, A.G.; Malinský, Petr; Macková, Anna

    2017-01-01

    Roč. 8, č. 4 (2017), č. článku 045005. E-ISSN 2043-6262 R&D Projects: GA MŠk LM2015056 Institutional support: RVO:61389005 Keywords : nanoscience * thin film * surface and interface Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders OBOR OECD: Nuclear physics

  10. The Adhesion Molecule KAL-1/anosmin-1 Regulates Neurite Branching through a SAX-7/L1CAM–EGL-15/FGFR Receptor Complex

    Directory of Open Access Journals (Sweden)

    Carlos A. Díaz-Balzac

    2015-06-01

    Full Text Available Neurite branching is essential for correct assembly of neural circuits, yet it remains a poorly understood process. For example, the neural cell adhesion molecule KAL-1/anosmin-1, which is mutated in Kallmann syndrome, regulates neurite branching through mechanisms largely unknown. Here, we show that KAL-1/anosmin-1 mediates neurite branching as an autocrine co-factor with EGL-17/FGF through a receptor complex consisting of the conserved cell adhesion molecule SAX-7/L1CAM and the fibroblast growth factor receptor EGL-15/FGFR. This protein complex, which appears conserved in humans, requires the immunoglobulin (Ig domains of SAX-7/L1CAM and the FN(III domains of KAL-1/anosmin-1 for formation in vitro as well as function in vivo. The kinase domain of the EGL-15/FGFR is required for branching, and genetic evidence suggests that ras-mediated signaling downstream of EGL-15/FGFR is necessary to effect branching. Our studies establish a molecular pathway that regulates neurite branching during development of the nervous system.

  11. PD-L1 expression associated with worse survival outcome in malignant pleural mesothelioma.

    Science.gov (United States)

    Nguyen, Bella Hai; Montgomery, Renn; Fadia, Mitali; Wang, Jiali; Ali, Sayed

    2018-02-01

    There is currently a need to identify prognostic biomarkers to assist in a risk adopted approach in treatment of malignant pleural mesothelioma (MPM). Expression of programmed death ligand 1 (PD-L1) has been studied as a prognostic biomarker in a number of tumors given its central role in antitumoral immune response evasion. Four previously published analyses found PD-L1 positivity to be an adverse survival prognostic factor in MPM. This study aims to further investigate the relationship between PD-L1 expression in mesothelioma tissues and survival outcome. Clinical data of MPM patients from a single institution between 2006 and 2016 were reviewed. Patient's archived tissues were stained with PD-L1 (Clone Ventana SP263). PD-L1 positivity was defined as > 1% membranous staining regardless of intensity. Data from fifty eight patients were analyzed. Median age was 73, majority was male (49, 84%) and had ECOG between 0 and 2 (46, 79%). Most common histopathological subtype was epithelioid (42, 72%), 9 (16%) biphasic subtype and 7 (12%) sarcomatoid. Thirty one patients (53%) received best supportive care and twenty seven patients (47%) received chemotherapy or combination treatment. Forty-two patients had positive PD-L1 expression (72.4%). The median survival time for PD-L1 negative group is 15.5 months and 6 months for the positive group. Positive PD-L1 expression is independently correlated with worse prognosis (HR = 2.02; 95% CI, 1.005-4.057; P-value = 0.0484). Our analysis found a higher percentage of MPM patients with positive PD-L1 (> 1%) compared to other studies. Highly positive PD-L1 expression was associated with statistically significantly lower median survival time. © 2017 John Wiley & Sons Australia, Ltd.

  12. GPM SSMI on F14 Common Calibrated Brightness Temperatures L1C 1.5 hours 13 km V05 (GPM_1CF14SSMI) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  13. Differential L1 regulation in pluripotent stem cells of humans and apes.

    Science.gov (United States)

    Marchetto, Maria C N; Narvaiza, Iñigo; Denli, Ahmet M; Benner, Christopher; Lazzarini, Thomas A; Nathanson, Jason L; Paquola, Apuã C M; Desai, Keval N; Herai, Roberto H; Weitzman, Matthew D; Yeo, Gene W; Muotri, Alysson R; Gage, Fred H

    2013-11-28

    Identifying cellular and molecular differences between human and non-human primates (NHPs) is essential to the basic understanding of the evolution and diversity of our own species. Until now, preserved tissues have been the main source for most comparative studies between humans, chimpanzees (Pan troglodytes) and bonobos (Pan paniscus). However, these tissue samples do not fairly represent the distinctive traits of live cell behaviour and are not amenable to genetic manipulation. We propose that induced pluripotent stem (iPS) cells could be a unique biological resource to determine relevant phenotypical differences between human and NHPs, and that those differences could have potential adaptation and speciation value. Here we describe the generation and initial characterization of iPS cells from chimpanzees and bonobos as new tools to explore factors that may have contributed to great ape evolution. Comparative gene expression analysis of human and NHP iPS cells revealed differences in the regulation of long interspersed element-1 (L1, also known as LINE-1) transposons. A force of change in mammalian evolution, L1 elements are retrotransposons that have remained active during primate evolution. Decreased levels of L1-restricting factors APOBEC3B (also known as A3B) and PIWIL2 (ref. 7) in NHP iPS cells correlated with increased L1 mobility and endogenous L1 messenger RNA levels. Moreover, results from the manipulation of A3B and PIWIL2 levels in iPS cells supported a causal inverse relationship between levels of these proteins and L1 retrotransposition. Finally, we found increased copy numbers of species-specific L1 elements in the genome of chimpanzees compared to humans, supporting the idea that increased L1 mobility in NHPs is not limited to iPS cells in culture and may have also occurred in the germ line or embryonic cells developmentally upstream to germline specification during primate evolution. We propose that differences in L1 mobility may have

  14. Asymmetric light transmission based on coupling between photonic crystal waveguides and L1/L3 cavity

    Science.gov (United States)

    Zhang, Jinqiannan; Chai, Hongyu; Yu, Zhongyuan; Cheng, Xiang; Ye, Han; Liu, Yumin

    2017-09-01

    A compact design of all-optical diode with mode conversion function based on a two-dimensional photonic crystal waveguide and an L1 or L3 cavity is theoretically investigated. The proposed photonic crystal structures comprise a triangular arrangement of air holes embedded in a silicon substrate. Asymmetric light propagation is achieved via the spatial mode match/mismatch in the coupling region. The simulations show that at each cavity's resonance frequency, the transmission efficiency of the structure with the L1 and L3 cavities reach 79% and 73%, while the corresponding unidirectionalities are 46 and 37 dB, respectively. The functional frequency can be controlled by simply adjusting the radii of specific air holes in the L1 and L3 cavities. The proposed structure can be used as a frequency filter, a beam splitter and has potential applications in all-optical integrated circuits.

  15. A novel PKD2L1 C-terminal domain critical for trimerization and channel function.

    Science.gov (United States)

    Zheng, Wang; Hussein, Shaimaa; Yang, JungWoo; Huang, Jun; Zhang, Fan; Hernandez-Anzaldo, Samuel; Fernandez-Patron, Carlos; Cao, Ying; Zeng, Hongbo; Tang, Jingfeng; Chen, Xing-Zhen

    2015-03-30

    As a transient receptor potential (TRP) superfamily member, polycystic kidney disease 2-like-1 (PKD2L1) is also called TRPP3 and has similar membrane topology as voltage-gated cation channels. PKD2L1 is involved in hedgehog signaling, intestinal development, and sour tasting. PKD2L1 and PKD1L3 form heterotetramers with 3:1 stoichiometry. C-terminal coiled-coil-2 (CC2) domain (G699-W743) of PKD2L1 was reported to be important for its trimerization but independent studies showed that CC2 does not affect PKD2L1 channel function. It thus remains unclear how PKD2L1 proteins oligomerize into a functional channel. By SDS-PAGE, blue native PAGE and mutagenesis we here identified a novel C-terminal domain called C1 (K575-T622) involved in stronger homotrimerization than the non-overlapping CC2, and found that the PKD2L1 N-terminus is critical for dimerization. By electrophysiology and Xenopus oocyte expression, we found that C1, but not CC2, is critical for PKD2L1 channel function. Our co-immunoprecipitation and dynamic light scattering experiments further supported involvement of C1 in trimerization. Further, C1 acted as a blocking peptide that inhibits PKD2L1 trimerization as well as PKD2L1 and PKD2L1/PKD1L3 channel function. Thus, our study identified C1 as the first PKD2L1 domain essential for both PKD2L1 trimerization and channel function, and suggest that PKD2L1 and PKD2L1/PKD1L3 channels share the PKD2L1 trimerization process.

  16. Spectral L2/L1 norm: A new perspective for spectral kurtosis for characterizing non-stationary signals

    Science.gov (United States)

    Wang, Dong

    2018-05-01

    Thanks to the great efforts made by Antoni (2006), spectral kurtosis has been recognized as a milestone for characterizing non-stationary signals, especially bearing fault signals. The main idea of spectral kurtosis is to use the fourth standardized moment, namely kurtosis, as a function of spectral frequency so as to indicate how repetitive transients caused by a bearing defect vary with frequency. Moreover, spectral kurtosis is defined based on an analytic bearing fault signal constructed from either a complex filter or Hilbert transform. On the other hand, another attractive work was reported by Borghesani et al. (2014) to mathematically reveal the relationship between the kurtosis of an analytical bearing fault signal and the square of the squared envelope spectrum of the analytical bearing fault signal for explaining spectral correlation for quantification of bearing fault signals. More interestingly, it was discovered that the sum of peaks at cyclic frequencies in the square of the squared envelope spectrum corresponds to the raw 4th order moment. Inspired by the aforementioned works, in this paper, we mathematically show that: (1) spectral kurtosis can be decomposed into squared envelope and squared L2/L1 norm so that spectral kurtosis can be explained as spectral squared L2/L1 norm; (2) spectral L2/L1 norm is formally defined for characterizing bearing fault signals and its two geometrical explanations are made; (3) spectral L2/L1 norm is proportional to the square root of the sum of peaks at cyclic frequencies in the square of the squared envelope spectrum; (4) some extensions of spectral L2/L1 norm for characterizing bearing fault signals are pointed out.

  17. Purification and Characterization of Recombinant Vaccinia L1R Protein from Escherichia coli

    Science.gov (United States)

    2016-08-01

    RECOMBINANT VACCINIA L1R PROTEIN FROM ESCHERICHIA COLI 1. INTRODUCTION 1.1 Background Vaccinia virus (VACV) is the active component of the...the preparation of the recombinant VACV L1R protein fragment by denaturing , refolding, and purifying material expressed into inclusion bodies in...PURIFICATION AND CHARACTERIZATION OF RECOMBINANT VACCINIA L1R PROTEIN FROM ESCHERICHIA COLI ECBC-TR-1370

  18. Biodegradation of Nitro-Substituted Explosives 2,4,6-Trinitrotoluene, Hexahydro-1,3,5-Trinitro-1,3,5-Triazine, and Octahydro-1,3,5,7-Tetranitro-1,3,5-Tetrazocine by a Phytosymbiotic Methylobacterium sp. Associated with Poplar Tissues (Populus deltoides × nigra DN34)

    Science.gov (United States)

    Van Aken, Benoit; Yoon, Jong Moon; Schnoor, Jerald L.

    2004-01-01

    A pink-pigmented symbiotic bacterium was isolated from hybrid poplar tissues (Populus deltoides × nigra DN34). The bacterium was identified by 16S and 16S-23S intergenic spacer ribosomal DNA analysis as a Methylobacterium sp. (strain BJ001). The isolated bacterium was able to use methanol as the sole source of carbon and energy, which is a specific attribute of the genus Methylobacterium. The bacterium in pure culture was shown to degrade the toxic explosives 2,4,6-trinitrotoluene (TNT), hexahydro-1,3,5-trinitro-1,3,5-triazene (RDX), and octahydro-1,3,5,7-tetranitro-1,3,5-tetrazocine (HMX). [U-ring-14C]TNT (25 mg liter−1) was fully transformed in less than 10 days. Metabolites included the reduction derivatives amino-dinitrotoluenes and diamino-nitrotoluenes. No significant release of 14CO2 was recorded from [14C]TNT. In addition, the isolated methylotroph was shown to transform [U-14C]RDX (20 mg liter−1) and [U-14C]HMX (2.5 mg liter−1) in less than 40 days. After 55 days of incubation, 58.0% of initial [14C]RDX and 61.4% of initial [14C]HMX were mineralized into 14CO2. The radioactivity remaining in solution accounted for 12.8 and 12.7% of initial [14C]RDX and [14C]HMX, respectively. Metabolites detected from RDX transformation included a mononitroso RDX derivative and a polar compound tentatively identified as methylenedinitramine. Since members of the genus Methylobacterium are distributed in a wide diversity of natural environments and are very often associated with plants, Methylobacterium sp. strain BJ001 may be involved in natural attenuation or in situ biodegradation (including phytoremediation) of explosive-contaminated sites. PMID:14711682

  19. Regulation of Synaptic Structure by the Ubiquitin C-terminal Hydrolase UCH-L1

    Science.gov (United States)

    Cartier, Anna E.; Djakovic, Stevan N.; Salehi, Afshin; Wilson, Scott M.; Masliah, Eliezer; Patrick, Gentry N.

    2009-01-01

    UCH-L1 is a de-ubiquitinating enzyme that is selectively and abundantly expressed in the brain, and its activity is required for normal synaptic function. Here, we show that UCH-L1 functions in maintaining normal synaptic structure in hippocampal neurons. We have found that UCH-L1 activity is rapidly up-regulated by NMDA receptor activation which leads to an increase in the levels of free monomeric ubiquitin. Conversely, pharmacological inhibition of UCH-L1 significantly reduces monomeric ubiquitin levels and causes dramatic alterations in synaptic protein distribution and spine morphology. Inhibition of UCH-L1 activity increases spine size while decreasing spine density. Furthermore, there is a concomitant increase in the size of pre and postsynaptic protein clusters. Interestingly, however, ectopic expression of ubiquitin restores normal synaptic structure in UCH-L1 inhibited neurons. These findings point to a significant role of UCH-L1 in synaptic remodeling most likely by modulating free monomeric ubiquitin levels in an activity-dependent manner. PMID:19535597

  20. Spallation neutron spectrum on a massive lead/paraffin target irradiated with 1 GeV protons

    Czech Academy of Sciences Publication Activity Database

    Adam, Jindřich; Balabekyan, A. R.; Barashenkov, V. S.; Brandt, R.; Golovatiouk, V. M.; Kalinnikov, V. G.; Katovsky, K.; Krivopustov, M. I.; Kumar, V.; Kumawat, H.; Odoj, R.; Pronskikh, V. S.; Solnyshkin, A. A.; Stegailov, V. I.; Tsoupko-Sitnikov, V. M.; Westmeier, W.

    2005-01-01

    Roč. 23, č. 1 (2005), s. 61-68 ISSN 1434-6001 R&D Projects: GA MŠk 1P04LA213 Keywords : monitor reactions * beams * ionization Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.659, year: 2005

  1. Growth characteristics of a strain of iron-oxidizing bacterium and its application in bioleaching of uranium ores

    International Nuclear Information System (INIS)

    Zhang Rui; Liu Yajie; Gao Feng; Xu Lingling

    2008-01-01

    05B is a strain of iron-oxidizing bacterium which separated from a uranium ore. The effect of temperature, initial pH, inoculation amount and initial total iron concentration on the strain's growth and activities in bioleaching of uranium ores are studied. The results show that the optimum growth temperature is 40-45 degree C, the optimum inoculation pH value being 1.5-1.7, the optimum initial inoculation amount being 10%-20%, and the initial total iron concentration being not more than 5 g/L. 05B is fit for leaching of low grade uranium ores. (authors)

  2. Paired Comparison of PD-L1 Expression on Cytologic and Histologic Specimens from Malignancies in the Lung Assessed with PD-L1 IHC 28-8pharmDx and PD-L1 IHC 22C3pharmDx

    DEFF Research Database (Denmark)

    Skov, Birgit G.; Skov, Torsten

    2017-01-01

    of the patients are diagnosed on cytology alone. We hypothesized that cytologic cell block material is suitable for PD-L1 analysis. Materials and Methods: Eighty-six paired samples of malignancies from the lung where cytologic cell block and histologic material were available from the same lesion were stained...... with PD-L1 IHC 28-8pharmDx and PD-L1 IHC 22C3pharmDx. Scorings of like material (cytology or histology) stained with different assays were analyzed in order to evaluate the analytical agreement between assays. Scoring of different materials stained with like assays were analyzed in order to evaluate...... the agreement between cytology and histology. Results: A high degree of agreement was found between 28- 8pharmDx and 22C3pharmDx, whether applied to histologic or cytologic cell blocks, with Pearson R2 of 0.95. The Pearson R2 between 2 rounds of assessment of the same assay on the same type of material was also...

  3. Neural overlap of L1 and L2 semantic representations in speech: A decoding approach.

    Science.gov (United States)

    Van de Putte, Eowyn; De Baene, Wouter; Brass, Marcel; Duyck, Wouter

    2017-11-15

    Although research has now converged towards a consensus that both languages of a bilingual are represented in at least partly shared systems for language comprehension, it remains unclear whether both languages are represented in the same neural populations for production. We investigated the neural overlap between L1 and L2 semantic representations of translation equivalents using a production task in which the participants had to name pictures in L1 and L2. Using a decoding approach, we tested whether brain activity during the production of individual nouns in one language allowed predicting the production of the same concepts in the other language. Because both languages only share the underlying semantic representation (sensory and lexical overlap was maximally avoided), this would offer very strong evidence for neural overlap in semantic representations of bilinguals. Based on the brain activation for the individual concepts in one language in the bilateral occipito-temporal cortex and the inferior and the middle temporal gyrus, we could accurately predict the equivalent individual concepts in the other language. This indicates that these regions share semantic representations across L1 and L2 word production. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. L2 Acquisition of Prosodic Properties of Speech Rhythm: Evidence from L1 Mandarin and German Learners of English

    Science.gov (United States)

    Li, Aike; Post, Brechtje

    2014-01-01

    This study examines the development of speech rhythm in second language (L2) learners of typologically different first languages (L1s) at different levels of proficiency. An empirical investigation of durational variation in L2 English productions by L1 Mandarin learners and L1 German learners compared to native control values in English and the…

  5. Mitigation of membrane biofouling by a quorum quenching bacterium for membrane bioreactors.

    Science.gov (United States)

    Ham, So-Young; Kim, Han-Shin; Cha, Eunji; Park, Jeong-Hoon; Park, Hee-Deung

    2018-06-01

    In this study, a quorum-quenching (QQ) bacterium named HEMM-1 was isolated at a membrane bioreactor (MBR) plant. HEMM-1 has diplococcal morphology and 99% sequence identity to Enterococcus species. The HEMM-1 cell-free supernatant (CFS) showed higher QQ activities than the CFS of other QQ bacteria, mostly by degrading N-acyl homoserine lactones (AHLs) with short acyl chains. Instrumental analyses revealed that HEMM-1 CFS degraded AHLs via lactonase activity. Under static, flow, and shear conditions, the HEMM-1 CFS was effective in reducing bacterial and activated-sludge biofilms formed on membrane surfaces. In conclusion, the HEMM-1 isolate is a QQ bacterium applicable to the control of biofouling in MBRs via inhibition of biofilm formation on membrane surfaces. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Sparse Recovery via l1 and L1 Optimization

    Science.gov (United States)

    2014-11-01

    of China 1.1 (Mar. 2013), pp. 79–105. [13] H. Brezis. “Solutions with compact sup- port of variational inequalities ”. In: Rus- sian Mathematical...Surveys 29.2 (Apr. 30, 1974), pp. 103–108. [14] H. Brezis and A. Friedman. “Estimates on the support of solutions of parabolic varia- tional inequalities ...ized inverse problems (e.g., total variation image reconstruction [4]) have made `1 optimization a central tool in data processing problems. As the

  7. Isothermal (vapour + liquid) equilibrium for the binary {l_brace}1,1,2,2-tetrafluoroethane (R134) + propane (R290){r_brace} and {l_brace}1,1,2,2-tetrafluoroethane (R134) + isobutane (R600a){r_brace} systems

    Energy Technology Data Exchange (ETDEWEB)

    Dong Xueqiang [Key Laboratory of Cryogenics, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, P.O. Box 2711, Beijing 100190 (China); Graduate University of Chinese Academy of Sciences, Beijing 100039 (China); Gong Maoqiong, E-mail: gongmq@mail.ipc.ac.c [Key Laboratory of Cryogenics, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, P.O. Box 2711, Beijing 100190 (China); Liu Junsheng [Key Laboratory of Cryogenics, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, P.O. Box 2711, Beijing 100190 (China); Graduate University of Chinese Academy of Sciences, Beijing 100039 (China); Wu Jianfeng, E-mail: jfwu@mail.ipc.ac.c [Key Laboratory of Cryogenics, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, P.O. Box 2711, Beijing 100190 (China)

    2010-09-15

    (Vapour + liquid) equilibrium (VLE) data for the binary systems of {l_brace}1,1,2,2-tetrafluoroethane (R134) + propane (R290){r_brace} and {l_brace}1,1,2,2-tetrafluoroethane (R134) + isobutane (R600a){r_brace} were measured with a recirculation method at the temperatures ranging from (263.15 to 278.15) K and (268.15 to 288.15) K, respectively. All of the data were correlated by the Peng-Robinson (PR) equation of state (EoS) with the Huron-Vidal (HV) mixing rules utilizing the non-random two-liquid (NRTL) activity coefficient model. Good agreement can be found between the experimental data and the correlated results. Azeotropic behaviour can be found at the measured temperature ranges for these two mixtures.

  8. Genetic variability in L1 and L2 genes of HPV-16 and HPV-58 in Southwest China.

    Directory of Open Access Journals (Sweden)

    Yaofei Yue

    Full Text Available HPV account for most of the incidence of cervical cancer. Approximately 90% of anal cancers and a smaller subset (<50% of other cancers (oropharyngeal, penile, vaginal, vulvar are also attributed to HPV. The L1 protein comprising HPV vaccine formulations elicits high-titre neutralizing antibodies and confers type restricted protection. The L2 protein is a promising candidate for a broadly protective HPV vaccine. In our previous study, we found the most prevalent high-risk HPV infectious serotypes were HPV-16 and HPV-58 among women of Southwest China. To explore gene polymorphisms and intratypic variations of HPV-16 and HPV-58 L1/L2 genes originating in Southwest China, HPV-16 (L1: n = 31, L2: n = 28 and HPV-58 (L1: n = 21, L2: n = 21 L1/L2 genes were sequenced and compared to others described and submitted to GenBank. Phylogenetic trees were then constructed by Neighbor-Joining and the Kimura 2-parameters methods (MEGA software, followed by an analysis of the diversity of secondary structure. Then selection pressures acting on the L1/L2 genes were estimated by PAML software. Twenty-nine single nucleotide changes were observed in HPV-16 L1 sequences with 16/29 non-synonymous mutations and 13/29 synonymous mutations (six in alpha helix and two in beta turns. Seventeen single nucleotide changes were observed in HPV-16 L2 sequences with 8/17 non-synonymous mutations (one in beta turn and 9/17 synonymous mutations. Twenty-four single nucleotide changes were observed in HPV-58 L1 sequences with 10/24 non-synonymous mutations and 14/24 synonymous mutations (eight in alpha helix and four in beta turn. Seven single nucleotide changes were observed in HPV-58 L2 sequences with 4/7 non-synonymous mutations and 3/7 synonymous mutations. The result of selective pressure analysis showed that most of these mutations were of positive selection. This study may help understand the intrinsic geographical relatedness and biological differences of HPV-16/HPV-58 and

  9. L2 Word Recognition: Influence of L1 Orthography on Multi-syllabic Word Recognition.

    Science.gov (United States)

    Hamada, Megumi

    2017-10-01

    L2 reading research suggests that L1 orthographic experience influences L2 word recognition. Nevertheless, the findings on multi-syllabic words in English are still limited despite the fact that a vast majority of words are multi-syllabic. The study investigated whether L1 orthography influences the recognition of multi-syllabic words, focusing on the position of an embedded word. The participants were Arabic ESL learners, Chinese ESL learners, and native speakers of English. The task was a word search task, in which the participants identified a target word embedded in a pseudoword at the initial, middle, or final position. The search accuracy and speed indicated that all groups showed a strong preference for the initial position. The accuracy data further indicated group differences. The Arabic group showed higher accuracy in the final than middle, while the Chinese group showed the opposite and the native speakers showed no difference between the two positions. The findings suggest that L2 multi-syllabic word recognition involves unique processes.

  10. Crystal Structures of Intermediates in the Dehalogenation of Haloalkanoates by L-2-Haloacid Dehalogenase

    NARCIS (Netherlands)

    Ridder, Ivo S.; Rozeboom, Henriëtte J.; Kalk, Kor H.; Dijkstra, Bauke W.

    1999-01-01

    The L-2-haloacid dehalogenase from the 1,2-dichloroethane-degrading bacterium Xanthobacter autotrophicus GJ10 catalyzes the hydrolytic dehalogenation of small L-2-haloalkanoates to their corresponding D-2-hydroxyalkanoates, with inversion of the configuration at the C2 atom. The structure of the

  11. Modulation of gut microbiota and increase in fecal water content in mice induced by administration of Lactobacillus kefiranofaciens DN1.

    Science.gov (United States)

    Jeong, Dana; Kim, Dong-Hyeon; Kang, Il-Byeong; Kim, Hyunsook; Song, Kwang-Young; Kim, Hong-Seok; Seo, Kun-Ho

    2017-02-22

    Lactobacillus kefiranofaciens is the key probiotic bacterium in kefir. In this study, we investigated the effects of oral consumption of L. kefiranofaciens on the fecal quality and intestinal microbiota of mice. Four-week-old Balb/c mice were divided into two groups (n = 8 each) and administered 0.2 mL of saline (control group) or saline containing 2 × 10 8 cfu L. kefiranofaciens DN1 (LKF_DN1 group) for two weeks. At the end of the experiment, their fecal samples were collected and the fecal quality and microbiota were assessed. The LKF_DN1 group exhibited higher total fecal weight and fecal weight per stool sample than the control group (p kefiranofaciens DN1 administration could alleviate constipation and improve gut microbiota.

  12. Asymmetric reduction of ketones and β-keto esters by (S)-1-phenylethanol dehydrogenase from denitrifying bacterium Aromatoleum aromaticum.

    Science.gov (United States)

    Dudzik, A; Snoch, W; Borowiecki, P; Opalinska-Piskorz, J; Witko, M; Heider, J; Szaleniec, M

    2015-06-01

    Enzyme-catalyzed enantioselective reductions of ketones and keto esters have become popular for the production of homochiral building blocks which are valuable synthons for the preparation of biologically active compounds at industrial scale. Among many kinds of biocatalysts, dehydrogenases/reductases from various microorganisms have been used to prepare optically pure enantiomers from carbonyl compounds. (S)-1-phenylethanol dehydrogenase (PEDH) was found in the denitrifying bacterium Aromatoleum aromaticum (strain EbN1) and belongs to the short-chain dehydrogenase/reductase family. It catalyzes the stereospecific oxidation of (S)-1-phenylethanol to acetophenone during anaerobic ethylbenzene mineralization, but also the reverse reaction, i.e., NADH-dependent enantioselective reduction of acetophenone to (S)-1-phenylethanol. In this work, we present the application of PEDH for asymmetric reduction of 42 prochiral ketones and 11 β-keto esters to enantiopure secondary alcohols. The high enantioselectivity of the reaction is explained by docking experiments and analysis of the interaction and binding energies of the theoretical enzyme-substrate complexes leading to the respective (S)- or (R)-alcohols. The conversions were carried out in a batch reactor using Escherichia coli cells with heterologously produced PEDH as whole-cell catalysts and isopropanol as reaction solvent and cosubstrate for NADH recovery. Ketones were converted to the respective secondary alcohols with excellent enantiomeric excesses and high productivities. Moreover, the progress of product formation was studied for nine para-substituted acetophenone derivatives and described by neural network models, which allow to predict reactor behavior and provides insight on enzyme reactivity. Finally, equilibrium constants for conversion of these substrates were derived from the progress curves of the reactions. The obtained values matched very well with theoretical predictions.

  13. Biodegradation of alkaline lignin by Bacillus ligniniphilus L1

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Daochen; Zhang, Peipei; Xie, Changxiao; Zhang, Weimin; Sun, Jianzhong; Qian, Wei-Jun; Yang, Bin

    2017-02-21

    Background: Lignin is the most abundant aromatic biopolymer in the biosphere and it comprises up to 30% of plant biomass. Although lignin is the most recalcitrant component of the plant cell wall, still there are microorganisms able to decompose it or degrade it. Fungi are recognized as the most widely used microbes for lignin degradation. However, bacteria have also been known to be able to utilize lignin as a carbon or energy source. Bacillus ligniniphilus L1 was selected in this study due to its capability to utilize alkaline lignin as a single carbon or energy source and its excellent ability to survive in extreme environments. Results: To investigate the aromatic metabolites of strain L1 decomposing alkaline lignin, GC-MS analyze was performed and fifteen single phenol ring aromatic compounds were identified. The dominant absorption peak included phenylacetic acid, 4-hydroxy-benzoicacid, and vanillic acid with the highest proportion of metabolites resulting in 42%. Comparison proteomic analysis were carried out for further study showed that approximately 1447 kinds of proteins were produced, 141 of which were at least 2-fold up-regulated with alkaline lignin as the single carbon source. The up-regulated proteins contents different categories in the biological functions of protein including lignin degradation, ABC transport system, environmental response factors, protein synthesis and assembly, etc. Conclusions: GC-MS analysis showed that alkaline lignin degradation of strain L1 produced 15 kinds of aromatic compounds. Comparison proteomic data and metabolic analysis showed that to ensure the degradation of lignin and growth of strain L1, multiple aspects of cells metabolism including transporter, environmental response factors, and protein synthesis were enhanced. Based on genome and proteomic analysis, at least four kinds of lignin degradation pathway might be present in strain L1, including a Gentisate pathway, the benzoic acid pathway and the

  14. Insights into the extremotolerance of Acinetobacter radioresistens 50v1, a gram-negative bacterium isolated from the Mars Odyssey spacecraft.

    Science.gov (United States)

    McCoy, K B; Derecho, I; Wong, T; Tran, H M; Huynh, T D; La Duc, M T; Venkateswaran, K; Mogul, R

    2012-09-01

    The microbiology of the spacecraft assembly process is of paramount importance to planetary exploration, as the biological contamination that can result from remote-enabled spacecraft carries the potential to impact both life-detection experiments and extraterrestrial evolution. Accordingly, insights into the mechanisms and range of extremotolerance of Acinetobacter radioresistens 50v1, a Gram-negative bacterium isolated from the surface of the preflight Mars Odyssey orbiter, were gained by using a combination of microbiological, enzymatic, and proteomic methods. In summary, A. radioresistens 50v1 displayed a remarkable range of survival against hydrogen peroxide and the sequential exposures of desiccation, vapor and plasma phase hydrogen peroxide, and ultraviolet irradiation. The survival is among the highest reported for non-spore-forming and Gram-negative bacteria and is based upon contributions from the enzyme-based degradation of H(2)O(2) (catalase and alkyl hydroperoxide reductase), energy management (ATP synthase and alcohol dehydrogenase), and modulation of the membrane composition. Together, the biochemical and survival features of A. radioresistens 50v1 support a potential persistence on Mars (given an unintended or planned surface landing of the Mars Odyssey orbiter), which in turn may compromise the scientific integrity of future life-detection missions.

  15. Effects of Metalloporphyrins on Heme Oxygenase-1 Transcription: Correlative Cell Culture Assays Guide in Vivo Imaging

    Directory of Open Access Journals (Sweden)

    Monica Hajdena-Dawson

    2003-07-01

    Full Text Available Heme oxygenase (HO is the rate-limiting step in the heme degradation pathway and is a potential target for the control, or prevention, of pathologic jaundice in neonates. Metalloporphyrins (Mps, a diverse set of synthetic derivatives of heme, can competitively inhibit the HO enzymes. However, certain Mps are phototoxic and some increase transcription of HO-1, the inducible HO isozyme. Therefore, effective development of this class of compounds as therapeutics for treating pathologic jaundice will require rapid and integrated biological screens to identify the most efficacious and safe Mps. To study the safety of these compounds, we assessed their cytotoxic effects and measured luciferase activity by bioluminescent imaging (BLI as an index of HO-1 transcription, first in live cell cultures and then in living transgenic reporter mice. A total of 12 Mps were first evaluated in the correlative cell culture assay. Based on results from this study, 2 Mps, zinc protoporphyrin (ZnPP and zinc bis glycol porphyrin (ZnBG, were selected for further studies in the live animal model. In vitro BLI showed ZnPP to be a strong inducer of HO-1 transcription in comparison to ZnBG, which showed minimal induction. Cytotoxicity studies revealed that ZnPP was phototoxic, whereas ZnBG had no effect on cell viability. In vivo BLI showed that both ZnPP and ZnBG had minimal effects on the levels of HO-1 transcription in the animals. Furthermore, serum enzyme assays indicated that neither caused detectable liver toxicity. These findings, and especially those with ZnBG, support the use of selected Mps as therapies for pathologic jaundice. Coupling the high throughput advantage of cell culture with the capability of imaging for whole-body temporal analyses could accelerate and refine the preclinical phases of drug development. Thus, this study serves as a model for understanding the effects of specific compounds in relation to defined targets using an integrated approach.

  16. Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune resistance.

    Science.gov (United States)

    Martin, A M; Nirschl, T R; Nirschl, C J; Francica, B J; Kochel, C M; van Bokhoven, A; Meeker, A K; Lucia, M S; Anders, R A; DeMarzo, A M; Drake, C G

    2015-12-01

    Primary prostate cancers are infiltrated with programmed death-1 (PD-1) expressing CD8+ T-cells. However, in early clinical trials, men with metastatic castrate-resistant prostate cancer did not respond to PD-1 blockade as a monotherapy. One explanation for this unresponsiveness could be that prostate tumors generally do not express programmed death ligand-1 (PD-L1), the primary ligand for PD-1. However, lack of PD-L1 expression in prostate cancer would be surprising, given that phosphatase and tensin homolog (PTEN) loss is relatively common in prostate cancer and several studies have shown that PTEN loss correlates with PD-L1 upregulation--constituting a mechanism of innate immune resistance. This study tested whether prostate cancer cells were capable of expressing PD-L1, and whether the rare PD-L1 expression that occurs in human specimens correlates with PTEN loss. Human prostate cancer cell lines were evaluated for PD-L1 expression and loss of PTEN by flow cytometry and western blotting, respectively. Immunohistochemical (IHC) staining for PTEN was correlated with PD-L1 IHC using a series of resected human prostate cancer samples. In vitro, many prostate cancer cell lines upregulated PD-L1 expression in response to inflammatory cytokines, consistent with adaptive immune resistance. In these cell lines, no association between PTEN loss and PD-L1 expression was apparent. In primary prostate tumors, PD-L1 expression was rare, and was not associated with PTEN loss. These studies show that some prostate cancer cell lines are capable of expressing PD-L1. However, in human prostate cancer, PTEN loss is not associated with PD-L1 expression, arguing against innate immune resistance as a mechanism that mitigates antitumor immune responses in this disease.

  17. A search for cyanopolyynes in L1157-B1

    Science.gov (United States)

    Mendoza, Edgar; Lefloch, B.; Ceccarelli, C.; Kahane, C.; Jaber, A. A.; Podio, L.; Benedettini, M.; Codella, C.; Viti, S.; Jimenez-Serra, I.; Lepine, J. R. D.; Boechat-Roberty, H. M.; Bachiller, R.

    2018-04-01

    We present here a systematic search for cyanopolyynes in the shock region L1157-B1 and its associated protostar L1157-mm in the framework of the Large Program`Astrochemical Surveys At IRAM' (ASAI), dedicated to chemical surveys of solar-type star-forming regions with the IRAM 30-m telescope. Observations of the millimeter windows between 72 and 272 GHz permitted the detection of HC3N and its 13C isotopologues, and HC5N (for the first time in a protostellar shock region). In the shock, the analysis of the line profiles shows that the emission arises from the outflow cavities associated with L1157-B1 and L1157-B2. Molecular abundances and excitation conditions were obtained from the analysis of the Spectral Line Energy Distributions under the assumption of Local Thermodynamical Equilibrium or using a radiative transfer code in the Large Velocity Gradient approximation. Towards L1157 mm, the HC3N emission arises from the cold envelope (T_rot=10K) and a higher-excitation region (Trot = 31K) of smaller extent around the protostar. We did not find any evidence of 13C or D fractionation enrichment towards L1157-B1. We obtain a relative abundance ratio HC3N/HC5N of 3.3 in the shocked gas. We find an increase by a factor of 30 of the HC3N abundance between the envelope of L1157-mm and the shock region itself. Altogether, these results are consistent with a scenario in which the bulk of HC3N was produced by means of gas phase reactions in the passage of the shock. This scenario is supported by the predictions of a parametric shock code coupled with the chemical model UCL_CHEM.

  18. Effect of size of bioactive glass nanoparticles on mesenchymal stem cell proliferation for dental and orthopedic applications

    International Nuclear Information System (INIS)

    Ajita, J.; Saravanan, S.; Selvamurugan, N.

    2015-01-01

    Bioactive glass nanoparticles (nanostructured bioglass ceramics or nBGs) have been widely employed as a filler material for bone tissue regeneration. The physical properties of nBG particles govern their biological actions. In this study, the impact of the size of nBG particles on mouse mesenchymal stem cell (mMSC) proliferation was investigated. Three different sizes of nBG particles were prepared via the sol–gel method with varying concentrations of the surfactant and polyethylene glycol (PEG), and the particles were characterized. Increased concentrations of PEG decreased the size of nBG particles (nBG-1: 74.7 ± 0.62 nm, nBG-2: 43.25 ± 1.5 nm, and nBG-3: 37.6 ± 0.81 nm). All three nBGs were non-toxic at a concentration of 20 mg/mL. Increased proliferation was observed in mMSCs treated with smaller nBG particles. Differential mRNA expression of cyclin A2, B2, D1, and E1 genes induced by nBG particles was noticed in the mMSCs. nBG-1 and nBG-3 particles promoted cells in the G0/G1 phase to enter the S and G2/M phases. nBG particles activated ERK, but prolonged activation was achieved with nBG-3 particles. Among the prepared nBG particles, nBG-3 particles showed enhanced mMSC proliferation via the sustained activation of ERKs, upregulation of cyclin gene(s) expression, and promotion of cell transition from the G0/G1 phase to the S and G2/M phases. Thus, this study indicates that small nBG particles have clinical applications in dental and bone treatments as fillers or bone-tissue bond forming materials. - Highlights: • Three different sizes of bioactive glass nanoparticles (nBGs) were prepared via the sol–gel method. • Increased concentrations of polyethylene glycol decreased the size of nBG particles. • All three nBGs were non-toxic at a concentration of 20 mg/mL. • Cell number, cell cycle phase analysis, cyclin gene expression and ERK activation were studied. • Increased proliferation was observed in mMSCs treated with smaller nBG particles

  19. Extrap L-1 experimental stability

    International Nuclear Information System (INIS)

    Brunsell, P.; Hellblom, G.; Karlsson, P.; Mazur, S.; Nordlund, P.; Scheffel, J.

    1990-01-01

    In the Extrap scheme a Z-pinch is stabilized by imposing a strongly inhomogeneous octupole magnetic field. This field is generated by four conductor rods, each carrying equal currents I v antiparallel to the plasma current I p itself. Theoretically, interchange stability is improved by the magnetic field, as well as long-wavelength kinks due to induced currents in the plasma and in the rods. Short wavelength kinks are, as in the 1-D pinch, stabilized by FLR and viscous-resistive effects. We have performed a set of experiments in the linear Extrap L-1 device (length 40 cm, plasma radius a 2 cm, rod distance 3 cm) in order to determine optimal performance in terms of confined current (5-20 kA) and stability during the discharge length (80 μs; of the order 100 Alfven times). In this paper we summarize our results from two types of experiments; with and without external axial magnetic field. The results are compared with theory in the final paragraph. (author) 5 figs

  20. RKIP phosphorylation–dependent ERK1 activation stimulates adipogenic lipid accumulation in 3T3-L1 preadipocytes overexpressing LC3

    Energy Technology Data Exchange (ETDEWEB)

    Hahm, Jong Ryeal [Department of Internal Medicine, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of); Institute of Health Sciences, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of); Ahmed, Mahmoud [Department of Biochemistry and Convergence Medical Science, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of); Institute of Health Sciences, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of); Kim, Deok Ryong, E-mail: drkim@gnu.ac.kr [Department of Biochemistry and Convergence Medical Science, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of); Institute of Health Sciences, Gyeongsang National University School of Medicine, JinJu, 527-27 (Korea, Republic of)

    2016-09-09

    3T3-L1 preadipocytes undergo adipogenesis in response to treatment with dexamethaxone, 1-methyl-3-isobutylxanthine, and insulin (DMI) through activation of several adipogenic transcription factors. Many autophagy-related proteins are also highly activated in the earlier stages of adipogenesis, and the LC3 conjugation system is required for formation of lipid droplets. Here, we investigated the effect of overexpression of green fluorescent protein (GFP)-LC3 fusion protein on adipogenesis. Overexpression of GFP-LC3 in 3T3-L1 preadipocytes using poly-L-lysine-assisted adenoviral GFP-LC3 transduction was sufficient to produce intracellular lipid droplets. Indeed, GFP-LC3 overexpression stimulated expression of some adipogenic transcription factors (e.g., C/EBPα or β, PPARγ, SREBP2). In particular, SREBP2 was highly activated in preadipocytes transfected with adenoviral GFP-LC3. Also, phosphorylation of Raf kinase inhibitory protein (RKIP) at serine 153, consequently stimulating extracellular-signal regulated kinase (ERK)1 activity, was significantly increased during adipogenesis induced by either poly-L-lysine-assisted adenoviral GFP-LC3 transduction or culture in the presence of dexamethasone, 1-methyl-3-isobutylxanthine, and insulin. Furthermore, RKIP knockdown promoted ERK1 and PPARγ activation, and significantly increased the intracellular accumulation of triacylglycerides in DMI-induced adipogenesis. In conclusion, GFP-LC3 overexpression in 3T3-L1 preadipocytes stimulates adipocyte differentiation via direct modulation of RKIP-dependent ERK1 activity. - Highlights: • Overexpression of GFP-LC3 in 3T3-L1 cells produces intracellular lipid droplets. • SREBP2 is highly activated in preadipocytes transfected with adenoviral GFP-LC3. • RKIP phosphorylation at serine 153 is significantly increased during adipogenesis. • RKIP knockdown promotes ERK1 and PPARγ activation during adipogenesis. • RKIP-dependent ERK1 activation increases triacylglycerides in

  1. The O-antigen structure of bacterium Comamonas aquatica CJG.

    Science.gov (United States)

    Wang, Xiqian; Kondakova, Anna N; Zhu, Yutong; Knirel, Yuriy A; Han, Aidong

    2017-11-01

    Genus Comamonas is a group of bacteria that are able to degrade a variety of environmental waste. Comamonas aquatica CJG (C. aquatica) in this genus is able to absorb low-density lipoprotein but not high-density lipoprotein of human serum. Using 1 H and 13 C NMR spectroscopy, we found that the O-polysaccharide (O-antigen) of this bacterium is comprised of a disaccharide repeat (O-unit) of d-glucose and 2-O-acetyl-l-rhamnose, which is shared by Serratia marcescens O6. The O-antigen gene cluster of C. aquatica, which is located between coaX and tnp4 genes, contains rhamnose synthesis genes, glycosyl and acetyl transferase genes, and ATP-binding cassette transporter genes, and therefore is consistent with the O-antigen structure determined here.

  2. Bioproduction of L-Aspartic Acid and Cinnamic Acid by L-Aspartate Ammonia Lyase from Pseudomonas aeruginosa PAO1.

    Science.gov (United States)

    Patel, Arti T; Akhani, Rekha C; Patel, Manisha J; Dedania, Samir R; Patel, Darshan H

    2017-06-01

    Aspartase (L-aspartate ammonia lyase, EC 4.3.1.1) catalyses the reversible amination and deamination of L-aspartic acid to fumaric acid which can be used to produce important biochemical. In this study, we have explored the characteristics of aspartase from Pseudomonas aeruginosa PAO1 (PA-AspA). To overproduce PA-AspA, the 1425-bp gene was introduced in Escherichia coli BL21 and purified. A 51.0-kDa protein was observed as a homogenous purified protein on SDS-PAGE. The enzyme was optimally active at pH 8.0 and 35 °C. PA-AspA has retained 56% activity after 7 days of incubation at 35 °C, which displays the hyperthermostablility characteristics of the enzyme. PA-AspA is activated in the presence of metal ions and Mg2+ is found to be most effective. Among the substrates tested for specificity of PA-AspA, L-phenylalanine (38.35 ± 2.68) showed the highest specific activity followed by L-aspartic acid (31.21 ± 3.31) and fumarate (5.42 ± 2.94). K m values for L-phenylalanine, L-aspartic acid and fumarate were 1.71 mM, 0.346 μM and 2 M, respectively. The catalytic efficiency (k cat /K m ) for L-aspartic acid (14.18 s -1  mM -1 ) was higher than that for L-phenylalanine (4.65 s -1  mM -1 ). For bioconversion, from an initial concentration of 1000 mM of fumarate and 30 mM of L-phenylalanine, PA-AspA was found to convert 395.31 μM L-aspartic acid and 3.47 mM cinnamic acid, respectively.

  3. Turbulence, raindrops and the l{sup 1/2} number density law

    Energy Technology Data Exchange (ETDEWEB)

    Lovejoy, S [Department of Physics, McGill University, 3600 University street, Montreal, Quebec, H3A 2T8 (Canada); Schertzer, D [Universite Paris-Est, ENPC/CEREVE, 77455 Marne-la-Vallee Cedex 2 (France)], E-mail: lovejoy@physics.mcgill.ca

    2008-07-15

    Using a unique data set of three-dimensional drop positions and masses (the HYDROP experiment), we show that the distribution of liquid water in rain displays a sharp transition between large scales which follow a passive scalar-like Corrsin-Obukhov (k{sup -5/3}) spectrum and a small-scale statistically homogeneous white noise regime. We argue that the transition scale l{sub c} is the critical scale where the mean Stokes number (= drop inertial time/turbulent eddy time) St{sub l} is unity. For five storms, we found l{sub c} in the range 45-75 cm with the corresponding dissipation scale St{sub {eta}} in the range 200-300. Since the mean interdrop distance was significantly smaller ({approx} 10 cm) than l{sub c} we infer that rain consists of 'patches' whose mean liquid water content is determined by turbulence with each patch being statistically homogeneous. For l>l{sub c}, we have St{sub l}<1 and due to the observed statistical homogeneity for l{sub c}, we argue that we can use Maxey's relations between drop and wind velocities at coarse grained resolution l{sub c}. From this, we derive equations for the number and mass densities (n and {rho}) and their variance fluxes ({psi} and {chi}). By showing that {chi} is dissipated at small scales (with l{sub {rho}}{sub ,diss}{approx}l{sub c}) and {psi} over a wide range, we conclude that {rho} should indeed follow Corrsin-Obukhov k{sup -5/3} spectra but that n should instead follow a k{sup -2} spectrum corresponding to fluctuations scaling as {delta}{rho}{approx}l{sup 1/3} and {delta}n{approx}l{sup 1/2}. While the Corrsin-Obukhov law has never been observed in rain before, its discovery is perhaps not surprising; in contrast the {delta}n{approx}l{sup 1/2} number density law is quite new. The key difference between the {delta}{rho}, {delta}n laws is the fact that the microphysics (coalescence, breakup) conserves drop mass, but not numbers of particles. This implies that the timescale for the transfer of the

  4. Functional and structural characterization of recombinant dermcidin-1L, a human antimicrobial peptide

    International Nuclear Information System (INIS)

    Lai Yuping; Peng Yifei; Zuo Yi; Li Jun; Huang Jing; Wang Linfa; Wu Zirong

    2005-01-01

    Antimicrobial peptides from human skin are an important component of the innate immune response and play a key role as a first line of defense against infections. One such peptide is the recently discovered dermcidin-1L. To better understand its mechanism and to further investigate its antimicrobial spectrum, recombinant dermcidin-1L was expressed in Escherichia coli as a fusion protein and purified by affinity chromatography. The fusion protein was cleaved by factor Xa protease to produce recombinant dermcidin-1L. Antimicrobial and hemolytic assays demonstrated that dermcidin-1L displayed microbicidal activity against several opportunistic nosocomial pathogens, but no hemolytic activity against human erythrocytes even at concentrations up to 100 μM. Structural studies performed by circular dichroism spectroscopy indicated that the secondary structure of dermcidin-1L was very flexible, and both α-helix and β-sheet structures might be required for the antimicrobial activity. Our results confirmed previous findings indicating that dermcidin-1L could have promising therapeutic potentials and shed new light on the structure-function relationship of dermcidin-1L

  5. Identification of CREB3L1 as a Biomarker Predicting Doxorubicin Treatment Outcome.

    Directory of Open Access Journals (Sweden)

    Bray Denard

    Full Text Available Doxorubicin has been shown to inhibit proliferation of cancer cells through proteolytic activation of CREB3L1 (cAMP response element binding protein 3-like 1, a transcription factor synthesized as a membrane-bound precursor. Upon doxorubicin treatment, CREB3L1 is cleaved so that the N-terminal domain of the protein can reach the nucleus where it activates transcription of genes that inhibit cell proliferation. These results suggest that the level of CREB3L1 in cancer cells may determine their sensitivity to doxorubicin.Mice transplanted with 6 lines of renal cell carcinoma (RCC were injected with doxorubicin to observe the effect of the chemotherapy on tumor growth. Immunohistochemistry and bioinformatics analyses were performed to compare CREB3L1 levels in types of cancer known to respond to doxorubicin versus those resistant to doxorubicin.Higher levels of CREB3L1 protein are correlated with increased doxorubicin sensitivity of xenograft RCC tumors (p = 0.017 by Pearson analysis. From patient tumor biopsies we analyzed, CREB3L1 was expressed in 19% of RCC, which is generally resistant to doxorubicin, but in 70% of diffuse large B-cell lymphoma that is sensitive to doxorubicin. Doxorubicin is used as the standard treatment for cancers that express the highest levels of CREB3L1 such as osteosarcoma and malignant fibrous histiocytoma but is not generally used to treat those that express the lowest levels of CREB3L1 such as RCC.Identification of CREB3L1 as the biomarker for doxorubicin sensitivity may markedly improve the doxorubicin response rate by applying doxorubicin only to patients with cancers expressing CREB3L1.

  6. Data of evolutionary structure change: 1AIFA-2AI0L [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 2> 0 n> 1AIF n>A ...n>1AIFAn> VSSSI----SSSNL...n> 2AI0 n>L 2AI...1AIFA-2AI0L 1AIF 2AI0 A L DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...SER CA 251 SER CA 276 SER CA 258 ASN CA 337 LEU CA 410

  7. Code-Switching: L1-Coded Mediation in a Kindergarten Foreign Language Classroom

    Science.gov (United States)

    Lin, Zheng

    2012-01-01

    This paper is based on a qualitative inquiry that investigated the role of teachers' mediation in three different modes of coding in a kindergarten foreign language classroom in China (i.e. L2-coded intralinguistic mediation, L1-coded cross-lingual mediation, and L2-and-L1-mixed mediation). Through an exploratory examination of the varying effects…

  8. PD-L1 expression by neurons nearby tumors indicates better prognosis in glioblastoma patients

    DEFF Research Database (Denmark)

    Liu, Yawei; Carlsson, Robert; Ambjørn, Malene

    2013-01-01

    Glioblastoma multiforme (GBM) is the most aggressive form of brain tumor. In general, tumor growth requires disruption of the tissue microenvironment, yet how this affects glioma progression is unknown. We studied program death-ligand (PD-L)1 in neurons and gliomas in tumors from GBM patients...... and associated the findings with clinical outcome. Remarkably, we found that upregulation of PD-L1 by neurons in tumor-adjacent brain tissue (TABT) associated positively with GBM patient survival, whereas lack of neuronal PD-L1 expression was associated with high PD-L1 in tumors and unfavorable prognosis...... in GBM patients, better survival in wild-type mice was associated with high neuronal PD-L1 in TABT and downregulation of PD-L1 in tumors, which was defective in Ifnb-/- mice. Our data indicated that neuronal PD-L1 signaling in brain cells was important for GBM patient survival. Reciprocal PD-L1...

  9. Symmetry tests in polarized Z0 decays to b anti bg

    International Nuclear Information System (INIS)

    Abe, K.; Abe, K.; Akagi, T.

    1997-06-01

    Angular asymmetries have been measured in polarized Z 0 decays to b anti bg collected by the SLD experiment at the SLC. A high purity b anti bg event sample is selected utilizing lifetime information given by the SLD CCD pixel vertex detector and the stable micron-size SLC beams, and the b- and anti b-jets are identified using lifetime information and momentum-weighted track charge. The forward-backward asymmetry is observed in the b-jet polar angle distribution, and the parity-violation parameter is measured to test the Standard Model. Two angular correlations between the three-jet plane and the Z 0 polarization are studied. The CP-even and T-odd angular asymmetry, and the CP-odd and T-odd angular asymmetry are sensitive to physics beyond the Standard Model. The authors measure the expectation values of these quantities to be consistent with zero and set limits on the correlations

  10. Agronomie Africaine - Vol 17, No 1 (2005)

    African Journals Online (AJOL)

    Associations culturales à base d\\'hévéa : bilan de 20 années d\\'expérimentations en Côte d\\'Ivoire. Partie 1 : Comportement végétatif · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JZ Keli, H Omont, AA Assiri, KA Boko, S Abouayebe, BG Dea, A Doumbia, 37-52.

  11. Immunohistochemical analysis and prognostic significance of PD-L1, PD-1, and CD8+ tumor-infiltrating lymphocytes in Ewing's sarcoma family of tumors (ESFT).

    Science.gov (United States)

    Machado, Isidro; López-Guerrero, Jose Antonio; Scotlandi, Katia; Picci, Piero; Llombart-Bosch, Antonio

    2018-05-01

    Ewing's sarcoma family of tumors (ESFT) are aggressive neoplasms with scant tumor-infiltrating lymphocytes. We analyzed the immunohistochemical (IHC) expression of PD-L1 and PD-1 and their prognostic significance in clinically localized neoplasms in a cohort of 370 ESFT. Slides prepared from tissue microarrays were stained for PD-L1, PD-1, and CD8. Membranous/cytoplasmic staining over 5% of tumor cells was regarded as positive for PD-L1 and PD-1. Prognostic analysis was done considering only clinically localized tumors (n = 217). PD-L1 expression was present in 19% of ESFT, while PD-1 was expressed in 26%. Forty-eight percent of tumors were negative and 12% were positive for both PD-L1 and PD-1. Metastatic tumors displayed higher expression of PD-L1 (p < 0.0001). Histological subtypes were not correlated with PD-L1 or PD-1 positivity. ESFT with elevated proliferation index (Ki-67) were associated with higher PD-L1 expression (p = 0.049). Regarding prognosis, no significant association was found between PD-L1 expression and progression-free survival (PFS) or overall survival (OS), whereas lack of PD-1 expression in tumor cells was correlated with both poor PFS (p = 0.02) and poor OS (p = 0.004). Tumor-infiltrating CD8(+) T lymphocytes were observed in 15.4% of ESFT with informative results (347 tumors). No correlation was found between tumor-infiltrating CD8(+) T lymphocytes and ESFT histological subtypes, tumor location, or PD-1 and PD-L1 expression, nor with PFS (p = 0.473) or OS (p = 0.087). PD-L1 expression was not significantly related to prognosis. PD-1 was expressed in 26% of ESFT tumor cells and may have prognostic and therapeutic implications. CD8 expression in tumor-infiltrating lymphocytes was not related to prognosis.

  12. The Level of Autoantibodies Targeting Eukaryote Translation Elongation Factor 1 α1 and Ubiquitin-Conjugating Enzyme 2L3 in Nondiabetic Young Adults

    Directory of Open Access Journals (Sweden)

    Eunhee G. Kim

    2016-01-01

    Full Text Available BackgroundThe prevalence of novel type 1 diabetes mellitus (T1DM antibodies targeting eukaryote translation elongation factor 1 alpha 1 autoantibody (EEF1A1-AAb and ubiquitin-conjugating enzyme 2L3 autoantibody (UBE2L3-AAb has been shown to be negatively correlated with age in T1DM subjects. Therefore, we aimed to investigate whether age affects the levels of these two antibodies in nondiabetic subjects.MethodsEEF1A1-AAb and UBE2L3-AAb levels in nondiabetic control subjects (n=150 and T1DM subjects (n=101 in various ranges of age (18 to 69 years were measured using an enzyme-linked immunosorbent assay. The cutoff point for the presence of each autoantibody was determined based on control subjects using the formula: [mean absorbance+3×standard deviation].ResultsIn nondiabetic subjects, there were no significant correlations between age and EEF1A1-AAb and UBE2L3-AAb levels. However, there was wide variation in EEF1A1-AAb and UBE2L3-AAb levels among control subjects <40 years old; the prevalence of both EEF1A1-AAb and UBE2L3-AAb in these subjects was 4.4%. When using cutoff points determined from the control subjects <40 years old, the prevalence of both autoantibodies in T1DM subjects was decreased (EEFA1-AAb, 15.8% to 8.9%; UBE2L3-AAb, 10.9% to 7.9% when compared to the prevalence using the cutoff derived from the totals for control subjects.ConclusionThere was no association between age and EEF1A1-AAb or UBE2L3-AAb levels in nondiabetic subjects. However, the wide variation in EEF1A1-AAb and UBE2L3-AAb levels apparent among the control subjects <40 years old should be taken into consideration when determining the cutoff reference range for the diagnosis of T1DM.

  13. Identification and characterization of a core fucosidase from the bacterium Elizabethkingia meningoseptica.

    Science.gov (United States)

    Li, Tiansheng; Li, Mengjie; Hou, Linlin; Guo, Yameng; Wang, Lei; Sun, Guiqin; Chen, Li

    2018-01-26

    All reported α-l-fucosidases catalyze the removal of nonreducing terminal l-fucoses from oligosaccharides or their conjugates, while having no capacity to hydrolyze core fucoses in glycoproteins directly. Here, we identified an α-fucosidase from the bacterium Elizabethkingia meningoseptica with catalytic activity against core α-1,3-fucosylated substrates, and we named it core fucosidase I (cFase I). Using site-specific mutational analysis, we found that three acidic residues (Asp-242, Glu-302, and Glu-315) in the predicted active pocket are critical for cFase I activity, with Asp-242 and Glu-315 acting as a pair of classic nucleophile and acid/base residues and Glu-302 acting in an as yet undefined role. These findings suggest a catalytic mechanism for cFase I that is different from known α-fucosidase catalytic models. In summary, cFase I exhibits glycosidase activity that removes core α-1,3-fucoses from substrates, suggesting cFase I as a new tool for glycobiology, especially for studies of proteins with core fucosylation. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Mechanism for the differentiation of EoL-1 cells into eosinophils by histone deacetylase inhibitors.

    Science.gov (United States)

    Kaneko, Motoko; Ishihara, Kenji; Takahashi, Aki; Hong, Jangja; Hirasawa, Noriyasu; Zee, Okpyo; Ohuchi, Kazuo

    2007-01-01

    EoL-1 cells have a FIP1L1-PDGFRA fusion gene which causes the transformation of eosinophilic precursor cells into leukemia cells. Recently, we suggested that the induction of differentiation of EoL-1 cells into eosinophils by the HDAC inhibitors apicidin and n-butyrate is due to the continuous inhibition of HDACs. However, neither apicidin nor n-butyrate inhibited the expression of FIP1L1-PDGFRA mRNA, although both these inhibitors suppressed cell proliferation. Therefore, in this study, we analyzed whether the levels of FIP1L1-PDGFRalpha protein and phosphorylated-Stat5 involved in the signaling for the proliferation of EoL-1 cells are attenuated by HDAC inhibitors. EoL-1 cells were incubated in the presence of apicidin, TSA or n-butyrate. FIP1L1-PDGFRalpha and phosphorylated-Stat5 were detected by Western blotting. Treatment of EoL-1 cells with apicidin at 100 nM or n-butyrate at 500 microM decreased the levels of FIP1L1-PDGFRalpha protein and phosphorylated-Stat5, while that with trichostatin A at 30 nM did not. The decrease in the level of FIP1L1-PDGFRalpha protein caused by apicidin and n-butyrate might be one of the mechanisms by which EoL-1 cells are induced to differentiate into eosinophils by these HDAC inhibitors.

  15. The Bacterium That Got Infected by a Cow! - Horizontal Gene

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 1. The Bacterium That Got Infected by a Cow! - Horizontal Gene Transfer and Evolution. Saurabh Dhawan Tomás John Ryan. General Article Volume 12 Issue 1 January 2007 pp 49-59 ...

  16. The Effects of Giving and Receiving Marginal L1 Glosses on L2 Vocabulary Learning by Upper Secondary Learners

    Science.gov (United States)

    Samian, Hosein Vafadar; Foo, Thomas Chow Voon; Mohebbi, Hassan

    2016-01-01

    This paper reports the findings of a study that investigated the effect of giving and receiving marginal L1 glosses on L2 vocabulary learning. To that end, forty nine Iranian learners of English were assigned to three different experimental conditions including marginal L1 glosses Giver (n = 17), marginal L1 glosses Receiver (n = 17), and no…

  17. "1"8F-FBPA as a tumor-specific probe of L-type amino acid transporter 1 (LAT1): a comparison study with "1"8F-FDG and "1"1C-Methionine PET

    International Nuclear Information System (INIS)

    Watabe, Tadashi; Ikeda, Hayato; Aoki, Masanao; Nagamori, Shushi; Wiriyasermkul, Pattama; Tanaka, Yoko; Hagiwara, Kohei; Kanai, Yoshikatsu; Naka, Sadahiro; Kanai, Yasukazu; Shimosegawa, Eku; Hatazawa, Jun

    2017-01-01

    The purpose of this study was to evaluate the usefulness of L-4-borono-2-"1"8F-fluoro-phenylalanine ("1"8F-FBPA) as a tumor-specific probe, in comparison to "1"8F-FDG and "1"1C-methionine (Met), focusing on its transport selectivity by L-type amino acid transporter 1 (LAT1), which is highly upregulated in cancers. Cellular analyses of FBPA were performed to evaluate the transportability and K_m value. PET studies were performed in rat xenograft models of C6 glioma (n = 12) and in rat models of turpentine oil-induced subcutaneous inflammation (n = 9). The kinetic parameters and uptake values on static PET images were compared using the one-tissue compartment model (K_1, k_2) and maximum standardized uptake value (SUVmax). The cellular analyses showed that FBPA had a lower affinity to a normal cell-type transporter LAT2 and induced less efflux through LAT2 among FBPA, Met, and BPA, while the efflux through LAT1 induced by FBPA was similar among the three compounds. The K_m value of "1"8F-FBPA for LAT1 (196.8 ± 11.4 μM) was dramatically lower than that for LAT2 (2813.8 ± 574.5 μM), suggesting the higher selectivity of "1"8F-FBPA for LAT1. K_1 and k_2 values were significantly smaller in "1"8F-FBPA PET (K_1 = 0.04 ± 0.01 ml/ccm/min and k_2 = 0.07 ± 0.01 /min) as compared to "1"1C-Met PET (0.22 ± 0.09 and 0.52 ± 0.10, respectively) in inflammatory lesions. Static PET analysis based on the SUVmax showed significantly higher accumulation of "1"8F-FDG in the tumor and inflammatory lesions (7.2 ± 2.1 and 4.6 ± 0.63, respectively) as compared to both "1"8F-FBPA (3.2 ± 0.40 and 1.9 ± 0.19) and "1"1C-Met (3.4 ± 0.43 and 1.6 ± 0.11). No significant difference was observed between "1"8F-FBPA and "1"1C-Met in the static PET images. This study shows the utility of "1"8F-FBPA as a tumor-specific probe of LAT1 with low accumulation in the inflammatory lesions. (orig.)

  18. Critical contrastive rhetoric: The influence of L2 letter writing instruction on L1letter writing

    Directory of Open Access Journals (Sweden)

    Mehrnoosh Fakharzadeh

    2014-08-01

    Full Text Available The present study employed critical contrastive rhetoric to investigate the L2 to L1 transfer of organizational pattern and directness level of speech acts in business complaint letters. By examining the L1 complaint letters of 30 tourism university students in two phases of study, pre and post instruction of English complaint letter, the study revealed that the rhetorical organization of Persian letters are in a state of hybridity. The post instruction comparison of letters, however, showed a tendency towards applying English conventions both in organization and directness level of complaint speech act in the L1 complaint letters. The results also revealed that after instruction the expert in the field of tourism viewed some letters as inappropriate in terms of politeness which is reflected through some lexical items.

  19. Genetic variation in the cholesterol transporter NPC1L1, ischaemic vascular disease, and gallstone disease

    DEFF Research Database (Denmark)

    Lauridsen, Bo Kobberø; Stender, Stefan; Frikke-Schmidt, Ruth

    2015-01-01

    developed IVD or symptomatic gallstone disease, respectively, during follow-up from 1977 to 2013. We genotyped four common NPC1L1 variants, previously associated with reduced LDL cholesterol levels, thus mimicking the effect of ezetimibe, and calculated a weighted genotype score. With increasing genotype...

  20. The midgut cadherin-like gene is not associated with resistance to Bacillus thuringiensis toxin Cry1Ac in Plutella xylostella (L.).

    Science.gov (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-03-01

    The Gram-positive bacterium Bacillus thuringiensis (Bt) produces Cry toxins that have been used to control important agricultural pests. Evolution of resistance in target pests threatens the effectiveness of these toxins when used either in sprayed biopesticides or in Bt transgenic crops. Although alterations of the midgut cadherin-like receptor can lead to Bt Cry toxin resistance in many insects, whether the cadherin gene is involved in Cry1Ac resistance of Plutella xylostella (L.) remains unclear. Here, we present experimental evidence that resistance to Cry1Ac or Bt var. kurstaki (Btk) in P. xylostella is not due to alterations of the cadherin gene. The bona fide P. xylostella cadherin cDNA sequence was cloned and analyzed, and comparisons of the cadherin cDNA sequence among susceptible and resistant P. xylostella strains confirmed that Cry1Ac resistance was independent of mutations in this gene. In addition, real-time quantitative PCR (qPCR) indicated that cadherin transcript levels did not significantly differ among susceptible and resistant P. xylostella strains. RNA interference (RNAi)-mediated suppression of cadherin gene expression did not affect larval susceptibility to Cry1Ac toxin. Furthermore, genetic linkage assays using four cadherin gDNA allelic biomarkers confirmed that the cadherin gene is not linked to resistance against Cry1Ac in P. xylostella. Taken together, our findings demonstrate that Cry1Ac resistance of P. xylostella is independent of the cadherin gene. Copyright © 2015 Elsevier Inc. All rights reserved.